Modified interleukin 12 and use thereof in preparing drugs for treating tumours

11345732 · 2022-05-31

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a modified interleukin 12 (nsIL-12) and its gene, recombinant vector and use in manufacture of a medicament for treatment of tumors. When the oncolytic adenovirus vector carrying the modified interleukin 12 gene targets tumor tissue, the modified interleukin 12 is continuously expressed at a low level and mainly distributed in the local tumor tissue, which improves the specificity to tumor cells and reduces the systemic toxicity of interleukin 12; the modified interleukin 12 shows stronger inhibitory effect on tumor growth in intraperitoneally disseminated tumors and orthotopic tumors, and has low toxicity. The modified interleukin 12 armed oncolytic viruses show excellent anti-tumor effects, with a significant regression of tumors and lower toxicity compared with the existing IL-12 armed virus.

Claims

1. A recombinant vector, which is an oncolytic virus and comprises a nucleotide sequence encoding a modified IL-12, which is non-secretory, wherein the non-secretory IL-12 has the following structure: p40-linker-p35 or p35-linker-p40; and wherein the non-secretory IL-12 does not contain a secretory signal peptide, and wherein the recombinant vector is the viral vector with the CCTCC Accession NO: V201520.

2. A method for treatment of a disease associated with IL-12, which comprises administering to a subject the recombinant vector according to claim 1.

3. The method according to claim 2, wherein the disease is a cancer.

4. The method according to claim 2, wherein the disease is pancreatic cancer, head and neck cancer, lung cancer, esophageal cancer, ovarian cancer, colorectal cancer, colon cancer or gastric cancer.

5. The method according to claim 2, wherein the disease is an intraperitoneally disseminated tumor.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: pSS-CHL plasmid map.

(2) FIG. 2: pVV-TK plasmid map.

(3) FIG. 3: pVV-TK-nsIL-12 plasmid map.

(4) FIG. 4: Schematic diagrams of adenovirus serotype 5 vector Ad-TD-nsIL-12, Vaccinia virus vector VV-TK-nsIL-12 and type 11 adenovirus vector Ad11-Tel-nsIL-12.

(5) FIG. 5: IL-12 expression of Ad-TD-nsIL-12 in cells.

(6) FIG. 6: IL-12 expression of VV-TK-nsIL-12 in cells.

(7) FIG. 7: Anti-tumor effect of Ad-TD-nsIL-12 on different types of solid tumors.

(8) FIG. 8: Anti-tumor effect of VV-TK-nsIL-12 on different types of solid tumors.

(9) FIG. 9: Expression of IL-12 in peripheral blood of tumor-bearing Syrian hamsters injected with different viral vectors.

(10) FIG. 10: Comparison of anti-tumor effects of Ad-TD-nsIL-12 with Ad-TD-LUC and Ad-TD-IL-12 in Syrian hamster subcutaneous transplanted tumor models of pancreatic cancer.

(11) FIG. 11: Comparison of tumor free rates of Ad-TD-nsIL-12 with Ad-TD-LUC and Ad-TD-IL-12 in Syrian hamster subcutaneous transplanted tumor models of pancreatic cancer.

(12) FIG. 12: Comparison of anti-tumor effects of Ad-TD-nsIL-12 with Ad-TD-LUC and Ad-TD-IL-12 in Syrian hamster orthotopic models of pancreatic cancer.

(13) FIG. 13: Comparison of anti-tumor effects of Ad-TD-nsIL-12 with Ad-TD-LUC and Ad-TD-IL-12 in Syrian hamster intraperitoneally disseminated tumor models of pancreatic cancer.

(14) FIG. 14: Comparison of hepatotoxicity of Ad-TD-nsIL-12 with Ad-TD-LUC and Ad-TD-IL-12 in Syrian hamster intraperitoneally disseminated tumor models of pancreatic cancer.

(15) FIG. 15: Comparison of anti-tumor effects of Ad-TD-nsIL-12 in Syrian hamster subcutaneous transplanted tumor models of head and neck tumor.

(16) FIG. 16: Comparison of anti-tumor effects of VV-TK-nsIL-12 versus VV-TK-RFP and VV-TK-IL-12 in Syrian hamster intraperitoneally disseminated tumor models of pancreatic cancer.

(17) FIG. 17: Comparison of anti-tumor effects of Ad11-Tel-nsIL-12 versus Ad11-Tel-GFP and Ad11-Tel-IL-12 in Syrian hamster intraperitoneally disseminated tumor models of pancreatic cancer.

DEPOSIT OF BIOLOGICAL MATERIAL

(18) The following biological material has been deposited with the China Center For Type Culture Collection (ATCC), Wuhan University, Wuhan 430072 P. R. China

(19) TABLE-US-00001 Vector Designation CCTCC No. Deposit Date Ad-TD-nsIL-12 V201520 May 21, 2015

(20) This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. This assures the maintenance of a viable culture of the deposit for 30 years from the date of deposit and for at least five (5) years after the most recent request for furnishing of a sample of the deposit. The deposit will be made available by the CCTCC under the terms of the Budapest Treaty, and subject to an agreement between the depositor and the CCTCC, which assures that all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the pertinent U.S. patent, assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 U.S.C. § 122 and the Commissioner's rules pursuant thereto (including 37 C.F.R. § 1.14 with particular reference to 886 OG 638).

DETAILED DESCRIPTION OF THE INVENTION

(21) The present invention is further illustrated by way of examples, which are not intended to limit the scope of the invention, and those skilled in the art will be able to make modifications to these embodiments in light of the teachings of the present invention without departing from the spirit and scope of the invention to obtain similar or same results, and all of these modifications are within the scope of the present invention.

EXAMPLE 1

Method for Construction of Oncolytic Adenovirus Serotype 5 Vector Ad-TD-nsIL-12 for Targeting Therapy of Human Tumors, Comprising the Steps of

(22) (1) Cloning nsIL-12 fusion gene: the total RNA of cultured RPMI-8866 cell was extracted and reverse transcribed into cDNA, a PCR assay was performed to clone a modified p35 subunit gene (ns-p35, which nucleotide sequence was shown in SEQ NO:3) and a modified p40 subunit gene (primer: p40-F: CCTACGTAATGATATGGGAACTGAAGAAAG, p40-R: GCCCACCCCAGGTACCCCTACTCCAGGAACACTGCAGGGCACA GATGC, ns-p40, which nucleotide sequence was shown in SEQ NO: 5) by using a primer (p35-F: GTTCCTGGAGTAGGGGTACCTGGGGTGGGCGCCAG AAACCTCCCCGTG, p35-R: GCTACGTATTAGGAAGCATTCAGATA) containing a SnaBI cleavage site and an elastin sequence (GTTCCTGGAGTAGGGGTACCTGGGGTGGGC), the ns-p40 subunit gene fragment and the ns-p35 subunit gene fragment were ligated by PCR to form nsIL-12 complete gene fragment, and the nsIL-12 complete gene fragment was ligated into a cloning vector T vector, which was designated as T-nsIL-12; the T-nsIL-12 plasmid was digested with SnaBI to obtain nsIL-12 gene fragment for standby use (SEQ NO: 1);

(23) (2) Construction of pSSE3gp19K shuttle vector: the multiple cloning sites at CHL upstream of pSS-CHL (see: FIG. 1) were digested with Sal1 and EcoRV, an upstream 1091 bp sequence of E3 6.7K gene termination codon was cloned by using a primer containing Sal1 and EcoRV cleavage sites at two ends thereof, used as left arm and ligated to pSS-CHL to form pSSE3gp19K-L; the pSSE3gp19K-L was digested with SnaB1 and Xho1, and a downstream 1146 bp sequence of E3gp19K gene termination codon was cloned by using a primer containing SnaB1 and Xho1 cleavage sites at two ends thereof, and both of them were ligated to form pSSE3gp19K shuttle vector;

(24) (3) Construction of pSSE3gp19K-nsIL-12 vector: the pSSE3gp19K vector was digested with EcoRV and its terminal phosphate group was removed with phosphatase, then it was ligated with the nsIL-12 gene fragment to produce the p55E3gp19K-nsIL-12 vector, which sequence was determined by sequencing analysis;

(25) (4) Construction of Ad-TD-nsIL-12-CHL: the pSSE3gp19K-nsIL-12 was linearized with Pme1, a large fragment containing nsIL-12 was recovered, homologous recombination with pAd-TD vector (see patent: ZL200910066130.4) was performed by electroporation in BJ5183 competent cells, and positive clones pAd-TD-nsIL-12-CHL were picked out;

(26) (5) Construction of pAd-TD-nsIL-12: the positive vector pAd-TD-nsIL-12-CHL was digested with Swa1 to delete CHL gene, after inactivation of Swa1 and T4 ligase, it was used to transform TOP10 competent cells to obtain pAd-TD-nsIL-12 vector; and

(27) (6) Construction of Ad-TD-nsIL-12 virus vector: the recombinant pAd-TD-nsIL-12 vector was linearized with Pac1 and transfected into 293 cells to produce the recombinant adenovirus vector Ad-TD-nsIL-12.

(28) 3. The recombinant Ad-TD-nsIL-12 vector was linearized with Pac1 and transfected into 293 cells to produce the recombinant adenovirus vector Ad-TD-nsIL-12 (human adenovirus serotype 5 mutant, China Center for Type Culture Collection, Wuhan, China, Wuhan University, Accession No. CCTCC NO: V201520, date of deposit: May 21, 2015), also known as Ad-TD-nsIL12.

EXAMPLE 2

Method for Construction of Vector VV-TK-nsIL-12 of Oncolytic Vaccinia Virus for Target Therapy of Human Tumor, Comprising the Steps of

(29) 1. Construction of Shuttle Vector pVV-TK-nsIL-12

(30) As described in Example 1, nsIL-12 gene was cloned with a primer containing Sal1 and Nhe1 cleavage sites, and digested with corresponding enzymes for standby application, pVV-TK plasmid was digested with Sal1 and Nhe1 (see FIG. 2, construction was performed by the method as published by the inventors, Mol Ther Methods Clin Dev. 2015 Sep. 16; 2:15035. doi: 10.1038/mtm. 2015.35. eCollection 2015), the nsIL-12 gene was ligated with pVV-TK to construct the pVV-TK-nsIL-12 vector (FIG. 3).

(31) 2. Recombination of VV-TK-nsIL-12 Viral Vector

(32) CV1 cells were cultured, and then the CV1 was inoculated into a 96-well plate. When the cells grew to 90% confluence, they were transfected with CRISP-cas9 and gRNA plasmid, then infected with vaccinia virus VVL15 after 24 hours, and transfected with pVV-TK after 2 hours. After 24 hours, they were observed under a fluorescence microscope and the red fluorescent cell clones were picked out, which demonstrated that the VV-TK-nsIL-12 virus vector (FIG. 4) was successfully recombined.

(33) 3. Screening of VV-TK-nsIL-12 Virus Vector

(34) The picked red fluorescent clones were frozen and thawed once, then infected CV1 cells again, the red fluorescent clones were picked, this screening process was repeated 5 times, and CV1 cells were infected to produce the virus. Its genome was extracted for sequencing.

EXAMPLE 3

Method for Construction of Vector Ad11-Tel-nsIL-12 of Oncolytic Adenovirus Serotype 11 for Target Therapy of Human Tumor, Comprising the Steps of

(35) 1. Construction of Shuttle Vector pSSE3-18.5K-nsIL-12 Containing nsIL-12

(36) (1) Construction of pSSE3-18.5K: multiple cloning sites of pSS-CHL (constructed on the basis of pBR322 plasmid, see FIG. 1) were digested with SnaB1 and Xho1, E3 16.1K gene stop codon upstream 535 bp sequence was cloned by using a primer containing SnaB1 and Xho1 cleavage sites at two ends, used as the left arm and ligated to pSS-CHL, so as to form pSSE3-18.5K-L; the pSSE3-18.5K-L was digested with Sal1 and EcoRV, a downstream 584 bp sequence of E3-18.5K gene stop codon was cloned by using a primer containing Sal1 and EcoRV cleavage sites at two ends, and the two were ligated to form pSSE3-18.5K shuttle vector;

(37) (2) Construction of pSSE3-18.5K-nsIL-12 vector: the pSSE3-18.5K vector was digested with SnaB1, and terminal phosphate group was removed by using phosphatase, then it was ligated to nsIL-12 gene fragment to produce pSSE3-18.5K-NsIL-12 vector, the sequencing analysis thereof was performed;

(38) (3) The pSSE3gp19K-nsIL-12 was linearized with Pme1, large fragments containing nsIL-12 were recovered, homologous recombination with Ad11-Tel-GFP (see construction method in patent ZL201110143385.3) was performed via electroporation in BJ5183 competent cells, and positive clones Ad11-Tel-nsIL-12 (see FIG. 4) were picked out.

(39) 2. The recombinant Ad11-Tel-nsIL-12 vector was linearized with Not1 and transfected into 293 cells to produce the recombinant adenovirus vector Ad11-Tel-nsIL-12.

EXAMPLE 4

IL-12 Expression of Ad-TD-nsIL-12 and VV-TK-nsIL-12 in Tumor Cells

(40) The cultured human pancreatic cancer Suit2 and Capan1, head and neck tumor EC9706, lung cancer A549 and H1299, esophageal cancer EC9706 and ZZB, ovarian cancer SKOV3, colorectal cancer SW620 and HCT116 as well as gastric cancer AGS cells were digested with trypsin, counted, loaded to 6-well plates, 2×10.sup.5 cells/well, and separately infected with Ad-TD-nsIL-12 and VV-TK-nsIL-12, supernatants and cell mixtures were collected, respectively, and their IL-12 expression levels were detected by ELISA. The results are shown in FIG. 5 and FIG. 6.

(41) FIG. 5 shows that Ad-TD-nsIL-12 expressed IL-12 in tumor cells, and FIG. 6 shows that VV-TK-nsIL-12 expressed IL-12 in tumor cells.

EXAMPLE 5

Anti-Tumor Effect of Ad-TD-nsIL-12 on Various Solid Tumors

(42) The cultured pancreatic cancer SUIT2 and Capan1, head and neck cancer EC9706, lung cancer A549 and H1299, esophageal cancer EC9706 and ZZB, ovarian cancer SKOV3, colorectal cancer SW620 and HCT116 as well as gastric cancer AGS cells, were digested with trypsin, countered, turned into a cell suspension with DMEM containing 2% FBS, inoculated in the center of a 96-well plate, in which B1 to G1 were cell-free medium and the other three were PBS.

(43) After 24-18 h, multiple proportion dilution of virus VV-TK/Ad-TD-nsIL-12, VV-TK/Ad-TD-IL-12 (full length human IL-12) and Ad-TD-LUC (LUC, Luciferase) or VV-TK-RFP was preformed, in which with 1×10.sup.4 pfu/cell as initial concentration, 10 times dilution was applied to these virus solutions to form nine gradients of dilution, and the last row of cells was not added with virus. After the multiple proportion dilution, the virus was added to the center of 96-well plate by using a volley pipettor, with 10 μl/well and the same virus gradient in each row.

(44) The virus-infected cells were returned to a 37° C. incubator. After 6 days, 20 μl of a mixture solution of MTS and PMS, 20:1 (MTS:PMS), was added to each well other than those added with PBS. After 1-4 h, the solution was taken out and measured with microplate reader to determine absorbance at wavelength of 490 nm. EC50 was calculated accordingly and the results were shown in FIGS. 7 and 8.

(45) FIGS. 7 and 8 show that Ad-TD-nsIL-12 and VV-TK-nsIL-12 had the ability to kill various solid tumor cells.

EXAMPLE 6

Comparison of Changes in IL-12 Expression of Ad-TD-nsIL-12 Versus Ad-TD-LUC and Ad-TD-IL-12 After Intraperitoneal Injection Once in Tumor-Bearing Syrian Hamsters

(46) 1×10.sup.7 SHPC6 cells (Syrian hamster pancreatic cancer cells, supplied by WSM Wold of St. Louis University) were intraperitoneally inoculated into 5 to 6 weeks old Syrian hamsters, and the animals were divided into 4 groups after 4 days, 9 animals per group. The animals were separately intraperitoneally injected once with 500 μl of PBS, 1×10.sup.9 PFU Ad-TD-LUC (LUC was derived from pGL3 vector luciferase, constructed according to the method for construction of Ad-TD-nsIL-12 in Example 1), Ad-TD-IL-12 (full length human IL-12, constructed according to the method for construction of Ad-TD-nsIL-12 as described in Example 1), or Ad-TD-nsIL-12. On the 1.sup.st, 3.sup.rd and 5.sup.th day after injection, serum samples were collected and analyzed to determine changes of IL-12 expression in peripheral blood, and the results were shown in FIG. 9.

(47) The results of FIG. 9 show that the expression of IL-12 was high in the Ad-TD-IL-12 group animals on the 1.sup.st day after the injection of virus vector, and the expression of IL-12 on the 3.sup.rd and 5.sup.th day was significantly decreased, showing a significant change in IL-12 expression level; while the Ad-TD-nsIL-12 group animals showed a constant expression of IL-12 at a low level for each day, that was, the expression of IL-12 showed no significant difference from the 1.sup.st day to the 5.sup.th day, suggesting that Ad-TD-nsIL-12 was unlikely to produce IL-12 in a large amount that would cause toxic and side effects in vivo.

EXAMPLE 7

Antitumor Application of Tumor Targeting Adenovirus Ad-TD-nsIL-12 and Comparison Thereof with Ad-TD-LUC and Ad-TD-IL-12

(48) 1×10.sup.6 HPD1-NR (Syrian hamster pancreatic cancer cells, donated by WSM Wold, University of St. Louis, USA) were inoculated on the right upper side of back of each of 5 to 6 weeks old Syrian hamsters. The average tumor volume of each group of animals was about 330 mm.sup.3. Intratumoral injection was carried out with PBS, Ad-TD-LUC, Ad-TD-IL-12 and Ad-TD-nsIL-12, respectively. The viral vector was injected at a dose of 1×10.sup.9 PFU, once per day, for total 6 times, and tumor growth curves and tumor free rates were observed. The results were shown in FIG. 10 and FIG. 11.

(49) FIG. 10 shows that Ad-TD-nsIL-12 and Ad-TD-IL-12 showed stronger antitumor effects than the control vector Ad-TD-LUC and PBS; FIG. 11 shows that Ad-TD-nsIL-12 and Ad-TD-IL-12 treatment groups had a very high tumor free rate of up to 100%, while the Ad-TD-LUC group had a tumor free rate of only 42.8%.

EXAMPLE 8

Therapeutic Effect of Ad-TD-nsIL-12 on In Situ Model of Pancreatic Carcinoma in Syrian Hamsters and Comparison Thereof with Ad-TD-LUC and Ad-TD-IL-12

(50) Anesthetization of 4 to 5 weeks old Syrian hamsters was carried out by using 10% chloral hydrate, the left abdomen of Syrian hamster was opened, pancreas that linked with spleen was found, 3×10.sup.6 HapT1 cells (Syrian hamster pancreatic cancer cells, provided by WSM Wold, University of St. Louis) were inoculated to pancreas parenchyma. Six days later, the tumor-bearing animals were divided into 4 groups, 7 animals per group. Intraperitoneal injection of 500 μl of PBS, 1×10.sup.9 PFU of Ad-TD-LUC, Ad-TD-IL-12 or Ad-TD-nsIL-12 was performed respectively for treatment, once per every other day, for total 6 times. Survival time of animal was observed, and the results were shown in FIG. 12.

(51) The results of FIG. 12 show that Ad-TD-nsIL-12 had better therapeutic effect than Ad-TD-LUC and Ad-TD-IL-12, and was capable of significantly prolonging the survival time of the tumor-bearing animals. The death of all animals of Ad-TD-IL-12 group was significantly earlier than that of PBS group and other groups, suggesting that full length IL-12 could cause animal death due to its toxicity.

EXAMPLE 9

Therapeutic Effects of Ad-TD-LUC, Ad-TD-IL-12 and Ad-TD-nsIL-12 on Peritoneally Disseminated PaCa in Syrian Hamsters

(52) 1×10.sup.7 SHPC6 cells were inoculated into the abdominal cavity of each of 4 to 5 weeks old Syrian hamsters. Four days later, the animals were divided into 4 groups, 10 animals per group. Intraperitoneal injection of 500 μl of PBS, 1×10.sup.9 PFU of Ad-TD-LUC, Ad-TD-IL-12 or Ad-TD-nsIL-12 was performed separately for treatment, once per every other day, for total 3 times. Survival time of the animals was observed, and the results were shown in FIG. 13.

(53) The results of FIG. 13 show that the animals in the Ad-TD-nsIL-12 treatment group had survival rate of 100% during the observation period (200 days after the first treatment), whereas the animals in the Ad-TD-LUC group and the Ad-TD-IL-12 group had survival rates of 30% and 10%, respectively, and the death of the Ad-TD-IL-12 group animals was earlier than that of PBS group and other groups, suggesting that the full length IL-12 could lead to animal death due to its toxicity.

EXAMPLE 10

Comparison of Hepatotoxicity Between Ad-TD-nsIL-12 and Ad-TD-IL-12 After Intraperitoneal Injection in Syrian Hamsters

(54) 1×10.sup.7 SHPC6 cells were inoculated into the abdominal cavity of 5-6 weeks old Syrian hamsters, the animals were grouped after 4 days, 9 animals per group. Intraperitoneal injection of 500 μl PBS, 1×10.sup.9 of PFU Ad-TD-LUC, Ad-TD-nsIL-12 or 5×10.sup.8 of Ad-TD-IL-12 was performed once, and serum samples were collected on the 1.sup.st, 3.sup.rd and 5.sup.th day after the injection. Alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) were detected, and the results were shown in FIG. 14.

(55) The results of FIG. 14 show that the increases of ALT, AST and ALP induced by Ad-TD-nsIL-12 were significantly lower than those of Ad-TD-IL-12, indicating that Ad-TD-nsIL-12 had a hepatotoxicity significantly lower than that of Ad-TD-IL-12.

EXAMPLE 11

Comparison of Anti-Tumor Effect of Ad-TD-nsIL-12 on Subcutaneous Hamster Tumor Model of Head and Neck Tumor

(56) 1×10.sup.7 HCPC1 cells (Syrian hamster head and neck tumor cells) were inoculated on the right upper part of back of each of 5 to 6 weeks old Syrian hamsters. When the average tumor volume of each group was about 330 mm.sup.3, PBS, Ad-TD-LUC and Ad-TD-nsIL-12 were injected in tumors, respectively. The viral vector was injected with 5×10.sup.7 PFU each time, once per day, for total 6 times. The tumor growth curves and tumor free rates were observed, and the results were shown in FIG. 15.

(57) The results of FIG. 15 show that Ad-TD-nsIL-12 showed a stronger antitumor effect than the control viral vector Ad-TD-LUC and PBS.

EXAMPLE 12

Comparison of Anti-Tumor Effect of VV-TK-nsIL-12 Versus VV-TK-RFP and VV-TK-IL-12 on Peritoneally Disseminated PaCa in Syrian Hamsters

(58) 1×10.sup.7 SHPC6 cells were inoculated into abdominal cavity of each of 4 to 5 weeks old Syrian hamsters. Four days later, the animals were divided into four groups, 10 animals per group. Intraperitoneal injection of 500 μl PBS, 4×10.sup.7 PFU VV-TK-RFP (inserted with red fluorescent protein, constructed according to the method for construction of VV-TK-nsIL-12), VV-TK-IL-12 (inserted with full length human IL-12 gene, constructed according to the method for construction of VV-TK-nsIL-12) or VV-TK-nsIL-12 was performed for treatment, once per every other day, for total 3 times. The survival time of animals was observed, and the results were shown in FIG. 16.

(59) The results of FIG. 16 show that VV-TK-nsIL-12 had better therapeutic effect than VV-TK-RFP and VV-TK-IL-12, and was capable of significantly prolonging the survival time of tumor-bearing animals.

EXAMPLE 13

Comparison of Anti-Tumor Effect of Ad11-Tel-nsIL-12 Versus Ad11-Tel-GFP and Ad11-Tel-IL-12 on Peritoneally Disseminated PaCa in Syrian Hamsters

(60) 1×10.sup.7 SHPC6 cells were inoculated into the abdominal cavity of each of 4 to 5 weeks old Syrian hamsters. Four days later, the animals were divided into 4 groups, 10 animals per group. Intraperitoneal injection of 500 μl of PBS, 1×10.sup.9 PFU of Ad11-Tel-GFP (inserted with green fluorescent protein, constructed according to the method for construction of Ad11-Tel-nsIL-12), Ad11-Tel-IL-12 (inserted with full length human IL-12 gene, constructed according to the method for construction of Ad11-Tel-nsIL-12) or Ad11-Tel-nsIL-12 was performed for treatment, once per every other day, for total 3 times. The survival time of animals was observed, and the results were shown in FIG. 17.

(61) The results of FIG. 17 show that Ad11-Tel-nsIL-12 had better therapeutic effect than Ad11-Tel-GFP and Ad11-Tel-IL-12, and was able to significantly prolong the survival time of tumor-bearing animals.

(62) Finally, it should be noted that the above embodiments are merely illustrative of the technical aspects of the present invention and are not restrictive. Although the present invention has been described in detail with reference to preferred embodiments, it will be understood by those skilled in the art that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solution of the invention, and all of these changes are intended to be included within the scope of the claims of the invention.