Compositions and Methods for Allelic Gene Drive Systems and Lethal Mosaicism
20220177905 · 2022-06-09
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/8279
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A01K2227/706
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
An active genetic approach to preferentially transmit allelic variants (allelic-drive) resulting from only a single or a few nucleotide alterations. Embodiments are provided for allelic-drive: one, copy-cutting, in which a non-preferred allele is selectively targeted for Cas9/guide RNA (gRNA) cleavage, and a more general approach, copy-grafting, that permits selective inheritance of a desired allele located at some distance from the gRNA cut site. A lethal mosaicism is provided that dominantly eliminates NHEJ-induced mutations and favors inheritance of functional cleavage-resistant alleles. These two efficient allelic-drive methods, enhanced by lethal mosaicism and a trans-generational drive process provide a shadow-drive, that are applicable to improvements in health and agriculture.
Claims
1. A method of introducing a preferred nucleotide sequence into a genome by allelic-drive copy-cutting, comprising genomically replacing a non-preferred nucleotide sequence with that of a preferred allele of the same gene using an allelic-drive element that comprises first and second guide RNAs and a cleavage resistant preferred allele, wherein a Cas endonuclease guided by the first guide RNA copies the allelic-drive element, and a Cas endonuclease guided by the second guide RNA cuts the non-preferred allele, but not the preferred allele, and copies the cleavage resistant preferred allele into a double stranded DNA break created by the second guide RNA by homology-directed repair (HDR)-mediated repair.
2. A method of introducing a preferred nucleotide sequence into a genome by allelic-drive copy-grafting, comprising genomically replacing a non-preferred nucleotide sequence with that of a preferred allele of the same gene using an allelic-drive element that comprises a first and a second guide RNAs and a cleavage resistant site adjacent to the preferred allele, wherein Cas endonuclease guided by the first guide RNA copies the allelic-drive element, and the second guide RNA cuts the non-preferred allele, but not the preferred allele, that is associated with the cleavage resistant sequence residing within less than 100 nucleotides of the preferred allele, and copies the cleavage resistant sequence together with the preferred adjacent allele by virtue of a short range single stranded resection step which occurs during homology-directed repair (HDR)-mediated repair.
3. The method of claim 1, wherein the Cas endonuclease is not integrated into the allelic-drive element.
4. The method of claim 1, wherein Cas endonuclease is integrated into the allelic drive element and transmission of both alleles is super-Mendelian.
5. The method of claim 1, wherein allelic conversion of both alleles in a second filial generation is at least 40%, 50%, 60% or 70%
6. The method of claim 2, wherein allelic conversion of both alleles in a second filial generation is at least 80%, 85%, 90%, 95% or 97%.
7. The method of claim 2, wherein the second guide RNA targets the second chromosome at a sensitive portion within less than 80, 60, 40, 25, 20, 10 or 5 nucleotides of the non-preferred allele.
8. The method of claim 1, wherein progeny, which maintain an association between a first allele comprising an allelic-drive element and a second uncleavable allele, survive in the presence of Cas9.
9. The method of claim 1, wherein perduring Cas9-gRNA complexes are transmitted maternally for one generation in the absence of Cas9 or gRNA transgenes.
10. The method of claim 1, wherein the allelic-drive element is inserted into an essential gene required for viability or fertility and also carries functional recoded sequences of the essential gene rendering the allelic drive element viable in a homozygous or hemizygous state.
11. The method of claim 10, wherein the functional recoded sequences of the essential gene are recoded as a direct in-frame fusion with recoded cDNA sequences inserted at the 5 end of the allelic drive element abutting the guide RNA cut site.
12. The method of claim 10, wherein the essential gene is Notch, Rab11, Rab5, Rab1; Prosalpha1, Dpp=decapentaplegic, EGF-Receptor; Mre11, Spo11, cinnabar=kynurenine hydroxylase; doublesex; a gene encoding a male-specific tubulin subunit; cardinal, ENa=sodium ion channel, or FREP1.
13. A method of selectively eliminating an allele of a gene generated by non-homologous end joining (NHEJ) comprising utilizing a lethal mosaicism technique, wherein NHEJ-induced drive-resistant, non-functional, or loss-of-function alleles of an essential gene are dominantly eliminated in progeny due to maternal perdurance of Cas/guide RNA complexes targeting the paternal allele.
14. A method of germline editing comprising repair of a cleavage-sensitive allele with sequences provided by a cut-resistant allele present on the homologous chromosome in heterozygous individuals.
15. The method of claim 1, wherein the alleles are assembled in plants to provide drought resistance, higher crop yields, optimal architectures, or rapid growth.
16. The method of claim 1, wherein the alleles are assembled in insects to reverse pesticide resistance in pest species or to favor genetic variants that prevent host species from serving as disease vectors.
17. An organism made by a method of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION
[0032] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0033] Unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the exemplary methods, devices, and materials are described herein.
[0034] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, 2.sup.nd ed. (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987, and periodic updates); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); Remington, The Science and Practice of Pharmacy, 20.sup.th ed., (Lippincott, Williams & Wilkins 2003), and Remington, The Science and Practice of Pharmacy, 22.sup.th ed., (Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences 2012). The disclosure incorporates by reference the entirety of WO2016/073559.
[0035] In embodiments, the invention provides methods of introducing a preferred nucleotide sequence into a genome by allelic-drive copy-cutting. In embodiments, allelic-drive copy-cutting comprises genomically replacing a non-preferred nucleotide sequence with that of a preferred allele of the same gene using an allelic-drive element that comprises first and second guide RNAs and a cleavage resistant preferred allele, wherein a Cas endonuclease guided by the first guide RNA copies the allelic-drive element, and a Cas endonuclease guided by the second guide RNA cuts the non-preferred allele, but not the preferred allele, and copies the cleavage resistant preferred allele into a double stranded DNA break created by the second guide RNA by homology-directed repair (HDR)-mediated repair.
[0036] In embodiments, the invention provides a method of propagating a preferred allele in a genome by allelic-drive copy-cutting, comprising: a) integrating into a first chromosome, containing a preferred allele, an allelic-drive element comprising a first guide RNA, a second guide RNA, and a cleavage insensitive portion of the preferred allele, wherein the first guide RNA cleaves the first chromosome and inserts the allelic-drive element into the first chromosome with a Cas endonuclease; and b) integrating into a second chromosome, containing a non-preferred allele of the preferred allele, the allelic-drive element, wherein the first guide RNA cleaves the second chromosome and inserts the allelic-drive element into the second chromosome with a Cas endonuclease, and the second guide RNA cleaves the second chromosome at a sensitive portion of the non-preferred allele, but not the insensitive portion of the preferred allele, with a Cas endonuclease and by homology-directed repair (HDR)-mediated repair.
[0037] In embodiments, the allelic-drive can be inserted into any locus, whether on the same chromosome as the preferred allele or not. In embodiments, the allelic-drive element can be on the first chromosome and the preferred allele can be on either the first or second chromosome. In embodiments, for example in Drosophila, the first chromosome can be X and the second chromosome can be an autosome, there also being third and fourth autosomal chromosomes. In embodiments, the allelic-drive element is inserted into the genome in a genetic background that carries the cleavage resistant or insensitive version of the preferred allele, to avoid the gRNA cutting the target gene and creating a mutation by NHEJ.
[0038] In embodiments, allelic-drive copy-cutting provides allelic conversion of both alleles in a second filial generation is at least 40%, 50%, 60% or 70%.
[0039] In embodiments, the invention provides methods of introducing a preferred nucleotide sequence into a genome by allelic-drive copy-grafting. In embodiments, the allelic-drive copy-grafting comprises genomically replacing a non-preferred nucleotide sequence with that of a preferred allele of the same gene using an allelic-drive element that comprises a first and a second guide RNAs and a cleavage resistant site adjacent to the preferred allele, wherein a Cas endonuclease guided by the first guide RNA copies the allelic-drive element, and a Cas endonuclease guided by the second guide RNA cuts the non-preferred allele, but not the preferred allele, that is associated with the cleavage resistant site residing within less than 100 nucleotides of the preferred allele, and copies the cleavage resistant sequence together with the preferred adjacent allele as an intact “island” by virtue of the short range single stranded resection step which occurs during homology-directed repair (HDR)-mediated repair.
[0040] In embodiments, the invention provides methods of introducing a preferred nucleotide sequence into a genome by allelic-drive copy-grafting. In embodiments, the allelic-drive copy-grafting comprising: a) integrating into a first chromosome, containing a preferred allele, an allelic-drive element comprising a first guide RNA, a second guide RNA, and a cleavage insensitive portion of the preferred allele, wherein the first guide RNA cleaves the first chromosome and inserts the allelic-drive element into the first chromosome with a Cas endonuclease; and b) integrating into a second chromosome, containing a non-preferred allele of the preferred allele, the allelic-drive element, wherein the first guide RNA cleaves the second chromosome and inserts the allelic-drive element into the second chromosome with a Cas endonuclease, and the second guide RNA cleaves the second chromosome at a sensitive portion within less than 100 nucleotides of the non-preferred allele with a Cas endonuclease and by homology-directed repair (HDR)-mediated repair.
[0041] In embodiments, the allelic-drive can be inserted into any locus, whether on the same chromosome as the preferred allele or not. In embodiments, the allelic-drive element can be on the first chromosome and the preferred allele can be on either the first or second chromosome. In embodiments, in the allelic-drive copy-grafting methods, a cleavage insensitive site can be created adjacent to the preferred allele, and Cas9 induced DNA breaks directed by guide RNA-mediated cleavage of chromosomes carrying either the non-preferred allele or a cleavage-sensitive preferred allele (perhaps a wild-type allele) are repaired by copying an intact region of 5 to 100 nucleotides (or base pairs) that includes the preferred allele. This embodiment replaces both non-preferred and cleavage sensitive preferred alleles with the cleavage resistance preferred allele. In embodiments, the second guide RNA cleaves the second chromosome at a cleavage sensitive portion within less than 80, 60, 40, 25, 20, 10 or 5 nucleotides from the non-preferred allele.
[0042] In embodiments, allelic-drive copy-grafting provides allelic conversion of both alleles in a second filial generation is at least 80%, 85%, 90%, 95% or 97%.
[0043] In embodiments of the allelic-drive copy-cutting and copy-grafting methods of the invention, the Cas endonuclease is not integrated into the allelic-drive element. In embodiments, the Cas endonuclease is integrated into the allelic drive element and transmission of both alleles is super-Mendelian.
[0044] In embodiments of the allelic-drive copy-cutting and copy-grafting methods of the invention, the progeny, which maintain an association between a first allele comprising an allelic-drive element and a second uncleavable (or cleavage insensitive or cleavage resistant) allele, survive in the presence of Cas9.
[0045] In embodiments of the allelic-drive copy-cutting and copy-grafting methods of the invention, perduring Cas9-gRNA complexes are transmitted maternally for one generation in the absence of Cas9 or gRNA transgenes.
[0046] In embodiments, the prodigy result from a lethal mosaicism. In embodiments of the allelic-drive copy-cutting and copy-grafting methods of the invention, the allelic-drive element is inserted into an essential gene required for viability or fertility and also carries functional recoded sequences of the essential gene rendering the allelic drive element viable in a homozygous or hemizygous state. In embodiments of the allelic-drive copy-cutting and copy-grafting methods of the invention, the functional recoded sequences of the essential gene are recoded as a direct in-frame fusion with recoded cDNA sequences inserted at the 5 end of the allelic drive element abutting the guide RNA cut site. In embodiments, the essential gene is for example Notch, Rab11, Rab5, Rab1; Prosalpha1, Dpp=decapentaplegic, EGF-Receptor; Mre11, Spo11, cinnabar=kynurenine hydroxylase; doublesex; a gene encoding a male-specific tubulin subunit; cardinal, ENa=sodium ion channel, or FREP1.
[0047] In embodiments the invention provides methods of selectively eliminating an allele of a gene generated by non-homologous end joining (NHEJ) comprising utilizing a lethal mosaicism technique, wherein NHEJ-induced drive-resistant, non-functional, or loss-of-function alleles of an essential gene are dominantly eliminated in progeny due to maternal perdurance of Cas/guide RNA complexes targeting the paternal allele.
[0048] In embodiments the invention provides methods of germline editing comprising repair of a cleavage-sensitive allele with sequences provided by a cut-resistant allele present on the homologous chromosome in heterozygous individuals.
[0049] In embodiments of the invention, the alleles are assembled in plants to provide a trait of interest, such as but not limited to, drought resistance, insect resistance, salinity resistance, higher crop yields, optimal architectures, or rapid growth.
[0050] In embodiments of the invention, the alleles are assembled in insects to reverse pesticide resistance in pest species or to favor genetic variants that prevent host species from serving as disease vectors.
[0051] In embodiments, the invention provides organism made by a method of any of the inventions and methods described herein. In embodiments, the organism is eukaryotic, such as a plant, an insect, an agricultural pest, or an animal, including a human.
[0052] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains”, “containing,” “characterized by,” or any other variation thereof, are intended to encompass a non-exclusive inclusion, subject to any limitation explicitly indicated otherwise, of the recited components. For example, a fusion protein, a pharmaceutical composition, and/or a method that “comprises” a list of elements (e.g., components, features, or steps) is not necessarily limited to only those elements (or components or steps), but may include other elements (or components or steps) not expressly listed or inherent to the fusion protein, pharmaceutical composition and/or method.
[0053] As used herein, the transitional phrases “consists of” and “consisting of” exclude any element, step, or component not specified. For example, “consists of” or “consisting of” used in a claim would limit the claim to the components, materials or steps specifically recited in the claim except for impurities ordinarily associated therewith (i.e., impurities within a given component). When the phrase “consists of” or “consisting of” appears in a clause of the body of a claim, rather than immediately following the preamble, the phrase “consists of” or “consisting of” limits only the elements (or components or steps) set forth in that clause; other elements (or components) are not excluded from the claim as a whole.
[0054] As used herein, the transitional phrases “consists essentially of” and “consisting essentially of” are used to define a fusion protein, pharmaceutical composition, and/or method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting essentially of” occupies a middle ground between “comprising” and “consisting of”.
[0055] When introducing elements of the present invention or the preferred embodiment(s) thereof, the articles “a”, “an”, “the” and “said” are intended to mean that there are one or more of the elements. The terms “comprising”, “including” and “having” are intended to be inclusive and mean that there may be additional elements other than the listed elements.
[0056] The term “and/or” when used in a list of two or more items, means that any one of the listed items can be employed by itself or in combination with any one or more of the listed items. For example, the expression “A and/or B” is intended to mean either or both of A and B, i.e. A alone, B alone or A and B in combination. The expression “A, B and/or C” is intended to mean A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination or A, B, and C in combination.
[0057] It is understood that aspects and embodiments of the invention described herein include “consisting” and/or “consisting essentially of” aspects and embodiments.
[0058] It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Values or ranges may be also be expressed herein as “about,” from “about” one particular value, and/or to “about” another particular value. When such values or ranges are expressed, other embodiments disclosed include the specific value recited, from the one particular value, and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that there are a number of values disclosed therein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. In embodiments, “about” can be used to mean, for example, within 10% of the recited value, within 5% of the recited value, or within 2% of the recited value.
[0059] As used herein the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia, other generally recognized pharmacopoeia in addition to other formulations that are safe for use in animals, and more particularly in humans and/or non-human mammals.
[0060] As used herein the term “pharmaceutically acceptable carrier” refers to an excipient, diluent, preservative, solubilizer, emulsifier, adjuvant and/or vehicle with which demethylation compound(s), is administered. Such carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents. Antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose may also be a carrier. Methods for producing compositions in combination with carriers are known to those of skill in the art. In some embodiments, the language “pharmaceutically acceptable earner” is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. See, e.g., Remington, The Science and Practice of Pharmacy, 20th ed., (Lippincott, Williams & Wilkins 2003). Except insofar as any conventional media or agent is incompatible with the active compound, such use in the compositions is contemplated.
[0061] “Complementaty” or “complement thereof” means that a contiguous nucleic acid base sequence is capable of hybridizing to another base sequence by standard base pairing (hydrogen bonding) between a series of complementary bases. Complementary sequences may be completely complementary (i.e. no mismatches in the nucleic acid duplex) at each position in an oligomer sequence relative to its target sequence by using standard base pairing (e.g., G:C, A:T or A:U pairing) or sequences may contain one or more positions that are not complementary by base pairing (e.g., there exists at least one mismatch or unmatched base in the nucleic acid duplex), but such sequences are sufficiently complementary because the entire oligomer sequence is capable of specifically hybridizing with its target sequence in appropriate hybridization conditions (i.e. partially complementary). Contiguous bases in an oligomer are typically at least 80%, preferably at least 90%, and more preferably completely complementary to the intended target sequence.
[0062] “Configured to” or “designed to” denotes an actual arrangement of a nucleic acid sequence configuration of a referenced oligonucleotide. For example, a primer that is configured to generate a specified amplicon from a target nucleic acid has a nucleic acid sequence that hybridizes to the target nucleic acid or a region thereof and can be used in an amplification reaction to generate the amplicon. Also as an example, an oligonucleotide that is configured to specifically hybridize to a target nucleic acid or a region thereof has a nucleic acid sequence that specifically hybridizes to the referenced sequence under stringent hybridization conditions.
[0063] “Region” refers to a portion of a nucleic acid wherein said portion is smaller than the entire nucleic acid.
[0064] “Region of interest” refers to a specific sequence of a target nucleic acid that includes all codon positions having at least one single nucleotide substitution mutation associated with a genotype and/or subtype that are to be modified, and all marker positions that are to be amplified and detected, if any.
[0065] “RNA-dependent DNA polymerase” or “reverse transcriptase” (“RT”) refers to an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases. RTs may also have an RNAse H activity. A primer is required to initiate synthesis with both RNA and DNA templates.
[0066] “DNA-dependent DNA polymerase” is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli, bacteriophage T7 DNA polymerase, or DNA polymerases from bacteriophages T4, Phi-29, M2, or T5. DNA-dependent DNA polymerases may be the naturally occurring enzymes isolated from bacteria or bacteriophages or expressed recombinantly, or may be modified or “evolved” forms which have been engineered to possess certain desirable characteristics, e.g., thermostability, or the ability to recognize or synthesize a DNA strand from various modified templates. All known DNA-dependent DNA polymerases require a complementary primer to initiate synthesis. It is known that under suitable conditions a DNA-dependent DNA polymerase may synthesize a complementary DNA copy from an RNA template. RNA-dependent DNA polymerases typically also have DNA-dependent DNA polymerase activity.
[0067] “DNA-dependent RNA polymerase” or “transcriptase” is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially double-stranded DNA molecule having a promoter sequence that is usually double-stranded. The RNA molecules (“transcripts”) are synthesized in the 5′-to-3′ direction beginning at a specific position just downstream of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.
[0068] A “sequence” of a nucleic acid refers to the order and identity of nucleotides in the nucleic acid. A sequence is typically read in the 5′ to 3′ direction. The terms “identical” or percent “identity” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, e.g., as measured using one of the sequence comparison algorithms available to persons of skill or by visual inspection. Exemplary algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST programs, which are described in, e.g., Altschul et al. (1990) “Basic local alignment search tool” J. Mol. Biol. 215:403-410, Gish et al, (1993) “Identification of protein coding regions by database similarity search” Nature Genet. 3:266-272, Madden et al. (1996) “Applications of network BLAST server” Meth. Enzymol. 266:131-141, Altschul et al. (1997) “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs” Nucleic Acids Res. 25:3389-3402, and Zhang et al. (1997) “PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation” Genome Res. 7:649-656, which are each incorporated by reference. Many other optimal alignment algorithms are also known in the art and are optionally utilized to determine percent sequence identity.
[0069] A “label” refers to a moiety attached (covaleinly or non-covidently), or capable of being attached, to a molecule, which moiety provides or is capable of providing information about the molecule (e.g., descriptive, identifying, etc. information about the molecule) or another molecule with which the labeled molecule interacts (e.g., hybridizes, etc.). Exemplary labels include fluorescent labels (including, e.g., quenchers or absorbers), weakly fluorescent labels, non-fluorescent labels, colorimetric labels, chemiluminescent labels, bioluminescent labels, radioactive labels, mass-modifying groups, antibodies, antigens, biotin, haptens, enzymes (including, e.g., peroxidase, phosphatase, etc.), and the like.
[0070] A “linker” refers to a chemical moiety that covalently or non-coyalently attaches a compound or substituent group to another moiety, e.g., a nucleic acid, an oligonucleotide probe, a primer nucleic acid, an amplicon, a solid support, or the like. For example, linkers are optionally used to attach oligonucleotide probes to a solid support (e.g., in a linear or other logic probe array). To further illustrate, a linker optionally attaches a label (e.g., a fluorescent dye, a radioisotope, etc.) to an oligonucleotide probe, a primer nucleic acid, or the like. Linkers are typically at least bifunctional chemical moieties and in certain embodiments, they comprise cleavable attachments, which can be cleaved by, e.g., heat, an enzyme, a chemical agent, electromagnetic radiation, etc. to release materials or compounds from, e.g., a solid support. A careful choice of linker allows cleavage to be performed under appropriate conditions compatible with the stability of the compound and assay method. Generally a linker has no specific biological activity other than to, e.g., join chemical species together or to preserve some minimum distance or other spatial relationship between such species. However, the constituents of a linker may be selected to influence some property of the linked chemical species such as three-dimensional conformation, net charge, hydrophobicity, etc. Exemplary linkers include, e.g., oligopeptides, oligonucleotides, oligopolyamides, oligoethyleneglycerols, oligoacrylamides, alkyl chains, or the like. Additional description of linker molecules is provided in, e.g., Hermanson, Bioconjugate Techniques, Elsevier Science (1996), Lyttle et al. (1996) Nucleic Acids Res. 24(14):2793, Shchepino et al. (2001) Nucleosides, Nucleotides, & Nucleic Acids 20:369, Doronina et al (2001) Nucleosides, Nucleotides, & Nucleic Acids 20:1007, Trawick et al. (2001) Bioconjugate Chem. 12:900, Olejnik et al. (1998) Methods in Enzymology 291:135, and Pljevaljcic et al. (2003) J. Am. Chem. Soc. 125(12):3486, all of which are incorporated by reference.
[0071] “Fragment” refers to a piece of contiguous nucleic acid that contains fewer nucleotides than the complete nucleic acid.
[0072] “Hybridization,” “annealing,” “selectively bind,” or “selective binding” refers to the base-pairing interaction of one nucleic acid with another nucleic acid (typically an antiparallel nucleic acid) that results in formation of a duplex or other higher-ordered structure (i.e. a hybridization complex). The primary interaction between the antiparallel nucleic acid molecules is typically base specific, e.g., A/T and G/C. It is not a requirement that two nucleic acids have 100% complementarity over their full length to achieve hybridization. Nucleic acids hybridize due to a variety of well characterized physio-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” (Elsevier, New York), as well as in Ausubel (Ed.) Current Protocols in Molecular Biology, Volumes I, II, and III, 1997, which is incorporated by reference.
[0073] “Nucleic acid” or “nucleic acid molecule” refers to a multimeric compound comprising two in more covalently bonded nucleosides or nucleoside analogs having nitrogenous heterocyclic bases, or base analogs, where the nucleosides are linked together by phosphodiester bonds or other linkages to form a polynucleotide. Nucleic acids include RNA, DNA, or chimeric DNA-RNA polymers or oligonucleotides, and analogs thereof. A nucleic acid backbone can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds, phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of the nucleic acid can be ribose, deoxyribose, or similar compounds having known substitutions (e.g. 2′-methoxy substitutions and 2′-halide substitutions). Nitrogenous bases can be conventional bases (A, G, C, T, U) or analogs thereof (e.g., inosine, 5-methylisocytosine, isoguanine). A nucleic acid can comprise only conventional sugars, bases, and linkages as found in RNA and DNA, or can include conventional components and substitutions (e.g., conventional bases linked by a 2′-methoxy backbone, or a nucleic acid including a mixture of conventional bases and one or more base analogs). Nucleic acids can include “locked nucleic acids” (LNA), in which one or more nucleotide monomers have a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhances hybridization affinity toward complementary sequences in single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), or double-stranded DNA (dsDNA). Nucleic acids can include modified bases to alter the function or behavior of the nucleic acid (e.g., addition of a 3′-terminal dideoxynucleotide to block additional nucleotides from being added to the nucleic acid). Synthetic methods for making nucleic acids in vitro are well known in the art although nucleic acids can be purified from natural sources using routine techniques. Nucleic acids can be single-stranded or double-stranded.
[0074] An “oligonucleotide” or “oligomer” refers to a nucleic acid that includes at least two nucleic acid monomer units (e.g., nucleotides), typically more than three monomer units, and more typically greater than ten monomer units. The exact size of an oligonucleotide generally depends on various factors, including the ultimate function or use of the oligonucleatide. Oligonucleotides are optionally prepared by any suitable method, including, but not limited to, isolation of an existing or natural sequence, DNA replication or amplification, reverse transcription, cloning and restriction digestion of appropriate sequences, or direct chemical synthesis.
[0075] Nucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Endonucleases include, but are not limited to, Cas proteins, restriction endonucleases, meganucleases, homing endonucleases, TAL effector nucleases, and Zinc finger nucleases. Endonucleases include, but are not limited to, Type I, Type II, Type III, Type IV, and Type V endonucleases, any one of which may further include subtypes. Cas proteins include, but are not limited to, Cas1, Cas1B, Cas2Cas3, Cas3′ (Cas3-prime), Cas3″ (Cas3-double prime), Cas4, Cas5, Cas6, Cas6e (formerly referred to as CasE, Cse3), Cas6f (i.e., Csy4), Cas7, Cas8, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (also known as Csn1 and Csx12), Cas10, Cas10d, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, and modified versions thereof. One skilled in the art can choose a nuclease based on various factors, including size, stability, ability to bind to a guide nucleic acid, ability to recognize a target sequence, etc. In some embodiments, the nuclease may be further optimized (e.g., to have a longer halflife, to be codon-optimized for the organism, to further comprise a nuclear localization signal, etc.). In some embodiments, the nuclease can be fused to other functional groups, for example a GFP domain, to visualize the protein.
[0076] In some embodiments, the nuclease may be Cas9. In some embodiments, the nuclease may be a Cas9 cloned or derived from a bacteria (S. pyogenes, S. pneumoniae, S. aureus, or S. thermophilus). One skilled in the art will recognize there are many Cas9 nucleases derived from bacteria. One skilled in the art can choose a Cas9 nuclease based on various factors, including size, stability, ability to bind to a guide nucleic acid, ability to recognize a protospacer adjacent motif (i.e., PAM) etc. In some embodiments, the Cas9 nuclease may be further optimized (e.g., to have a longer half-life, to be codon-optimized for the organism, to further comprise a nuclear localization signal, etc.). In some embodiments, the Cas9 nuclease can be fused to other functional groups, for example a GFP domain, to visualize the protein.
[0077] A Cas9 protein may recognize a protospacer adjacent motif (PAM) sequence comprising NGG. A Cas9 protein may recognize a protospacer adjacent motif (PAM) sequence that does not comprise NGG. A Cas9 protein may recognize a protospacer adjacent motif (PAM) sequence comprising NNGRRT, such as TTGAAT or TTGGGT.
[0078] An endonuclease may have DNA cleavage activity, such as Cas9. In some embodiments, an endonuclease directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, an endonuclease directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
[0079] In some embodiments, an endonuclease is mutated with respect to a corresponding wild-type enzyme such that the mutated endonuclease lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (e.g., D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. In some embodiments, the Cas protein (e.g., Cas9 protein) may be a nickase. In aspects of the invention, nickases may be used for genome editing via homologous recombination. In some embodiments, a Cas9 nickase may be used in combination with guide polynucleotide(s), e.g., two guide polynucleotides, which target respectively sense and antisense strands of the DNA target. Two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III) may be mutated to produce a mutated Cas9 substantially lacking DNA cleavage activity. In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking DNA cleavage activity. In some embodiments, an endonuclease is considered to substantially lacking DNA cleavage activity when the DNA cleavage activity of the mutated endonuclease is less than about 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, or lower than 0.01% with respect to its non-mutated form.
[0080] In some embodiments, a gene encoding an endonuclease (e.g., a Cas protein such as Cas9) is codon optimized for expression in particular cells, such as eukarymic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cell of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more than 50 codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species may exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) may correlate with the efficiency of translation of messenger RNA (mRNA), which may depend on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, more than 50, or all codons) in a sequence encoding an endonuclease correspond to the most frequently used codon for a particular amino acid. In certain embodiments, a gene encoding an endonuclease may not be codon optimized.
[0081] In some embodiments, an endonuclease is part of a fusion protein comprising one or more heterologous peptide or protein domains (e.g., about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 domains in addition to an endonuclease). An endonuclease fusion protein may comprise any additional peptide or protein sequence, and optionally a linker sequence between any two domains. Examples of peptide or protein domains that may be fused to an endonuclease include, without limitation, epitope tags, reporter gene sequences, localization signals, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), other fluorescent proteins, and autofluorescent proteins including blue fluorescent protein (BFP). An endonuclease may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Examples of localization signals include, but are not limited to, nuclear localization signals (e.g., SV40 large T-antigen, acidic M9 domain of hnRNP A1), cytoplasmic localization signals, mitochondrial localization signals, nuclear export signals, chloroplast localization signals, and endoplasmic reticulum retention signals. In some embodiments, a tagged endonuclease is used to identify the location of a target sequence.
[0082] As used herein, the term “guide polynucleotide”, refers to a polynucleotide sequence that can form a complex with an endonuclease (e.g., Cas protein such as Cas9) and enables the endonuclease to recognize and optionally cleave a target site on a polynucleotide such as DNA. The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence). Optionally, the guide polynucleotide can comprise at least one nucleotide, phosphodiester bond, or linkage modification such as, but not limited, to locked nucleic acid (LNA), peptide nucleic acid (PNA), bridged nucleic acid (BNA), 5-methyl dC, 2,6-Diaminopurine, 2′-Fluoro A, 2′-Fluoro U, 2′-O-Methyl RNA, Phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5′ to 3′ covalent linkage resulting in circularization. In some embodiments, the guide polynucleotide does not solely comprise ribonucleic acids (RNAs). In other embodiments, the guide polynucleotide does solely comprise ribonucleic acids (RNAs). A guide polynucleotide that solely comprises ribonucleic acids is also referred to as a “guide RNA”.
[0083] The guide polynucleotide can be a double molecule (also referred to as duplex guide polynucleotide) comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide sequence domain (referred to as Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease. The CER domain of the double molecule guide polynucleotide comprises two separate molecules that are hybridized along a region of complementarity. The two separate molecules can be RNA, DNA, and/or RNA-DNA combination sequences. In some embodiments, the duplex guide polynucleotide does not solely comprise ribonucleic acids (RNAs). In some embodiments, the first molecule of the duplex guide polynucleotide comprising a VT domain linked to a CER domain is referred to as “crDNA” (when composed of a contiguous stretch of DNA nucleotides) or “crRNA” (when composed of a contiguous stretch of RNA nucleotides), or “crDNA-RNA” (when composed of a combination of DNA and RNA nucleotides). In some embodiments, the second molecule of the duplex guide polynucleotide comprising a CER domain is referred to as “tracrRNA” (when composed of a contiguous stretch of RNA nucleotides) or “tracrDNA” (when composed of a contiguous stretch of DNA nucleotides) or “tracrDNA-RNA” (when composed of a combination of DNA and RNA nucleotides).
[0084] The guide polynucleotide can also be a single molecule comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide domain (referred to as endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide. By “domain” it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and/or RNA-DNA-combination sequence. The VT domain and/or the CER domain of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence. In some embodiments, the single guide polynueleotide comprises a crNucleotide (comprising a VT domain linked to a CER domain) linked to a tracrNucleotide (comprising a CER domain), wherein the linkage is a nucleotide sequence comprising a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. The single guide polynucleotide being comprised of sequences from the crNucleotide and tracrNucleotide may be referred to as “single guide RNA” (when composed of a contiguous stretch of RNA nucleotides) or “single guide DNA” (when composed of a contiguous stretch of DNA nucleotides) or “single guide RNA-DNA” (when composed of a combination of RNA and DNA nucleotides).
[0085] The term “variable targeting domain” or “VT domain” is used interchangeably herein and refers to a nucleotide sequence that is complementary to one strand (nucleotide sequence) of a double strand DNA target site. The % complementation between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The variable target domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.
[0086] In general, a guide polynucleotide is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide polynucleotide and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide polynucleotide is about or at least about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more than 75 nucleotides in length. In some embodiments, a guide polynucleotide is up to about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer than 12 nucleotides in length. The ability of a guide polynucleotide to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay.
[0087] A guide polynucleotide may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome.
[0088] A homology arm may be about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, or more than 500 nucleotides in length. In some embodiments, homology arms on a construct are the same length, similar lengths, or different lengths. In some embodiments, the degree of complementarily between a homology arm and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%. In some instances, the homology arms directly abut the endonuclease cleavage sites. In some embodiments of any one of the methods or constructs described herein, the homology arms directly abut the endonuclease cut site(s) determined by the at least one guide polynucleotide, or are separated by less than 100, 75, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleic acids.
[0089] A cell has been “genetically modified” or “transformed” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication.
[0090] Methods of introducing a nucleic acid into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a cell. Suitable methods of genetic modification (also referred to as “transformation”) include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, direct micro injection, nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et., al Adv Drug Deliv Rev. 2012 Sep. 13, pii: S0169-409X(12)00283-9, doi: 10.1016/j.addr.2012.09.023), and the like.
[0091] Similar strategies can be devised to combat other insect borne diseases. Insects that carry insect borne diseases include, but are not limited to, the mosquito, tick, flea, lice, Culicoid midge, sandfly, Tsetse fly, and bed bug. Insect borne diseases include, but are not limited to, mosquito borne diseases, tick borne diseases, flea borne diseases, lice borne diseases, Culicoid midge borne diseases, sandfly home diseases, Tsetse fly borne diseases, bed bug borne diseases, and any combination thereof. Examples of insect borne diseases include, but are not limited to, African horse sickness, babesiosis, bluetongue disease, tick-borne encephalitis, Rickettsial diseases (e.g., typhus, rickettsialpox, Boutonneuse fever, African tick bite fever, Rocky Mountain spotted fever), Crimean-Congo hemorrhagic fever, ehrlichiosis, Southern tick-associated rash illness, tick-borne relapsing fever, tularemia, lice infestation, heartland virus, plague, Trypanosomiasis, sleeping sickness, leishmaniasis, Chagas disease, and Lyme disease. Mosquito borne diseases include, but are not limited to, malaria, dengue fever, yellow fever, chikungunya, dog heartworm, Eastern equine encephalitis, epidemic polyarthritis, filariasis, Rift Valley fever, Ross River fever, St. Louis encephalitis, Japanese encephalitis, pogosta disease, LaCrosse encephalitis, Western equine encephalitis, and West Nile virus.
[0092] Treating diseases or conditions: Elements can be designed that treat diseases or conditions by selectively adding, deleting, or mutating genes. For example, genes that encode immunogenic proteins may be targeted to reduce or eliminate immunogenicity. Allergens in food may be reduced by targeting the genes encoding the allergen in the organism (e.g., peanut, tree nut, cow (or other source of milk), chicken (or other source of egg), wheat, soy, fish, shellfish) from which the food was derived. Specific cells may be targeted, such as beta cells (role in diabetes) or cells and/or genes involved in autoimmune disorders.
[0093] Controlling Agriculture Pest Species: Agriculture pests and invasive species cause over $3 billion of damage to crops per year. Constructs targeting one or more genes, for example those required for female fertility or survival, may reduce the damage caused by many of these pests.
[0094] For instance, the invention can suppress crop pests actively attacking a crop of interest or be used for weed control. This strategy closely parallels that illustrated above for combating malaria. For example, the spotted wing fly (Drosophila suzukii), which is related to the laboratory fruit fly (Drosophila melanogaster), may be targeted. D. suzukii entered the U.S. in 2008 and in 2010 was estimated to cause over $500 million of damage is to soft fruits (strawberries, other berries, grapes, cherries) in Pacific coast states, amounting to nearly 20% of this $2.5 billion industry. The genome sequence of D. suzukii has been determined, and constructs described herein can be generated to test for control and eradication of this invasive pest. Other pests that may also be targeted include, but are not limited to, the Medfly (≈$1.2 billion damage/yr), olive fly (can reduce oil production by as much as 80%), pea leaf miner (a fly causing over $1.5 billion of crop damage), and Asian tiger mosquito (a vector for encephalitis, dengue fever, yellow fever and dog heartworm). Pests or weeds that are resistant to pesticides or herbicides (e.g., glyphosate), respectively, may also be targeted by the invention. For example, allelic-drive elements may replace resistant alleles to restore susceptibility to a pesticide or herbicide. Resistant pests that may be targeted include, but are not limited to, the western corn rootworm, horseweed, pigweed, Amaranthus hybridus (syn: quitensis) (Smooth Pigweed); Amaranthus palmeri (Palmer Amaranth); Amaranthus spinosus (Spiny Amaranth); Amaranthus tuberculatus (=A, rudis) (Tall Waterhemp); Ambrosia artemisiifolia (Common Ragweed); Ambrosia trifida (Giant Ragweed); Bidens pilosa (Hairy Beggarticks); Brachiaria eruciformis (Sweet Summer Grass); Bromus diandrus (Ripgut Brome); Bromus rubens (Red Brome); Chloris elata (Tall Windmill Grass); Chloris truncata (Windmill Grass); Conyza bonariensis (Hairy Fleabane); Conyza canadensis (Horseweed); Conyza sumatrensis (Sumatran Fleabane); Cynodon hirsutus (Gramilla mansa); Digitaria insularis (Sourgrass); Echinochloa colona (Junglerice); Eleusine indica (Goosegrass); Hedyotis verticillata (Woody borreria); Kochia scoparia (Kochia); Leptochloa virgata (Tropical Sprangletop, Juddsgrass); Lolium perenne (Perennial Ryegrass); Lolium perenne ssp. multiflorum (Italian Ryegrass); Lolium rigidum (Rigid Ryegrass); Parthenium hysterophorus (Ragweed Parthenium); Plantago lanceolata (Buckhorn Plantain); Poa annua (Annual Bluegrass); Raphanus raphanistrum (Wild Radish); Sonchus oleraceus (Annual Sowthistle); Sorghum halepense (Johnsongrass); Urochloa panicoides (Liverseedgrass) and any combination thereof. By reducing resistance or reversing it, a pesticide or herbicide may be used for a longer period of time and/or in lower concentrations or amounts.
[0095] Agriculture pests include, but are not limited to, agriculture pest insects, agriculture pest mites, agriculture pest nematodes, grape pests, pest molluscs, strawberry pests, Western honey bee pests, insect pests of ornamental plants, insect vectors of plant pathogens, plant pathogenic nematodes, invasive species, and any combination thereof.
[0096] Agriculture pest insects include, but are not limited to, Acalymma, Acrythosiphon kondoi, Acyrthosiphon gossypii, Acyrthosiphon pisum, African armyworm, Africanized bee, Agrilus planipennis (Emerald ash borer), Agromyzidae, Agrotis ipsilon, Agrotis munda, Agrotis porphyricollis, Akkaia taiwana, Aleurocanthus woglumi, Aleyrodes proletella, Alphitobius diaperinus, Alsophila aescularia, Altica chalybea, Ampeloglypter ater, Anasa tristis, Anisoplia austriaca, Anthonomus pomorum, Anthonomus signatus, Aonidiella aurantii, Apamea apamiformis, Apamea niveivenosa, Aphid, Aphis gossypii, Aphis nasturtii, Apple maggot, Argentine ant, Army cutworm, Arotrophora arcuatalis, Astegopteryx bambusae, Astegopteryx insularis, Astegopteryx minuta, Asterolecanium coffeae, Atherigona reversura, Athous haemorrhoidalis, Aulacophora, Aulacorthum solani, Australian plague locust, Bactericera cockerelli, Bactrocera, Bactrocera correcta, Bagrada hilaris, Beet armyworm, Black bean aphid, Blepharidopterus chlorionis, Bogong moth, Boll weevil, Bollworm, Brassica pod midge, Brevicoryne brassicae, Brown locust, Brown marmorated stink bug, Brown planthopper Cabbage moth, Cabbage worm, Callosobruchus maculatus, Cane beetle, Carrot fly, Cerataphis brasiliensis, Ceratitis capitata, Ceratitis rosa, Ceratoglyphina bambusae, Ceratopemphigus zehntneri, Ceratovacuna lanigera, Cereal leaf beetle, Chaetosiphon tetrarhodum, Chlorops pumilionis, Chrysophtharta bimaculata, Citrus flatid planthopper, Citrus long-horned beetle, Coccus hesperidum, Coccus viridis, Codling moth, Coffee borer beetle, Colorado potato beetle, Confused flour beetle, Crambus, Cucumber beetle, Curculio nucum, Curculio occidentis, Cutworm, Cyclocephala borealis, Date stone beetle, Delia (genus), Delia antiqua, Delia floralis, Delia radicum, Desert locust, Diabrotica, Diabrotica balteata, Diabrotica speciosa, Diamondback moth, Diaphania indica, Diaphania nitidalis, Diaphorina citri, Diaprepes abbreviatus, Diatraea saccharalis, Differential grasshopper, Dociostaurus maroccanus, Drosophila suzukii, Dryocosmus kuriphilus, Dysaphis crataegi, Earias perhuegeli, Epicauta vittata, Epilachna varivestis, Erionota thrax, Eriosoma lanigerum, Eriosomatinae, Euleia heraclei, Eumetopina flavipes, Eupoecilia ambiguella, European corn borer, Eurydema oleracea, Eurygaster integriceps, Ferrisia virgata, Forest bug, Frankliniella tritici, Galleria mellonella, Garden Dart, Geoica lucifuga, Glassy-winged sharpshooter, Great French Wine Blight, Greenhouse whitefly, Greenidea artocarpi, Greenidea formosana, Greenideoida ceyloniae, Gryllotalpa orientalis, Gypsy moths in the United States, Helicoverpa armigera, Helicoverpa gelotopoeon, Helicoverpa punctigera, Helicoverpa zea, Heliothis virescens, Henosepilachna vigintioctopunctata, Hessian fly, Hyalopterus pruni, Hysteroneura setariae, Ipuka dispersum, Jacobiasca formosana, Japanese beetle, Kaltenbachiella elsholtriae, Kaltenbachiella japonica, Khapra beetle, Knulliana, Lampides boeticus, Leaf miner, Leek moth, Lepidiota consobrina, Lepidosaphes beckii, Lepidosaphes ulmi, Leptocybe, Leptoglossus zonatus, Leptopterna dolabrata, Lesser wax moth, Leucoptera (moth), Leucoptera caffeina, Light brown apple moth, Light brown apple moth controversy, Lipaphis erysimi, Lissothoptrus oryzophilus, Long-tailed skipper, Lygus, Lygus hesperus, Maconellicoccus hirsutus, Macrodactylus subspinosus, Macrosiphoniella pseudoartemisiae, Macrosiphoniella sanborni, Macrosiphum euphorbiae, Maize weevil, Manduca sexta, Matsumuraja capitophoroides, Mayetiola hordei, Mealybug, Megacopta cribraria, Melanaphis sacchari, Micromyzus judenkoi, Micromyzus kalimpongensis, Micromyzus niger, Moth, Myzus ascalonicus Myzus boehmeriae, Myzus cerasi, Myzus obtusirostris, Myzus omatus, Myzus persicae, Neomyzus circumflexus, Neotoxoptera oliveri, Nezara viridula, Nomadacris succincta, Oak processionary, Oebalus pugnax, Olive fruit fly, Ophiomyia simplex, Opisina arenosella, Opomyza, Opomyza florum, Opomyzidae, Oscinella frit, Ostrinia furnacalis, Oxycarenus hyalinipennis, Papilio demodocus, Paracoccus marginatus, Paralobesia viteana, Paratachardina pseudolobata, Pentalonia nigronervosa, Pentatomoidea, Phorodon humuli, Phthorimaea operculella, Phyllophaga, Phylloxeridae, Phylloxeroidea, Pieris brassicae, Pink bollworm, Planococcus citri, Platynota idaeusalis, Plum curculio, Prionus californicus, Pseudococcus maritimus, Pseudococcus viburni, Pseudoregma bambucicola, Pyralis farinalis, Red imported fire ant, Red locust, Rhagoletis cerasi, Rhagoletis indifferens, Rhagoletis mendax, Rhodobium porosum, Rhopalosiphoninus latysiphon, Rhopalosiphum maidis, Rhopalosiphum padi, Rhopalosiphum rufiabdominale, Rhyacionia frustrana, Rhynchophorus ferrugineus, Rhynchophorus palmarum, Rhyzopertha, Rice moth, Russian wheat aphid, San Jose scale, Scale insect, Schistocerca americana, Schizaphis graminum, Schizaphis hypersiphonata, Schizaphis minuta, Schizaphis rotundiventris, Schoutedenia lutea, Sciaridae, Scirtothrips dorsalis, Scutelleridae, Scutiphora pedicellata, Serpentine leaf miner, Setaceous Hebrew character, Shivaphis celti, Silver Y, Silverleaf whitefly, Sinomegoura citricola, Sipha nava, Sitobion avenae, Sitobion lambersi, Sitobion leelamaniae, Sitobion miscanthi, Sitobion pauliani, Sitobion phyllanthi, Sitobion wikstroemiae, Small hive beetle, Southwestern corn borer, Soybean aphid, Spodoptera cilium, Spodoptera litura, Spotted cucumber beetle, Squash vine borer, Stemborer, Stenotus binotatus, Strauzia longipennis, Striped flea beetle, Sunn pest, Sweetpotato bug, Synanthedon exitiosa, Tarnished plant bug, Tetraneura nigriabdominalis, Tetraneura yezoensis, Thrips, Thrips angusticeps, Thrips palmi, Tinocallis kahawaluokalani, Toxoptera aurantii, Toxoptera citricida, Toxoptera odinae, Trioza erytreae, Turnip moth, Tuta absoluta, Uroleucon minutum, Varied carpet beetle, Vesiculaphis caricis, Virachola isocrates, Waxworm, Western corn rootworm, Western flower thrips, Wheat fly, Wheat weevil, Whitefly, Winter moth, Xylotrechus quadripes, and any combination thereof.
[0097] Agriculture pest mites include, but are not limited to, Abacarus hystrix, Abacarus sacchari, Acarapis woodi, Aceria guerreronis, Aceria tosichella, Brevipalpus phoenicis, Dermanyssus gallinae, Eriophyes padi, Eriophyidae, Flour mite, Oligonychus sacchari, Panonychus ulmi, Polyphagotarsonemus latus, Redberry mite, Steneotarsonemus spinki, Tetranychus urticae, Tuckerella, Varroa destructor, Varroa jacobsoni, Varroa sensitive hygiene, and any combination thereof.
[0098] Agriculture pest nematodes include, but are not limited to, Achlysiella williamsi, Anguina (nematode), Anguina agrostis, Anguina amsinckiae, Anguina australis, Anguina balsamophila, Anguina funesta, Anguina graminis, Anguina spermophaga, Anguina tritici, Aphelenchoides, Aphelenchoides arachidis, Aphelenchoides besseyi, Aphelenchoides fragariae, Aphelenchoides parietinus, Aphelenchoides ritzemabosi, Aphelenchoides subtenuis, Belonolaimus, Belonolaimus gracilis, Belonolaimus longicaudatus, Cereal cyst nematode, Coffee root-knot nematode, Ditylenchus, Ditylenchus africanus, Ditylenchus angustus, Ditylenchits destructor, Ditylenchus dipsaci, Dolichodorus heterocephalus, Fig Pin Nematode, Foliar nematode, Globodera pallida, Globodera rostochiensis, Globodera tabacum, Helicotylenchus dihystera, Hemicriconemoides kanayaensis, Hemicriconemoides mangiferae, Hemicycliophora arenaria, Heterodera avenae, Heterodera cajani, Heterodera carotae, Heterodera ciceri, Hoplolaimus galeatus, Hoplolaimus indicus, Hoplolaimus magnistylus, Hoplolaimus seinhorsti, Hoplolaimus uniformis, Longidorus africanus, Longidorus maximus, Longidorus sylphus, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne artiellia, Meloidogyne brevicauda, Meloidogyne chitwoodi, Meloidogyne enterolobii, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne naasi, Meloidogyne partityla, Meloidogyne thamesi, Merlinius brevidens, Mesocriconema xenoplax, Nacobbus aberrans, Northern root-knot nematode, Paralongidorus maximus, Paratrichodorus minor, Paratylenchus curvitatus, Paratylenchus elachistus, Paratylenchus macrophallus, Paratylenchus microdorus, Paratylenchus projectus, Paratylenchus tenuicaudatus, Potato cyst nematode, Pratylenehus alleni, Quinisulcius acutus, Quinisulcius capitatus, Radopholus similis, Soybean cyst nematode, Tylenchorhynchus, Tylenchorhynchus brevilineatus, Tylenchorhynchus claytoni, Tylenchorhynchus dubius, Tylenchorhynchus maximus, Tylenchorhynchus nudes, Tylencharhynchus phaseoli, Tylenchorhynchus vulgaris, Tylenchorhynchus zeae, Tylenchulus semipenetrans, Xiphinema, Xiphinema americanum, Xiphinema bakeri, Xiphinema brevicolle, Xiphinema diversicaudatum, Xiphinema insigne, Xiphinema rivesi, Xiphinema Vuittenezi, and any combination thereof.
[0099] Grape pests include, but are not limited to, Ampeloglypter ater, Ampeloglypter sesostris, Eriophyes vitis, Eupoecilia ambiguella, Fig Pin Nematode, Great French Wine Blight, Japanese beetle, List of Lepidoptera that feed on grapevines, Maconellicoccus hirsutus, Mesocriconema xenoplax, Otiorhynchus cribricollis, Paralobesia viteana, Paratrichodorus minor, Phylloxera, Pseudococcus maritimus, Pseudococcus viburni, Tetranychus urticae, Xiphinema index, Zenophassus, and any combination thereof.
[0100] Pest molluscs include, but are not limited to, Cornu aspersum, Deroceras, Grove snail, Limax, Milax gagates, Theba pisana, and any combination thereof.
[0101] Strawberry pests include, but are not limited to, Anthonomus rubi, Anthonomus signatus, Aphelenchoides fragariae, Otiorhynchus ovatus, Pratylenchus coffeae, Xiphinema diversicaudatum, and any combination thereof.
[0102] Western honey bee pests include, but are not limited to, Acarapis woodi, American foulbrood, Braula, Deformed wing virus, List of diseases of the honey bee, Nosema apis, Small hive beetle, Varroa destructor, Waxworm, and any combination thereof.
[0103] Insect pests of ornamental plants include, but are not limited to, Acieris variegana, Acyrthosiphon pisum, Alsophila aescularia, Aphid, Bird-cherry ermine, Coccus hesperidan, Coccus viridis, Contarinia quinquenotata, Grapeleaf skeletonizer, Gypsy moths in the United States, Japanese beetle, Macrodactylus subspinosus, Mealybug, Mullein moth, Orchidophilus, Otiorhynchus sulcatus, Paratachardina pseudolobata, Paysandisia archon, Sawfly, Scale insect, Scarlet lily beetle, Sciaridae, Spodoptera cilium, Stephanitis takeyai, Tenthredo scrophulariae, Yponomeuta malinellus, Yponomeuta padella, and any combination thereof.
[0104] Insect vectors of plant pathogens include, but are not limited to, Acyrthosiphon pisum, Agromyzidae, Authomyiidae, Aphid, Bark beetle, Beet leafhopper, Brevicoryne brassicae, Cacopsylla melanoneura, Chaetosiphon fragaefolii, Cicadulina, Cicadulina mbila, Common brown leafhopper, Cryptococcus fagisuga, Curculionidae, Diabrotica balteata, Empoasca decedens, Eumetopina flavipes, Euscelis plebejus, Frankliniella tritici, Glassy-winged sharpshooter, Haplaxius crudus, Hyalesthes obsoletus, Hylastes ater, Jumping plant louse, Leaf beetle, Leafhopper, Macrosteles quadrilineatus, Mealybug, Melon fly, Molytinae, Pegomya hyoscyami, Pissodes, Pissodes strobi, Pissodini, Planthopper, Pseudococcus maritimus, Pseudococcus viburni, Psylla pyri, Rhabdophaga rosaria, Rhynchophorus palmarum, Scaphoideus titanus, Scirtothrips dorsalis, Silverleaf whitefly, Tephritidae, Thripidae, Thrips palmi, Tomicus piniperda, Toxoptera citricida, Treehopper, Triozidae, Western flower thrips, Xyleborus glabratus, and any combination thereof.
[0105] Plant pathogenic nematodes include, but are not limited to, Helicotylenchus, Heterodera, Heterodera amygdali, Heterodera arenaria, Heterodera aucklandica, Heterodera bergeniae, Heterodera hi fenestra, Heterodera cacti, Heterodera canadensis, Heterodera cardiolata, Heterodera cruciferae, Heterodera delvii, Heterodera elachista, Heterodera filipjevi, Heterodera gambiensis, Heterodera goettinuiana, Heterodera hordecalis, Heterodera humuli, Heterodera latipons Heterodera medicaginis, Heterodera oryzae, Heterodera oryzicola, Heterodera rosii, Heterodera sacchari, Heterodera schachtii, Heterodera tabacum, Heterodera trifolii, Heteroderidae, Hirschmanniella oryzae, Hoplolaimidae, Hoplolaijus columbus, Hoplolaimus pararobustus, Meloidogyne fruglia, Meloidogyne gajuscus, Nacobbus dorsalis, Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus crenatus, Pratylenchus dulscus, Pratylenchus fallax, Pratylenchus flakkensis, Pratylenchus goodeyi, Pratylenchus hexincisus, Pratylenchus loosi, Pratylenchus minutus, Pratylenchus mulchandi, Pratylenchus musicola, Pratylenchus neglectus, Pratylenchus penetrans, Pratylenchus pratensis, Pratylenchus reniformia, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, Pratylenchus zeae, Punctodera chalcoensis, Root gall nematode, Root invasion (parasitic), Root-knot nematode, Rotylenchulus, Rotylenchulus parvus, Rotylenchulus reniformis, Rotylenchus brachyurus, Rotylenchus robustus, Scutellonema brachyurum, Scutellonema cavenessi, Subanguina radicicola, Subanguina wevelli, and any combination thereof.
[0106] Invasive species include, but are not limited to, Acacia mearnsii, Achatina fulica, Acridotheres tristis, Aedes albopictus, Anopheles quadrimaculatus, Anoplolepis gracilipes, Anoplophora glabripennis, Aphanomyces astaci, Ardisia elliptica, Arundo donax, Asterias amurensis, Banana bunchy top virus (BBTV), Batrachochytrium dendrobatidis, Bemisia tabaci, Boiga irregularis, Bufo marinas=Rhinella marina, Capra hircus, Carcinus maenas, Caulerpa taxifolia, Cecropia peltata, Cercopagis pengoi, Cervus elaphus, Chromolaena odorata, Cinara cupressi, Cinchona pubescens, Clarias batrachus, Clidemia hirta, Coptotermes formosanus, Corbula amurensis, Cryphonectria parasitica, Cyprinus carpio, Dreissena polymorpha, Eichhornia crassipes, Eleutherodactylus coqui, Eriocheir sinensis, Euglandina rosea, Euphorbia esula, Fallopia japonica=Polygonum cuspidatum, Felis catus, Gambusia affinis, Hedychium gardnerianum, Herpestes javanicus, Hiptage benghalensis, Imperata cylindrica, Lantana camara, Lates niloticus, Leucaena leucocephala, Ligustrum robustum, Linepithema humile, Lymantria dispar, Lythrum salicaria, Macaca fascicularis, Melaleuca quinquenervia, Miconia calvescens, Micropterus salmoides, Mikania micrantha, Mimosa pigra, Mnemiopsis leidyi, Mus musculus, Mustela erminea, Myocastor coypus, Morella faya, Mytilus galloprovincialis, Oncorhynchus mykiss, Ophiostoma ulmi sensu lato, Opuntia stricta, Oreochromis mossambicus, Oryctolagus cuniculus, Pheidole megacephala, Phytophthora cinnamomi, Pinus pinaster, Plasmodium relictum, Platydemus manokwari, Pomacea canaliculata, Prosopis glandulosa, Psidium cattleianum, Pueraria montana var. lobata, Pycnonotus cafer, Rana catesbeiana, Rattus rattus, Rubus ellipticus, Salmo trutta, Salvinia molesta, Schinus terebinthifolius, Sciurus carolinensis, Solenopsis invicta, Spartina anglica, Spathodea campanulata, Sphagneticola trilobata, Sturnus vulgaris, Sus scrofa, Tamarix ramosissima, Trachemys scripta elegans, Trichosurus vulpecula, Trogoderma granarium, Ulex europaeus, Undaria pinnatifida, Vespula vulgaris, Vulpes vulpes, Wasmannia auropunctata, and any combination thereof.
[0107] Similar methods may be used to generate libraries of model organisms; generate specific strains, breeds, or mutants of a model organism; for one-step mutagenesis schemes to generate scoreable recessive mutant phenotypes in a single generation; facilitate basic genetic manipulations in diverse experimental and agricultural organisms (e.g., accelerating the generation of combinatorial mutants and facilitating mutagenesis in polyploid organisms); accelerate genetic manipulations in animals (e.g., primates) or plants (e.g., trees) with a long generation time; and for gene therapy.
[0108] Model organisms include, but are not limited to, viruses, prokaryotes, eukaryates, protists, fungi, plants, invertebrate animals, vertebrate animals, and any combination thereof. A model organism may include, but is not limited to, a mammal, human, non-human mammal, a domesticated animal (e.g., laboratory animals, household pets, or livestock), non-domesticated animal (e.g., wildlife), dog, cat, rodent, mouse, hamster, cow, bird, chicken, fish, pig, horse, goat, sheep, rabbit, and any combination thereof.
[0109] Virus model organisms include, but are not limited to, Phage lambda; Phi X 174; SV40; T4 phage; Tobacco mosaic virus; Herpes simplex virus; and any combination thereof.
[0110] Prokaryotic model organisms include, but are not limited to, Escherichia coli; Bacillus subtilis; Caulobacter crescentus; Mycoplasma genitalium; Aliivibrio fischeri; Synechocystis; Pseudomonas fluorescens; and any combination thereof.
[0111] Protist model organisms include, but are not limited to, Chlamydomonas reinhardtii; Dictyostelium discoideum; Tetrahymena thermophila; Emiliania huxleyi; Thalassiosira pseudonana; and any combination thereof.
[0112] Fungal model organisms include, but are not limited to, Ashbya gossypii; Aspergillus nidulans; Coprinus cinereus; Cryptococcus neoformans; Cunninghamella elegans; Neurospora crassa; Saccharomyces cerevisiae; Schizophyllum commune; Schizosaccharomyces pombe; Ustilago maydis; and any combination thereof.
[0113] Plant model organisms include, but are not limited to, Arabidopsis thaliana; Boechera; Selaginella moellendorffii; Brachypodium distachyon; Setaria viridis; Lotus japonicus; Lemna gibba; Maize (Zea mays L.); Medicago truncatula; Mimulus guttatus; Nicotiana benthamiana; Nicotiana tabacum; Rice (Oryza sativa); Physcomitrella patens; Marchantia polymorpha; Populus; and any combination thereof.
[0114] Invertebrate animal model organisms include, but are not limited to, Amphimedon queenslandica; Arbacia punctulata; Aplysia; Branchiostoma floridae; Caenorhabditis elegans; Caledia captiva (Orthoptera); Callosobruchus maculatus; Chorthippus parallelus; Ciona intestinalis; Daphnia spp.; Coelopidae; Diopsidae; Drosophila (e.g., Drosophila melanogaster); Euprymna scolopes; Galleria mellonella; Gryllus bimaculatus; Hydra; Loligo pealei; Macrostomum lignano; Mnemiopsis leidyi; Nematostella vectensis; Oikopleura dioica; Oscarella carmela; Parhyale hawaiensis; Platynereis dumerilii; Podisma spp.; Pristionchus pacificus; Scathophaga stercoraria; Schmidtea mediterranea; Stomatogastric ganglion; Strongylocentrotus purpuratus; Symsagittifera roscoffensis; Tribolium castaneum; Trichoplax adhaerens; Tubifex tubifex; and any combination thereof.
[0115] Vertebrate animal model organisms include, but are not limited to, Laboratory mice; Bombina bombing, Bombina variegata; Cat (Felis sylvestris catus); Chicken (Gallus gallus domesticus); Cotton rat (Sigmodon hispidus); Dog (Canis lupus familiaris); Golden hamster (Mesocricetus auratus); Guinea pig (Cavia porcellus); Little brown bat (Myotis lucifugus); Medaka (Oryzias latipes, or Japanese ricefish); Mouse (Mus musculus); Poecilia reticulata; Rat (Rattus norvegicus); Rhesus macaque (or Rhesus monkey) (Macaca mulatta); Sea lamprey (Petromyzon murinus); Takifugu (Takifugu rubripes); Xenopus tropicalis; Xenopus laevis; Zebra finch (Taeniopygia guttata); Zebrafish (Danio rerio); African Killifish (Nothobranchius furzeri); Human (Homo sapiens); and any combination thereof.
EXAMPLES
Results
Allele-Specific Cas9-Dependent Cleavage
[0116] The X-linked Drosophila Notch (N) locus is particularly well suited for testing the allelic-drive of this invention since both loss- and gain-of-function dominant alleles of this locus have been characterized. Loss-of-function N.sup.− mutations, which are non-viable when homozygous in females (or hemizygous in males), produce dominant wing margin notching and thickened veins phenotypes in heterozygous females (
[0117] Specifically,
[0118] One previously identified N.sup.Ax16 allele (Ax16) eliminates a PAM site present on the wild-type allele (
[0119] Specifically,
[0120] A gRNA (gRNA-N+) anchored by this PAM site was designed to direct cleavage of the wild-type N.sup.+ allele, but not the N.sup.Ax16 allele (
[0121] Whether the y.sup.<ccN> allele would efficiently copy itself, as well as the neighboring uncleavable N.sup.Ax16 allele, onto a wild-type (y.sup.+ N.sup.+) X-chromosome (
[0122] Transmission percentages for the y.sup.<ccN> (DsRed+) and dominant N.sup.Ax16 alleles in F2 ♂ revealed highly biased inheritance of both alleles wherein 85.3% of these progeny were DsRed+ and yet a higher percentage (93.6%) were N.sup.Ax16 (
[0123] Specifically,
[0124] Super-Mendelian inheritance of the DsRed marked y.sup.<ccN> element in F2 ♀ progeny (72.4%) was observed. However, Notch-related phenotypes can not be scored with certainty due to a high degree of mosaicism in which wings often displayed a mixture of wild-type, gain-, and loss-of-function phenotypes (
[0125] Specifically,
[0126] In order to circumvent this difficulty in scoring Notch phenotypes in F2 ♀, 104 individual lines derived from single F2 females (selected for absence of the Cas9-GFP transgene) were established, thus permitting unambiguous scoring of N phenotypes in subsequent generations (
[0127] An important feature of the analysis of gRNA-induced events in the individual F2 ♀ lines was the ability to assign specific copying or non-copying events at the Notch locus to donor versus receiver chromosomes. In order to achieve the same end while analyzing larger numbers of progeny, the donor chromosome was marked with the tightly linked white-apricot (w.sup.3) allele (0.5 centimorgans from Notch,
[0128] Specifically,
[0129] Compiled results from ˜20 such crosses conducted in parallel (
[0130] Specifically,
[0131] The relative proportions of receiver versus donor chromosomes in F2 progeny of F1 master females were examined and a ˜2-fold overabundance of donor chromosomes in males and a more modest, but highly statistically significant (p<0.0001 unpaired parametric t-test analysis), parallel bias in females (
[0132] Specifically,
[0133] One explanation for the pronounced Cas9-induced reciprocal inheritance bias of the N.sup.Ax16 donor allele, is that a fraction of gRNA-N+ induced cleavage events at the Notch locus on the receiver chromosome may result in NHEJ-induced N.sup.− loss-of-function alleles. In males, such alleles would be hemizygous lethal resulting in strong embryonic neurogenic phenotypes causing much of the ventral epidermis to differentiate inappropriately as nervous system.sup.14. To test this, embryos from F1 master females (y.sup.>ccN> N.sup.AX16/++; Cas9/+ ♀) were collected and crossed to wild-type ♂. An abundant class of mutants (˜20%) with strong neurogenic phenotypes (
Dominant Elimination of Lethal NHEJ Alleles
[0134] While the above results provide strong evidence for Cas9-dependent generation of N.sup.− alleles in the progeny of F1 master females, they do not readily account for the failure to recover any heterozygous N.sup.− alleles among the isogenic F2 ♀ lines. One possibility is that if F2 ♀ progeny derived from F1 master females inherit a N.sup.− allele from their mothers, the “wild-type” paternal allele might be acted on in a mosaic fashion by maternally perduring Cas9-gRNA complexes.sup.3,5,12,13. Such a maternal effect could result in a large enough proportion of somatic cells having two mutant copies of the Notch gene to preclude viability in trans-heterozygotes. This hypothetical mechanism, hereinafter referred to as lethal mosaicism, is consistent with the high frequency of mosaic wing phenotypes in F2 ♀ females as observed in this invention (
[0135] Another avenue for testing the lethal mosaicism hypothesis was provided by sequencing single F2 ♀ lines that inherited phenotypically wild-type N.sup.+ alleles (
[0136] Specifically,
[0137] An additional prediction of the lethal-mosaic hypothesis is that progeny inheriting the ccN drive element and any NHEJ-induced N.sup.− allele from their mothers should be inviable if they also carried a zygotic source of vasa-Cas9. This was tested by establishing three different lines in which NHEJ induced N.sup.− alleles (N.sup.−17, N.sup.−20, and N.sup.−21—
[0138] As a yet more stringent test of the lethal mosaic hypothesis, both males and females carrying the ccN element combined with a wild-type cleavage sensitive N.sup.+ allele (N.sup.+S) were separately crossed to flies carrying the vasa-Cas9 transgene. Again, no surviving F1 progeny inherited the y.sup.<ccN> allele (
[0139] Specifically,
[0140] Lethal mosaicism is a highly potent process that eliminates all progeny carrying the y.sup.<ccN> allele, a hemizygous or homozygous cleavage-sensitive Notch allele, and a vasa-Cas9 source (either maternally or paternally provided). Moreover, progeny maintaining an association between the y.sup.<ccN> and N.sup.Ax alleles (or the very rarely generated N.sup.+IS cleavage insensitive alleles) can survive in the presence of Cas9.
[0141] The observation of pervasive somatic and lethal mosaicism in crosses of F1 master females to wild-type males raised the possibility that maternally inherited Cas9-gRNA complexes in F2 ♀ might also persist and act in the germline to generate some degree of gene-drive or allelic-drive in the F3 generation, even in animals that did not inherit the Cas9 transgene. This was tested by crossing F2 y.sup.<ccN> N.sup.Ax16/++; +/+ (non-Cas9) ♀ to N.sup.+IS ♂ (
[0142] Specifically,
[0143] F3 progeny from this cross did indeed manifest a substantial degree of perduring germline Cas9/gRNA activity as indicated by several measures, including: 1) copying of the DsRed-labeled y.sup.<ccN> element onto the y+ N+ receiver chromosome (29.3% and 31.8% conversion of the receiver chromosome in males and females, respectively), 2) copying of the N.sup.Ax16 allele (27% conversion of the receiver chromosome in males), 3) recovery of N.sup.−/N.sup.+ ♀ (12%), and 4) Cas9-dependent depletion of receiver chromosomes in males (40.8% compared to 51.1% in control animals). Each of these measures of residual drive observed in the F3 generation (
Co-Transmission of a Protected Allele and Drive Element
[0144] One surprise emerging from analysis of the copying efficiency of the y.sup.<ccN> CopyCat element versus the N.sup.Ax16 allele, which was also a striking trend in the 104 single female lines (
[0145] Specifically,
[0146] Finally, the impact of cis- versus trans-configurations for the y.sup.<ccN> and N.sup.Ax16 alleles was examined by generating master females of the genotype y.sup.<ccN> N.sup.+S/y.sup.+ N.sup.Ax16; Cas9/+ (
[0147] Specifically,
[0148] While copying of the Ax16 allele from the donor to the receiver chromosome was the overwhelmingly prevalent event in the above allelic drive experiments, rare in-frame NHEJ-induced indels induced at the gRNA-N+ cut-site that generated de-novo Abruptex alleles were also identified (
[0149] Copy grafting: is a broadly applicable allelic drive strategy. The experiments described above demonstrate highly efficient allelic-drive of the N.sup.Ax16 allele via copy-cutting mechanism, exceeding by nearly a third that observed for the y.sup.<ccN> gene-drive CopyCat element. While these results are encouraging, the obvious limitation of such a strategy lies in the requirement for a gRNA to selectively cut the targeted undesired allele. This constraint requires that the preferred allele either lacks a PAM site or differs from the targeted allele in core gRNA sequences (˜1-5 nucleotides from the PAM site), which would occur in only a fraction of cases (˜60% of single nucleotide polymorphisms if GG di-nucleotides occur at a frequency of 1/16 and are randomly distributed). A more general allelic-drive method was also developed in this invention by making use of the fact that homology directed repair (HDR) is often accompanied by local gene conversion events spanning as much as several hundred nucleotides from the double stranded cleavage site.sup.15. This local repair phenomenon has been well documented in Drosophila.sup.16-18, and may reflect the range of 3′ resection during the DNA repair process.sup.16.
[0150] With the above motivating concept in mind, and the rich array of genetic variants available in Drosophila, as well as those generated in this study, a reverse-drive scenario wherein the wild-type N.sup.+IS allele should be preferentially inherited over a different cleavage-sensitive, Abruptex allele (AxE2) was conceived. The N.sup.AxE2 allele results from a C.fwdarw.T substitution located 21 bp upstream of the cleavage resistant N.sup.Ax16 G.fwdarw.A alteration (
[0151] Specifically,
[0152] If the y.sup.<ccN> CopyCat element were recombined with the wild-type N.sup.+IS cleavage insensitive allele, which carries a single nucleotide change (C.fwdarw.A) at the −4 position (
[0153] Results in
[0154] Specifically,
[0155]
[0156]
[0157] This invention has demonstrated the feasibility of two forms of allelic-drive: copy-cutting, which applies to cases in which a gRNA can be designed to selectively target a non-preferred allele; and copy-grafting, a more general strategy in which one associates a cleavage-resistant site in proximity to a favored allelic variant (
[0158] Specifically,
[0159] One important category of potential applications of this invention is the aggregation of multiple favored naturally occurring allelic variants in plants or animals. In plants, allelic drive schemes can facilitate combining favorable traits to improve crop yields and resistance to environmental stresses, particularly in polyploid species (e.g., wheat or rye). Similarly in animal models, active genetics can accelerate the construction of complex genotypes in model organisms for biomedical and basic research. For example, one can envision crossing individual plants or animals bearing a favored allele to a strain carrying a Mendelian cassette with Cas9 and a gRNA that target the corresponding non-preferred alleles. The Cas9 bearing progeny also inheriting the first favored allele can then be crossed to a strain carrying the second favored allele and a guide RNA targeting the second unwanted allele, and so on until all favored alleles are gathered into a single strain. Finally, one can perform a final cross to segregate out the Cas9-gRNA cassettes. In polyploid crops such a strategy should permit assembly of several preferred alleles providing drought resistance.sup.23, higher yields.sup.24, optimal architectures.sup.25, or more rapid growth.sup.26 that would be long, difficult or impossible to assemble into a single strain by standard genetic crossing schemes.
[0160] Another important class of allelic-drive applications of this invention is to reverse pesticide resistance in pest species. Use of insecticides has repeatedly led to the emergence of specific insecticide-resistant alleles in insect disease vectors and crop pests. Many pesticides target essential components of the nervous system such as the Na.sup.+ channel or glutamate receptor.sup.27. Allelic drive systems can help revert these populations back to their wild-type sensitive state, which would be aided by the reduced fitness of certain prominent insecticide resistant alleles in the absence of pesticide use.sup.28-30. Even modest reductions in the incidence of resistant alleles (e.g., to prevalence of <50%) can have major positive impacts on disease reduction strategies.sup.31,32. Similarly, allelic drives can be used to favor genetic variants that prevent host species from serving as disease vectors or pests.
[0161] One potential concern in such allelic drive scenarios is whether NHEJ-induced cleavage resistant alleles can also be driven by the gRNA intended to drive the favored allele. This run-away NHEJ problem might arise if the primary drive cassette became separated from the preferred allele and instead became associated with an undesired NHEJ-induced allele. Several lines of evidence presented in this invention show that this scenario is unlikely so long as the gRNA sustaining allelic drive targets a critical region of an essential gene such as Notch (or the Na.sup.+ ion channel). Firstly, the strong co-drive greatly limits the number of events separating the favored allele from the drive element (only a few percent). Secondly, lethal mosaicism eliminated 100% of the progeny carrying three different NHEJ-induced N.sup.− alleles and also killed all offspring carrying the gene-drive element and unprotected wild-type alleles. Finally, allelic-drives work very effectively in-trans as well as in-cis, so that should an uncoupling event occur, it would be rapidly reversed in most instances. Thus, all non-functional NHEJ alleles will be eliminated immediately as they are generated, and drive of the favored allele will persist either in-cis or in-trans. The only remaining concern is whether one might not occasionally create a functional non-cleavable version of the undesired allele that can then also be driven. While this is possible (e.g., rare N.sup.+IS and novel Ax alleles were recovered), such events are very infrequent and should not drive any more efficiently than the overwhelmingly prevalent preferred allele. It is possible to further reduce the production of such rare events by using two gRNAs simultaneously, one directing copy-cutting and the other copy-grafting of the same preferred allele. Thus, it is practical to drive preferred alleles of essential genes efficiently into a population so long as they do not impart a significant fitness cost relative to the non-preferred allele.
[0162] Lethal mosaicism also has game-changing implications for developing new efficient gene-drive systems. A drive element targeting a critical site in a gene essential for viability or reproduction can also carry a functional recoded (and non-cleavable) portion of that same gene, thereby protecting progeny inheriting this element from lethal (or sterile) mosaicism. In contrast, non-functional NHEJ-induced mutations rendered dominant by lethal mosaicism are eliminated immediately, thereby “killing or sterilizing the mistakes” and providing a powerful solution to the frequently highlighted drive-resistance problem. These and other diverse applications of allelic-drive will greatly expand the impact of active genetics, accelerating progress in many areas of synthetic biology.
Methods:
Construction of ccN CopyCat Element
[0163] Cloning, of the ccN CopyCat plasmid followed the same strategy as described in Xu et al..sup.7 using homology arms to the yellow locus abutting gRNA-y1 cleavage site and carrying gRNA-y1, gRNA-N+, and a 3XP3-DsRed eye marker as depicted in
[0164] Specifically,
[0165] Following assembly of its components, the ccN CopyCat plasmid was transformed into ONE SHOT® TOP10 competent cells (Invitrogen #C4040) and purified using the Qiagen Plasmid Midi kit (#12191). An injection mix containing the ccN plasmid (final concentration: 250 ng/μl) was sent to Best Gene Inc. for injection into embryos collected from a w.sup.3 N.sup.Ax16 rb.sup.− stock (which is resistant to the otherwise lethal mutagenesis of the Notch locus generated by Cas9/gRNA-N+) with a transient source of pHsp70-Cas9 (Addgene plasmid #45945). The w.sup.3 N.sup.Ax16 rb.sup.− stock was kindly provided by Jim Posakony (UCSD). Male transformants carrying the ccN element were identified in F1 progeny by virtue of their yellow.sup.− and DsRed fluorescent eye-marker phenotypes. This genomic insertional allele is referred to as: y.sup.<CC|gRNA-y1, gRNA-N+|3XP3DsRed> in accordance with the previously established nomenclature convention.sup.6,7 (see
[0166] Genomic DNA preparation: Genomic DNA from single adult flies were prepared according to protocols by Gloor et al..sup.33 Single flies were crushed in lysis buffer (10 mM Tris pH8.2, 1 mM EDTA, 25 mM NaCl, with 0.3 mg/ml proteinase K, added right before incubation), incubated at 37° C. for 30 min, and heated at 95° C. for 2 min. 100 μl of ddH.sub.2O were added to each tube before storage at −20° C.
[0167] Drosophila genetics: Flies carrying the donor y.sup.<ccN> w.sup.3 N.sup.Ax16 chromosome were identifiable through the visible w.sup.3 orange eye phenotype. y.sup.<ccN> w.sup.2 N.sup.Ax16/FM7 females were crossed to Casty homozygous males (BL# 51324) to generate Fl master females as diagrammed in
[0168] Sequence analysis: To sequence mutations in the yellow locus, a ˜500 bp fragment was amplified by PCR (Q5 Hot Start High-Fidelity 2x Master Mix) with primers 417 (TTTAGTGCCTCAATAATAGTTTGGCCCTGC) and 356 (GGACATACCAAATATACCCTCC), then sequenced with primer 418 (GGAAGTTAATACCAGCGACATTGAAATCGC) at Genewiz. To identify donor vs receiver chromosomes, a fragment from Notch intron 5 was amplified with primers NintS3 (CTACGAGTGCAAGTGCCCCAAAG) and NintAS3 (CGCCCGGAACGTTGGAATGGAATG) and sequenced with NintS3bis (CAGTAGGAACCAGATTAATCGAGTT). For sequencing mutations in the the NAx region, primers NAxS (CCACGAGCAAAACAACGAGTACAC) and NAxAS2 (TTCGAATCACAATCCTGACCACTCAGC) were used to amplify a ˜1 Kb fragment, and sequenced using primer NAxS3 (GCATCAATGGCTACAACTGTAGC).
[0169] Active genetic safety measures: All crosses using active genetics were performed in accordance with an Institutional Biosafety Committee (IBC) approved protocol from UCSD in which full gene drive experiments are performed in a high security ACL2 barrier facility and split drive experiments are performed in an ACL1 insectary in plastic vials that are autoclaved prior to being discarded in accord with currently suggested guidelines for laboratory confinement of gene drive systems(.sup.34, 35).
[0170] Wing dissection and mounting: Drosophila wings were dissected in Isopropanol and mounted in 100% Canada balsam.
[0171] Antibody Staining of Drosophila embryos: Fixation and antibody staining of embryos using a rat anti-Elav (DSHB #7E8A10, antibody dilution=1/20) was performed according to standard procedures. Samples were mounted in Slowfade diamond anti-fade mountant (Thermo Fisher Scientific #S36963) and imaged on a Leica SP5 confocal microscope. Each data point in
TABLE-US-00001 TABLE 1 Complete DNA sequence of ccN CopyCat element. >pVG209_y1-Notch_in_y1-DSRED 2.dna (8907 bp) ACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGT TTCCCGACTGGAAAGCGGGCAGTGAGC GCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACAC TTTATGCTTCCGGCTCGTATGTTGTGT GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT ACGCCAAGCTATTTAGGTGACACTATAG AATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACG GCCGCCAGTGTGCTGGAATTCGCCCTT ctggagaactacattgcctgaattggcgggcaaataagtgcgacttggaggaggcggcgaggaagcccagctggtctgagg tttctgtggcaagacaggacgatattgtttcgtatataacggtggacccattggcaaaacggcttgttttggtattgaaa cggtatttggcggcccataggcgttattcctcaaatcacacacagtattctcaattaaagtggccaagggagccgtgtaa attcggaaattagtatctgaataatccaagtcagacagcaagaaaacgggcatcctatcggatagaacccaaacgttttt gttctcatcaattttcacatcggccggaaaaactaagccaacgtcatcgcgatccacaatgccatgaaattgcggtgagt acggcattgatgagtgccagcaacccacttgcattttgatctattaaattgaacagctcaattccatcatcgctcatcaca cgtgaagtggtatgggagtttggaccccgttcatctaaggcaacaaagtcatgatagctatcttccgtcctggtttcatc cctccaaaatcctcgtggatacggcaaattgtcgatgacttgctaacggactaaagtacagggtacgataaccatccgatc gaatgggcgaaagggacataccaaatataccctcctcgccccattggaagttaataccagcgacattgaaatcgccctc aatggatcggggaaaaaatacgaatgtgccgagaatctccaggacttgttcagttcccaggagtaagcaatcaagccgta tcccaattcatcggcaaaataggcatatgcatcatcgcaatttttgcctatatccacggcaatgttagctatgaaagtat ttggatttgtgtccacgccaggtagctcgtatctccgaattcgcgtatccgtggtcaagtcaaagacatttaccgcatag gggcacggattagtGGTGGTATTGCCGATGCCCACGGtcgacCGAGCTCGCCCGGGGATC TAATTCAATTAGAGACTAAT TCAATTAGAGCTAATTCAATTAGGATCCAAGCTTATCGATTTCGAACCCTCGA CCGCCGGAGTATAAATAGAGGCGCTTC GTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAG CTGAACAAGCTAAACAATCGGCTCGAAGCCGGTCGCCACCatgGCCTCCTCCGA GGACGTCATCAAGGAGTTCATGCGCT TCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGGAGATAGGG CGAGGGCGAGGGCCGCCCCTACGAGGGC ACCCAGACCGCCAACGTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTG GGACATCCTGTCCCCCCAGTTCCAGTA CGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAG CTGTCCTTCCCCGAGGGCTTCAAGTGGG AGCGCGTGATGAACTTCGAGGACGGCGGGTGGTGACCGTGACCCAGGACTC CTCCCTcCAGGACGGCTCCTTCATCTAC AAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAATGCAGAA GAAGACTATGGGCTGGGAGGCgTCCAC CGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCC CTGAAGCTGAAGGACCGGCGGCCACTACC TGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGC TACTACTACGTGGACTCCAAGCTGGAC ATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCCG AGGGCCGCCACCACCTGTTCCTGTAGgg ggcGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCT TTAAAAAACCTCCCACACCTCCCCC TGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCA GCTTATAATGGTTACaaataaaGCAAT AGCATCACAAATTTCACaaataaaGCATTTTTTTCACTGCATTCTAGTTGTGGTTTG TCCAAACTCATCAATGTATCtta AAGCTTATCGATACGCGTACgctagcACAAAAGCTGGAGCTCCTGCAGGTTGTTG GTTGGCACACCACAAATATACTGTT GCCGAGCACAATTGTCTAGAATGCATACGCATTAAGCGAACATTAAAAAGAT GTGAAAACATAACTATTATGTCTAAATA AACACACGTCAGATGTATGTACGTCAACGGAAAACCATTGTCTATATATTACA ATTACTAAATACATACCAAATTGAATA CATATTGATGAAAAATAATAAATACTGGCGAAAGCAAAAAAACGAAACATTT TTATTTTATTGAACAACTCTCAGGCTCC AGGTAGGCAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGAC TAGCCTTATTTTAACTTGCTATTTCTA GCTCTAAAACCGGTTCCAGTGTCCAAAACCGACGTTAAATTGAAAATAGGTCT ATATATACGAACTGAGTCTGGAAAAAG AAGTTGAGAATTATAAAAAGTAGTGAGCACTGGCGCCCTCTCTGCTTGGCGAG CTAACCTTTTCGCCTCTTGGCTGAGTA GGTGGCGTTTCATTCTACTCTGTAAAATTAATGTAGAATTGAAACACTATGGT CAAAAAATACTTAGGGGCATAAGTTAT AAAACGTATGAAATGAATTTTTATCAACCTGGGCTATTCAAAAATTTTCGAAT TATTTTATGTATTTTTTTTAATCGTTT TTCATTATAGGTTAAAATACACTTTAAAAGGAATTCTTTCCTGTAAAATAAAT ATAAATAAATATGCTTTATTGACAGAA AATTTGATGTTTTTGTATTTGAGTAGGAGCAATCACAGGTGAGCAAAAAAGCA CCGACTCGGTGCCACTTTTTCAAGTTG ATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACtgggagcagtag cacacatgcCGAAGTTCACCCG GATATCTTTCCTATATATACTGTACTCTTGCAGAATATGTACTTGGGAATCATA AGGATGCGAAGGACGTACGCGCTGTG TCTGTAACTAAGGGGTTGCTTTCGGGTACCTACCATGCCAATGATGGGACTAC CGCCGGATAGGAATCCCTTTTGGGTGC ACACCGTCACCTCCAGTTCCGTCTGCCTGAGTTCGGCAATGGAAATCAGGTAC TCAAAGGATGCATCGTAGACGGGGTTG CAGTTGTCCTTGATCACGCTCGTCTTGCGTTTGCACTCCTTGGTGCGTCCAGGC AACAGATACAGCTTAACATACGGATC GGGGATATTGCTGGGATCGCGAAGTGGTATCTTCTGGATTTTGTGTATGGTCA CGTCTAGTTTTTGACGCTGGGCGCTGT AGCGGATCGACAACTGCATTCGTCCAAGGCCATGTTCGCCFFFTGAGGAGGT GGAGTCTGGAAAGCGGTGGGTCAGCACA GAGGTGGCCAGCTCGCTGATGGGTTTTTCGCTGGAGGTGGAGGCCGACATGGC CGGGGAGATTTTCGTAGCCGCCACAGG ATCTTCTTCACTGATGGGCGATTCGGGCGGACAAACGCTTGCTGGATGCCTGAG ATTCCTAAAAGCAATGGCAAATTAGAT TCAATTAAAACAAAAATTGTTTATATAACAAAGTAAAAGAAAAAAAAAAAGA ATCACAGATTCTCCCCGACGGGGAATTG AACCCCGGTCTCCCGCGTGACAGGCGGGGATACTAACCACTATACTATCGAGG ACGTTGAAAATgacgtcttccagtgtc caaaacccacagccgaccacactcatccactttaatgcggtaggcagtggtaatactgttggcgcaatctccgctgtat ttgagcgccaatctggatacggaattagctccggtgaacccgtcaaactgcggtccatgtttatataggtcagagtggcc ggaatccctaaaaaataaaataggagaattagcagggccaaactattattgaggcactaaataaagtttgttttgaatat ttaattaactggaatttctgcctaaattccttctttggattattatactaagcaatgttgcaagttatcgctgtctgttt tctggataatagtaaatgcatacagattgtaaaggtaaattagaatcgcttatgtttggcatttaattatttatacct atttgtcattattttggacacaaggaatcataagcaatggtaactgccgtgctaatggctcttttttctgcttgtacatc tactggaagtttatgttaaaagatccccggctatatgtacttcagtcataattggcactattgcaagttgcgtgcaattt gcgatgtcattagccgtctgaagcaattgcgtctgacatcattatcaatatgtataccatatatcgctgttaaatgtata tgtggccattggcagtatttcgaccgatttccgctccagttcttttccttctttatttcttcgttaattgaatttaaaga catttattgtttctgggaacttttaatgtttttatagcaggcgagtgagactgcaacgaccagaaaatatagcttttatc gatttaccgacccatcttcttaaaaatcaaaccaggcgtttttgctttacaaagtaaccgggggttgcgataaatataca tttgagcataatgcacctttcaatctttatttaattcataacttttaaaataacaactaattcagtcaaatataaagta tttgaacaaatttatattttgacatgtgctctttcagtcctaaaacctcgcaacAAGGGCGAATTCTGCAGATATC CATC ACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTG AGTCGTATTACAATTCACTGGCCGTCG TTTTACAACGTCGTGACTGGGAAAAACCCTGGCGTTACCCAACTTAATCGCCTT GCAGCACATCCCCCTTTCGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCT GAATGGCGAATGGACGCGCCCTGTAGC GGCGCATTAAGCGCGGCGGGTGTGGTGGTTAGCCGCAGCGTGACCGCTACACT TGCCAGCGCCCTAGCGCCCGCTCCTTT GCGTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTA AATCGGGGGCTCCCTTTAGGGTTCC GATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGT TCACGTAGTGGGCCATCGCCCTGATAG ACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTG TTCCAAACTGGAACAACACTCAACCC TATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTG GTTAAAAAATGAGCTGATTTAACAAA AATTTAACGCGAATTTTAACAAAATTCAGGGCGCAAGGGCTGCTAAAGGAAG CGGAACACGTAGAAAGCCAGTCCGCAGA AACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGA AAACGCAAGCGCAAAGAGAAAGCAGGTA GCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGC AAGCGAACCGGAATTGCCAGCTGGGGC GCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGC CGCCAAGGATCTGATGGCGCAGGGGAT CAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGA TGGATTGCACGCAGGTTCTCCGGCCGCT TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTC TGATGCCGCCGTGTTCCGGCTGTCAGC GCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATG AACTGCAGGACGAGGCAGCGCGGCTAT CGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACT GAAGCGGGAAGGGACTGGCTGCTATTG GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCCCACCTTGCTCCTGCCGAGAA AGTATCCATCATGGCTGATGCAATGCG GCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAC ATCGCATCGAGCGAGCACGTACTCGGA TGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCT CGCGCCAGCCGAACTGTTCGCCAGGCTC AAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCT GCTTGCCGAATATCATGGTGGAAAATGG CCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATC AGGACATAGCGTTGGCTACCCGTGATA TTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGT ATCGCCGCTCCCGATTCGCAGCGCATC GCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTGAAAAAGGAAGAGTATG AGTATTCAACATTTCCGTGTCGCCCTT ATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGG TGAAAGTAAAAGATGCTGAAGATCA GTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCC TTGAGAGTTTTCGCCCCGAAGAACGTT TTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTA TTGACGCCGGGCAAGAGCAACTCGGT CGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGA AAAGCATCTTACGGATGGCATGACAGT AAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACGT TACTTCTGACAACGATCGGAGGAACCGA AGGAGCTAACCGCTTTTTTGCACAACATGGGGATCATGTAACTCGCCTTGAT CGTTGGGAACCGGAGCTGAATGAAGCC ATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGT TGCGCCAAACTATTAACTGGCGAACTACT TACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTG CAGGACCACTTCTGCGCTCGGCCCTTC CGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGC GGTATCATTGCAGCACTGGGGCCAGAT GGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTAT GGATGAACGAAATAGACAGATCGCTGA GATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCAT ATATAACTTTAGATTGATTTAAAACTTC ATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCA AAATCCCTTAACGTGAGTTTTCGTTC CACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTT TTTTCTGCGCGTAATCTGCTGCTTGCA AACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTAC CAACTCTTTTTCCGAAGGTAACTGGCT TCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGC CACCATTCAAGAACTCTGTAGCACCG CCTACATACCCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGAT AAGTCGTGTCTTACCGGGTTGGACTC AAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG TGCACACGCCCAGCTTGGAGCGAACGA CCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTT CCCGAAGGGAGAAAGGCGGACAGGTAT CCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGG GGAAACGCCTGGTATCTTTATAGTCCTGT CGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG GCGGAGCCTATGGAAAAACGCCAGCA ACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTT TCCTGCGTTATCCCCTGATTCTGTG GATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAAC GACCGAGCGCAGCGAGTCAGTGAGCGA GGAAGCGGAAGAGCGCCCAATACGCAA
TABLE-US-00002 TABLE 2 Phenotypic and molecular analysis of 104 isogenic F2 lines. Donor N+/ y+ NAx or Ax16 or region line # DsRed Receiver phenotype y− Sequence Category Comments A1 + D Ax y− DON A2 + D Ax y− DON A4 + R Ax y− Ax16 DCR A5 + R Ax y− Ax16 DCR A6 + R Ax y− Ax16 DCR A7 + D Ax y− DON A8 + D Ax y− DON A9 + D Ax y− DON A10 + D Ax y− DON A11 − R Ax y− 3 nt deletion ACR new Ax at cut site allele A12 + R Ax y− Ax16 DCR A13 + R N+ y− N+ RCR A14 + D Ax y− DON A15 + D Ax y− DON C25 + R Ax y− Ax16 DCR C26 + R Ax y− Ax16 DCR C27 + R Ax y− Ax16 DCR C28 − R N+ y− N+ INR C29 + D Ax y− DON D31 − R Ax y− Ax16 ACR D33 + R Ax y− Ax16 DCR D34 + D Ax y− DON D35 + D Ax y− DON D36 − R N+ y− N+ INR D37 − R N+ y− N+ INR D39 + D Ax y− DON E41 + D Ax y− DON E42 + R Ax y− Ax16 DCR E43 + D Ax y− DON E44 − D Ax y− DON recombination E45 − R Ax y− Ax16 ACR E47 + R Ax y− Ax16 DCR E48 − R Ax y− Ax16 ACR E49 + R Ax y− Ax16 DCR F50 + D Ax y− DON F51 − R Ax y− Ax16 ACR G52 − R N+ y− C to A sub, INR cut-resistant at position N+ allele −1 G53 − R N+ y− N+ INR G54 − R Ax y− Ax16 ACR H55 − R N+ y− N+ INR H56 + D Ax y− DON H57 + D Ax y− DON H58 + D Ax y− DON H59 − R Ax y− Ax16 ACR I60 − R Ax y− Ax16 ACR I61 + D Ax − DON I62 − R N+ y− N+ INR I63 + R Ax y− Ax16 DCR I64 + D Ax y− DON I65 + D Ax y− DON I66 + D Ax y− DON I67 + D Ax y− DON I68 + D Ax y− DON K69 + D Ax y− DON K70 − R N+ y− N+ INR K71 + D Ax y− DON K72 + D Ax y− DON K73 + D Ax y− DON K74 + D Ax y− DON K76 + R Ax y− Ax16 DCR K77 − R Ax y− Ax16 ACR K78 + D Ax y− DON K79 − R Ax y− Ax16 ACR K80 − D Ax y− DON recombination K81 + D Ax y− DON K82 − R Ax y− Ax16 ACR K83 − R Ax y− Ax16 ACR K84 + D Ax y− DON K85 + D Ax y− DON K87 + D Ax y− DON K88 + R Ax y− Ax16 DCR K89 + D Ax y− DON K90 + D Ax y− DON K91 + D Ax y− DON L92 + D Ax y− DON L93 + R Ax y− Ax16 DCR L94 + R Ax y− Ax16 DCR L95 + D Ax y− DON L96 + D Ax y− DON L97 + D Ax y− DON L98 + D Ax y− DON L99 + R Ax y− Ax16 DCR M100 − R Ax y− Ax16 ACR M101 − R N+ y− N+ IR M102 + R Ax y− Ax16 DCR M103 + R Ax y− 3 nt deletion DCR new Ax at cut site allele M104 − R N+ y− N+ IR M105 + D Ax y− DON M106 + D Ax y− DON M107 + D Ax y− DON M108 + D Ax y− DON M109 − R Ax y− Ax16 ACR M110 + R Ax y− Ax16 DCR M111 + R Ax y− Ax16 DCR M112 + R Ax y− Ax16 DCR M113 + D Ax y− DON M114 + D Ax y− DON M115 − R N+ y− N+ INR M117 + D Ax y− DON M118 + D Ax y− DON M119 − R N+ y− N+ INR M120 + R Ax y− Ax16 DCR M121 + D Ax y− DON M122 + D Ax y− DON
[0172] Table 2: Phenotypic, and molecular analysis of 104 isogenic F2 female lines. Column 1: line number. Column 2: Presence (+) or absence (−) of the DsRed-marked ccN CopyCat element. Column 3: origin of the founder chromosome (Donor: D, or Receiver: R), as determined by sequencing a polymorphic site located 6.5 Kb upstream of the Ax16 mutation (
TABLE-US-00003 TABLE 3 Summary of phenotypic analysis of 104 isogenic lines Categories Abbreviation #Lines Percentage Donor DON 54 51.92% Double Conversion DCR 23 22.11% Intact receiver INR 12 11.53% Ax only Conversion ACR 14 13.46% DsRed only Conversion RCR 1 0.96% Total 104 Categories Includes #Lines Percentage DsRed- ACR + INR 28 27% DsRed+ DON + DCR + RCR 76 75% N+ INR + RCR 13 12.50% NAx DON + ACR + DCR 91 87.50% DsRed Conversion DCR + RCR 24 48% NAx Conversion DCR + ACR 37 74%
[0173] Table 3: Summary of the different categories of molecular events determined on receiver versus donor chromosomes for the 104 isogenic lines and accompanying abbreviation key Table 2.
[0174] The embodiments of the invention disclosed herein are exemplary, and other embodiments and variations of the invention will be apparent to those skilled in the art and are intended to be encompassed herein.
REFERENCES
[0175] 1 DiCarlo, J. E., Chavez, A., Dietz, S. L., Esvelt, K. M. & Church, G. M. RNA-guided gene drives can efficiently bias inheritance in wild yeast, bioRxiv, doi:http://dx.doi.org/10.1101/013896 (2015). [0176] 2 Gantz, V. M. & Bier, E. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations. Science 348, 442-444, doi:science.aaa5945 [pii]10.1126/science.aaa5945 (2015). [0177] 3 Gantz, V. M. et al. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi, Proc Natl Acad Sci USA 112, E6736-6743, doi:1521077112 [pii] 10.1073/pnas.1521077112 (2015). [0178] 4 Grunwald, H. A. et al. Super-Mendelian inheritance mediated by CRISPR-Cas9 in the female mouse germline. Nature In Press (2019). [0179] 5 Hammond, A. et al. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae, Nat Biotechnol 34, 78-83, doi:10.1038/nbt.3439 (2016). [0180] 6 Gantz, V. M. & Bier, E. The dawn of active genetics. Bioessays 38, 50-63, doi:10.1002/bies.201500102 (2016). [0181] 7 Xu, X. S., Gantz, V. M., Siomava, N. & Bier, E. CRISPR-Cas9 and active genetics-based trans-species replacement of the endogenous Drosophila kni-L2 CRM reveals unexpected complexity. Elife 6, doi:10.7554/eLife.30281 (2017). [0182] 8 Housden, B. E. et al. Loss-of-function genetic tools for animal models: cross-species and cross-platform differences. Nat Rev Genet 18, 24-40, doi:10.1038/nrg.2016.118 (2017). [0183] 9 Komor, A. C., Badran, A. H. & Liu, D. R. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell 168, 20-36, doi:10.1016/j.cell.2016.10.044 (2017). [0184] 10 Paquet, D. et al. Efficient introduction of specific homozygous and heterozygous mutations using CRISPR-Cas9. Nature 533, 125-129, doi:10.1038/nature17664 (2016). [0185] 11 Kelley, M. R., Kidd, S., Deutsch, W. A. & Young, M. W. Mutations altering the structure of epidermal growth factor-like coding sequences at the Drosophila Notch locus. Cell 51, 539-548 (1987). [0186] 12 Lin, C. C. & Potter, C. J. Non-Mendelian Dominant Maternal Effects Caused by CRISPR-Cas9 Transgenic Components in Drosophila melanogaster. G3 (Bethesda), doi:10.1534/g3.116.034884 (2016). [0187] 13 Champer, J. et al. Novel CRISPR-Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations. PLoS Genet 13, e1006796, doi:10.1371/journal.pgen.1006796 (2017). [0188] 14 Lehmann, R., Dietrich, U., Jimenez, F. & Campos-Ortega, J. A. Mutations of early neurogenesis in Drosophila. Wilehm Roux Arch Dev Biol 190, 226-229, doi:10.1007/BF00848307 (1981). [0189] 15 Mehta, A. & Haber, J. E. Sources of DNA double-strand breaks and models of recombinational DNA repair. Cold Spring Harb Perspect Biol 6, a016428, doi:10.1101/cshperspect.a016428 (2014). [0190] 16 Joyce, E. F., Paul, A., Chen. K. E., Tanneti, N. & McKim, K. S. Multiple barriers to nonhomologous DNA end joining during meiosis in Drosophila. Genetics 191, 739-746, doi:10.1534/genetics.112.140996 (2012). [0191] 17 Wei, D. S. & Rong, Y. S. A genetic screen for DNA double-strand break repair mutations in Drosophila. Genetics 177, 63-77, doi:10.1534/genetics.107.077693 (2007). [0192] 18 Do, A. T., Brooks, J. T., Le Neveu, M. K. & LaRocque, J. R. Double-strand break repair assays determine pathway choice and structure of gene conversion events in Drosophila melanogaster. G3 (Bethesda) 4, 425-432, doi:10.1534/g3.113.010074 (2014). [0193] 19 Ewen-Campen, B. & Perrimon, N. ovo(D) Co-selection: A Method for Enriching CRISPR-Cas9-Edited Alleles in Drosophila. G3 (Bethesda) 8, 2749-2756, doi:10.1534/g3.118.200498 (2018). [0194] 20 Roth, T. L. et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 559, 405-409, doi:10.1038/s41586-018-0326-5 (2018). [0195] 21 Hu, J. H. et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 556, 57-63, doi:10.1038/nature26155 (2018). [0196] 22 Nishimasu, H. et al. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361, 1259-1262, doi:10.1126/science.aas9129 (2018). [0197] 23 Xiong, H. et al. Natural Variation in OsLG3 Increases Drought Tolerance in Rice by Inducing ROS Scavenging. Plant Physiol 178, 451-467, doi:10.1104/pp.17.01492 (2018). [0198] 24 Lemmon, Z. H. et al. Rapid improvement of domestication traits in an orphan crop by genome editing. Nat Plants 4, 766-770, doi:10.1038/s41477-018-0259-x (2018). [0199] 25 Dixon, L. E. et al. TEOSINTE BRANCHED1 Regulates Inflorescence Architecture and Development in Bread Wheat (Triticum aestivum), Plant Cell 30, 563-581, doi:10.1105/tpc.17.00961 (2018). [0200] 26 Wissuwa, M., Kretzschmar, T. & Rose, T. J. From promise to application: root traits for enhanced nutrient capture in rice breeding. J Exp Bol 67, 3605-3615, doi:10.1093/jxb/erw061 (2016). [0201] 27 Ffrench-Constant, R. H., Williamson, M. S., Davies, T. G. & Bass, C. Ion channels as insecticide targets. J Neurogenet 30, 163-177, doi:10.1080/01677063.2016.1229781 (2016). [0202] 28 Brito, L. P. et al. Assessing the effects of Aedes aegypti kdr imitations on pyrethroid resistance and its fitness cost. PLoS One 8, e60878, doi:10.1371/journal.pone.0060878 (2013). [0203] 29 Hanai, D., Hardstone Yoshimizu, M. & Scott, J. G. The insecticide Resistance Allele kdr-his has a Fitness Cost in the Absence of Insecticide Exposure. J Econ Entomol 111, 2992-2995, doi:10.1093/jee/toy300 (2018). [0204] 30 Platt, R. J. et al. CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell 159, 440-455, doi:S0092-8674(14)01163-5 [pii] 10.1016/j.cell.2014.09.014 (2014). [0205] 31 Churcher, T. S., Lissenden, N., Griffin, J. T., Worrall, E. & Ranson, H. The impact of pyrethroid resistance on the efficacy and effectiveness of bednets for malaria control in Africa. Elife 5, doi:10.7554/eLife.16090 (2016). [0206] 32 Glunt, K. D. et al. Empirical and theoretical investigation into the potential impacts of insecticide resistance on the effectiveness of insecticide-treated bed nets. Evol Appl 11, 431-441, doi:10.1111/eva.12574 (2018). [0207] 33 Gloor, G. B. et al. Type I repressors of P element mobility. Genetics 135, 81-95 (1993). [0208] 34 Akbari, O. S. et al. Safeguarding gene drive experiments in the laboratory. Science 349, 927-929, doi:science.aac7932 [pii] 10.1126/science.aac7932 (2015). [0209] 35 Org., C. G. D. R. i. N.-H., Conduct, R. f. R., Sciences, B. o. L., Studies, D. E. a. L. & Med., N. A. S. E. Gene Drives on the Horizon: Advancing Science, Navigating Uncertainty, and Aligning Research with Public Values. (THE NATIONAL ACADEMIES PRESS, Washington D.C., 2016). [0210] 36 Sturtevant, A. H., J. Animal Behavior 5, 351-366, 1915.