METHODS, USES & COMPOSITIONS

20220162270 · 2022-05-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the production of transduction particles, such as phage, as well as compositions comprising the particles and use of these. The particles are particularly useful for delivering toxic payloads into target bacteria for antibacterial action. The invention is also useful for the production of wild-type (“native”) phage and phage cocktails comprising different types of phage. Embodiments enable production of compositions of such particles for use in medical, environmental or food production settings.

    Claims

    1. A method of producing transduction particles wherein the particles are capable of recognising a receptor on bacterial target cells for transduction of the cells, the method comprising producing the particles in bacterial producer cells, wherein the producer cells do not express the receptor on their surface.

    2. The method of claim 1, wherein the producer and target cells are cell of the same species.

    3. The method of claim 1, wherein the producer cells are E coli cells.

    4. The method of claim 1, wherein the transduction particles comprise a phage capsid, wherein the capsid comprises a packaged nucleic acid of interest (NSI) for transduction into target bacterial cells.

    5. The method of claim 4, wherein the NSI comprises or encodes an antibacterial agent that kills target cells, or wherein the NSI comprises or encodes a component of such an agent.

    6. The method of claim 5, wherein the NSI comprises a nucleotide sequence encoding a guide RNA of a CRISPR/Cas system.

    7. The method of claim 1, wherein the transduction particles are phages.

    8. The method of claim 1, wherein the transduction particles are non-self-replicative.

    9. The method of claim 1, wherein the genome of each producer cell comprises a genetic modification that disrupts synthesis of the receptor and/or its expression as a cell surface receptor.

    10. The method of claim 9, wherein the modification is a modification of a lipopolysaccharide (LPS) synthesis pathway.

    11. The method of claim 1, wherein the receptor comprises a LPS.

    12. The method of claim 1, wherein the production yield of transduction particles is enhanced compared to production in producer cells that express the receptor on their surface.

    13. (canceled)

    14. The method of claim 12, wherein the yield is increased at least 10-fold compared to production in producer cells that surface express the receptor.

    15. The method of claim 14, wherein the increase is at least 100-fold.

    16. The method of claim 14, wherein the increase is 10-1000-fold.

    17. The method of claim 1, comprising isolating the transduction particles from cellular material.

    18. A composition comprising transduction particles obtained or obtainable by the method of claim 17.

    19. The composition according to claim 18, wherein the composition comprises no producer cell LPS.

    20. A method of killing bacterial target cells, the method comprising contacting the cells with the composition according to claim 18, wherein transduction particles infect the cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.

    21. A method of treating or preventing a disease or condition in a human or animal subject, wherein the disease or condition is mediated by bacterial target cells, the method comprising administering the composition of claim 18 to the subject and contacting the target cells with the composition, whereby target cells are killed or the growth or proliferation of target cells is inhibited, thereby treating or preventing the disease or condition.

    22. The method of claim 21, wherein transduction particles comprised by the composition infect the target cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.

    23. The method of claim 21, wherein the target cells are Escherichia, Klebsiella, Clostridium or Pseudomonas cells.

    24. The method of claim 21, wherein the target cells are E. coli, K. pneumoniae, C. dificile or P. aeruginosa cells.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0028] FIG. 1: The LPS core biosynthesis pathway of E. coli (www.ecocyc.org). Numbers indicate the sequence of synthesis. Genes involved in the pathway were individually knocked out and P2 phage propagation was tested on each mutant. Genes which are essential for P2 plaque formation are marked with a star.

    [0029] FIG. 2: Transduction of E. coli C1a cells by the lysates prepared from wild type (WT) and from phage receptor mutant (ΔrfaD) cells. (A) The yield of production was assayed by transduction of the spectinomycin marker to C1a cells. Lysates were serially diluted and mixed with a constant number of recipient cells. (B) Transduction efficiencies, defined as the number of Spectinomycin resistant colonies obtained per 1 ml of lysate, were calculated from 6 independent lysates for both strains. Error bars show standard deviations from the means.

    DETAILED DESCRIPTION

    [0030] The invention relates to the production of transduction particles, such as phage, as well as compositions comprising the particles and use of these. The particles are particularly useful for delivering toxic payloads into target bacteria for antibacterial action. The invention is also useful for the production of wild-type (“native”) phage and phage cocktails comprising different types of phage. Embodiments enable production of compositions of such particles for use in medical, environmental or food production settings. Transduction particles, eg, phage, can be used in compositions, such as medicaments, herbicides and other agents where such particles may usefully be used. Thus, the invention provides the following Clauses and embodiments.

    CLAUSES

    [0031] 1. A method of producing transduction particles wherein the particles are capable of recognising a receptor on bacterial target cells for transduction of the cells, the method comprising producing the particles in bacterial producer cells, wherein the producer cells do not express the receptor on their surface.

    [0032] The particles can be capable of attaching to the receptor when surface expressed on target cells. In an example, the particles attach to the receptor on target cells and transduce DNA into the target cells. In an embodiment, the DNA comprises a NSI. In an example, the particles are phage-like or are phage. For example, the particles comprise a phage capsid in which the DNA is packaged.

    [0033] In an example, the producer and target cells are bacterial cells. In another example, they are archaeal cells.

    [0034] The producer cells are different from the target cells. At least, they differ in that the former do not (or substantially do not) surface express the receptor and the latter do. [0035] 2. The method of Clause 1, wherein the producer and target cells are cell of the same species.

    [0036] Optionally, the producer and target cells are cell of the same strain, with the exception that the target cells surface express the receptor. [0037] 3. The method of any preceding Clause, wherein the producer cells are E coli cells.

    [0038] In an example the cells are E coli Nissle or K-12 (eg, K-12 MG1655) cells.

    [0039] In an example, each producer cell comprises a nucleic acid comprising a nucleic acid sequence of interest (NSI), a phage packaging sequence (eg, pac or cos or a homologue thereof) and an origin of replication. In an embodiment, nucleic acid is a phagemid of plasmid. The nucleic acid is packaged in the producer cell to produce the particles of the invention. In an embodiment, the producer cell comprises the genome of a helper virus or phage which is used to provide essential functions required for packaging and/or replicating the nucleic acid in the producer cell. The skilled person will be familiar with helper viruses and helper phage.

    [0040] In an example, each producer cell comprises (i) a helper phage genome; and (ii) a nucleic acid comprising a nucleic acid sequence of interest (NSI), a phage packaging sequence (eg, pac or cos), an origin of replication and optionally one or more nucleotide sequences each encoding a helper phage transactivation factor for activating the helper phage. In an embodiment, component (i) is comprised by the nucleic acid (ii). In an embodiment, nucleic acid (ii) is a phagemid of plasmid.

    [0041] In an embodiment, the NSI encodes a protein of interest (POI), eg, an enzyme, a nuclease, an antibiotic, an antigen binding site, a marker (eg, an antibiotic marker or fluorescence marker) or a medicament or component thereof. [0042] 4. The method of any preceding Clause, wherein the transduction particles comprise a phage capsid, wherein the capsid comprises a packaged nucleic acid of interest (NSI) for transduction into target bacterial cells.

    [0043] In an example, the NSI is comprised by a phagemid. In an example, the NSI is comprised by a plasmid. [0044] 5. The method of Clause 4, wherein the NSI comprises or encodes an antibacterial agent that kills target cells, or wherein the NSI comprises or encodes a component of such an agent. [0045] 6. The method of Clause 5, wherein the NSI comprises a nucleotide sequence encoding a guide RNA (optionally a single guide RNA) of a CRISPR/Cas system.

    [0046] Optionally, the guide comprises a spacer sequence that is capable of hybridising to a protospacer sequence comprised by target cells. In one embodiment, the target cells comprise endogenously active Cas (eg, Cas 3 or Cas9) that is operable with the guide RNA in the target cells to guide the Cas to the cognate protospacer sequence for modification (eg, cutting) of the sequence, and optionally killing of the target cell. In another embodiment, the Cas is instead or additionally encoded by DNA transduced into the target cell by the particle of the invention. [0047] 7. The method of any preceding Clause, wherein the transduction particles are phages. [0048] 8. The method of any preceding Clause, wherein the transduction particles are non-self-replicative. [0049] 9. The method of any preceding Clause, wherein the genome of each producer cell comprises a genetic modification that disrupts synthesis of the receptor and/or its expression as a cell surface receptor.

    [0050] In an example, each producer cell is a rfa mutant, eg, wherein the producer cell is an E coli cell. In an embodiment, the rfa is rfaC. In an embodiment, the rfa is rfaD. In an embodiment, the rfa is rfaF. In an embodiment, the rfa is rfaG. In an embodiment, the rfa is rfaI. In an embodiment, the rfa is rfa J. See FIG. 1, for example.

    [0051] Optionally there is a disruption of a rfa gene in the genome (eg, chromosome) of the producer cell, eg, rfaC, rfaD, rfaE, rfaF, rfaG, rfaP, rfaQ, rfaY, rfaB, rfaI or rfaJ. Optionally, the disruption is a disruption (eg, deletion) of rfaD and/or rfaE. Optionally, the producer cell here is an E coli cell. The disruption may be a knock-out of the gene, insertion of a heterologous nucleotide sequence in the gene, one or mutations (eg, deletions, substitutions or additions, or any combination in the gene) that renders the gene non-functional for production of the receptor, a component of the receptor, or a gene product that is essential for receptor production in the producer cell. Standard molecular biology techniques for effecting this will be apparent to the skilled person. [0052] 10. The method of Clause 9, wherein the modification is a modification of a lipopolysaccharide (LPS) synthesis pathway. [0053] 11. The method of any preceding Clause, wherein the receptor comprises a LPS.

    [0054] In an example, the receptor is any receptor mentioned in Tables 1-3 or otherwise mentioned herein. In an example, the particles comprise P2 phage capsids and the receptor is a P2 receptor. [0055] 12. Use of producer cells as defined in any preceding Clause, for enhancing the production yield of transduction particles. [0056] 13. The use of Clause 12, wherein the transduction particles are as defined in any one of Clauses 1 to 11. [0057] 14. The use of Clause 12 or 13, for increasing the yield at least 10-fold compared to production in producer cells that surface express the receptor. [0058] 15. The use of Clause 14, wherein the increase is at least 100-fold. [0059] 16. The use of Clause 14, wherein the increase is 10-1000-fold. [0060] 17. The method or use of any preceding Clause, comprising isolating the transduction particles from cellular material. [0061] 18. A composition (optionally a pharmaceutical composition) comprising transduction particles obtained or obtainable by the method or use of Clause 17.

    [0062] Optionally the composition comprises an antibiotic that kills or is toxic to the target cells. [0063] 19. The composition according to Clause 18, wherein the composition comprises no producer cell LPS. [0064] 20. A method of killing bacterial target cells, the method comprising contacting the cells with a composition according to Clause 18 or 19, wherein transduction particles infect the cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.

    [0065] Optionally, any method or use of the composition, population or particles of the invention is a method or use in vitro or ex vivo. Optionally, the method or use is not performed in or on a human or animal. Optionally, the method or use is performed in or on a human or animal tissue, cell or serum sample in vitro. [0066] 21. A composition according to Clause 18 or 19 for use in a method of treating or preventing a disease or condition in a human or animal subject, wherein the disease or condition is mediated by bacterial target cells, the method comprising administering the composition to the subject and contacting the target cells with a composition according to Clause 18 or 19, whereby target cells are killed or the growth or proliferation of target cells is inhibited, thereby treating or preventing the disease or condition. [0067] 22. The composition of Clause 21, wherein transduction particles comprised by the composition infect the target cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent [0068] 23. The composition of Clause 21 or 22, wherein the target cells are Escherichia, Klebsiella, Clostridium or Pseudomonas cells. [0069] 24. The composition of Clause 21 or 22, wherein the target cells are E. coli, K pneumoniae, C. dificile or P. aeruginosa cells.

    [0070] Examples of receptors for use in the present invention are discussed below.

    [0071] Proteinaceous receptors are mainly outer membrane proteins; sugar moieties include those that compose the cell wall, pellicles, teichoic and LTA. The receptor of the invention is, for, example selected from any of these.

    [0072] Bacteriophage adsorption initiates the infection process. Through a series of interactions between binding proteins of the bacteriophage (phage) and receptors on the bacterial cell surface, the virus recognizes a potentially sensitive host and then positions itself for DNA ejection. Phage adsorption is thus not only a crucial step in the infection process, but also represents the initial point of contact between virus and host and dictates host range specificity.

    [0073] Bacteriophage adsorption generally consists of three steps: initial contact, reversible binding and irreversible attachment (Duckworth 1987). The first step involves random collisions between phage and host caused by Brownian motion, dispersion, diffusion or flow (Kokjohn and Miller 1992). In the reversible step, binding to bacterial surface components is not definitive and the phage can desorb from the host. This process, firstly identified by Garen and Puck (1951) through experimental observations of phage detachment after elution, may serve to keep the phage close to the cell surface as it searches for a specific receptor (Kokjohn and Miller 1992). The specific connection between bacterial receptor and phage-binding domains is sometimes mediated by an enzymatic cleavage. This step triggers conformational rearrangements in other phage molecules that allow the insertion of the genetic material into the host (for further details on the mechanism of phage genome ejection, see the review by Molineux and Panja (2013)).

    [0074] Numerous review studies have highlighted the extensive range of host-associated receptors (proteins, sugars and cell surface structures) that bacteriophages target during adsorption (Lindberg 1977; Schwartz 1980; Wright, McConnell and Kanegasaki 1980; Heller 1992; Frost 1993; Henning and Hashemolhosseini 1994; Vinga et al. 2006; Rakhuba et al. 2010; Chaturongakul and Ounjai 2014). The nature and location of the host cell receptors recognised by bacteriophages varies greatly depending on the phage and host. They range from peptide sequences to polysaccharide moieties. In fact, bacteriophages have been shown to bind to receptors located in the walls of both Gram-positive (Xia et al. 2011) and Gram-negative bacteria (Marti et al. 2013), in bacterial capsules or slime layers (Fehmel et al. 1975), and in appendages [e.g. pili (Guerrero-Ferreira et al. 2011) and flagella (Shin et al. 2012)]. This diversity in receptors and structures involved is a testament to the multiplicity of mechanisms developed by phages and hosts to overcome the evolutionary strategies adopted by their counterparts. It is not unexpected to encounter so many possibilities considering the diversity and staggering amount of phages estimated to populate the different environments of the planet (Clokie et al. 2011). Nevertheless, in all cases, adsorption has so far been shown to involve either constituents of the bacterial cell wall or protruding structures. In an embodiment, therefore, a receptor in the present invention can be any such receptor mentioned in this paragraph or elsewhere in this disclosure.

    [0075] Optionally, the receptor comprises lipopolysaccharide (LPS), a heptose moiety, the host's glucosylated cell wall teichoic acid (WTA), YueB, or a receptor recognized by a tail fiber protein of the phage or gp21 of the phage.

    Receptors in the Cell Wall of Gram-Positive Bacteria

    [0076] Peptidoglycan, or murein, is an important component of the bacterial cell wall and is often involved in bacteriophage adsorption. It is a polymer composed of multiple units of amino acids and sugar derivatives—N-acetylglucosamine and N-acetylmuramic acid. These sugar constituents are connected through glycosidic bonds, forming glycan tetrapeptide sheets that are joined together through the cross-linking of amino acids. The cross-linking occurs through peptide bonds between diaminopimelic acid (an amino acid analog) and D-alanine, or through short peptide interbridges. These interbridges are more numerous in Gram-positive bacteria, leading to their characteristically thicker cell walls.

    [0077] Another main component of the cell wall of Gram-positive bacteria that can be involved in phage adsorption is teichoic acid-polysaccharides composed of glycerol phosphate or ribitol phosphate and amino acids. They are bonded to the muramic acid of peptidoglycans. When teichoic acids are bonded to the lipids of the plasma membrane, they are called lipoteichoic acids (LTA). Further details of the composition of cell walls of bacteria can be found in Tortora, Funke and Case (2007), Willey, Sherwood and Woolverton (2008), Pommerville (2010) and Madigan et al. (2012).

    [0078] The majority of the receptors so far identified are associated either with peptidoglycan or teichoic acid structures (Table 1). Out of 30 phages targeting Gram-positive bacteria reported in Table 1, only 10 utilize other structures for adsorption. Among these 10 phages, 9 display interactions with residues of either teichoic acid (phage SPP1) or peptidoglycan (phages 5, 13, c2, h, m13, kh, L and p2) for reversible binding. This highlights the important role these structures may play in the adsorption of phage to Gram-positive bacteria.

    [0079] Optionally, the receptor of the invention is peptidoglycan, murein, teichoic acid or lipoteichoic acid (LTA). Optionally, each transduction particle of the invention is a first phage or comprises a capsid of a first phage, wherein the first phage is a phage of a family listed in Table 1 (and optionally the producer and/or target cell is the host for the phage as listed in Table 1 and/or the receptor is the receptor for the phage as listed in Table 1). In an embodiment, the producer and target cells are gram-positive cells. Optionally the producer and/or target cells are of a species or strain listed in Table 1 (where the producer and target cell species are different or the same). Preferably when the producer cell is a gram-positive bacteria, the receptor is a peptidoglycan. Alternatively, when the producer cell is a gram-positive bacteria, the receptor is a teichoic acid.

    Receptors in the Cell Wall of Gram-Negative Bacteria

    [0080] In Gram-negative bacteria, the peptidoglycan layer is relatively thin and is located inward of the outer membrane, the major component of the cell wall. These two layers are connected by Braun's lipoproteins. The outer membrane is a sophisticated structure composed of a lipid bilayer ornamented with proteins, polysaccharides and lipids; the latter two molecules form the LPS layer. LPSs are complexes that consist of three parts: lipid A, the core polysaccharide and the O-polysaccharide. Lipid A is, in general, composed of fatty acids attached to glucosamine phosphate disaccharides. The core polysaccharide is connected to the lipid A through a ketodeoxyoctonate linker. The core polysaccharide and the O-polysaccharide (O-chain or O-antigen) contain several units of sugar residues extending outward to the outer membrane. Cells that contain all three components of the LPS are denominated as smooth (S) type and those that lack the O-polysaccharide portion are distinguished as rough (R) type. In general, the saccharides composing the O-antigen are highly variable and those of the core polysaccharide are more conserved among species. Because of this, phages specific to only S-type strains tend to target the O-polysaccharide and, thus, have generally a narrower host range when compared to those able to adsorb to R-type cells (Rakhuba et al. 2010).

    [0081] Table 2(a) compiles Gram-negative bacterial receptors located in the cell wall that interact with phage receptor-binding proteins (RBPs). Interestingly, in coliphages there is no preference for proteinaceous or polysaccharide receptors: some phages adsorb on cell wall proteins, some on sugar moieties and others require both structures for adsorption. In the case of Salmonella phages, the picture is not so different: some use proteins, some sugar moieties and some both types of receptors. On the other hand, Pseudomonas phages commonly adsorb onto polysaccharide receptors. Although definitive conclusions cannot be drawn from such a small sample size, it should be noted that Pseudomonas can have two LPS moieties, a short chain LPS named A band and a longer B-band LPS (Beveridge and Graham 1991).

    [0082] Optionally, the receptor of the invention is a host cell wall protein. Optionally, the receptor is a saccharide. Optionally, the receptor comprises O-antigen, LPS lipid A or LPS core polysaccharide. In an example, the receptor is smooth LPS or rough LPS. Optionally, the host cells are S-type bacteria and the receptor comprises O-antigen of the host. Optionally, the host cells are R-type bacteria and the receptor comprises LPS lipid A of the host.

    [0083] Optionally, the receptor is a host cell wall protein. Optionally, the receptor is a saccharide. Optionally, the receptor comprises O-antigen, LPS lipid A or LPS core polysaccharide. In an example, the receptor is smooth LPS or rough LPS. Optionally, the host cells are S-type bacteria and the receptor comprises O-antigen of the host. Optionally, the host cells are R-type bacteria and the receptor comprises LPS lipid A of the host.

    [0084] In an example, the host is E coli and the transduction particles are coliphage (or comprise coliphage capsids), wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express E coli polysaccharide receptor and/or an E coli cell wall protein receptor.

    [0085] In an example, the host is Salmonella, wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express Salmonella polysaccharide receptor and/or a Salmonella cell wall protein receptor.

    [0086] In an example, the host is Klebsiella, wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express Klebsiella polysaccharide receptor and/or a Klebsiella cell wall protein receptor.

    [0087] In an example, the host is Pseudomonas, wherein the receptor is a polysaccharide receptor. In an example, the second cells are engineered not to express Pseudomonas polysaccharide receptor.

    [0088] Optionally, each transduction particle of the invention is a first phage or comprises a capsid of a first phage, wherein the first phage is a phage of a family listed in Table 2 (and optionally the producer cell is the host for the phage as listed in Table 2 and/or the receptor is the receptor for the phage as listed in Table 2).

    [0089] In an embodiment, the producer and target cells are gram-negative cells. Preferably, the producer cells are E coli cells. Optionally the producer and/or target cells are of a species or strain listed in Table 2 (eg, where the cell species are different or the same).

    [0090] Table 2(b) reports cases where phages not only adsorb onto bacterial surfaces but also enzymatically degrade the sugar moieties in the O-chain structure. It should be noted that all these phages belong to the Podoviridae family.

    Receptors in Other Structures of Gram-Negative Bacteria

    [0091] In this section, bacterial structures, other than cell wall moieties, that also serve as receptors for particles or phages are discussed. These include structures such as flagella, pili and capsules. They can be found in species from both Gram stains. See Table 3 for examples.

    [0092] Optionally, the receptor of the invention is a flagellum, pilus or capsule component (eg, a component listed in Table 3 in the listed species or as found in a host that is of a different species to that listed). Optionally, the phage is a phage of a family listed in Table 3 (and optionally the host is the host for the phage as listed in Table 3 and/or the receptor is the receptor for the phage as listed in Table 3). Optionally, the phage is a phage listed in Table 3 (and optionally the host is the host for the phage as listed in Table 3 and/or the receptor is the receptor for the phage as listed in Table 3).

    [0093] Flagella are long thin helical structures that confer motility to cells. They are composed of a basal body, a flagellar hook and a flagellar filament composed of subunits of flagellin proteins (Willey, Sherwood and Woolverton 2008). Table 3(a) reports phages attaching to flagellal proteins. The adhesion of phages to the filament structure is generally reversible and the flagellum's helical movement causes the phage to move along its surface until they reach the bacterial wall. Irreversible adsorption occurs, then, on receptors located on the surface of the bacterium, near the base of the flagellum (Schade, Adler and Ris 1967; Lindberg 1973; Guerrero-Ferreira et al. 2011). Interestingly, some phages (ϕCbK and ϕCb13) were observed to contain filaments protruding from their capsids that are responsible for reversible binding onto the host's flagellum; irreversible adsorption occurs only when the phage's tails interact with pili portals on the cell pole (Guerrero-Ferreira et al. 2011). Because for these phages irreversible adsorption occurs on the pilus, even if they interact with the flagellum, they were reported in Table 3(b), which focuses on phages interacting with receptors in pili and mating pair formation structures.

    [0094] Pili are rod-shaped filamentous appendages used for bacterial conjugation (Lindberg 1973). They extend from the donor cell and attach to receptors on the wall of the recipient cell. A depolymerization of the pilus causes its retraction, bringing both cells closer to each other. Further adhesion of the cells is achieved through binding proteins on their surfaces; genetic material is transferred through this conjugating junction (Madigan et al. 2012). Adsorption to the pilus structure has been so far associated with phages that belong to orders different from Caudovirales (Table 3b). In fact, according to Frost (1993), the families Cystoviridae and Inoviridae compose the majority of phages that adsorb onto pili structures. Interestingly, phages can be selective towards certain parts of the pili. That is the case for F-type phages, whose adsorption occur only on the tip of the pilus (Click and Webster 1998). In other phages, such as 46, the attachment happens at the sides (shaft) of the structure (Daugelavicius et al. 2005).

    [0095] Capsules are flexible cementing substances that extend radially from the cell wall. They act as binding agents between bacteria and/or between cells and substrates (Beveridge and Graham 1991). Slime layers are similar to capsules, but are more easily deformed. Both are made of sticky substances released by bacteria, and their common components are polysaccharides or proteins (Madigan et al. 2012). Adsorption of phages to capsules or slime layers is mediated by enzymatic cleavage of the exopolysaccharides that compose the layers. The hydrolysis of the layer is a reversible step, whereas irreversible binding is achieved through bonding of the phage with receptors on the cell wall (Rakhuba et al. 2010). As can be seen in Table 3(c), the few phages identified to have RBP recognizing exopolysaccharides are mostly of Podoviridae morphology.

    [0096] In an example, the producer cell is a Salmonella (eg, S enterica Serovar Typhimurium) cell and the receptor is selected from flagella, vitamin B.sub.12 uptake outer membrane protein, BtuB and lipopolysaccharide-related O-antigen. In an example the receptor is a flagellum or BtuB and the first phage are Siphoviridae phage. In an example the receptor is O-antigen of LPS and the first phage are Podoviridae phage. Optionally, the receptor is FliC host receptor or FUjB receptor.

    [0097] Optionally, the producer cell is a S enterica or P aeruginosa cell. Optionally, the receptor is the receptor of the host as listed in Table 4.

    [0098] The O-antigen structure of Salmonella O66 has been established, which reportedly differs from the known O-antigen structure of Escherichia coli O166 only in one linkage (most likely the linkage between the O-units) and O-acetylation. The O-antigen gene clusters of Salmonella O66 and E. coli O166 were found to have similar organizations, the only exception being that in Salmonella O66, the wzy gene is replaced by a non-coding region. The function of the wzy gene in E. coli O166 was confirmed by the construction and analysis of deletion and trans-complementation mutants. It is proposed that a functional wzy gene located outside the O-antigen gene cluster is involved in Salmonella O66 O-antigen biosynthesis, as has been reported previously in Salmonella sero groups A, B and D1. The sequence identity for the corresponding genes between the O-antigen gene clusters of Salmonella O66 and E. coli O166 ranges from 64 to 70%, indicating that they may originate from a common ancestor. It is likely that after the species divergence, Salmonella O66 got its specific O-antigen form by inactivation of the wzy gene located in the O-antigen gene cluster and acquisition of two new genes (a wzy gene and a prophage gene for O-acetyl modification) both residing outside the O-antigen gene cluster.

    [0099] In an example, the producer cells are E coli cells and do not comprise an expressible E coli (eg, Escherichia coli O166) wzy gene.

    [0100] Optionally, the receptor is selected from lipopolysaccharides, teichoic acids (optionally a ManNAc(β1.fwdarw.4)GlcNAc disaccharide with one to three glycerol phosphates attached to the C4 hydroxyl of the ManNAc residue followed by a long chain of glycerol- or ribitol phosphate repeats), proteins and flagella.

    [0101] Optionally, the receptor comprises an O-antigen of the producer cell species.

    [0102] Optionally, the phage or particles of the invention are operable to express an endolysin or holin in the producer cells, optionally when phage or particles replicate in producer cells. This is useful for releasing the particles for subsequent purification away from cellular material to produce a composition of the invention.

    [0103] In an embodiment, each particle is capable of infecting a target bacterium, the particle comprising a nucleotide sequence of interest (NSI) that is capable of expressing a protein or RNA in the target bacterium, or wherein the NSI comprises a regulatory element that is operable in the target bacterium. In an example, the NSI is capable of recombination with the target cell chromosome or an episome comprised by the target cell to modify the chromosome or episome. Optionally, this is carried out in a method wherein the chromosome or episome is cut (eg, at a predetermined site using a guided nuclease, such as a Cas, TALEN, zinc finger or meganuclease; or a restriction endonuclease) and simultaneously or sequentially the cell is infected by a particle that comprises first DNA comprising the NSI, wherein the DNA is introduced into the cell and the NSI or a sequence thereof is introduced into the chromosome or episome at or adjacent the cut site. In an example the first DNA comprises one or more components of a CRISPR/Cas system operable to perform the cutting (eg, comprising at least a nucleotide sequence encoding a guide RNA or crRNA for targeting the site to be cut) and further comprising the NSI.

    [0104] In an embodiment, the presence in the target bacterium of the NSI or its encoded protein or RNA mediates target cell killing, or downregulation of growth or propagation of target cells, or mediates switching off of expression of one or more RNA or proteins encoded by the target cell genome, or downregulation thereof.

    [0105] In an embodiment, the presence in the target bacterium of the NSI or its encoded protein or RNA mediates upregulation of growth or propagation of the target cell, or mediates switching on of expression of one or more RNA or proteins encoded by the target cell genome, or upregulation thereof.

    [0106] In an embodiment, the NSI encodes a component of a CRISPR/Cas system that is toxic to the target bacterium.

    [0107] In an embodiment, the first NSI is comprised by a vector (eg, a plasmid or shuttle vector).

    [0108] An embodiment provides a method of treating an environment ex vivo, the method comprising exposing the environment to a population of transduction particles obtainable by the production method of the invention, wherein the environment comprises target bacteria and the particles (eg, phage or particles comprising a phage capsid) infect and kill the target bacteria. In an example an agent is further administered to the environment simultaneously or sequentially with the phage administration. In an example, the agent is an herbicide, pesticide, insecticide, plant fertilizer or cleaning agent.

    [0109] A method of treating an infection of target bacteria in a human or animal subject is provided, the method comprising exposing the bacteria to a population of transduction particles obtainable by the production method, wherein the particles infect and kill the target bacteria.

    [0110] Optionally, target bacteria herein are comprised by a microbiome of the subject, eg, a gut microbiome. Alternatively, the microbiome is a skin, scalp, hair, eye, ear, oral, throat, lung, blood, rectal, anal, vaginal, scrotal, penile, nasal or tongue microbiome.

    [0111] In an example the subject is further administered a medicament simultaneously or sequentially with the transduction particle administration. In an example, the medicament is an antibiotic, antibody, immune checkpoint inhibitor (eg, an anti-PD-1, anti-PD-LI or anti-CTLA4 antibody), adoptive cell therapy (eg, CAR-T therapy) or a vaccine.

    [0112] In an example, the invention employs helper phage for packaging the NSI. In an example, the helper phage are capable of packaging DNA comprising the NSI to produce first transduction particles, wherein the particles are different from the helper phage and the helper phage are incapable themselves of producing helper phage particles.

    [0113] A composition is provided comprising a population of transduction particles of the invention, wherein the particles require helper phage according to the immediately preceding paragraph for replication of the transduction particles; and optionally wherein less than 20, 15, 10, 5, 4, 3, 2, 1, 0.5, 0.4, 0.2 or 0.1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.5% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.01% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.0001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.00001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.000001% of total transduction particles comprised by the composition are particles of such helper phage.

    [0114] In an example the composition comprises helper phage and less than 0.0000001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.00000001% of total transduction particles comprised by the composition are particles of such helper phage.

    [0115] In an example, the composition or population comprises at least 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 transduction particles, as indicated a transduction assay, for example. In an example, the composition or population comprises at least 10.sup.3 transduction particles and eg, no more than 10.sup.11 particles. In an example, the composition or population comprises at least 10.sup.4 transduction particles and eg, no more than 10.sup.14 particles. In an example, the composition or population comprises at least 10.sup.5 transduction particles and eg, no more than 10.sup.14 particles. In an example, the population comprises at least 10.sup.6 transduction particles and eg, no more than 10.sup.14 particles. To have a measure of the particle concentration, for example, one can perform a standard transduction assay when the genome of the particles of the invention contains an antibiotic marker. Thus, in this case the particles of the invention are capable of infecting target bacteria and in a sample of 1 ml the composition of population comprises at least 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 transduction particles, which can be determined by infecting susceptible bacteria at a multiplicity of infection <0.1 and determining the number of infected cells by plating on a selective agar plate corresponding to the antibiotic marker in vitro at 20 to 37 degrees centigrade, eg, at 20 or 37 degrees centrigrade.

    [0116] Optionally at least 99.9, 99.8, 99.7, 99.6, 99.5, 99.4, 99.3, 99.2, 99.1, 90, 85, 80, 70, 60, 50 or 40% of total transduction particles comprised by the composition are particles of particles of the invention.

    [0117] In an example, genome of the particles of the invention comprises an f1 origin of replication.

    [0118] In an example, the helper phage are E coli phage. In an example, the particles of the invention are E coli, C dificile, Streptococcus, Klebsiella, Pseudomonas, Acitenobacter, Enterobacteracea, Firmicutes or Bacteroidetes phage or comprise a capsid of such a genus, wherein the capsid packages a NSI. In an example, the helper phage are engineered M13 phage.

    [0119] In an example, the genome of the particles of the invention comprises a phagemid, wherein the phagemid comprises a packaging signal for packaging the particles in the presence of the helper phage.

    [0120] The particles of the invention may contain DNA comprising a nucleotide sequence of interest (NSI), eg, as defined herein, such as a NSI that encodes a component of a CRISPR/Cas system operable in target bacteria that can be infected by the particles. Once inside the target bacteria, optionally the particle DNA is incapable of being packaged to form transduction particles in the absence of the helper phage. This usefully contains the activity of the genome of the particles of the invention and its encoded products (proteins and/or nucleic acid), as well as limits or controls dosing of the NSI and its encoded products in an environment comprising the target bacteria that have been exposed to the particles of the invention. This is useful, for example to control the medical treatment of an environment comprised by a human or animal subject, plant or other environment (eg, soil or a foodstiff or food ingredient).

    [0121] In an embodiment, each particle of the invention comprises one or more phage structural proteins and/or comprises a phage capsid. Examples of phage structural proteins are phage coat proteins, collar proteins and phage tail fibre proteins. In an example, the particle comprises a capsid and tail fibre proteins of first type of phage. For example, the phage type is an E coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Clostridium dificile, Helicobacter pylori, Staphylococcus aureus, Salmonella (eg, typhimurium) or Campylobacter phage.

    [0122] Optionally, at least 95% (eg, 100%) of transduction particles comprised by the composition are particles of the invention.

    [0123] In another embodiment, the composition comprises second transduction (eg, phage) particles, wherein the second particles are different from the first particles of the invention (ie, the particles recited in claim 1).

    [0124] Optionally, the composition population comprises at least 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 phage particles, as indicated in a transduction assay.

    [0125] Optionally, each particle of the invention comprises a vector for the NSA, wherein the vectors are plasmids or phagemids. For example, the vectors are shuttle vectors (eg, pUC vectors) that can be replicated in host bacteria.

    [0126] Optionally, the genome of each particle of the invention comprises a packaging signal, such as a pac or cos sequence or homologue thereof.

    [0127] Optionally, the transduction particles of the invention are temperate phage. Optionally, the transduction particles of the invention are lytic phage.

    [0128] Optionally, the particles of the invention are capable of infecting target bacteria, the particles comprising a nucleotide sequence of interest (NSI) that is capable of expressing a protein or RNA (eg, gRNA or crRNA) in target bacteria, or wherein the NSI comprises a regulatory element that is operable in target bacteria.

    [0129] Optionally, the presence in target bacteria of the NSI or its encoded protein or RNA mediates target cell killing, or downregulation of growth or propagation of target cells, or mediates switching off of expression of one or more RNA or proteins encoded by the target cell genomes, or downregulation thereof.

    [0130] Optionally, the presence in target bacteria of the NSI or its encoded protein or RNA mediates upregulation of growth or propagation of target cells, or mediates switching on of expression of one or more RNA or proteins encoded by the target cell genomes, or upregulation thereof.

    [0131] Optionally, the particles of the invention are capable of infecting target bacteria and each particle comprises engineered antibacterial means for killing target bacteria. By use of the term “engineered” it will be readily apparent to the skilled addressee that the relevant means has been introduced and is not naturally-occurring in the phage or particle. For example, the means is recombinant, artificial or synthetic.

    [0132] In an example, each particle of the invention comprises a genomic island DNA or pathogenicity island (eg, saPI) DNA, wherein optionally the DNA comprises the NSI or engineered antibacterial means for killing target bacteria (eg, the DNA encodes a nuclease, such as Cas nuclease (eg, Cas9 or Cas3), and/or a guide RNA for expression in a target bacterium).

    [0133] Optionally, the antibacterial means comprises one or more components of a CRISPR/Cas system.

    [0134] Optionally, the component(s) comprise (i) a DNA sequence encoding a guide RNA (eg, a single guide RNA) or comprising a CRISPR array for producing guide RNA, wherein the guide RNA is capable of targeting the genome of target bacteria; (ii) a Cas nuclease-encoding DNA sequence; and/or (iii) a DNA sequence encoding one or more components of Cascade. In an example, a Cas herein is a Cas9. In an example, a Cas herein is a Cas3. The Cas may be identical to a Cas encoded by the target bacteria.

    [0135] Optionally, the antibacterial means comprises a nucleic acid encoding a guided nuclease, such as a Cas nuclease, TALEN, zinc finger nuclease or meganuclease.

    [0136] Optionally, the composition, population or transduction particles is each for use in medicine practised on a human or animal subject, or the composition is a pharmaceutical composition for use in medicine practised on a human or animal subject. In an example, the animal is a livestock or companion pet animal (eg, a cow, pig, goat, sheep, horse, dog, cat or rabbit). In an example, the animal is an insect (an insect at any stage of its lifecycle, eg, egg, larva or pupa). In an example, the animal is a protozoan. In an example, the animal is a cephalopod.

    [0137] Optionally, the composition is a herbicide, pesticide, food or beverage processing agent, food or beverage additive, petrochemical or fuel processing agent, water purifying agent, cosmetic additive, detergent additive or environmental (eg, soil) additive or cleaning agent.

    [0138] The inability in some embodiments of the particles of the invention to self-replicate and to require helper phage to do this usefully provides containment in the location (eg, gut) of action of the composition and/or in the environment of the subject, eg, when exposed to secretions such as urine and faeces of the subject that otherwise may contain replicated first phage. Inability of the helper phage in some embodiments to self-package limits availability of factors required by the particles to form packaged particles, hence providing containment by limiting propagation of the particles of the invention. This may be useful, for example, to contain an antibacterial activity provided by the particles, such as a CRISPR/Cas killing principle.

    [0139] In an example, when the subject is a human, the subject is not an embryo.

    [0140] Optionally, the environment is a microbiome of soil; a plant, part of a part (e.g., a leaf, fruit, vegetable or flower) or plant product (e.g., pulp); water; a waterway; a fluid; a foodstuff or ingredient thereof; a beverage or ingredient thereof; a medical device; a cosmetic; a detergent; blood; a bodily fluid; a medical apparatus; an industrial apparatus; an oil rig; a petrochemical processing, storage or transport apparatus; a vehicle or a container. In an example, the environment is an ex vivo bodily fluid (e.g., urine, blood, blood product, sweat, tears, sputum or spit), bodily solid (e.g., faeces) or tissue of a human or animal subject that has been administered the composition.

    [0141] Optionally, the antibacterial means comprises one or more components of a CRISPR/Cas system.

    [0142] For example, the component(s) comprise (i) a DNA sequence encoding a guide RNA (eg, a single guide RNA) or comprising a CRISPR array for producing guide RNA, wherein the guide RNA is capable of targeting the genome of target bacteria; (ii) a Cas (eg, Cas9, Cas3, Cpf1, CasX or CasY) nuclease-encoding DNA sequence; and/or (iii) a DNA sequence encoding one or more components of Cascade (eg, CasA).

    [0143] Optionally, the antibacterial means comprises a nucleic acid encoding a guided nuclease, such as a Cas nuclease, TALEN, zinc finger nuclease or meganuclease.

    [0144] In an example, the particles, population or composition of the invention is comprised by a medical container, eg, a syringe, vial, IV bag, inhaler, eye dropper or nebulizer. In an example, the particles, population or composition of the invention is comprised by a sterile container. In an example, the particles, population or composition of the invention is comprised by a medically-compatible container. In an example, the particles, population or composition of the invention is comprised by a fermentation vessel, eg, a metal, glass or plastic vessel.

    [0145] In an example, the particles, population or composition of the invention is comprised by a medicament, e,g in combination with instructions or a packaging label with directions to administer the medicament by oral, IV, subcutaneous, intranasal, intraocular, vaginal, topical, rectal or inhaled administration to a human or animal subject. In an example, the particles, population or composition of the invention is comprised by an oral medicament formulation. In an example, the particles, population or composition of the invention is comprised by an intranasal or ocular medicament formulation. In an example, the particles, population or composition of the invention is comprised by a personal hygiene composition (eg, shampoo, soap or deodorant) or cosmetic formulation. In an example, the particles, population or composition of the invention is comprised by a detergent formulation. In an example, the particles, population or composition of the invention is comprised by a cleaning formulation, eg, for cleaning a medical or industrial device or apparatus. In an example, the particles, population or composition of the invention is comprised by foodstuff, foodstuff ingredient or foodstuff processing agent. In an example, the particles, population or composition of the invention is comprised by beverage, beverage ingredient or beverage processing agent. In an example, the particles, population or composition of the invention is comprised by a medical bandage, fabric, plaster or swab. In an example, the particles, population or composition of the invention is comprised by an herbicide or pesticide. In an example, the particles, population or composition of the invention is comprised by an insecticide.

    [0146] In an example, each particle is a first phage particle or comprises a capsid of a first phage (and optionally also tail fibres of the first phage), wherein the first phage is a is a Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae virus. In an example, the helper phage is a is a Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae virus. In an example, the helper phage is a filamentous M13, a Noviridae, a tailed phage (eg, a Myoviridae, Siphoviridae or Podoviridae), or a non-tailed phage (eg, a Tectiviridae).

    [0147] In an example, both the first phage are Corticoviridae. In an example, the first phage are Cystoviridae. In an example, the first phage are Inoviridae. In an example, the first phage are Leviviridae.

    [0148] In an example, the first phage are Microviridae. In an example, the first phage are Podoviridae. In an example, the first phage are Siphoviridae. In an example, the first phage are Tectiviridae.

    [0149] In an example, the CRISPR/Cas component(s) are component(s) of a Type I CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type II CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type III CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type IV CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type V CRISPR/Cas system. In an example, the CRISPR/Cas component(s) comprise a Cas9-encoding nucleotide sequence (eg, Spyogenes Cas9, S aureus Cas9 or S thermophilus Cas9). In an example, the CRISPR/Cas component(s) comprise a Cas3-encoding nucleotide sequence (eg, E coli Cas3, C dificile Cas3 or Salmonella Cas3). In an example, the CRISPR/Cas component(s) comprise a Cpf-encoding nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a CasX-encoding nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a CasY-encoding nucleotide sequence.

    [0150] In an example, the genomes of the particles encode a CRISPR/Cas component or protein of interest from a nucleotide sequence comprising a promoter that is operable in the target bacteria.

    [0151] In an example, the host bacteria and/or target bacteria are E coli. In an example, the host bacteria and/or target bacteria are C difficile (eg, the vector is a shuttle vector operable in E coli and the host bacteria are C difficile). In an example, the host bacteria and/or target bacteria are Streptococcus, such as S thermophilus (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Streptococcus). In an example, the host bacteria and/or target bacteria are Pseudomonas, such as P aeruginosa (eg, the vector is a shuttle vector operable in E coli and the host bacteria are P aeruginosa). In an example, the host bacteria and/or target bacteria are Klebsiella, such as K pneumoniae (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Klebsiella). In an example, the host bacteria and/or target bacteria are Salmonella, eg, S typhimurium (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Salmonella).

    [0152] Optionally, each producer and/or target bacterium is a gram negative bacterium (eg, a spirilla or vibrio). Optionally, each producer and/or target bacterium is a gram positive bacterium. Optionally, each producer and/or target bacterium is a mycoplasma, chlamydiae, spirochete or mycobacterium. Optionally, each producer and/or target bacterium is a Streptococcus (eg, pyogenes or thermophilus). Optionally, each producer and/or target bacterium is a Staphylococcus (eg, aureus, eg, MRSA). Optionally, each producer and/or target bacterium is an E. coli (eg, O157: H7) host, eg, wherein the Cas is encoded by the vecor or an endogenous host Cas nuclease activity is de-repressed. Optionally, each producer and/or target bacterium is a Pseudomonas (eg, aeruginosa). Optionally, each producer and/or target bacterium is a Vibro (eg, cholerae (eg, O139) or vulnificus). Optionally, each producer and/or target bacterium is a Neisseria (eg, gonnorrhoeae or meningitidis). Optionally, each producer and/or target bacterium is a Bordetella (eg, pertussis). Optionally, each producer and/or target bacterium is a Haemophilus (eg, influenzae). Optionally, each producer and/or target bacterium is a Shigella (eg, dysenteriae). Optionally, each producer and/or target bacterium is a Brucella (eg, abortus). Optionally, each producer and/or target bacterium is a Francisella host. Optionally, each producer and/or target bacterium is a Xanthomonas host. Optionally, each producer and/or target bacterium is an Agrobacterium host. Optionally, each producer and/or target bacterium is an Erwinia host. Optionally, each producer and/or target bacterium is a Legionella (eg, pneumophila). Optionally, each producer and/or target bacterium is a Listeria (eg, monocytogenes). Optionally, each producer and/or target bacterium is a Campylobacter (eg, jejuni). Optionally, each producer and/or target bacterium is a Yersinia (eg, pestis). Optionally, each producer and/or target bacterium is a Borelia (eg, burgdorferi). Optionally, each producer and/or target bacterium is a Helicobacter (eg, pylon). Optionally, each producer and/or target bacterium is a Clostridium (eg, drjicile or botulinum). Optionally, each producer and/or target bacterium is a Erlichia (eg, chafeensis). Optionally, each producer and/or target bacterium is a Salmonella (eg, typhi or enterica, eg, serotype typhimurium, eg, DT 104). Optionally, each producer and/or target bacterium is a Chlamydia (eg, pneumoniae). Optionally, each producer and/or target bacterium is a Parachlamydia host. Optionally, each producer and/or target bacterium is a Corynebacterium (eg, amycolatum). Optionally, each producer and/or target bacterium is a Klebsiella (eg, pneumoniae). Optionally, each producer and/or target bacterium is an Enterococcus (eg, faecalis or faecim, eg, linezolid-resistant). Optionally, each producer and/or target bacterium is an Acinetobacter (eg, baumannii, eg, multiple drug resistant).

    [0153] Further examples of target cells and targeting of antibiotic resistance in such cells using the present invention are as follows:— [0154] 1. Optionally the target bacteria are Staphylococcus aureus cells, eg, resistant to an antibiotic selected from methicillin, vancomycin, linezolid, daptomycin, quinupristin, dalfopristin and teicoplanin. [0155] 2. Optionally the target bacteria are Pseudomonas aeuroginosa cells, eg, resistant to an antibiotic selected from cephalosporins (eg, ceftazidime), carbapenems (eg, imipenem or meropenem), fluoroquinolones, aminoglycosides (eg, gentamicin or tobramycin) and colistin. [0156] 3. Optionally the target bacteria are Klebsiella (eg, pneumoniae) cells, eg, resistant to carbapenem. [0157] 4. Optionally the target bacteria are Streptoccocus (eg, thermophilus, pneumoniae or pyogenes) cells, eg, resistant to an antibiotic selected from erythromycin, clindamycin, beta-lactam, macrolide, amoxicillin, azithromycin and penicillin. [0158] 5. Optionally the target bacteria are Salmonella (eg, serotype Typhi) cells, eg, resistant to an antibiotic selected from ceftriaxone, azithromycin and ciprofloxacin. [0159] 6. Optionally the target bacteria are Shigella cells, eg, resistant to an antibiotic selected from ciprofloxacin and azithromycin. [0160] 7. Optionally the target bacteria are Mycobacterium tuberculosis cells, eg, resistant to an antibiotic selected from Resistance to isoniazid (NH), rifampicin (RMP), fluoroquinolone, amikacin, kanamycin and capreomycin and azithromycin. [0161] 8. Optionally the target bacteria are Enterococcus cells, eg, resistant to vancomycin. [0162] 9. Optionally the target bacteria are Enterobacteriaceae cells, eg, resistant to an antibiotic selected from a cephalosporin and carbapenem. [0163] 10. Optionally the target bacteria are E. coli cells, eg, resistant to an antibiotic selected from trimethoprim, itrofurantoin, cefalexin and amoxicillin. [0164] 11. Optionally the target bacteria are Clostridium (eg, dificile) cells, eg, resistant to an antibiotic selected from fluoroquinolone antibiotic and carbapenem. [0165] 12. Optionally the target bacteria are Neisseria gonnorrhoea cells, eg, resistant to an antibiotic selected from cefixime (eg, an oral cephalosporin), ceftriaxone (an injectable cephalosporin), azithromycin and tetracycline. [0166] 13. Optionally the target bacteria are Acinetoebacter baumannii cells, eg, resistant to an antibiotic selected from beta-lactam, meropenem and a carbapenem. [0167] 14. Optionally the target bacteria are Campylobacter cells, eg, resistant to an antibiotic selected from ciprofloxacin and azithromycin. [0168] 15. Optionally, the target cell(s) produce Beta (β)-lactamase. [0169] 16. Optionally, the target cell(s) are bacterial cells that are resistant to an antibiotic recited in any one of examples 1 to 14.
    Mobile Genetic Elements. Genomic Islands. Pathogenicity Islands Etc.

    [0170] Genetic variation of bacteria and archaea can be achieved through mutations, rearrangements and horizontal gene transfers and recombinations. Increasing genome sequence data have demonstrated that, besides the core genes encoding house-keeping functions such as essential metabolic activities, information processing, and bacterial structural and regulatory components, a vast number of accessory genes encoding antimicrobial resistance, toxins, and enzymes that contribute to adaptation and survival under certain environmental conditions are acquired by horizontal gene transfer of mobile genetic elements (MGEs). Mobile genetic elements are a heterogeneous group of molecules that include plasmids, bacteriophages, genomic islands, chromosomal cassettes, pathogenicity islands, and integrative and conjugative elements. Genomic islands are relatively large segments of DNA ranging from 10 to 200 kb often integrated into tRNA gene clusters flanked by 16-20 bp direct repeats. They are recognized as discrete DNA segments acquired by horizontal gene transfer since they can differ from the rest of the chromosome in terms of GC content (% G+C) and codon usage.

    [0171] Pathogenicity islands (PTIs) are a subset of horizontally transferred genetic elements known as genomic islands. There exists a particular family of highly mobile PTIs in Staphylococcus aureus that are induced to excise and replicate by certain resident prophages. These PTIs are packaged into small headed phage-like particles and are transferred at frequencies commensurate with the plaque-forming titer of the phage. This process is referred to as the SaPI excision replication-packaging (ERP) cycle, and the high-frequency SaPI transfer is referred to as SaPI-specific transfer (SPST) to distinguish it from classical generalized transduction (CGT). The SaPIs have a highly conserved genetic organization that parallels that of bacteriophages and clearly distinguishes them from all other horizontally acquired genomic islands. The SaPI1-encoded and SaPIbov2-encoded integrases are used for both excision and integration of the corresponding elements, and it is assumed that the same is true for the other SaPIs. Phage 80α can induce several different SaPIs, including SaPI11, SaPI2, and SaPlbov1, whereas φ11 can induce SaPlbov1 but neither of the other two SaPIs.

    [0172] Reference is made to “Staphylococcal pathogenicity island DNA packaging system involving cos-site packaging and phage-encoded HNH endonucleases”, Quiles-Puchalt et al, PNAS Apr. 22, 2014. 111 (16) 6016-6021. Staphylococcal pathogenicity islands (SaPIs) are highly mobile and carry and disseminate superantigen and other virulence genes. It was reported that SaPIs hijack the packaging machinery of the phages they victimise, using two unrelated and complementary mechanisms. Phage packaging starts with the recognition in the phage DNA of a specific sequence, termed “pac” or “cos” depending on the phage type. The SaPI strategies involve carriage of the helper phage pac- or cos-like sequences in the SaPI genome, which ensures SaPI packaging in full-sized phage particles, depending on the helper phage machinery. These strategies interfere with phage reproduction, which ultimately is a critical advantage for the bacterial population by reducing the number of phage particles.

    [0173] Staphylococcal pathogenicity islands (SaPIs) are the prototypical members of a widespread family of chromosomally located mobile genetic elements that contribute substantially to intra- and interspecies gene transfer, host adaptation, and virulence. The key feature of their mobility is the induction of SaPI excision and replication by certain helper phages and their efficient encapsidation into phage-like infectious particles. Most SaPIs use the headful packaging mechanism and encode small terminase subunit (TerS) homologs that recognize the SaPI-specific pac site and determine SaPI packaging specificity. Several of the known SaPIs do not encode a recognizable TerS homolog but are nevertheless packaged efficiently by helper phages and transferred at high frequencies. Quiles-Puchalt et al report that one of the non-terS-coding SaPIs, SaPIbov5, and found that it uses two different, undescribed packaging strategies. SaPIbov5 is packaged in full-sized phage-like particles either by typical pac-type helper phages, or by cos-type phages—i.e., it has bothpac and cossites and uses the two different phage-coded TerSs. This is an example of SaPI packaging by a cos phage, and in this, it resembles the P4 plasmid of Escherichia coli. Cos-site packaging in Staphylococcus aureus is additionally unique in that it requires the HNH nuclease, carried only by cos phages, in addition to the large terminase subunit, for cos-site cleavage and melting.

    [0174] Characterization of several of the phage-inducible SaPIs and their helper phages has established that the pac (or headful) mechanism is used for encapsidation. In keeping with this concept, some SaPIs encode a homolog of TerS, which complexes with the phage-coded large terminase subunit TerL to enable packaging of the SaPI DNA in infectious particles composed of phage proteins. These also contain a morphogenesis (cpm) module that causes the formation of small capsids commensurate with the small SaPI genomes. Among the SaPI sequences first characterized, there were several that did not include either a TerS homolog or a cpm homolog, and the same is true of several subsequently identified SaPIs from bovine sources and for many phage-inducible chromosomal islands from other species. It was assumed, for these several islands, either that they were defective derivatives of elements that originally possessed these genes, or that terS and cpm genes were present but not recognized by homology.

    [0175] Quiles-Puchalt et al observed that an important feature of ϕSLT/SaPlbov5 packaging is the requirement for an HNH nuclease, which is encoded next to the ϕSLT terminase module. Proteins carrying HNH domains are widespread in nature, being present in organisms of all kingdoms. The HNH motif is a degenerate small nucleic acid-binding and cleavage module of about 30-40 as residues and is bound by a single divalent metal ion. The HNH motif has been found in a variety of enzymes playing important roles in many different cellular processes, including bacterial killing; DNA repair, replication, and recombination; and processes related to RNA. HNH endonucleases are present in a number of cos-site bacteriophages of Gram-positive and -negative bacteria, always adjacent to the genes encoding the terminases and other morphogenetic proteins. Quiles-Puchalt et al have demonstrated that the HNH nucleases encoded by #12 and the closely related ϕSLT have nonspecific nuclease activity and are required for the packaging of these phages and of SaPIbov5. Quiles-Puchalt et al have shown that HNH and TerL are jointly required for cos-site cleavage. Quiles-Puchalt et al have also observed that only cos phages of Gram-negative as well as of Gram-positive bacteria encode HNH nucleases, consistent with a special requirement for cos-site cleavage as opposed to pac-site cleavage, which generates flush-ended products. The demonstration that HNH nuclease activity is required for some but not other cos phages suggests that there is a difference between the TerL proteins of the two types of phages-one able to cut both strands and the other needing a second protein to enable the generation of a double-stranded cut.

    [0176] In the alternative, instead of a bacterium, each producer and/or target cell is an archaeal cell and instead of a phage there is a virus that is capable of infecting the archaeal cell (or each particle comprises a capsid (and optionally tail fibres) of such a virus).

    [0177] Optionally, the transduction particles are non-self replicative particles. A “non-self replicative transduction particle” refers to a particle, (eg, a phage or phage-like particle; or a particle produced from a genomic island (eg, a SaPI) or a modified version thereof) capable of delivering a nucleic acid molecule encoding an antibacterial agent or component into a bacterial cell, but does not package its own replicated genome into the transduction particle. In an alternative herein, instead of a phage, there is used or packaged a virus that infects an animal, human, plant or yeast target cell. For example, an adenovirus when the target cell is a human cell.

    [0178] Optionally, the genome of each particle is devoid of genes encoding phage structural proteins. These can be supplied instead by a helper phage during production. Optionally, the genome of each particle is devoid of one or more phage genes rinA, terS and terL.

    [0179] Optionally, the genomic island is an island that is naturally found in target and/or producer bacterial cells (and optionally in particles of the invention, the genomic island DNA comprises the NSI). In an example, the genomic island is selected from the group consisting of a SaPI, a SaPI1, a SaPI2, a SaPIbov1 and a SaPibov2 genomic island. For example, the island is a modified pathogenicity island. Optionally, the pathogenicity island is an island that is naturally found in target and/or producer bacterial cells, eg, a Staphylococcus SaPI or a Vibro PLE or a P. aeruginosa pathogenicity island (eg, a PAPI or a PAGI, eg, PAPI-1, PAGI-5, PAGI-6, PAGI-7, PAGI-8, PAGI-9, PAGI-10, or PAGI-11. Optionally, the pathogenicity island is a SaPI (S aureus pathogenicity island); optionally, a helper phage is used during production in this case, wherein the helper phage is ϕ11, 80α, ϕ12 or ϕSLT. Staphylococcus phage 80α appears to mobilise all known SaPIs. Thus, in an example, the genome of each particle comprises modified SaPI and the helper phage is a 80α. Optionally, the pathogenicity island is a V. cholerae PLE (phage-inducible chromosomal island-like element) and optionally the first phage is ICP1. Optionally, the pathogenicity island is a E coli PLE.

    [0180] Optionally, each particle genome comprises P4 DNA, eg, at least P4 packaging signal sequence. The particle may comprise DNA comprising a P4 packaging signal and the NSI or antibacterial means. In an embodiment, a helper phage is used to produce the particle, wherein the helper phage is a P2 phage or a modified P2 phage that is self-replicative defective; optionally present as a prophage in the producer cell genome.

    [0181] Optionally, the transcription of particle nucleic acid is under the control of a constitutive promoter, for transcription of copies of the antibacterial agent or component or NSI in a target cell. Optionally, Constitutive transcription and production in target cells may be used where the target cells should be killed, eg, in medical settings.

    [0182] Optionally, the transcription of particle nucleic acid is under the control of an inducible promoter, for transcription of copies of the antibacterial agent or component or NSI in a target cell. This may be useful, for example, to control switching on of the antibacterial activity against target bacterial cells, such as in an environment (eg, soil or water) or in an industrial culture or fermentation container containing the target cells. For example, the target cells may be useful in an industrial process (eg, for fermentation, eg, in the brewing or dairy industry) and the induction enables the process to be controlled (eg, stopped or reduced) by using the antibacterial agent against the target bacteria.

    [0183] When the agent comprises a plurality of components, eg, wherein the agent is a CRISPR/Cas system, or is a CRISPR array encoding crRNA or a nucleic acid encoding a guide RNA (eg, single guide RNA) operable with a Cas in target cells, wherein the crRNA or gRNA guides the Cas to a target sequence in the cell to modify the target (eg, cut it or repress transcription from it). Optionally, the genes are comprised by the target cell chromosome and/or one or more cell episome(s).

    [0184] Optionally, the agent is a guided nuclease system or a component thereof, wherein the agent is capable of recognising and cutting target cell DNA (eg, chromosomal DNA).

    In examples, such cutting causes one or more of the following:— [0185] (i) The target cell is killed by the antibacterial agent; [0186] (ii) growth or proliferation of the target cell is reduced; and/or [0187] (iii) The target cell is sensitised to an antibiotic, whereby the antibiotic is toxic to the cell.

    [0188] Optionally, the guided nuclease system is selected from a CRISPR/Cas system, TALEN system, meganuclease system or zinc finger system. Optionally, the system is a CRISPR/Cas system and each particle genome encodes a (a) CRISPR array encoding crRNA or (b) a nucleic acid encoding a guide RNA (gRNA, eg, single guide RNA), wherein the crRNA or gRNA is operable with a Cas in target cells, wherein the crRNA or gRNA guides the Cas to a target nucleic acid sequence in the target cell to modify the target sequence (eg, cut it or repress transcription from it). Optionally, the Cas is a Cas encoded by a functional endogenous nucleic acid of a target cell. For example, the target is comprised by a DNA or RNA of the target cell. Optionally, the system is a CRISPR/Cas system and each particle genome encodes a Cas (eg, a Cas nuclease) that is operable in a target bacterial cell to modify a target nucleic acid sequence comprised by the target cell.

    [0189] Any Cas herein may be a Cas3, Cas9, Cas13, CasX, CasY or Cpf1.

    [0190] Optionally, the system is a CRISPR/Cas system and each particle genome encodes one or more Cascade Cas (eg, Cas, A, B, C, D and E).

    [0191] Optionally, each particle genome further encodes a Cas3 that is operable in a target bacterial cell with the Cascade Cas.

    [0192] Optionally, the producer and/or target cell is a cell of a first species or strain, wherein the first species or strain is a gram positive species or strain.

    [0193] Optionally, the producer and/or target cell is a cell of a first species or strain, wherein the first species or strain is a gram negative species or strain.

    [0194] Optionally, the first species or strain is selected from Table 6 For example, the first species or strain is selected from Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter. These are species that P2 phage can infect. Thus, in an embodiment, the particle genome comprises one or more P4 sequences (eg, a P4 packaging sequence) and the genome is packaged by a P2 phage capsid. Thus, the genome is packaged by P2 structural proteins and the resultant transduction particles can usefully infect a broad spectrum of species, ie, two or more of Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter. This provides a broadly-applicable delivery platform, where target cell antibacterial specificity can be achieved by encoding on the particle genome guide RNA(s) that specifically target one or more predetermined species within the group of Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter.

    [0195] By “non-replicative” or “replicative-defective” it is meant that the particle is not capable by itself of self-replicating. For example, the particle genome is devoid of one or more nucleotide sequences encoding a protein (eg, a structural protein) that is necessary to produce a transduction particle.

    [0196] In an example, the reduction in growth or proliferation of target cells is at least 50, 60, 70, 80, 90 or 95%.

    [0197] In an example each producer cell and/or target cell is selected from a Staphylococcal, Vibrio, Pseudomonas, Clostridium, E coli, Helicobacter, Klebsiella and Salmonella cell.

    [0198] Optionally, each particle comprise a plasmid comprising [0199] a. A nucleotide sequence encoding an antibacterial agent or component thereof for expression in target bacterial cells; [0200] b. A constitutive promoter for controlling the expression of the agent or component; [0201] c. An optional terS nucleotide sequence; [0202] d. An origin of replication (on); and [0203] e. A phage packaging sequence (optionally pac, cos or a homologue thereof); and [0204] f. the plasmid being devoid of [0205] g. All nucleotide sequences encoding phage structural proteins necessary for the production of a transduction particle (optionally a phage), or the plasmid being devoid of at least one of such sequences; and [0206] h. Optionally terL.

    [0207] Optionally, the antibacterial agent is a CRISPR/Cas system and the plasmid encodes a crRNA or guide RNA (eg, single gRNA) that is operable with a Cas in the target cells to guide the Cas to a target nucleotide sequence to modify (eg, cut) the sequence, whereby [0208] (a) target cells are killed by the antibacterial agent; [0209] (b) growth or proliferation of target cells is reduced; or [0210] (c) target cells are sensitised to an antibiotic, whereby the antibiotic is toxic to the cells.

    [0211] Optionally, the antibacterial agent is a CRISPR/Cas system and the plasmid encodes a Cas that is operable with a crRNA or guide RNA (eg, single gRNA) in the target cells to guide the Cas to a target nucleotide sequence to modify (eg, cut) the sequence, whereby [0212] (a) target cells are killed by the antibacterial agent; [0213] (b) growth or proliferation of target cells is reduced; or [0214] (c) target cells are sensitised to an antibiotic, whereby the antibiotic is toxic to the cells.

    [0215] Optionally, the plasmid further encodes said crRNA or gRNA.

    [0216] A plurality of transduction particles obtainable by the method of the invention is provided for use in medicine, eg, for treating or preventing an infection of a human or animal subject by target bacterial cells, wherein transducing particles are administered to the subject for infecting target cells and killing the cells using the antibacterial agent.

    [0217] Optionally, the particles are for administration to a human or animal for medical use.

    Further Concepts of the invention are as follows:—

    [0218] The present invention is optionally for an industrial or domestic use, or is used in a method for such use. For example, it is for or used in agriculture, oil or petroleum industry, food or drink industry, clothing industry, packaging industry, electronics industry, computer industry, environmental industry, chemical industry, aeorspace industry, automotive industry, biotechnology industry, medical industry, healthcare industry, dentistry industry, energy industry, consumer products industry, pharmaceutical industry, mining industry, cleaning industry, forestry industry, fishing industry, leisure industry, recycling industry, cosmetics industry, plastics industry, pulp or paper industry, textile industry, clothing industry, leather or suede or animal hide industry, tobacco industry or steel industry.

    [0219] The present invention is optionally for use in an industry or the environment is an industrial environment, wherein the industry is an industry of a field selected from the group consisting of the medical and healthcare; pharmaceutical; human food; animal food; plant fertilizers; beverage; dairy; meat processing; agriculture; livestock farming; poultry fanning; fish and shellfish fanning; veterinary; oil; gas; petrochemical; water treatment; sewage treatment; packaging; electronics and computer; personal healthcare and toiletries; cosmetics; dental; non-medical dental; ophthalmic; non-medical ophthalmic; mineral mining and processing; metals mining and processing; quarrying; aviation; automotive; rail; shipping; space; environmental; soil treatment; pulp and paper; clothing manufacture; dyes; printing; adhesives; air treatment; solvents; biodefence; vitamin supplements; cold storage; fibre retting and production; biotechnology; chemical; industrial cleaning products; domestic cleaning products; soaps and detergents; consumer products; forestry; fishing; leisure; recycling; plastics; hide, leather and suede; waste management; funeral and undertaking; fuel; building; energy; steel; and tobacco industry fields.

    [0220] In an example, each particle genome comprises a CRISPR array that encodes a respective guide RNA that targets target bacteria, wherein the array comprises one, or two or more spacers (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 or more spacers) for targeting the genome of target bacteria.

    [0221] In an example, the target bacteria are comprised by an environment as follows. In an example, the environment is a microbiome of a human, eg, the oral cavity microbiome or gut microbiome or the bloodstream. In an example, the environment is not an environment in or on a human. In an example, the environment is not an environment in or on a non-human animal. In an embodiment, the environment is an air environment. In an embodiment, the environment is an agricultural environment. In an embodiment, the environment is an oil or petroleum recovery environment, eg, an oil or petroleum field or well. In an example, the environment is an environment in or on a foodstuff or beverage for human or non-human animal consumption.

    [0222] In an example, the environment is a human or animal microbiome (eg, gut, vaginal, scalp, armpit, skin or oral cavity microbiome). In an example, the target bacteria are comprised by a human or animal microbiome (eg, gut, vaginal, scalp, armpit, skin or oral cavity microbiome).

    [0223] In an example, the particles, population or composition of the invention are administered intranasally, topically or orally to a human or non-human animal, or is for such administration. The skilled person aiming to treat a microbiome of the human or animal will be able to determine the best route of administration, depending upon the microbiome of interest. For example, when the microbiome is a gut microbiome, administration can be intranasally or orally. When the microbiome is a scalp or armpit microbiome, administration can be topically. When the microbiome is in the mouth or throat, the administration can be orally.

    [0224] In any use or method herein, in an embodiment particles of the invention are contacted with the target bacteria at a multiplicity of infection (MOI) of at least 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600 or 700. For example, the MOI is from 20 to 200, from 20 to 100, fro 50 to 200, from 50 to 100, from 75 to 150, 100 or about 100, or 200 or about 200. In an example, this may be determined by obtaining a sample of the microbiome containing the target bacteria (eg, a sample of a waterway or gut microbiome of a subject) and determining the number of CFU/ml or mg in the sample and using this to titrate the phage dose at the desired MOI to be exposed to the microbiome or administered to the environment or subject to be treated.

    [0225] In an example, the environment is harboured by a beverage or water (eg, a waterway or drinking water for human consumption) or soil. The water is optionally in a heating, cooling or industrial system, or in a drinking water storage container.

    [0226] In an example, the producer and/or target bacteria are Firmicutes selected from Anaerotruncus, Acetanaerobacterium, Acetitomaculum, Acetivibrio, Anaerococcus, Anaerofilum, Anaerosinus, Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium, Capracoccus, Dehalobacter, Dialister, Dorea, Enterococcus, Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter, Guggenheimella, Hespellia, Lachnobacterium, Lachnospira, Lactobacillus, Leuconostoc, Megamonas, Moryella, Mitsuokella, Oribacterium, Oxobacter, Papillibacter, Proprionispira, Pseudobutyrivibrio, Pseudoramibacter, Roseburia, Ruminococcus, Sarcina, Seinonella, Shuttleworthia, Sporobacter, Sporobacterium, Streptococcus, Subdoligranulum, Syntrophococcus, Thermobacillus, Turibacter and Weisella.

    [0227] In an example, the particles, population, composition, use or method is for reducing pathogenic infections or for re-balancing gut or oral microbiota eg, for treating or preventing obesity or disease in a human or animal. For example, the particles, population, composition, use or method is for knocking-down Clostridium dificile or E col bacteria in a gut microbiota of a human or animal.

    [0228] In an example, the disease or condition is a cancer, inflammatory or autoimmune disease or condition, eg, obesity, diabetes, IBD (eg, wherein the target cell is an E coli or Klebsiella cell), a GI tract condition or an oral cavity condition.

    [0229] Optionally, the environment is comprised by, or the target bacteria are comprised by, a gut microbiota, skin microbiota, oral cavity microbiota, throat microbiota, hair microbiota, armpit microbiota, vaginal microbiota, rectal microbiota, anal microbiota, ocular microbiota, nasal microbiota, tongue microbiota, lung microbiota, liver microbiota, kidney microbiota, genital microbiota, penile microbiota, scrotal microbiota, mammary gland microbiota, ear microbiota, urethra microbiota, labial microbiota, organ microbiota or dental microbiota. Optionally, the environment is comprised by, or the target bacteria are comprised by, a plant (eg, a tobacco, crop plant, fruit plant, vegetable plant or tobacco, eg on the surface of a plant or contained in a plant) or by an environment (eg, soil or water or a waterway or aqueous liquid).

    [0230] Optionally, the disease or condition of a human or animal subject is selected from [0231] (a) A neurodegenerative disease or condition; [0232] (b) A brain disease or condition; [0233] (c) A CNS disease or condition; [0234] (d) Memory loss or impairment; [0235] (e) A heart or cardiovascular disease or condition, eg, heart attack, stroke or atrial fibrillation; [0236] (f) A liver disease or condition; [0237] (g) A kidney disease or condition, eg, chronic kidney disease (CKD); [0238] (h) A pancreas disease or condition; [0239] (i) A lung disease or condition, eg, cystic fibrosis or COPD; [0240] (j) A gastrointestinal disease or condition; [0241] (k) A throat or oral cavity disease or condition; [0242] (l) An ocular disease or condition; [0243] (m) A genital disease or condition, eg, a vaginal, labial, penile or scrotal disease or condition; [0244] (n) A sexually-transmissible disease or condition, eg, gonorrhea, HIV infection, syphilis or Chlamydia infection; [0245] (o) An ear disease or condition; [0246] (p) A skin disease or condition; [0247] (q) A heart disease or condition; [0248] (r) A nasal disease or condition [0249] (s) A haematological disease or condition, eg, anaemia, eg, anaemia of chronic disease or cancer, [0250] (t) A viral infection; [0251] (u) A pathogenic bacterial infection; [0252] (v) A cancer; [0253] (w) An autoimmune disease or condition, eg, SLE; [0254] (x) An inflammatory disease or condition, eg, rheumatoid arthritis, psoriasis, eczema, asthma, ulcerative colitis, colitis, Crohn's disease or IBD; [0255] (y) Autism; [0256] (z) ADHD; [0257] (aa) Bipolar disorder; [0258] (bb) ALS [Amyotrophic Lateral Sclerosis]; [0259] (cc) Osteoarthritis; [0260] (dd) A congenital or development defect or condition; [0261] (ee) Miscarriage; [0262] (ff) A blood clotting condition; [0263] (gg) Bronchitis; [0264] (hh) Dry or wet AMD; [0265] (ii) Neovascularisation (eg, of a tumour or in the eye); [0266] (ij) Common cold; [0267] (kk) Epilepsy; [0268] (ll) Fibrosis, eg, liver or lung fibrosis; [0269] (mm) A fungal disease or condition, eg, thrush; [0270] (nn) A metabolic disease or condition, eg, obesity, anorexia, diabetes, Type I or Type II diabetes. [0271] (oo) Ulcer(s), eg, gastric ulceration or skin ulceration; [0272] (pp) Dry skin, [0273] (qq) Sjogren's syndrome; [0274] (rr) Cytokine storm; [0275] (ss) Deafness, hearing loss or impairment; [0276] (tt) Slow or fast metabolism (ie, slower or faster than average for the weight, sex and age of the subject); [0277] (uu) Conception disorder, eg, infertility or low fertility; [0278] (vv) Jaundice; [0279] (ww) Skin rash, [0280] (xx) Kawasaki Disease; [0281] (yy) Lyme Disease; [0282] (zz) An allergy, eg, a nut, grass, pollen, dust mite, cat or dog fur or dander allergy; [0283] (aaa) Malaria, typhoid fever, tuberculosis or cholera; [0284] (bbb) Depression; [0285] (ccc) Mental retardation; [0286] (ddd) Microcephaly; [0287] (eee) Malnutrition; [0288] (fff) Conjunctivitis; [0289] (ggg) Pneumonia; [0290] (hhh) Pulmonary embolism; [0291] (iii) Pulmonary hypertension; [0292] (jjj) A bone disorder; [0293] (kkk) Sepsis or septic shock; [0294] (lll) Sinusitis; [0295] (mmm) Stress (eg, occupational stress); [0296] (nnn) Thalassemia, anaemia, von Willebrand Disease, or haemophilia; [0297] (ooo) Shingles or cold sore; [0298] (ppp) Menstruation; [0299] (qqq) Low sperm count.

    [0300] Neurodegenerative or CNS Diseases or Conditions for Treatment or Prevention by the Invention

    [0301] In an example, the neurodegenerative or CNS disease or condition is selected from the group consisting of Alzheimer disease, geriopsychosis, Down syndrome, Parkinson's disease, Creutzfeldt-jakob disease, diabetic neuropathy, Parkinson syndrome, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, diabetic neuropathy, and Creutzfeldt Creutzfeldt-Jakob disease. For example, the disease is Alzheimer disease. For example, the disease is Parkinson syndrome.

    [0302] In an example, wherein the method of the invention is practised on a human or animal subject for treating a CNS or neurodegenerative disease or condition, the method causes downregulation of Treg cells in the subject, thereby promoting entry of systemic monocyte-derived macrophages and/or Treg cells across the choroid plexus into the brain of the subject, whereby the disease or condition (eg, Alzheimer's disease) is treated, prevented or progression thereof is reduced. In an embodiment the method causes an increase of IFN-gamma in the CNS system (eg, in the brain and/or CSF) of the subject. In an example, the method restores nerve fibre and/or reduces the progression of nerve fibre damage. In an example, the method restores nerve myelin and/or reduces the progression of nerve myelin damage. In an example, the method of the invention treats or prevents a disease or condition disclosed in WO2015136541 and/or the method can be used with any method disclosed in WO2015136541 (the disclosure of this document is incorporated by reference herein in its entirety, eg, for providing disclosure of such methods, diseases, conditions and potential therapeutic agents that can be administered to the subject for effecting treatment and/or prevention of CNS and neurodegenerative diseases and conditions, eg, agents such as immune checkpoint inhibitors, eg, anti-PD-1, anti-PD-LI, anti-TIM3 or other antibodies disclosed therein).

    [0303] Cancers for Treatment or Prevention by the Method

    [0304] Cancers that may be treated include tumours that are not vascularized, or not substantially vascularized, as well as vascularized tumours. The cancers may comprise non-solid tumours (such as haematological tumours, for example, leukaemias and lymphomas) or may comprise solid tumours. Types of cancers to be treated with the invention include, but are not limited to, carcinoma, blastoma, and sarcoma, and certain leukaemia or lymphoid malignancies, benign and malignant tumours, and malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumours/cancers and paediatric tumours/cancers are also included.

    [0305] Haematologic cancers are cancers of the blood or bone marrow. Examples of haematological (or haematogenous) cancers include leukaemias, including acute leukaemias (such as acute lymphocytic leukaemia, acute myelocytic leukaemia, acute myelogenous leukaemia and myeloblasts, promyeiocytic, myelomonocytic, monocytic and erythroleukaemia), chronic leukaemias (such as chronic myelocytic (granulocytic) leukaemia, chronic myelogenous leukaemia, and chronic lymphocytic leukaemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myeiodysplastic syndrome, hairy cell leukaemia and myelodysplasia.

    [0306] Solid tumours are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumours can be benign or malignant. Different types of solid tumours are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumours, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumour, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous eel! carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumour, cervical cancer, testicular tumour, seminoma, bladder carcinoma, melanoma, and CNS tumours (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medu!loblastoma, Schwannoma craniopharyogioma, ependymoma, pineaioma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).

    [0307] Autoimmune Diseases for Treatment or Prevention by the Method [0308] 1. Acute Disseminated Encephalomyelitis (ADEM) [0309] 2. Acute necrotizing hemorrhagic leukoencephalitis [0310] 3. Addison's disease [0311] 4. Agammaglobulinemia [0312] 5. Alonecia areata [0313] 6. Amyloidosis [0314] 7. Ankylosing spondylitis [0315] 8. Anti-GBM/Anti-TBM nephritis [0316] 9. Antiphospholipid syndrome (APS) [0317] 10. Autoimmune angioedema [0318] 11. Autoimmune aplastic anemia [0319] 12. Autoimmune dysautonomia [0320] 13. Autoimmune hepatitis [0321] 14. Autoimmune hyperlipidemia [0322] 15. Autoimmune immunodeficiency [0323] 16. Autoimmune inner ear disease (AIED) [0324] 17. Autoimmune myocarditis [0325] 18. Autoimmune oophoritis [0326] 19. Autoimmune pancreatitis [0327] 20. Autoimmune retinopathy [0328] 21. Autoimmune thrombocytopenic purpura (ATP) [0329] 22. Autoimmune thyroid disease [0330] 23. Autoimmune urticaria [0331] 24. Axonal & neuronal neuropathies [0332] 25. Balo disease [0333] 26. Behcet's disease [0334] 27. Bullous pemphigoid [0335] 28. Cardiomyopathy [0336] 29. Castleman disease [0337] 30. Celiac disease [0338] 31. Chagas disease [0339] 32. Chronic fatigue syndrome [0340] 33. Chronic inflammatory demyelinating polyneuropathy (CIDP) [0341] 34. Chronic recurrent multifocal ostomyelitis (CRMO) [0342] 35. Churg-Strauss syndrome [0343] 36. Cicatricial pemphigoid/benign mucosal pemphigoid [0344] 37. Crohn's disease [0345] 38. Cogans syndrome [0346] 39. Cold agglutinin disease [0347] 40. Congenital heart block [0348] 41. Coxsackie myocarditis [0349] 42. CREST disease [0350] 43. Essential mixed cryoglobulinemia [0351] 44. Demyelinating neuropathies [0352] 45. Dermatitis herpetiformis [0353] 46. Dermatomyositis [0354] 47. Devic's disease (neuromyelitis optica) [0355] 48. Discoid lupus [0356] 49. Dressler's syndrome [0357] 50. Endometriosis [0358] 51. Eosinophilic esophagitis [0359] 52. Eosinophilic fasciitis [0360] 53. Erythema nodosum [0361] 54. Experimental allergic encephalomyelitis [0362] 55. Evans syndrome [0363] 56. Fibromyalgia [0364] 57. Fibrosing alveolitis [0365] 58. Giant cell arteritis (temporal arteritis) [0366] 59. Giant cell myocarditis [0367] 60. Glomerulonephritis [0368] 61. Goodpasture's syndrome [0369] 62. Granulomatosis with Polyangiitis (GPA) (formerly called Wegener's Granulomatosis) [0370] 63. Graves' disease [0371] 64. Guillain-Barre syndrome [0372] 65. Hashimoto's encephalitis [0373] 66. Hashimoto's thyroiditis [0374] 67. Hemolytic anemia [0375] 68. Henoch-Schonlein purpura [0376] 69. Herpes gestationis [0377] 70. Hypogammaglobulinemia [0378] 71. Idiopathic thrombocytopenic purpura (ITP) [0379] 72. IgA nephropathy [0380] 73. IgG4-related sclerosing disease [0381] 74. Immunoregulatory lipoproteins [0382] 75. Inclusion body myositis [0383] 76. Interstitial cystitis [0384] 77. Juvenile arthritis [0385] 78. Juvenile diabetes (Type 1 diabetes) [0386] 79. Juvenile myositis [0387] 80. Kawasaki syndrome [0388] 81. Lambert-Eaton syndrome [0389] 82. Leukocytoclastic vasculitis [0390] 83. Lichen planus [0391] 84. Lichen sclerosus [0392] 85. Ligneous conjunctivitis [0393] 86. Linear IgA disease (LAD) [0394] 87. Lupus (SLE) [0395] 88. Lyme disease, chronic [0396] 89. Meniere's disease [0397] 90. Microscopic polyangiitis [0398] 91. Mixed connective tissue disease (MCTD) [0399] 92. Mooren's ulcer [0400] 93. Mucha-Habermann disease [0401] 94. Multiple sclerosis [0402] 95. Myasthenia gravis [0403] 96. Myositis [0404] 97. Narcolepsy [0405] 98. Neuromyelitis optica (Devic's) [0406] 99. Neutropenia [0407] 100. Ocular cicatricial pemphigoid [0408] 101. Optic neuritis [0409] 102. Palindromic rheumatism [0410] 103. PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus) [0411] 104. Paraneoplastic cerebellar degeneration [0412] 105. Paroxysmal nocturnal hemoglobinuria (PNH) [0413] 106. Parry Romberg syndrome [0414] 107. Parsonnage-Turner syndrome [0415] 108. Pars planitis (peripheral uveitis) [0416] 109. Pemphigus [0417] 110. Peripheral neuropathy [0418] 111. Perivenous encephalomyelitis [0419] 112. Pernicious anemia [0420] 113. POEMS syndrome [0421] 114. Polyarteritis nodosa [0422] 115. Type I. II. & III autoimmune polyglandular syndromes [0423] 116. Polymyalgia rheumatica [0424] 117. Polymyositis [0425] 118. Postmyocardial infarction syndrome [0426] 119. Postpericardiotomy syndrome [0427] 120. Progesterone dermatitis [0428] 121. Primary biliary cirrhosis [0429] 122. Primary sclerosing cholangitis [0430] 123. Psoriasis [0431] 124. Psoriatic arthritis [0432] 125. Idiopathic pulmonary fibrosis [0433] 126. Pyoderma gangrenosum [0434] 127. Pure red cell aplasia [0435] 128. Raynauds phenomenon [0436] 129. Reactive Arthritis [0437] 130. Reflex sympathetic dystrophy [0438] 131. Reiter's syndrome [0439] 132. Relapsing polychondritis [0440] 133. Restless legs syndrome [0441] 134. Retroperitoneal fibrosis [0442] 135. Rheumatic fever [0443] 136. Rheumatoid arthritis [0444] 137. Sarcoidosis [0445] 138. Schmidt syndrome [0446] 139. Scleritis [0447] 140. Scleroderma [0448] 141. Sjogren's syndrome [0449] 142. Sperm & testicular autoimmunity [0450] 143. Stiff person syndrome [0451] 144. Subacute bacterial endocarditis (SBE) [0452] 145. Susac's syndrome [0453] 146. Sympathetic ophthalmia [0454] 147. Takayasu's arteritis [0455] 148. Temporal arteritis/Giant cell arteritis [0456] 149. Thrombocytopenic purpura (TTP) [0457] 150. Tolosa-Hunt syndrome [0458] 151. Transverse myelitis [0459] 152. Type 1 diabetes [0460] 153. Ulcerative colitis [0461] 154. Undifferentiated connective tissue disease (UCTD) [0462] 155. Uveitis [0463] 156. Vasculitis [0464] 157. Vesiculobullous dermatosis [0465] 158. Vitiligo [0466] 159. Wegener's granulomatosis (now termed Granulomatosis with Polyangiitis (GPA).

    [0467] Inflammatory Diseases for Treatment or Prevention by the Method [0468] 1. Alzheimer [0469] 2. ankylosing spondylitis [0470] 3. arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis) [0471] 4. asthma [0472] 5. atherosclerosis [0473] 6. Crohn's disease [0474] 7. colitis [0475] 8. dermatitis [0476] 9. diverticulitis [0477] 10. fibromyalgia [0478] 11. hepatitis [0479] 12. irritable bowel syndrome (IBS) [0480] 13. systemic lupus erythematous (SLE) [0481] 14. nephritis [0482] 15. Parkinson's disease [0483] 16. ulcerative colitis.

    [0484] In an example, any composition of the invention comprises at least 1×10.sup.3 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises at least 1×10.sup.4 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.5 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.6 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.7 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.8 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.9 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.10 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.11 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.12 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.13 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.14 transduction particles of the invention per ml or mg.

    [0485] In an example, any composition of the invention comprises up to 1×10.sup.14 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises up to 1×10.sup.13 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×10.sup.12 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×10.sup.11 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×10.sup.10 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×10.sup.9 transduction particles of the invention per ml or mg.

    [0486] In an example, any composition of the invention comprises at least 1×10.sup.3 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises at least 1×10.sup.4 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.5 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.6 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.7 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.8 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.9 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.10 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.11 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.12 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.13 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×10.sup.14 to 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13 or 1×10.sup.14 transduction particles of the invention per ml or mg.

    [0487] In an example, the composition comprises one or more doses of the transduction particles of the invention for administration to a subject for medical use, eg, to treat or prevent a disease or condition in the subject. In an example, the composition comprises a single dose. In an example, the composition comprises (or comprises at least) 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 doses. In an example, each dose is (or is at least) a 0.5, 1, 2, 3, 4, 5, 10, 20, 25, 30, 40, 50, 75, 100, 125, 200 or 250 mg or ml dose comprising said phage (ie, the dose is said amount and comprises phage and an excipient, diluent or carrier for example).

    [0488] In an example, the composition comprises one or more doses of the transduction particles of the invention for administration to a subject for non-medical use, eg, for agricultural use. In an example, the composition comprises a single dose. In an example, the composition comprises (or comprises at least) 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 doses. In an example, each dose is (or is at least) a 0.5, 1, 2, 3, 4, 5, 10, 20, 25, 30, 40, 50, 75, 100, 125, 200, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 10000, 50000, 100000 mg or ml dose comprising said phage (ie, the dose is said amount and comprises phage and an excipient, diluent or carrier for example). The dose may be dissolved or diluted in a solvent (eg, an aqueous solvent or water) before use for contacting with target bacteria. In an example 1 imperial gallon comprises one dose of the transduction particles of the invention, eg, for agricultural use, such as crop spraying, or for animal or livestock use, such as use as a beverage.

    [0489] Optionally, the NSI is comprised by a high copy number plasmid. Optionally, the NSI is comprised by a medium copy number plasmid. The meaning of low, medium and high copy number or and plasmids is known to the skilled addressee and these are terms of art. As is known by the skilled person, copy number denotes the average number of plasmid copies per cell. For example, a low copy number plasmid is a plasmid that exists in from 1 to 10 copies per bacterial cell in which the plasmid is harboured; a medium copy number plasmid exists in from 11 to 50 (eg, 11 to 40 or 20 to 30 or 40) copies per cell; and a high copy number is >50 (eg, up to 100, 200, 250, 300, 400, 500, 600 or 700) copies per cell. In an example, the plasmid or vector comprising first DNA is a medium copy number plasmid or vector. In an example, the plasmid or vector comprising first DNA is a high copy number plasmid or vector. An example of common on and plasmids is shown in Table 8.

    Examples

    Example 1: Increased Production of Transduction Particles by Inhibition of Phage Re-Absorption

    BACKGROUND

    [0490] This study relates to the production of transduction particles which contain a DNA sequence of interest, where the particles can usefully be used to infect target bacteria in to introduce the DNA for expression in the target bacteria. These particles can inject their DNA into the same set of bacterial strains as the original phage on which the particle design is based. Binding of the phage particles to the host cell requires the presence of one or more specific molecules on the surface of the cell, providing a phage receptor. We surprisingly see a very large increase in yield of particle production. Whilst not wishing to be bound by any theory, elimination of the phage receptor from the surface of the producer cells may prevent re-absorption of the produced particles thus increasing production yield significantly.

    Methods & Results

    [0491] We used the well-studied P2 phage/Escherichia coli system as a model. To identify P2 receptor mutants, we tested a set of single knockout mutants from the KEIO collection (“Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection”, Tomoya Baba et al, DOI 10.1038/msb4100050, Molecular Systems Biology (2006) 2, 2006.0008) for P2 plaque formation in a standard soft agar overlay spot test. LB agar was prepared in petri dishes and covered by 3 ml soft agar overlay (LB+0.6% agar) containing 100 ul overnight cell culture. P2 vir phage lysate was spotted on the plates and after overnight incubation at 37° C. the plates were checked for plaque formation. We found that P2 does not plaque on a set of rfa mutants involved in LPS core biosynthesis (FIG. 1).

    [0492] To construct a receptor deletion mutant for further studies, we replaced the rfaD gene with a zeocin resistance marker in the E. coli C1a P2 lysogen using the Lambda Red system (“One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products”, Kirill A. Datsenko and Barry L. Wanner, PNAS Jun. 6, 2000 97 (12) 6640-6645; https://doi.org/10.1073/pnas.120163297). The zeocin marker of plasmid pEM7/zeo (Invitrogen) was PCR amplified using the primers rfaDupR (SEQ ID NO: 1) and rfaDdnR (SEQ ID NO: 2). E. coli C1a P2 lysogen cells were transformed with the plasmid pKD46 (GenBank: MF287367.1), carrying the Lambda Red system. The transformants were grown at 30° C. to mid log phase in LB containing 100 ug/ml ampicillin and induced with 0.4% arabinose for 2 h. Cells were washed with 20% glycerol and electroporated with the PCR fragment containing the zeo marker.

    [0493] Recombinants were selected on LB zeo plates at 37° C., also eliminating the pKD46 plasmid, which has a temperature sensitive replication. Proper replacement of the rfaD gene with a zeo marker was sequence verified.

    [0494] Both the parental strain (C1a P2 lysogen) and the receptor mutant (C1a P2 lysogen ΔrfaD) were transformed with a plasmid, containing (i) the arabinose inducible P4 phage transactivation region (to induce the P2 helper functions), (ii) the P4 packaging site, (iii) a spectinomycin resistance marker, and (iv) the CloDF13 replication origin.

    [0495] To compare the yield of the transduction particles obtained in the two strains, overnight cell cultures were diluted 1:25 in LB medium containing 50 μg/ml Spectinomycin, 10 mM MgSO.sub.4, and 5 mM CaCl.sub.2. After 90 minutes shaking at 37° C., 0.8% arabinose was added to the cultures. Due to the induction of the chromosomal P2 phage, cells lysed after 3 hours. Cell debris was removed by centrifugation and the lysate was extracted with chloroform to remove any remaining cells.

    [0496] The yield of production was quantified by measuring transduction of the spectinomycin marker. The lysates were serially diluted in LB medium containing 10 mM MgSO.sub.4, and 5 mM CaCl.sub.2 (10-fold steps) in 100 μl volume and the dilutions were mixed with 100 μl overnight E. coli C1a cell cultures. After 30 minutes at 37° C., 10 μl of each sample was spotted on LB spectinomycin plates. Colonies were counted after overnight incubation. Results are shown in FIG. 2.

    Conclusion:

    [0497] Removal of the phage receptor surprisingly increased the yield of transduction particles by more than 100 times. Therefore, this invention can greatly reduce the production cost of transduction particles or phages.

    TABLE-US-00001 TABLE 1 Phages Family Main host Recetpor(s) References γ Siphoviridae Bacillus anthracis Membrane surface-anchored protein Davison et al. (2005) gamma phage receptor (GamR) SPP1 Siphoviridae Bacillus subtilis Glucosyl residues of poly(glycerophosphate) São-José, Baptista on WTA for reversible binding and and Santos (2004), membrane protein YueB for Baptista, Santos irreversible binding and São-José (2008) ϕ29 Podoviridae Bacillus subtilis Cell WTA (primary receptor) Xiang et al. (2009) Bam35 Tectiviridae Bacillus thuringiensis N-acetyl-muramic acid (MurNAc) of Gaidelyte et al. (2006) peptidoglycan in the cell wall LL-H Siphoviridae Lactobacillus delbrueckii Glucose moiety of LTA for reversible Munsch-Alatossava adsorption and negatively charged and Alatossava (2013) glycerol phosphate group of the LTA for irreversible binding B1 Siphoviridae Lactobacillus plantarum Galactose component of the Douglas and Wolin (1971) wall polysaccharide B2 Siphoviridae Lactobacillus plantarum Glucose substituents in teichoic acid Douglas and Wolin (1971) 513c2hml3khL Siphoviridae Lactococcus lactis Rhamnose.sup.a moieties in Monteville, Ardestani the cell wall peptidoglycan for reversible and Geller (1994) binding and membrane phage infection protein (PIP) for irreversible binding ϕLC3TP901ermTP901-1 Siphoviridae Lactococcus lactis Cell wall polysaccharides Ainsworth, Sadovskaya and Vinogradov (2014) p2 Siphoviridae Lactococcus lactis Cell wall saccharides for reversible Bebeacua et al. (2013) attachment and pellicle.sup.bphosphohexasaccharide motifs for irreversible adsorption A511 Myoviridae Listeria monocytogenes Peptidoglycan (murein) Wendlinger, Loessner and Scherer (1996) A118 Siphoviridae Listeria monocytogenes Glucosaminyl and rhamnosyl components of Wendlinger, Loessner ribitol teichoic acid and Scherer (1996) A500 Siphoviridae Listeria monocytogenes Glucosaminyl residues in teichoic acid Wendlinger, Loessner and Scherer (1996) ϕ812ϕK Myoviridae Staphylococcus aureus Anionic backbone of WTA Xia et al. (2011) 52A Siphoviridae Staphylococcus aureus O-acetyl group from the 6-position of muramic Shaw and Chatterjee (1971) acid residues in murein Wϕ13ϕ47ϕ77ϕSa2m Siphoviridae Staphylococcus aureus N-acetylglucosamine (GlcNAc) Xia et al. (2011) glycoepitope on WTA ϕSLT Siphoviridae Staphylococcus aureus Poly(glycerophosphate) moiety of LTA Kaneko et al. (2009) .sup.aMonteville, Ardestani and Geller (1994) noted that since phages can also bind to glucose and galactose moieties in the cell wall, these might, to a lesser extent, be involved in the adsorption mechanism; .sup.bPellicle is a protective polysaccharide layer that covers the cell surface of Lactococcus lactis(Chapot-Chartier et al. 2010).

    TABLE-US-00002 TABLE 2 Receptors in the cell wall of Gram-negative bacteria. Host names are ordered alphabetically. Phages Family Main host Receptor(s) References (a) Receptors that bind to RBP of phages ϕCr30 Myoviridae Caulobacter crescentus Paracrystalline surface Edwards and Smit (1991) (S) layer protein 434 Siphoviridae Escherichia coli Protein Ib (OmpC) Hantke (1978) BF23 Siphoviridae Escherichia coli Protein BtuB (vitamin Bradbeer, Woodrow and B.sub.12 receptor) Khalifah (1976) K3 Myoviridae Escherichia coli Protein d or 3A (OmpA) with LPS Skurray, Hancock and Reeves (1974); Manning and Reeves (1976); Van Alphen, Havekes and Lugtenberg (1977) K10 Siphoviridae Escherichia coli Outer membrane protein LamB Roa (1979) (maltodextran selective channel) Me1 Myoviridae Escherichia coli Protein c (OmpC) Verhoef, de Graaff and Lugtenberg (1977) Mu G(+) Myoviridae Escherichia coli Terminal Glcα-2Glcα1- or Sandulache, GlcNAcα1-2Glcα1- of the LPS Prehm and Kamp (1984) Mu G(−) Myoviridae Escherichia coli Terminal glucose with Sandulache et al. (1985) a βl,3 glycosidic linkage Erwinia Terminal glucose linked in βl,6 configuration M1 Myoviridae Escherichia coli Protein OmpA Hashemolhosseini et al. (1994) Ox2 Myoviridae Escherichia coli Protein OmpA.sup.a Morona and Henning (1984) ST-1 Microviridae Escherichia coli Terminal Glcα-2Glcα1- Sandulache, or GlcNAcα1- Prehm and Kamp (1984) 2Glcα1- of the LPS TLS Siphoviridae Escherichia coli Antibiotic efflux protein TolC German and and the inner core of LPS Misra (2001) TuIa Myoviridae Escherichia coli Protein Ia (OmpF) Datta, Arden and with LPS Henning (1977) TuIb Myoviridae Escherichia coli Protein Ib (OmpC) with LPS TuII* Myoviridae Escherichia coli Protein II* (OmpA) with LPS T1 Siphoviridae Escherichia coli Proteins TonA (FhuA, involved in Hantke and Braun (1975, 1978); ferrichrome uptake) and TonB.sup.b Hancock and Braun (1976) T2 Myoviridae Escherichia coli Protein Ia (OmpF) with Hantke (1978); Morona and LPS and the outer Henning (1986); Black (1988) membrane protein FadL (involved in the uptake of long-chain fatty acids) T3 Podoviridae Escherichia coli Glucosyl-α-1,3-glucose Prehm et al. (1976) terminus of rough LPS T4 Myoviridae Escherichia coliK-12 Protein O-8 (OmpC) with LPS Prehm et al. (1976); Mutoh, Furukawa and Mizushima (1978); Goldberg, Grinius and Letellier (1994) Escherichia coli B Glucosyl-α-1,3-glucose terminus of rough LPS T5 Siphoviridae Escherichia coli Polymannose sequence in the Braun and Wolff (1973); O-antigen and protein FhuA Braun, Schaller and Wolff (1973); Heller and Braun (1982) T6 Myoviridae Escherichia coli Outer membrane protein Tsx Manning and Reeves (1976, 1978) (involved in nucleoside uptake) T7 Podoviridae Escherichia coli LPS.sup.c Lindberg (1973) U3 Microviridae Escherichia coli Terminal galactose residue in LPS Picken and Beacham (1977) λ Siphoviridae Escherichia coli Protein LamB Randall-Hazelbauer and Schwartz (1973) ϕX174 Microviridae Escherichia coli Terminal galactose in the core Feige and Stirm (1976) oligosaccharide of rough LPS ϕ80 Siphoviridae Escherichia coli Proteins FhuA and TonB.sup.b Hantke and Braun (1975, 1978); Wayne and Neilands (1975); Hancock and Braun (1976) PM2 Corticoviridae Pseudoalteromonas Sugar moieties on the Kivela et al. (2008) cell surface.sup.d E79 Myoviridae Pseudomonas aeruginosa Core polysaccharide of LPS Meadow and Wells (1978) JG004 Myoviridae Pseudomonas aeruginosa LPS Garbe et al. (2011) ϕCTX Myoviridae Pseudomonas aeruginosa Core polysaccharide of Yokota, Hayashi LPS, with emphasis and Matsumoto (1994) on L-rhamnose and D-glucose residues in the outer core ϕPLS27 Podoviridae Pseudomonas aeruginosa Galactosamine-alanine region Jarrell and Kropinski (1981) of the LPS core ϕ13 Cystoviridae Pseudomonas syringae Truncated O-chain of LPS Mindich et al. (1999); Daugelavicius et al. (2005) ES18 Siphoviridae Salmonella Protein FhuA Killmann et al. (2001) Gifsy-1Gifsy-2 Siphoviridae Salmonella Protein OmpC Ho and Slauch (2001) SPC35 Siphoviridae Salmonella BtuB as the main receptor Kim and Ryu (2012) and O12-antigen as adsorption-assisting apparatus SPN1SSPN2TCWSPN4B Podoviridae Salmonella O-antigen of LPS Shin et al. (2012) SPN6TCW SPN8TCW SPN9TCW SPN13U SPN7CSPN9C SPN10H Siphoviridae Salmonella Protein BtuB SPN12C SPN14 SPN17T SPN18 vB_SenM-S16 (S16) Myoviridae Salmonella Protein OmpC Marti et al. (2013) L-413CP2 vir1 Myoviridae Yersinia pestis Terminal GlcNAc residue Filippov et al. (2011) of the LPS outer core. HepII/HepIII and HepI/Glc residues are also involved in receptor activity.sup.e ϕJA1 Myoviridae Yersinia pestis Kdo/Ko pairs of inner core residues. LPS outer and inner core sugars are also involved in receptor activity.sup.e T7.sub.YpY (YpP-Y) Podoviridae Yersinia pestis HepI/Glc pairs of inner core residues. HepII/HepIII and Kdo/Ko pairs are also involved in receptor activity.sup.e Pokrovskaya Podoviridae Yersinia pestis HepII/HepIII pairs of YepE2YpP-G inner core residues. HepI/Glc residues are also involved in receptor activity.sup.e ϕA1122 Podoviridae Yersinia pestis Kdo/Ko pairs of inner core residues. HepI/Glc residues are also involved in receptor activity.sup.e PST Myoviridae Yersinia pseudotuberculosis HepII/HepIII pairs of inner core residues.sup.e (b) Receptors in the O-chain structure that are enzymatically cleaved by phages Ω8 Podoviridae Escherichia coli The α-1,3-mannosyl linkages between Reske, Wallenfels the trisaccharide repeating unit and Jann (1973) α-mannosyl-1,2-α-mannosyl- 1,2-mannose c341 Podoviridae Salmonella The O-acetyl group in the mannosyl- Iwashita and rhamnosyl-O-acetylgalactose Kanegasaki (1976) repeating sequence P22 Podoviridae Salmonella α-Rhmanosyl 1-3 galactose Iwashita and Kanegasaki (1973) linkage of the O-chain ε.sup.34 Podoviridae Salmonella [-β-Gal-Man-Rha-] Takeda and Uetake (1973) polysaccharide units of the O-antigen Sf6 Podoviridae Shigella Rha II 1-α-3 Rha III linkage Lindberg et al. (1978) of the O-polysaccharide. .sup.aSukupolvi (1984) suggested that LPS is also required for adsorption of phage Ox2 on E. coli and S. typhimurium, although the study verified that isolated OmpA is enough to inactivate the phage and that the binding is not increased with the addition of LPS to the protein. .sup.bAccording to Rakhuba et al. (2010), TonB is not a receptor itself, but acts as a mediator of electrochemical potential transmission; Vinga et al. (2006) stated that TonB is a membrane protein required for genome entry; Letellier et al. (2004) explained that TonB is part of a protein complex involved in the energy transduction from the electron transfer chain in the cytoplasmic membrane to the outer membrane receptors and speculated that it possibly might be critical for the genome injection through its interaction with FhuA. .sup.cRhakuba et al. (2010) mentioned proteins FhuA and TonB as the receptors for T7; Molineux (2001) reported that ‘Bayer patches’, described as adhesion sites between the cytoplasmic membrane and the outer envelope of Gram-negative bacteria, are the proposed receptors for T7. .sup.dIn 2010 the same group suggested that the adsorption of the phage on the sugar moieties of the host is an initial interaction, and that the true receptor is a protein molecule or protein complex (Cvirkaite-Krupovic 2010). .sup.eKdo, 2-keto-3-deoxy-octulosonic acid; Ko, D-glycero-D-talo-oct-2-ulosonic acid; Hep, heptulose (ketoheptose); Glc, glucose; Gal, galactose; GlcNAc, N-acetylglucosamine (from Filippov et al. 2011).

    TABLE-US-00003 TABLE 3 Receptors in bacterial complexes other than cell wall structures. Host names are ordered alphabetically. Phages Family Main host Receptor(s) References (a) Receptors in flagella SPN2T SPN3C Siphoviridae Salmonella Flagellin protein FliC Shin et al. (2012) SPN8T SPN9T SPN11T SPN13B SPN16C SPN4SSPN5T Siphoviridae Salmonella Flagellin proteins FliC or FliB SPN6T SPN19 iEPS5 Siphoviridae Salmonella Flagellal molecular ruler protein FliK Choi et al. (2013); Chaturongakul and Ounjai (2014) (b) Receptors in pili and mating pair formation structures ϕCbK ϕCb13 Siphoviridae Caulobacter Initial contact between phage head Guerrero-Ferreira et al. (2011) crescentus filament and host's flagellum followed by pili portals on the cell pole FdFff1M13 Inoviridae Escherichia Tip of the F pilus followed by TolQRA Loeb (1960); Caro and Schnos coli complex in membrane after pilus (1966); Russel et al. (1988); retraction Click and Webster (1998) PRD1 Tectiviridae Escherichia Mating pair formation (Mpf) complex in Daugelavicius et al. (1997) coli the membrane ϕ6 Cystoviridae Pseudomonas Sides of the type IV pilus Vidaver, Koski and Van Etten (1973); Daugelavicius et al. (2005) MPK7 Podoviridae Pseudomonas Type IV pili (TFP) Bae and Cho (2013) aeruginosa MP22 Siphoviridae Pseudomonas Type IV pili (TFP) Heo et al. (2007) aeruginosa DMS3 Siphoviridae Pseudomonas Type IV pili (TFP) Budzik et al. (2004) aeruginosa (c) Receptors in bacterial capsules 29 Podoviridae Escherichia Endoglycosidase hydrolysis in β-D- Stirm et al. (1971); Fehmel et coli glucosido-(1-3)-D-glucoronic acid bonds al. (1975) in the capsule composed of hexasaccharides repeating units K11 Podoviridae Klebsiella Hydrolysis of β-D-glucosyl-(1-3)-β-D- Thurow, Niemann and Stirm glucuronic acid linkages. The phage is (1975) also able to cleave α-D-galactosyl-(1-3)- β-D-glucose bonds Vi I Myoviridae Salmonella Acetyl groups of the Vi Pickard et al. (2010) exopolysaccharide capsule (a polymer of α-1,4-linked N-acetyl galactosaminuronate) Vi II Siphoviridae Salmonella Acetyl groups of the Vi exopolysaccharide capsule (a polymer of α-1,4-linked N-acetyl galactosaminuronate) Vi IIIVi IVVi VVi Podoviridae Salmonella Acetyl groups of the Vi VIVi VII exopolysaccharide capsule (a polymer of α-1,4-linked N-acetyl galactosaminuronate)

    TABLE-US-00004 TABLE 4 Specific host receptors for Salmonella and P. aeruginosa phages. Specific host receptors Reference Flagellar proteins S. enterica FliC and Shin et al. (2012) FljB FliK Choi et al. (2013) Outermembrane proteins OmpC Ho and Slauch (2001), Marti et al. (2013) BtuB Kim and Ryu (2011) TolC Ricci and Piddock (2010) FhuA Casjens et al. (2005) Surface antigens O-antigen Shin et al. (2012) Vi-antigen Pickard et al. (2010) Surface antigens P. aeruginosa O-antigen Le et al. (2013) Vi-antigen Temple et al. (1986), Hanlon et al. (2001) Type IV pili PilA Bae and Cho (2013), Heo et al. (2007)

    TABLE-US-00005 TABLE 5 Sequences Sequences are written in 5′ to 3′ direction. SEQ ID NO: DESCRIPTION SEQUENCE 1 Primer rfaDupR ATTCGTGTCTGAGATTGTCTCTGACTCCATAATTCGAAGGTTACAGTTATGATC ATCGTTGATATCGCTAGCTCGAGCACGTGTTGAC 2 Primer rfaDdnR CCAAGACGGGCCGATCACCAGTATTTTCATGCAGAGCTCTTATGCGTCGCGATT CAGCCACGTTGTAAAACGACGGCCAGTGCCAAGC 3 RfaD coding sequence atgatcatc gttaccggcg gcgcgggctt tatcggcagc aacatcgtta in Cla aagccctgaa tgataaaggc atcaccgata ttctggtggt ggacaacctg (NCBI REF: aaagacggca ccaagtttgt gaacctggtg gatctggata tcgcggacta NZ_CP010116.1) tatggataag gaagacttcc tgatccagat tatggctggc gaagagttcg gcgatgtcga agcgattttc cacgaaggtg cgtgctcttc caccaccgag tgggacggca agtatatgat ggataacaac tatcaatact ccaaagagct gctgcactac tgtctggagc gcgaaatccc gttcctgtat gcctcttccg cagccaccta cggcggacgc acctccgact ttattgaatc ccgcgagtac gaaaaaccgt tgaatgtcta cggttactca aaattcctgt ttgatgaata tgttcgtcaa atcctgccag aagcgaactc gcagattgtt ggcttccgct atttcaacgt ttatggaccg cgtgaaggcc ataaaggcag catggcgagc gtcgctttcc atctcaacac tcagcttaac aacggtgaat cgccgaagct gttcgaaggt agcgagaact tcaaacgcga cttcgtttac gtaggcgacg tggcagatgt aaacctgtgg ttcctggaaa atggcgtttc cggcatcttc aacctcggta ctggtcgtgc ggaatccttc caggcggtag cagatgctac gcttgcttat cacaagaaag gccaaatcga atacattccg ttcccggata aactgaaagg ccgctaccag gcgttcacgc aggcagatct gacaaatctg cgcgcggcgg gttacgacaa accgttcaaa accgttgccg aaggtgtaac ggaatacatg gcttggctga atcgcgacgc ataa 4 Zeo marker GATATCGCTAGCTCGAGCACGTGTTGACAATTAATCATCGGCATAGTATATCGG CATAGTATAATACGACAAGGTGAGGAACTAAACCATGGCCAAGTTGACCAGTGC CGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGA CCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCG GGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAA CACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTC GGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGAT CGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTG CGTGCACTTCGTGGCCGAGGAGCAGGACTGAGAATTCCCGGGGATCCTCTAGAG TCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGT

    TABLE-US-00006 TABLE 6 Example Bacteria Optionally, the producer cells are selected from this Table and/or the target cells are selected from this Table (eg, wherein the producer and target cells are of a different species; or of the same species but are a different strain or the host cells are engineered but the target cells are wild-type or vice versa). For example the producter cells are E coli and the target cells are C dificile, E coli, Akkermansia, Enterobacteriacea, Ruminococcus, Faecalibacterium, Firmicutes, Bacteroidetes, Salmonella, Klebsiella, Pseudomonas, Acintenobacter or Streptococcus cells. Abiotrophia Acidocella Actinomyces Alkalilimnicola Aquaspirillum Abiotrophia defectiva Acidocella aminolytica Actinomyces bovis Alkalilimnicola ehrlichii Aquaspirillum polymorphum Acaricomes Acidocella facilis Actinomyces denticolens Alkaliphilus Aquaspirillum Acaricomes phytoseiuli Acidomonas Actinomyces europaeus Alkaliphilus oremlandii putridiconchylium Acetitomaculum Acidomonas methanolica Actinomyces georgiae Alkaliphilus transvaalensis Aquaspirillum serpens Acetitomaculum ruminis Acidothermus Actinomyces gerencseriae Allochromatium Aquimarina Acetivibrio Acidothermus cellulolyticus Actinomyces Allochromatium vinosum Aquimarina latercula Acetivibrio cellulolyticus Acidovorax hordeovulneris Alloiococcus Arcanobacterium Acetivibrio ethanolgignens Acidovorax anthurii Actinomyces howellii Alloiococcus otitis Arcanobacterium Acetivibrio multivorans Acidovorax caeni Actinomyces hyovaginalis Allokutzneria haemolyticum Acetoanaerobium Acidovorax cattleyae Actinomyces israelii Allokutzneria albata Arcanobacterium pyogenes Acetoanaerobium noterae Acidovorax citrulli Actinomyces johnsonii Altererythrobacter Archangium Acetobacter Acidovorax defluvii Actinomyces meyeri Altererythrobacter ishigakiensis Archangium gephyra Acetobacter aceti Acidovorax delafieldii Actinomyces naeslundii Altermonas Arcobacter Acetobacter cerevisiae Acidovorax facilis Actinomyces neuii Altermonas haloplanktis Arcobacter butzleri Acetobacter cibinongensis Acidovorax konjaci Actinomyces odontolyticus Altermonas macleodii Arcobacter cryaerophilus Acetobacter estunensis Acidovorax temperans Actinomyces oris Alysiella Arcobacter halophilus Acetobacter fabarum Acidovorax valerianellae Actinomyces radingae Alysiella crassa Arcobacter nitrofigilis Acetobacter ghanensis Acinetobacter Actinomyces slackii Alysiella filiformis Arcobacter skirrowii Acetobacter indonesiensis Acinetobacter baumannii Actinomyces turicensis Aminobacter Arhodomonas Acetobacter lovaniensis Acinetobacter baylyi Actinomyces viscosus Aminobacter aganoensis Arhodomonas aquaeolei Acetobacter malorum Acinetobacter bouvetii Actinoplanes Aminobacter aminovorans Arsenophonus Acetobacter nitrogenifigens Acinetobacter calcoaceticus Actinoplanes auranticolor Aminobacter niigataensis Arsenophonus Acetobacter oeni Acinetobacter gerneri Actinoplanes brasiliensis Aminobacterium nasoniae Acetobacter orientalis Acinetobacter haemolyticus Actinoplanes consettensis Aminobacterium mobile Arthrobacter Acetobacter orleanensis Acinetobacter johnsonii Actinoplanes deccanensis Aminomonas Arthrobacter agilis Acetobacter pasteurianus Acinetobacter junii Actinoplanes derwentensis Aminomonas paucivorans Arthrobacter albus Acetobacter pornorurn Acinetobacter lwoffi Actinoplanes digitatis Ammoniphilus Arthrobacter aurescens Acetobacter senegalensis Acinetobacter parvus Actinoplanes durhamensis Ammoniphilus oxalaticus Arthrobacter chlorophenolicus Acetobacter xylinus Acinetobacter radioresistens Actinoplanes ferrugineus Ammoniphilus oxalivorans Arthrobacter citreus Acetobacterium Acinetobacter schindleri Actinoplanes globisporus Amphibacillus Arthrobacter crystallopoietes Acetobacterium bakii Acinetobacter soli Actinoplanes humidus Amphibacillus xylanus Arthrobacter cumminsii Acetobacterium carbinolicum Acinetobacter tandoii Actinoplanes italicus Amphritea Arthrobacter globiformis Acetobacterium dehalogenans Acinetobacter tjernbergiae Actinoplanes liguriensis Amphritea balenae Arthrobacter Acetobacterium fimetarium Acinetobacter towneri Actinoplanes lobatus Amphritea japonica histidinolovorans Acetobacterium malicum Acinetobacter ursingii Actinoplanes missouriensis Amycolatopsis Arthrobacter ilicis Acetobacterium paludosum Acinetobacter venetianus Actinoplanes palleronii Amycolatopsis alba Arthrobacter luteus Acetobacterium tundrae Acrocarpospora Actinoplanes philippinensis Amycolatopsis albidoflavus Arthrobacter methylotrophus Acetobacterium wieringae Acrocarpospora corrugata Actinoplanes rectilineatus Amycolatopsis azurea Arthrobacter mysorens Acetobacterium woodii Acrocarpospora Actinoplanes regularis Amycolatopsis coloradensis Arthrobacter nicotianae Acetofilamentum macrocephala Actinoplanes Amycolatopsis lurida Arthrobacter nicotinovorans Acetofilamentum rigidum Acrocarpospora pleiomorpha teichomyceticus Amycolatopsis mediterranei Arthrobacter oxydans Acetohalobium Actibacter Actinoplanes utahensis Amycolatopsis rifamycinica Arthrobacter pascens Acetohalobium arabaticum Actibacter sediminis Actinopolyspora Amycolatopsis rubida Arthrobacter Acetomicrobium Actinoalloteichus Actinopolyspora halophila Amycolatopsis sulphurea phenanthrenivorans Acetomicrobium faecale Actinoalloteichus Actinopolyspora mortivallis Amycolatopsis tolypomycina Arthrobacter Acetomicrobium flavidum cyanogriseus Actinosynnema Anabaena polychromogenes Acetonema Actinoalloteichus Actinosynnema mirum Anabaena cylindrica Atrhrobacter protophormiae Acetonema longum hymeniacidonis Actinotalea Anabaena flos-aquae Arthrobacter Acetothermus Actinoalloteichus spitiensis Actinotalea fermentans Anabaena variabilis psychrolactophilus Acetothermus paucivorans Actinobaccillus Aerococcus Anaeroarcus Arthrobacter ramosus Acholeplasma Actinobacillus capsulatus Aerococcus sanguinicola Anaeroarcus burkinensis Arthrobacter sulfonivorans Acholeplasma axanthum Actinobacillus delphinicola Aerococcus urinae Anaerobaculum Arthrobacter sulfureus Acholeplasma brassicae Actinobacillus hominis Aerococcus urinaeequi Anaerobaculum mobile Arthrobacter uratoxydans Acholeplasma cavigenitalium Actinobacillus indolicus Aerococcus urinaehominis Anaerobiospirillum Arthrobacter ureafaciens Acholeplasma equifetale Actinobacillus lignieresii Aerococcus viridans Anaerobiospirillum Arthrobacter viscosus Acholeplasma granularum Actinobacillus minor Aeromicrobium succiniciproducens Arthrobacter woluwensis Acholeplasma hippikon Actinobacillus muris Aeromicrobium erythreum Anaerobiospirillum thomasii Asaia Acholeplasma laidlawii Actinobacillus Aeromonas Anaerococcus Asaia bogorensis Acholeplasma modicum pleuropneumoniae Aeromonas Anaerococcus hydrogenalis Asanoa Acholeplasma morum Actinobacillus porcinus allosaccharophila Anaerococcus lactolyticus Asanoa ferruginea Acholeplasma multilocale Actinobacillus rossii Aeromonas bestiarum Anaerococcus prevotii Asticcacaulis Acholeplasma oculi Actinobacillus scotiae Aeromonas caviae Anaerococcus tetradius Asticcacaulis biprosthecium Acholeplasma palmae Actinobacillus seminis Aeromonas encheleia Anaerococcus vaginalis Asticcacaulis excentricus Acholeplasma parvum Actinobacillus succinogenes Aeromonas Anaerofustis Atopobacter Acholeplasma pleciae Actinobaccillus suis enteropelogenes Anaerofustis stercorihominis Atopobacter phocae Acholeplasma vituli Actinobacillus ureae Aeromonas eucrenophila Anaeromusa Atopobium Achromobacter Actinobaculum Aeromonas ichthiosmia Anaeromusa acidaminophila Atopobium fossor Achromobacter denitrificans Actinobaculum massiliense Aeromonas jandaei Anaeromyxobacter Atopobium minutum Achromobacter insolitus Actinobaculum schaalii Aeromonas media Anaeromyxobacter Atopobium parvulum Achromobacter piechaudii Actinobaculum suis Aeromonas popoffii dehalogenans Atopobium rimae Achromobacter ruhlandii Actinomyces urinale Aeromonas sobria Anaerorhabdus Atopobium vaginae Achromobacter spanius Actinocatenispora Aeromonas veronii Anaerorhabdus furcosa Aureobacterium Acidaminobacter Actinocatenispora rupis Agrobacterium Anaerosinus Aureobacterium barkeri Acidaminobacter Actinocatenispora Agrobacterium Anaerosinus glycerini Aurobacterium hydrogenoformans thailandica gelatinovorum Anaerovirgula Aurobacterium liquefaciens Acidaminococcus Actinocatenispora sera Agrococcus Anaerovirgula multivorans Avibacterium Acidaminococcus fermentans Actinocorallia Agrococcus citreus Ancalomicrobium Avibacterium avium Acidaminococcus intestini Actinocorallia aurantiaca Agrococcus jenensis Ancalomicrobium adetum Avibacterium gallinarum Acidicaldus Actinocorallia aurea Agromonas Ancylobacter Avibacterium paragallinarum Acidicaldus organivorans Actinocorallia cavernae Agromonas oligotrophica Ancylobacter aquaticus Avibacterium volantium Acidimicrobium Actinocorallia glomerata Agromyces Aneurinibacillus Azoarcus Acidimicrobium ferrooxidans Actinocorallia herbida Agromyces fucosus Aneurinibacillus aneurinilyticus Azoarcus indigens Acidiphilium Actinocorallia libanotica Agromyces hippuratus Aneurinibacillus migulanus Azoarcus tolulyticus Acidiphilium acidophilum Actinocorallia longicatena Agromyces luteolus Aneurinibacillus Azoarcus toluvorans Acidiphilium angustum Actinomadura Agromyces mediolanus thermoaerophilus Azohydromonas Acidiphilium cryptum Actinomadura alba Agromyces ramosus Angiococcus Azohydromonas australica Acidiphilium multivorum Actinomadura atramentaria Agromyces rhizospherae Angiococcus disciformis Azohydromonas lata Acidiphilium organovorum Actinomadura Akkermansia Angulomicrobium Azomonas Acidiphilium rubrum bangladeshensis Akkermansia muciniphila Angulomicrobium tetraedrale Azomonas agilis Acidisoma Actinomadura catellatispora Albidiferax Anoxybacillus Azomonas insignis Acidisoma sibiricum Actinomadura chibensis Albidiferax ferrireducens Anoxybacillus pushchinoensis Azomonas macrocytogenes Acidisoma tundrae Actinomadura chokoriensis Albidovulum Aquabacterium Azorhizobium Acidisphaera Actinomadura citrea Albidovulum inexpectatum Aquabacterium commune Azorhizobium caulinodans Acidisphaera rubrifaciens Actinomadura coerulea Alcaligenes Aquabacterium parvum Azorhizophilus Acidithiobacillus Actinomadura echinospora Alcaligenes denitrificans Azorhizophilus paspali Acidithiobacillus albertensis Actinomadura fibrosa Alcaligenes faecalis Azospirillum Acidithiobacillus caldus Actinomadura formosensis Alcanivorax Azospirillum brasilense Acidithiobacillus ferrooxidans Actinomadura hibisca Alcanivorax borkumensis Azospirillum halopraeferens Acidithiobacillus thiooxidans Actinomadura kijaniata Alcanivorax jadensis Azospirillum irakense Acidobacterium Actinomadura latina Algicola Azotobacter Acidobacterium capsulatum Actinomadura livida Algicola bacteriolytica Azotobacter beijerinckii Actinomadura Alicyclobacillus Azotobacter chroococcum luteofluorescens Alicyclobacillus Azotobacter nigricans Actinomadura macra disulfidooxidans Azotobacter salinestris Actinomadura madurae Alicyclobacillus Azotobacter vinelandii Actinomadura oligospora sendaiensis Actinomadura pelletieri Alicyclobacillus vulcanalis Actinomadura rubrobrunea Alishewanella Actinomadura rugatobispora Alishewanella fetalis Actinomadura umbrina Alkalibacillus Actinomadura Alkalibacillus verrucosospora haloalkaliphilus Actinomadura vinacea Actinomadura viridilutea Actinomadura viridis Actinomadura yumaensis Bacillus Bacteroides Bibersteinia Borrelia Brevinema [see below] Bacteroides caccae Bibersteinia trehalosi Borrelia afzelii Brevinema andersonii Bacteriovorax Bacteroides coagulans Bifidobacterium Borrelia americana Brevundimonas Bacteriovorax stolpii Bacteroides eggerthii Bifidobacterium adolescentis Borrelia burgdorferi Brevundimonas alba Bacteroides fragilis Bifidobacterium angulatum Borrelia carolinensis Brevundimonas aurantiaca Bacteroides galacturonicus Bifidobacterium animalis Borrelia coriaceae Brevundimonas diminuta Bacteroides helcogenes Bifidobacterium asteroides Borrelia garinii Brevundimonas intermedia Bacteroides ovatus Bifidobacterium bifidum Borrelia japonica Brevundimonas subvibrioides Bacteroides pectinophilus Bifidobacterium boum Bosea Brevundimonas vancanneytii Bacteroides pyogenes Bifidobacterium breve Bosea minatitlanensis Brevundimonas variabilis Bacteroides salyersiae Bifidobacterium catenulatum Bosea thiooxidans Brevundimonas vesicularis Bacteroides stercoris Bifidobacterium choerinum Brachybacterium Brochothrix Bacteroides suis Bifidobacterium coryneforme Brachybacterium Brochothrix campestris Bacteroides tectus Bifidobacterium cuniculi alimentarium Brochothrix thermosphacta Bacteroides thetaiotaomicron Bifidobacterium dentium Brachybacterium faecium Brucella Bacteroides uniformis Bifidobacterium gallicum Brachybacterium Brucella canis Bacteroides ureolyticus Bifidobacterium gallinarum paraconglomeratum Brucella neotomae Bacteroides vulgatus Bifidobacterium indicum Brachybacterium rhamnosum Bryobacter Balnearium Bifidobacterium longum Brachybacterium Bryobacter aggregatus Balnearium lithotrophicum Bifidobacterium tyrofermentans Burkholderia Balneatrix magnumBifidobacterium Brachyspira Burkholderia ambifaria Balneatrix alpica merycicum Brachyspira alvinipulli Burkholderia andropogonis Balneola Bifidobacterium minimum Brachyspira hyodysenteriae Burkholderia anthina Balneola vulgaris Bifidobacterium Brachyspira innocens Burkholderia caledonica Barnesiella pseudocatenulatum Brachyspira murdochii Burkholderia caryophylli Barnesiella viscericola Bifidobacterium Brachyspira Burkholderia cenocepacia Bartonella pseudolongum pilosicoli Burkholderia cepacia Bartonella alsatica Bifidobacterium pullorum Bradyrhizobium Burkholderia cocovenenans Bartonella bacilliformis Bifidobacterium ruminantium Bradyrhizobium canariense Burkholderia dolosa Bartonella clarridgeiae Bifidobacterium saeculare Bradyrhizobium elkanii Burkholderia fungorum Bartonella doshiae Bifidobacterium subtile Bradyrhizobium japonicum Burkholderia glathei Bartonella elizabethae Bifidobacterium Bradyrhizobium liaoningense Burkholderia glumae Bartonella grahamii thermophilum Brenneria Burkholderia graminis Bartonella henselae Bilophila Brenneria alni Burkholderia kururiensis Bartonella rochalimae Bilophila wadsworthia Brenneria nigrifluens Burkholderia multivorans Bartonella vinsonii Biostraticola Brenneria quercina Burkholderia phenazinium Bavariicoccus Biostraticola tofi Brenneria quercina Burkholderia plantarii Bavariicoccus seileri Bizionia Brenneria salicis Burkholderia pyrrocinia Bdellovibrio Bizionia argentinensis Brevibacillus Burkholderia silvatlantica Bdellovibrio bacteriovorus Blastobacter Brevibacillus agri Burkholderia stabilis Bdellovibrio exovorus Blastobacter capsulatus Brevibacillus borstelensis Burkholderia thailandensis Beggiatoa Blastobacter denitrificans Brevibacillus brevis Burkholderia tropica Beggiatoa alba Blastococcus Brevibacillus centrosporus Burkholderia unamae Beijerinckia Blastococcus aggregatus Brevibacillus choshinensis Burkholderia vietnamiensis Beijerinckia derxii Blastococcus saxobsidens Brevibacillus invocatus Buttiauxella Beijerinckia fluminensis Blastochloris Brevibacillus laterosporus Buttiauxella agrestis Beijerinckia indica Blastochloris viridis Brevibacillus parabrevis Buttiauxella brennerae Beijerinckia mobilis Blastomonas Brevibacillus reuszeri Buttiauxella ferragutiae Belliella Blastomonas natatoria Brevibacterium Buttiauxella gaviniae Belliella baltica Blastopirellula Brevibacterium abidum Buttiauxella izardii Bellilinea Blastopirellula marina Brevibacterium album Buttiauxella noackiae Bellilinea caldifistulae Blautia Brevibacterium aurantiacum Buttiauxella warmboldiae Belnapia Blautia coccoides Brevibacterium celere Butyrivibrio Belnapia moabensis Blautia hansenii Brevibacterium epidermidis Butyrivibrio fibrisolvens Bergeriella Blautia producta Brevibacterium Butyrivibrio hungatei Bergeriella denitrificans Blautia wexlerae frigoritolerans Butyrivibrio proteoclasticus Beutenbergia Bogoriella Brevibacterium halotolerans Beutenbergia cavernae Bogoriella caseilytica Brevibacterium iodinum Bordetella Brevibacterium linens Bordetella avium Brevibacterium lyticum Bordetella bronchiseptica Brevibacterium mcbrellneri Bordetella hinzii Brevibacterium otitidis Bordetella holmesii Brevibacterium oxydans Bordetella parapertussis Brevibacterium paucivorans Bordetella pertussis Brevibacterium stationis Bordetella petrii Bordetella trematum Bacillus B. acidiceler B. aminovorans B. glucanolyticus B. taeanensis B. lautus B. acidicola B. amylolyticus B. gordonae B. tequilensis B. lehensis B. acidiproducens B. andreesenii B. gottheilii B. thermantarcticus B. lentimorbus B. acidocaldarius B. aneurinilyticus B. graminis B. thermoaerophilus B. lentus B. acidoterrestris B. anthracis B. halmapalus B. thermoamylovorans B. licheniformis B. aeolius B. aquimaris B. haloalkaliphilus B. thermocatenulatus B. ligniniphilus B. aerius B. arenosi B. halochares B. thermocloacae B. litoralis B. aerophilus B. arseniciselenatis B. halodenitrificans B. thermocopriae B. locisalis B. agaradhaerens B. arsenicus B. halodurans B. thermodenitrificans B. luciferensis B. agri B. aurantiacus B. halophilus B. thermoglucosidasius B. luteolus B. aidingensis B. arvi B. halosaccharovorans B. thermolactis B. luteus B. akibai B. aryabhattai B. hemicellulosilyticus B. thermoleovorans B. macauensis B. alcalophilus B. asahii B. hemicentroti B. thermophilus B. macerans B. algicola B. atrophaeus B. herbersteinensis B. thermoruber B. macquariensis B. alginolyticus B. axarquiensis B. horikoshii B. thermosphaericus B. macyae B. alkalidiazotrophicus B. azotofixans B. horneckiae B. thiaminolyticus B. malacitensis B. alkalinitrilicus B. azotoformans B. horti B. thioparans B. mannanilyticus B. alkalisediminis B. badius B. huizhouensis B. thuringiensis B. marisflavi B. alkalitelluris B. barbaricus B. humi B. tianshenii B. marismortui B. altitudinis B. bataviensis B. hwajinpoensis B. trypoxylicola B. marmarensis B. alveayuensis B. beijingensis B. idriensis B. tusciae B. massiliensis B. alvei B. benzoevorans B. indicus B. validus B. megaterium B. amyloliquefaciens B. beringensis B. infantis B. vallismortis B. mesonae B. B. berkeleyi B. infernus B. vedderi B. methanolicus a. subsp. amyloliquefaciens B. beveridgei B. insolitus B. velezensis B. methylotrophicus B. a. subsp. plantarum B. bogoriensis B. invictae B. vietnamensis B. migulanus B. boroniphilus B. iranensis B. vireti B. mojavensis B. dipsosauri B. borstelensis B. isabeliae B. vulcani B. mucilaginosus B. drentensis B. brevis Migula B. isronensis B. wakoensis B. muralis B. edaphicus B. butanolivorans B. jeotgali B. weihenstephanensis B. murimartini B. ehimensis B. canaveralius B. kaustophilus B. xiamenensis B. mycoides B. eiseniae B. carboniphilus B. kobensis B. xiaoxiensis B. naganoensis B. enclensis B. cecembensis B. kochii B. zhanjiangensis B. nanhaiensis B. endophyticus B. cellulosilyticus B. kokeshiiformis B. peoriae B. nanhaiisediminis B. endoradicis B. centrosporus B. koreensis B. persepolensis B. nealsonii B. farraginis B. cereus B. korlensis B. persicus B. neidei B. fastidiosus B. chagannorensis B. kribbensis B. pervagus B. neizhouensis B. fengqiuensis B. chitinolyticus B. krulwichiae B. plakortidis B. niabensis B. firmus B. chondroitinus B. laevolacticus B. pocheonensis B. niacini B. flexus B. choshinensis B. larvae B. polygoni B. novalis B. foraminis B. chungangensis B. laterosporus B. polymyxa B. oceanisediminis B. fordii B. cibi B. salexigens B. popilliae B. odysseyi B. formosus B. circulans B. saliphilus B. pseudalcalophilus B. okhensis B. fortis B. clarkii B. schlegelii B. pseudofirmus B. okuhidensis B. fumarioli B. clausii B. sediminis B. pseudomycoides B. oleronius B. funiculus B. coagulans B. selenatarsenatis B. psychrodurans B. oryzaecorticis B. fusiformis B. coahuilensis B. selenitireducens B. psychrophilus B. oshimensis B. galactophilus B. cohnii B. seohaeanensis B. psychrosaccharolyticus B. pabuli B. galactosidilyticus B. composti B. shacheensis B. psychrotolerans B. pakistanensis B. galliciensis B. curdlanolyticus B. shackletonii B. pulvifaciens B. pallidus B. gelatini B. cycloheptanicus B. siamensis B. pumilus B. pallidus B. gibsonii B. cytotoxicus B. silvestris B. purgationiresistens B. panacisoli B. ginsengi B. daliensis B. simplex B. pycnus B. panaciterrae B. ginsengihumi B. decisifrondis B. siralis B. qingdaonensis B. pantothenticus B. ginsengisoli B. decolorationis B. smithii B. qingshengii B. parabrevis B. globisporus (eg, B. B. deserti B. soli B. reuszeri B. paraflexus g. subsp. Globisporus; or B. B. solimangrovi B. rhizosphaerae B. pasteurii g. subsp. Marinus) B. solisalsi B. rigui B. patagoniensis B. songklensis B. ruris B. sonorensis B. safensis B. sphaericus B. salarius B. sporothermodurans B. stearothermophilus B. stratosphericus B. subterraneus B. subtilis (eg, B. s. subsp. Inaquosorum, or B. s. subsp. Spizizenr, or B. s. subsp. Subtilis) Caenimonas Campylobacter Cardiobacterium Catenuloplanes Curtobacterium Caenimonas koreensis Campylobacter coli Cardiobacterium hominis Catenuloplanes atrovinosus Curtobacterium albidum Caldalkalibacillus Campylobacter concisus Carnimonas Catenuloplanes castaneus Curtobacterium citreus Caldalkalibacillus uzonensis Campylobacter curvus Carnimonas nigrificans Catenuloplanes crispus Caldanaerobacter Campylobacter fetus Carnobacterium Catenuloplanes indicus Caldanaerobacter subterraneus Campylobacter gracilis Carnobacterium alterfunditum Catenuloplanes japonicus Caldanaerobius Campylobacter helveticus Carnobacterium divergens Catenuloplanes nepalensis Caldanaerobius fijiensis Campylobacter hominis Carnobacterium funditum Catenuloplanes niger Caldanaerobius Campylobacter hyointestinalis Carnobacterium gallinarum Chryseobacterium polysaccharolyticus Campylobacter jejuni Carnobacterium Chryseobacterium Caldanaerobius zeae Campylobacter lari maltaromaticum balustinum Caldanaerovirga Campylobacter mucosalis Carnobacterium mobile Citrobacter Caldanaerovirga acetigignens Campylobacter rectus Carnobacterium viridans C. amalonaticus Caldicellulosiruptor Campylobacter showae Caryophanon C. braakii Caldicellulosiruptor bescii Campylobacter sputorum Caryophanon latum C. diversus Caldicellulosiruptor kristjanssonii Campylobacter upsaliensis Caryophanon tenue C. farmeri Caldicellulosiruptor owensensis Capnocytophaga Catellatospora C. freundii Capnocytophaga canimorsus Catellatospora citrea C. gillenii Capnocytophaga cynodegmi Catellatospora C. koseri Capnocytophaga gingivalis methionotrophica C. murliniae Capnocytophaga granulosa Catenococcus C. pasteurii.sup.[1] Capnocytophaga haemolytica Catenococcus thiocycli C. rodentium Capnocytophaga ochracea C. sedlakii Capnocytophaga sputigena C. werkmanii C. youngae Clostridium (see below) Coccochloris Coccochloris elabens Corynebacterium Corynebacterium flavescens Corynebacterium variabile Clostridium Clostridium absonum, Clostridium aceticum, Clostridium acetireducens, Clostridium acetobutylicum, Clostridium acidisoli, Clostridium aciditolerans, Clostridium acidurici, Clostridium aerotolerans, Clostridium aestuarii, Clostridium akagii, Clostridium aldenense, Clostridium aldrichii, Clostridium algidicarni, Clostridium algidixylanolyticum, Clostridium algifaecis, Clostridium algoriphilum, Clostridium alkalicellulosi, Clostridium aminophilum, Clostridium aminovalericum, Clostridium amygdalinum, Clostridium amylolyticum, Clostridium arbusti, Clostridium arcticum, Clostridium argentinense, Clostridium asparagiforme, Clostridium aurantibutyricum, Clostridium autoethanogenum, Clostridium baratii, Clostridium barkeri, Clostridium bartlettii, Clostridium beijerinckii, Clostridium bifermentans, Clostridium bolteae, Clostridium bornimense, Clostridium botulinum, Clostridium bowmanii, Clostridium bryantii, Clostridium butyricum, Clostridium cadaveris, Clostridium caenicola, Clostridium caminithermale, Clostridium carboxidivorans, Clostridium carnis, Clostridium cavendishii, Clostridium celatum, Clostridium celerecrescens, Clostridium cellobioparum, Clostridium cellulofermentans, Clostridium cellulolyticum, Clostridium cellulosi, Clostridium cellulovorans, Clostridium chartatabidum, Clostridium chauvoei, Clostridium chromiireducens, Clostridium citroniae, Clostridium clariflavum, Clostridium clostridioforme, Clostridium coccoides, Clostridium cochlearium, Clostridium colletant, Clostridium colicanis, Clostridium colinum, Clostridium collagenovorans, Clostridium cylindrosporum, Clostridium difficile, Clostridium diolis, Clostridium disporicum, Clostridium drakei, Clostridium durum, Clostridium estertheticum, Clostridium estertheticum estertheticum, Clostridium estertheticum laramiense, Clostridium fallax, Clostridium felsineum, Clostridium fervidum, Clostridium fimetarium, Clostridium formicaceticum, Clostridium frigidicarnis, Clostridium frigoris, Clostridium ganghwense, Clostridium gasigenes, Clostridium ghonii, Clostridium glycolicum, Clostridium glycyrrhizinilyticum, Clostridium grantii, Clostridium haemolyticum, Clostridium halophilum, Clostridium hastiforme, Clostridium hathewayi, Clostridium herbivorans, Clostridium hiranonis, Clostridium histolyticum, Clostridium homopropionicum, Clostridium huakuii, Clostridium hungatei, Clostridium hydrogeniformans, Clostridium hydroxybenzoicum, Clostridium hylemonae, Clostridium jejuense, Clostridium indolis, Clostridium innocuum, Clostridium intestinale, Clostridium irregulare, Clostridium isatidis, Clostridium josui, Clostridium kluyveri, Clostridium lactatifermentans, Clostridium lacusfryxellense, Clostridium laramiense, Clostridium lavalense, Clostridium lentocellum, Clostridium lentoputrescens, Clostridium leptum, Clostridium limosum, Clostridium litorale, Clostridium lituseburense, Clostridium ljungdahlii, Clostridium lortetii, Clostridium lundense, Clostridium magnum, Clostridium malenominatum, Clostridium mangenotii, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium methylpentosum, Clostridium neopropionicum, Clostridium nexile, Clostridium nitrophenolicum, Clostridium novyi, Clostridium oceanicum, Clostridium orbiscindens, Clostridium oroticum, Clostridium oxalicum, Clostridium papyrosolvens, Clostridium paradoxum, Clostridium paraperfringens (Alias: C. welchii), Clostridium paraputrificum, Clostridium pascui, Clostridium pasteurianum, Clostridium peptidivorans, Clostridium perenne, Clostridium perfringens, Clostridium pfennigii, Clostridium phytofermentans, Clostridium piliforme, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium propionicum, Clostridium proteoclasticum, Clostridium proteolyticum, Clostridium psychrophilum, Clostridium puniceum, Clostridium purinilyticum, Clostridium putrefaciens, Clostridium putrificum, Clostridium quercicolum, Clostridium quinii, Clostridium ramosum, Clostridium rectum, Clostridium roseum, Clostridium saccharobutylicum, Clostridium saccharogumia, Clostridium saccharolyticum, Clostridium saccharoperbutylacetonicum, Clostridium sardiniense, Clostridium sartagoforme, Clostridium scatologenes, Clostridium schirmacherense, Clostridium scindens, Clostridium septicum, Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme, Clostridium sporogenes, Clostridium sporosphaeroides, Clostridium stercorarium, Clostridium stercorarium leptospartum, Clostridium stercorarium stercorarium, Clostridium stercorarium thermolacticum, Clostridium sticklandii, Clostridium straminisolvens, Clostridium subterminale, Clostridium sufflavum, Clostridium sulfidigenes, Clostridium symbiosum, Clostridium tagluense, Clostridium tepidiprofundi, Clostridium termitidis, Clostridium tertium, Clostridium tetani, Clostridium tetanomorphum, Clostridium thermaceticum, Clostridium thermautotrophicum, Clostridium thermoalcaliphilum, Clostridium thermobutyricum, Clostridium thermocellum, Clostridium thermocopriae, Clostridium thermohydrosulfuricum, Clostridium thermolacticum, Clostridium thermopalmarium, Clostridium thermopapyrolyticum, Clostridium thermosaccharolyticum, Clostridium thermosuccinogenes, Clostridium thermosulfurigenes, Clostridium thiosulfatireducens, Clostridium tyrobutyricum, Clostridium uliginosum, Clostridium ultunense, Clostridium villosum, Clostridium vincentii, Clostridium viride, Clostridium xylanolyticum, Clostridium xylanovorans Dactylosporangium Deinococcus Delftia Echinicola Dactylosporangium aurantiacum Deinococcus aerius Delftia acidovorans Echinicola pacifica Dactylosporangium fulvum Deinococcus apachensis Desulfovibrio Echinicola vietnamensis Dactylosporangium matsuzakiense Deinococcus aquaticus Desulfovibrio desulfuricans Dactylosporangium roseum Deinococcus aquatilis Diplococcus Dactylosporangium thailandense Deinococcus caeni Diplococcus pneumoniae Dactylosporangium vinaceum Deinococcus radiodurans Deinococcus radiophilus Enterobacter Enterobacter kobei Faecalibacterium Flavobacterium E. aerogenes E. ludwigii Faecalibacterium prausnitzii Flavobacterium antarcticum E. amnigemis E. mori Fangia Flavobacterium aquatile E. agglomerans E. nimipressuralis Fangia hongkongensis Flavobacterium aquidurense E. arachidis E. oryzae Fastidiosipila Flavobacterium balustinum E. asburiae E. pulveris Fastidiosipila sanguinis Flavobacterium croceum E. cancerogenous E. pyrinus Fusobacterium Flavobacterium cucumis E. cloacae E. radicincitans Fusobacterium nucleatum Flavobacterium daejeonense E. cowanii E. taylorae Flavobacterium defluvii E. dissolvens E. turicensis Flavobacterium degerlachei E. gergoviae E. sakazakii Enterobacter soli Flavobacterium E. helveticus Enterococcus denitrificans E. hormaechei Enterococcus durans Flavobacterium filum E. intermedins Enterococcus faecalis Flavobacterium flevense Enterococcus faecium Flavobacterium frigidarium Erwinia Flavobacterium mizutaii Erwinia hapontici Flavobacterium Escherichia okeanokoites Escherichia coli Gaetbulibacter Haemophilus Ideonella Janibacter Gaetbulibacter saemankumensis Haemophilus aegyptius Ideonella azotifigens Janibacter anophelis Gallibacterium Haemophilus aphrophilus Idiomarina Janibacter corallicola Gallibacterium anatis Haemophilus felis Idiomarina abyssalis Janibacter limosus Gallicola Haemophilus gallinarum Idiomarina baltica Janibacter melonis Gallicola barnesae Haemophilus haemolyticus Idiomarina fontislapidosi Janibacter terrae Garciella Haemophilus influenzae Idiomarina loihiensis Jannaschia Garciella nitratireducens Haemophilus paracuniculus Idiomarina ramblicola Jannaschia cystaugens Geobacillus Haemophilus parahaemolyticus Idiomarina seosinensis Jannaschia helgolandensis Geobacillus thermoglucosidasius Haemophilus parainfluenzae Idiomarina zobellii Jannaschia Geobacillus stearothermophilus Haemophilus Ignatzschineria pohangensis Geobacter paraphrohaemolyticus Ignatzschineria Jannaschia rubra Geobacter bemidjiensis Haemophilus parasuis larvae Janthinobacterium Geobacter bremensis Haemophilus pittmaniae Ignavigranum Janthinobacterium Geobacter chapellei Hafnia Ignavigranum ruoffiae agaricidamnosum Geobacter grbiciae Hafnia alvei Ilumatobacter Janthinobacterium lividum Geobacter hydrogenophilus Hahella Ilumatobacter fluminis Jejuia Geobacter lovleyi Hahella ganghwensis Ilyobacter Jejuia pallidilutea Geobacter metallireducens Halalkalibacillus Ilyobacter delafieldii Jeotgalibacillus Geobacter pelophilus Halalkalibacillus halophilus Ilyobacter insuetus Jeotgalibacillus Geobacter pickeringii Helicobacter Ilyobacter polytropus alimentarius Geobacter sulfurreducens Helicobacter pylori Ilyobacter tartaricus Jeotgalicoccus Geodermatophilus Jeotgalicoccus halotolerans Geodermatophilus obscurus Gluconacetobacter Gluconacetobacter xylinus Gordonia Gordonia rubripertincta Kaistia Labedella Listeria ivanovii Micrococcus Nesterenkonia Kaistia adipata Labedella gwakjiensis L. marthii Micrococcus luteus Nesterenkonia holobia Kaistia soli Labrenzia L. monocytogenes Micrococcus lylae Nocardia Kangiella Labrenzia aggregata L. newyorkensis Moraxella Nocardia argentinensis Kangiella aquimarina Labrenzia alba L. riparia Moraxella bovis Nocardia corallina Kangiella Labrenzia alexandrii L. rocourtiae Moraxella nonliquefaciens Nocardia koreensis Labrenzia marina L. seeligeri Moraxella osloensis otitidiscaviarum Kerstersia Labrys L. weihenstephanensis Nakamurella Kerstersia gyiorum Labrys methylaminiphilus L. welshimeri Nakamurella multipartita Kiloniella Labrys miyagiensis Listonella Nannocystis Kiloniella laminariae Labrys monachus Listonella anguillarum Nannocystis pusilia Klebsiella Labrys okinawensis Macrococcus Natranaerobius K. gramilomatis Labrys Macrococcus bovicus Natranaerobius K. oxytoca portucalensis Marinobacter thermophilus K. pneumoniae Lactobacillus Marinobacter algicola Natranaerobius trueperi K. terrigena [see below] Marinobacter bryozoorum Naxibacter K. variicola Laceyella Marinobacter flavimaris Naxibacter alkalitolerans Kluyvera Laceyella putida Meiothermus Neisseria Kluyvera ascorbata Lechevalieria Meiothermus ruber Neisseria cinerea Kocuria Lechevalieria aerocolonigenes Methylophilus Neisseria denitrificans Kocuria roasea Legionella Methylophilus methylotrophus Neisseria gonorrhoeae Kocuria varians [see below] Microbacterium Neisseria lactamica Kurthia Listeria Microbacterium Neisseria mucosa Kurthia zopfii L. aquatica ammoniaphilum Neisseria sicca L. booriae Microbacterium arborescens Neisseria subflava L. cornellensis Microbacterium liquefaciens Neptunomonas L. fleischmannii Microbacterium oxydans Neptunomonas japonica L. floridensis L. grandensis L. grayi L. innocua Lactobacillus L. acetotolerans L. catenaformis L. mali L. parakefiri L. sakei L. acidifarinae L. ceti L. manihotivorans L. paralimentarius L. salivarius L. acidipiscis L. coleohominis L. mindensis L. paraplantarum L. sanfranciscensis L. acidophilus L. collinoides L. mucosae L. pentosus L. satsumensis Lactobacillus agilis L. composti L. murinus L. perolens L. secaliphilus L. algidus L. concavus L. nagelii L. plantarum L. sharpeae L. alimentarius L. coryniformis L. namurensis L. pontis L. siliginis L. amylolyticus L. crispatus L. nantensis L. protectus L. spicheri L. amylophilus L. crustorum L. oligofermentans L. psittaci L. suebicus L. amylotrophicus L. curvatus L. oris L. rennini L. thailandensis L. amylovorus L. delbrueckii subsp. bulgaricus L. panis L. reuteri L. ultunensis L. animalis L. delbrueckii subsp. L. pantheris L. rhamnosus L. vaccinostercus L. antri delbrueckii L. parabrevis L. rimae L. vaginalis L. apodemi L. delbrueckii subsp. lactis L. parabuchneri L. rogosae L. versmoldensis L. aviarius L. dextrinicus L. paracasei L. rossiae L. vini L. bifermentans L. diolivorans L. paracollinoides L. ruminis L. vitulinus L. brevis L. equi L. parafarraginis L. saerimneri L. zeae L. buchneri L. equigenerosi L. homohiochii L. jensenii L. zymae L. camelliae L. farraginis L. iners L. johnsonii L. gastricus L. casei L. farciminis L. ingluviei L. kalixensis L. ghanensis L. kitasatonis L. fermentum L. intestinalis L. kefiranofaciens L. graminis L. kunkeei L. fornicalis L. fuchuensis L. kefiri L. hammesii L. leichmannii L. fructivorans L. gallinarum L. kimchii L. hamsteri L. lindneri L. frumenti L. gasseri L. helveticus L. harbinensis L. malefermentans L. hilgardii L. hayakitensis Legionella Legionella adelaidensis Legionella drancourtii Candidatus Legionella jeonii Legionella quinlivanii Legionella anisa Legionella dresdenensis Legionella jordanis Legionella rowbothamii Legionella beliardensis Legionella drozanskii Legionella lansingensis Legionella rubrilucens Legionella birminghamensis Legionella dumoffii Legionella londiniensis Legionella sainthelensi Legionella bozemanae Legionella erythra Legionella longbeachae Legionella santicrucis Legionella brunensis Legionella fairfieldensis Legionella lytica Legionella shakespearei Legionella busanensis Legionella fallonii Legionella maceachernii Legionella spiritensis Legionella cardiaca Legionella feeleii Legionella massiliensis Legionella steelei Legionella cherrii Legionella geestiana Legionella micdadei Legionella steigerwaltii Legionella cincinnatiensis Legionella genomospecies Legionella monrovica Legionella taurinensis Legionella clemsonensis Legionella gormanii Legionella moravica Legionella tucsonensis Legionella donaldsonii Legionella gratiana Legionella nagasakiensis Legionella tunisiensis Legionella gresilensis Legionella nautarum Legionella wadsworthii Legionella hackeliae Legionella norrlandica Legionella waltersii Legionella impletisoli Legionella oakridgensis Legionella worsleiensis Legionella israelensis Legionella parisiensis Legionella yabuuchiae Legionella jamestowniensis Legionella pittsburghensis Legionella pneumophila Legionella quateirensis Oceanibulbus Paenibacillus Prevotella Quadrisphaera Oceanibulbus indolifex Paenibacillus thiaminolyticus Prevotella albensis Quadrisphaera Oceanicaulis Pantoea Prevotella amnii granulorum Oceanicaulis alexandrii Pantoea Prevotella bergensis Quatrionicoccus Oceanicola agglomerans Prevotella bivia Quatrionicoccus Oceanicola batsensis Paracoccus Prevotella brevis australiensis Oceanicola granulosus Paracoccus alcaliphilus Prevotella bryantii Quinella Oceanicola nanhaiensis Paucimonas Prevotella buccae Quinella Oceanimonas Paucimonas lemoignei Prevotella buccalis ovalis Oceanimonas baumannii Pectobacterium Prevotella copri Ralstonia Oceaniserpentilla Pectobacterium aroidearum Prevotella dentalis Ralstonia eutropha Oceaniserpentilla haliotis Pectobacterium atrosepticum Prevotella denticola Ralstonia insidiosa Oceanisphaera Pectobacterium betavasculorum Prevotella disiens Ralstonia mannitolilytica Oceanisphaera donghaensis Pectobacterium cacticida Prevotella histicola Ralstonia pickettii Oceanisphaera litoralis Pectobacterium carnegieana Prevotella intermedia Ralstonia Oceanithermus Pectobacterium carotovorum Prevotella maculosa pseudosolanacearum Oceanithermus desulfurans Pectobacterium chrysanthemi Prevotella marshii Ralstonia syzygii Oceanithermus profundus Pectobacterium cypripedii Prevotella melaninogenica Ralstonia solanacearum Oceanobacillus Pectobacterium rhapontici Prevotella micans Ramlibacter Oceanobacillus caeni Pectobacterium wasabiae Prevotella multiformis Ramlibacter henchirensis Oceanospirillum Planococcus Prevotella nigrescens Ramlibacter Oceanospirillum linum Planococcus citreus Prevotella oralis tataouinensis Planomicrobium Prevotella oris Raoultella Planomicrobium okeanokoites Prevotella oulorum Raoultella ornithinolytica Plesiomonas Prevotella pallens Raoultella planticola Plesiomonas shigelloides Prevotella salivae Raoultella terrigena Proteus Prevotella stercorea Rathayibacter Proteus vulgaris Prevotella tannerae Rathayibacter caricis Prevotella timonensis Rathayibacter festucae Prevotella veroralis Rathayibacter iranicus Providencia Rathayibacter rathayi Providencia stuartii Rathayibacter toxicus Pseudomonas Rathayibacter tritici Pseudomonas aeruginosa Rhodobacter Pseudomonas alcaligenes Rhodobacter sphaeroides Pseudomonas anguillispetica Ruegeria Pseudomonas fluorescens Ruegeria gelatinovorans Pseudoalteromonas haloplanktis Pseudomonas mendocina Pseudomonas pseudoalcaligenes Pseudomonas putida Pseudomonas tutzeri Pseudomonas syringae Psychrobacter Psychrobacter faecalis Psychrobacter phenylpyruvicus Saccharococcus Sagittula Sanguibacter Stenotrophomonas Tatlockia Saccharococcus thermophilus Sagittula stellata Sanguibacter keddieii Stenotrophomonas Tatlockia maceachernii Saccharomonospora Salegentibacter Sanguibacter suarezii maltophilia Tatlockia micdadei Saccharomonospora azurea Salegentibacter salegens Saprospira Streptococcus Tenacibaculum Saccharomonospora cyanea Salimicrobium Saprospira grandis [also see below] Tenacibaculum Saccharomonospora viridis Salimicrobium album Sarcina Streptomyces amylolyticum Saccharophagus Salinibacter Sarcina maxima Streptomyces Tenacibaculum discolor Saccharophagus degradans Salinibacter ruber Sarcina ventriculi achromogenes Tenacibaculum Saccharopolyspora Salinicoccus Sebaldella Streptomyces gallaicum Saccharopolyspora erythraea Salinicoccus alkaliphilus Sebaldella cesalbus Tenacibaculum Saccharopolyspora gregorii Salinicoccus hispanicus termitidis Streptomyces cescaepitosus lutimaris Saccharopolyspora hirsuta Salinicoccus roseus Serratia Streptomyces cesdiastaticus Tenacibaculum Saccharopolyspora hordei Salinispora Serratia fonticola Streptomyces cesexfoliatus mesophilum Saccharopolyspora rectivirgula Salinispora arenicola Serratia marcescens Streptomyces fimbriatus Tenacibaculum Saccharopolyspora spinosa Salinispora tropica Sphaerotilus Streptomyces fradiae skagerrakense Saccharopolyspora taberi Salinivibrio Sphaerotilus natans Streptomyces fulvissimus Tepidanaerobacter Saccharothrix Salinivibrio costicola Sphingobacterium Streptomyces griseoruber Tepidanaerobacter Saccharothrix australiensis Salmonella Sphingobacterium multivorum Streptomyces griseus syntrophicus Saccharothrix coeruleofusca Salmonella bongori Staphylococcus Streptomyces lavendulae Tepidibacter Saccharothrix espanaensis Salmonella enterica [see below] Streptomyces Tepidibacter Saccharothrix longispora Salmonella subterranea phaeochromogenes formicigenes Saccharothrix mutabilis Salmonella typhi Streptomyces Tepidibacter thalassicus Saccharothrix syringae thermodiastaticus Thermus Saccharothrix tangerinus Streptomyces tubercidicus Thermus aquaticus Saccharothrix texasensis Thermus filiformis Thermus thermophilus Staphylococcus S. arlettae S. equorum S. microti S. schleiferi S. agnetis S. felis S. muscae S. sciuri S. aureus S. fleurettii S. nepalensis S. simiae S. auricularis S. gallinarum S. pasteuri S. simulans S. capitis S. haemolyticus S. petrasii S. stepanovicii S. caprae S. hominis S. pettenkoferi S. succinus S. carnosus S. hyicus S. piscifermentans S. vitulinus S. caseolyticus S. intermedius S. pseudintermedius S. warneri S. chromogenes S. kloosii S. pseudolugdunensis S. xylosus S. cohnii S. leei S. pulvereri S. condimenti S. lentus S. rostri S. delphini S. lugdunensis S. saccharolyticus S. devriesei S. lutrae S. saprophyticus S. epidermidis S. lyticans S. massiliensis Streptococcus Streptococcus agalactiae Streptococcus infantarius Streptococcus orisratti Streptococcus thermophilus Streptococcus anginosus Streptococcus iniae Streptococcus parasanguinis Streptococcus sanguinis Streptococcus bovis Streptococcus intermedius Streptococcus peroris Streptococcus sobrinus Streptococcus canis Streptococcus lactarius Streptococcus pneumoniae Streptococcus suis Streptococcus constellatus Streptococcus milleri Streptococcus Streptococcus uberis Streptococcus downei Streptococcus mitis pseudopneumoniae Streptococcus vestibularis Streptococcus dysgalactiae Streptococcus mutans Streptococcus pyogenes Streptococcus viridans Streptococcus equines Streptococcus oralis Streptococcus ratti Streptococcus Streptococcus faecalis Streptococcus tigurinus Streptococcus salivariu zooepidemicus Streptococcus ferus Uliginosibacterium Vagococcus Vibrio Virgibacillus Xanthobacter Uliginosibacterium Vagococcus carniphilus Vibrio aerogenes Virgibacillus Xanthobacter agilis gangwonense Vagococcus elongatus Vibrio aestuarianus halodenitrificans Xanthobacter Ulvibacter Vagococcus fessus Vibrio albensis Virgibacillus aminoxidans Ulvibacter litoralis Vagococcus fluvialis Vibrio alginolyticus pantothenticus Xanthobacter Umezawaea Vagococcus lutrae Vibrio campbellii Weissella autotrophicus Umezawaea tangerina Vagococcus salmoninarum Vibrio cholerae Weissella cibaria Xanthobacter flavus Undibacterium Variovorax Vibrio cincinnatiensis Weissella confusa Xanthobacter tagetidis Undibacterium pigrum Variovorax boronicumulans Vibrio coralliilyticus Weissella halotolerans Xanthobacter viscosus Ureaplasma Variovorax dokdonensis Vibrio cyclitrophicus Weissella hellenica Xanthomonas Ureaplasma Variovorax paradoxus Vibrio diazotrophicus Weissella kandleri Xanthomonas urealyticum Variovorax soli Vibrio fluvialis Weissella koreensis albilineans Ureibacillus Veillonella Vibrio furnissii Weissella minor Xanthomonas alfalfae Ureibacillus composti Veillonella atypica Vibrio gazogenes Weissella Xanthomonas Ureibacillus suwonensis Veillonella caviae Vibrio halioticoli paramesenteroides arboricola Ureibacillus terrenus Veillonella criceti Vibrio harveyi Weissella soli Xanthomonas Ureibacillus thermophilus Veillonella dispar Vibrio ichthyoenteri Weissella thailandensis axonopodis Ureibacillus thermosphaericus Veillonella montpellierensis Vibrio mediterranei Weissella viridescens Xanthomonas Veillonella parvula Vibrio metschnikovii Williamsia campestris Veillonella ratti Vibrio mytili Williamsia marianensis Xanthomonas citri Veillonella rodentium Vibrio natriegens Williamsia maris Xanthomonas codiaei Venenivibrio Vibrio navarrensis Williamsia serinedens Xanthomonas Venenivibrio stagnispumantis Vibrio nereis Winogradskyella cucurbitae Verminephrobacter Vibrio nigripulchritudo Winogradskyella Xanthomonas Verminephrobacter eiseniae Vibrio ordalii thalassocola euvesicatoria Verrucomicrobium Vibrio orientalis Wolbachia Xanthomonas fragariae Verrucomicrobium spinosum Vibrio parahaemolyticus Wolbachia persica Xanthomonas fuscans Vibrio pectenicida Wolinella Xanthomonas gardneri Vibrio penaeicida Wolinella succinogenes Xanthomonas hortorum Vibrio proteolyticus Zobellia Xanthomonas hyacinthi Vibrio shilonii Zobellia galactanivorans Xanthomonas perforans Vibrio splendidus Zobellia uliginosa Xanthomonas phaseoli Vibrio tubiashii Zoogloea Xanthomonas pisi Vibrio vulnificus Zoogloea ramigera Xanthomonas populi Zoogloea resiniphila Xanthomonas theicola Xanthomonas translucens Xanthomonas vesicatoria Xylella Xylella fastidiosa Xylophilus Xylophilus ampelinus Xenophilus Yangia Yersinia mollaretii Zooshikella Zobellella Xenophilus azovorans Yangia pacifica Yersinia philomiragia Zooshikella ganghwensis Zobellella denitrificans Xenorhabdus Yaniella Yersinia pestis Zunongwangia Zobellella taiwanensis Xenorhabdus beddingii Yaniella flava Yersinia pseudotuberculosis Zunongwangia profunda Zeaxanthinibacter Xenorhabdus bovienii Yaniella halotolerans Yersinia rohdei Zymobacter Zeaxanthinibacter Xenorhabdus cabanillasii Yeosuana Yersinia ruckeri Zymobacter palmae enoshimensis Xenorhabdus doucetiae Yeosuana aromativorans Yokenella Zymomonas Zhihengliuella Xenorhabdus griffiniae Yersinia Yokenella regensburgei Zymomonas mobilis Zhihengliuella Xenorhabdus hominickii Yersinia aldovae Yonghaparkia Zymophilus halotolerans Xenorhabdus koppenhoeferi Yersinia bercovieri Yonghaparkia alkaliphila Zymophilus paucivorans Xylanibacterium Xenorhabdus nematophila Yersinia enterocolitica Zavarzinia Zymophilus raffinosivorans Xylanibacterium ulmi Xenorhabdus poinarii Yersinia entomophaga Zavarzinia compransoris Xylanibacter Yersinia frederiksenii Xylanibacter oryzae Yersinia intermedia Yersinia kristensenii

    TABLE-US-00007 TABLE 7 SaPIs Lindsay att site core and Size Inducing (location, Element Staphylococcal genome Baba* Holdentext missing or illegible when filed (kb) phages att/int group) Refs SaPI4 S. aureus str. MRSA252 NA SaPI4 15.1 Endogenous AAAGAAGAACAATAA 7.39 prophage TAT (~8′.I) SaPI1028 S. aureus str. NY940 NA NA 15.6 Endogenous AAAGAAGAACAATAA 7.40 prophage TAT (~8.I) SaPIbov1 S. aureus str. RF122 vSa2 NA 15.8 φ11 and TAATTATTCCCAGTC 25.41 80α AAT (~9′.II) SaPIbov2 S. aureus str. V329 NA NA 27 80α TAATTATTCCCACTC 25 GAT (~9′.II) SaPlm4 S. aureus str. mu50 vSa3 NA 14.4 Endogenous TCCCGCCGTCTCCAT 7.12 type I prophage (~18.III) SaPlmw2 S. aureus str. mw2 vSa3 SaPI3 14.4 Endogenous TCGCGCCGTCTCCAT 7.12 type II prophage (~18.III) SePI1 S. aureus str. FRI909 NA NA 9.9 Not known TCCGCCGTCTCCAT 11 (location unknowntext missing or illegible when filed . III) ShPI2 S. haemolyticus vSh2 NA 16.6 Not known TCCCGCCGTCTCCAT 8 (48′, III)text missing or illegible when filed SaPI1 S. aureus str. RN4282 vSa1 NA 15.2 80α and TTATTTAGCAGGAAT 6 φ13 AA (~19′, IV) SaPI3 S. aureus str. COL vSa1 SaPI1 15.6 Not known TTATTTAGCAGGAAT 42 AA (~19′, IV) SaPI5 S. aureus str. USA300 NA NA 14.0 Not known TTATTTAGCAGGAAT 43 AA (~19′, IV) SaPln1 S. aureus str. n315 vSa4 SaPI2 15 80α GTTTTACCATCATTC 36 and and and type I CCGGCAT J. R. P., SaPlm1 S. aureus str. mu50, (~44′, V) unpublished respectively observations SaPI2 S. aureus str. RN3984 NA NA 14.7 80 and 80α ATTTTACATCATTCC 7.20 TGGCAT (~44′, V) SaRIfusB S. aureus European NA NA 20.7 Not known ATGCCAGGTATGATG 38 fusidic acid- TAAAAC resistant impetigo (~44′, V) clone CS6 SaPI122 S. aureus str. RF122 NA NA 17.9 Endogenous GTTTTACATCATTCC NAtext missing or illegible when filed prophage TGGCAT (~44′, V) SaPI6Δ S. aureus strains vSa4 NA 3.14 Not known GTTTTACCATCATTC 12 8325, COL, USA300, type II CCGGCATGTTTTACA MSSA476, Newman and TCATTCCTGGCAT mw2 (~44′, V) SsPI15305 S. saprophyticus str. vSs15305 NA 16.7 Not known Unknown 9 15305 sequence (~48′, VI) int, integrase: NA, not applicable; S. aureus, Staphylococcus aureus; S. haemolyticus, Staphylococcus haemolyticus; S. saprophyticus, Staphylococcus saprophyticus. *Nomencalture proposed by Baba et altext missing or illegible when filed . text missing or illegible when filed Nomenclature used by Lindsay and Holdentext missing or illegible when filed . text missing or illegible when filed This strain has not been sequenced yet so the genomic location os SaPI1 is unknown. text missing or illegible when filed ShPI2 is located 180° away from the other SaPIs with the same att core sequence. owling to the major chromosomal inverison that has been documented in the S. haemolyticus genometext missing or illegible when filed . text missing or illegible when filed GenBank accession NC 007622. text missing or illegible when filed indicates data missing or illegible when filed

    TABLE-US-00008 TABLE 8 Example Plasmids and Copy Number Common Copy Incompat- Vectors Number.sup.+ ORI ibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15-20 pMB1 A Relaxed pET ~15-20 pBR322 A Relaxed pGEX ~15-20 pBR322 A Relaxed pColE1 ~15-20 ColE1 A Relaxed pR6K ~15-20 R6K* C Stringent pACYC ~10  p15A B Relaxed pSC101 ~5 pSC101 C Stringent pBluescript ~300-500 ColE1 (derivative) A Relaxed and F1** pGEM ~300-500 pUC and F1* A Relaxed