DNA MOLECULES PRODUCING CUSTOM DESIGNED REPLICATING AND NON-REPLICATING NEGATIVE STRANDED RNA VIRUSES AND USES THERE OF
20230272423 · 2023-08-31
Inventors
- Vishwas Dattatraya Joshi (Maharashtra, IN)
- U.M. Sreenivasa Murthy (Hyderabad, IN)
- Shailendra Devicharan Rane (Maharashtra, IN)
- Manasi Sanjay Nade (Maharashtra, IN)
Cpc classification
C12N2770/24134
CHEMISTRY; METALLURGY
C12N2760/18443
CHEMISTRY; METALLURGY
C12N2760/18433
CHEMISTRY; METALLURGY
C12N2760/18421
CHEMISTRY; METALLURGY
C12N2760/18432
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
This invention comprises: compositions comprising a derivative, plasmids, a reagent kit and methods of making these compositions a derivative, vaccine- and non-vacicine-compositions of above for causing death of cancer cells that form part of a tunoour and virus infected Denguue, Measles and other diseased cells; the derivative comprising replicating as well as non-replicating dervivaties of an attenuated negative stranded RNA virus belonging to family paramyxoviridae, including Measles Virus, comprising a single additional transcriptional unit carrying either only one or two or more non-viral genes, and the non-replicating derivatives being free from contaminating replicating Measles Virus (b) a Measles Virus packaging cell line for making above compositions, expressing the M, F and H proteins of MV stably. And (c) a reagent kit for producing the Measles Virus derivatives describved above.
Claims
1. A non-replicating derivative of an attenuated negative stranded RNA virus belonging to family paramyxoviridae, wherein the derivative comprises artificially designed transcriptional units coding for non-viral genes inserted in the same.
2. The non-replicating derivative of attenuated negative stranded RNA virus of claim 1, wherein the derivative comprises of two or more non-viral genes.
3. The non-replicating derivative of an attenuated negative stranded RNA virus of claim 2, wherein the virus is a Measles Virus or any other virus with equivalent attenuation, equivalent safety for a human being and with requirements for rescuing the any other virus from cDNA, the requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit.
4. The non-replicating derivative of an attenuated negative stranded RNA virus of claim 3, wherein the process of making the same comprises use of (a) a two plasmid system and comprising (i) one cloning plasmid comprising the MV genome like replicon RNA coding for non-MV genes along with a subset of MV genes, wherein MV stands for “Measles Virus”, (ii) one helper plasmid coding for and expressing N, P, L proteins respectively, and (b) a cell line supporting measles virus replication; the cell line may or may not be modified to express one or more of M or F or H proteins of MV stably, but not requiring the help of exogenous vaccinia virus or exogenous T7 RNA polymerase.
5. The non-replicating derivative of an attenuated negative stranded RNA virus of claim 3, wherein the attenuated virus is a Measles Virus; the term “Measles Virus” being abbreviated as MV hereafter, and wherein the non-replicating derivative is a Virosome.
6. The non-replicating derivative of the attenuated negative stranded RNA virus of claim 5, wherein the Virosome, comprises one or more of: (a) non-MV genes, or (b) non-MV genes and a subset of MV genes, or (c) a subset of MV genes.
7. The non-replicating derivative of the attenuated negative stranded RNA of claim 5, wherein the Virosomes are capable of one of more of following features: a. displaying antigens from other pathogenic organisms including viruses like Dengue, b. delivering and inducing the expression of genes coding for antigens from other pathogenic organisms including viruses like Dengue, c. inducing immunity against different non-measles virus antigens, d. delivering non-measles virus genes into human/animal cells for modulating the expression of cellular genes, e. capable of serving as vaccines against different diseases, f. serving as therapeutic agents for treatment of different diseases.
8. The non-replicating derivative of the attenuated negative stranded RNA virus of claim 6, wherein the Virosome comprises any one of: a. a GFP virosome comprising genome coding for green fluorescent protein and produced from the plasmid pMTX-P1T (SEQ ID NO: 1)—by inserting the cDNA encoding green fluorescence protein (GFP), b. a Virosome comprising a genome that codes for prM and E proteins of dengue virus and produced from the plasmid pMTX-P1T-D2G comprising SEQ ID NO: 21, c. a Virosome comprising a genome that codes for the prM and E proteins of Dengue Virus along with the N, P and L proteins of the Measles Virus, produced from a plasmid derived from pMTX-P1T-High (SEQ ID NO: 7) by inserting the cDNA coding for prM and E proteins, d. a Virosome comprising a genome that codes for a truncated prM and E proteins of Dengue virus, and produced by deleting the region corresponding to SEQ ID NO: 22 from SEQ ID NO: 21, e. a Virosome comprising a genome that codes for a truncated prM and E proteins of Dengue virus along with N, P and L proteins of the Measles Virus, and produced from a plasmid derived from pMTX-P1T-High by inserting a cDNA corresponding to prM truncated by deleting SEQ ID NO: 22 and E proteins, f. a Virosome, comprising a genome that codes the H and F proteins of the Measles Virus and is derived from pMV (SEQ ID NO: 9 or SEQ ID NO: 28) by deleting the sequences corresponding to the N, P, M and L genes of MV, and g. a Virosome, comprising a genome for one or more of therapeutically useful genes and a sub-set of MV genes derived from pMTX-P1T-NP-RE1-FH-RE2-RE3 (SEQ ID NO: 8) or by replacing one or more of the MV protein coding regions from pMV (SEQ ID NO: 9 or SEQ ID NO: 28) with other therapeutically useful genes.
9. The non-replicating derivative of the attenuated negative stranded RNA virus of claim 8, wherein the Virosome of sub-claim g. of claim 8 comprises a Virosome comprising one or more of genes comprising dominant negative mutant of Cyclin G1, cytocidal genes, Cytosine deaminase gene, human granulocyte macrophage colony stimulating factor gene (GMCSF) gene, soluble PD-1 blockade gene, PD1 blocking antibody gene and gene for prostate specific acid phosphatase (PAP).
10. A composition comprising: a. the non-replicating derivative of an attenuated negative stranded RNA virus as claimed in claim 1, wherein the virus is a Measles Virus, the term “Measles Virus” being abbreviated as “MV” hereafter, or any other virus with equivalent attenuation, equivalent safety for a human being and with requirements for rescuing the any other virus from cDNA, the requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit, and b. pharmaceutically acceptable excipients.
11. The composition of claim 10, wherein the virosome is one or more selected from the group comprising a genome that codes for either (a) exclusively non-measles genes or (b) a combination of non-MV and a subset of MV genes or (c) exclusively a subset of MV genes.
12. The composition of claim 10, wherein the composition is a vaccine.
13. The composition of claim 10, wherein the vaccine comprises one or more of: a. a Virosome comprising a genome that codes for prM and E proteins of dengue virus, b. a Virosome comprising a genome that codes for the prM and E proteins of Dengue Virus along with the N, P and L proteins of the Measles Virus, c. a Virosome comprising a genome that codes for a truncated-prM and E proteins of Dengue virus, d. a Virosome comprising a genome that codes for a truncated-prM and E proteins of Dengue virus along with N, P and L proteins of the Measles Virus, and e. a Virosome, comprising a genome that codes the H and F proteins of the Measles Virus.
14. The composition of claim 13, wherein the vaccine comprising virosomes of claim 13 sub-claims b., c., d. and e corresponds to one or more of serotype 1, serotype 2, serotype 3 or serotype 4 of Dengue Virus.
15. The composition of claim 13, wherein virosomes of claim 13 sub-claims b., c., d. and e. are used as vaccine for prevention of Dengue.
16. The composition of claim 10, wherein the composition is a non-vaccine medication.
17. The composition of claim 16, wherein the non-vaccine medication comprises a Virosome, comprising a genome that codes for one or more of therapeutically useful genes and a sub-set of MV genes.
18. A method of reducing a number of cancer cells, wherein the cancer cells are part of a tumour, the method comprising the steps of administering: the Virosomes comprising artificially designed Measles Virus genome like replicon RNAs that comprise exclusively of non-Measles Virus genes or a combination of non-Measles Virus and a subset of MV genes.
Description
BRIEF DESCRIPTION OF FIGURES AND LEGENDS
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
DNA SEQUENCES
[0066] Seq ID 1: Plasmid pMTX-P1T. Seq ID 2: Modified Pst I fragment. Seq ID 3: Age-MVuptoSpe-Age fragment. Seq ID 4: Plasmid pMTX-P1T-Intermediate. Seq ID 5: Pml-L2-Eco RI fragment. Seq ID 6: Pml-L1-Pml I fragment. Seq ID 7: Plasmid pMTX-P1T-High Seq ID 8: Plasmid pMTX-NP-RE1-FH-RE2-RE3. Seq ID 9: Plasmid pMV. Seq ID 10: GMCSF-ires-PAP. Seq ID 11: GMCSF-ires-CytD. Seq ID 12: GMCSF-ires-sPD1-2A-PAP. Seq ID 13: GMCSF-ires-sPD1-2A-CytD. Seq ID 14: GMCSF-ires-sPD1-2A-DnG1-ires-PAP. Seq. ID 15: GMCSF-ires-sPD1-2A-DNG1-ires-CytD. Seq ID 16: Plasmid pMV-GP. Seq ID 17: pMV-GC
[0067] Seq ID 18: Helper plasmid. Seq ID 19: Modified Afe I-Not I fragment. Seq ID 20: pMV-NPFH-GCG. Seq ID 21: pMTX-P1T-D2G. Seq ID 22: Sequence that was deleted from the pMTX-P1T-D2G. Seq ID 23: pMV-GsPP. Seq ID 24: pMV-GsPDP. Seq ID 25: pMV-GsPC
[0068] Seq ID 26: pMV-GsPDC. Seq ID 27: ires-sPD1-2A-DnG1-ires. Seq ID 28: ires-sPD1-2A-DnG1-ires.
[0069] This invention describes the use of a recently described two plasmid system described in WO2013046216 that harnesses the RNA Dependent RNA Polymerase (RdRP) of non-segmented negative strand RNA viruses for expression of recombinant proteins and production of measles virus derivatives. The investion comprises (a) one cloning plasmid coding for suitably modified MV genome or a MV genome like replicon RNA that codes for desired non-MV genes cloned at conveniently provided restriction enzyme sites, and (b) one helper plasmid coding for and expressing N, P, L proteins respectively.
[0070] This invention comprises replicating and non-replicating derivatives of a virus that is attenuated. In one aspect of this invention, the said attenuated virus comprises attenuated MV (Measles Virus). Although this invention has been illustrated by using MV genome, any other virus with similar requirements for rescuing viruses from cDNA, equivalent attenuation and safety for a human being may be used in place of MV. The requirements for rescuing the above referred “any other virus” from cDNA comprise use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit.
[0071] The MV derivatives of this invention comprise recombinant replicating and non-replicating derivatives of MV. The replicating MV derivatives of this invention are considered more effective as therapeutic agents for cancer than other currently used oncolytic MV derivatives due to multiple features. Firstly, the replicating MV described in this invention code for 2 to 4 non-MV genes from a single ATU, these non-MV genes have the potential to cause cancer cell death and also induce anti-tumour immunity. Secondly, these viruses are armed to deliver other/additional genes that either sensitize them to death by prodrug activating enzymes like cytosine deaminase or kill cancer cells or inhibit their growth through other mechanisms. Secondly, the non-replicating Measles virus derivatives (named as “Virosomes”) described in this invention offer a greater versatility at combining therapeutically useful genes into MV, increased safety provide an opportunity to overcome the problem of pre-existing anti-MV immunity and alsoexpand the application of therapeutic MV to other disease conditions
[0072] This invention has been illustrated by disclosing an Oncolytic Measles Virosome that combines the oncolytic effect of MV with the therapeutic effect of a dominant negative mutant of Cyclin G1, sensitizing effect of Cytosine deaminase and immunopotentiating effect of GMCSF and/or PD-1 blockade. Such Virosomes will also help eliminate the potential risk factors associated with using live MV for therapy.
[0073] The MV derivatives described in this invention can be produced using just 2 plasmid DNA molecules which can be directly used as therapeutic agents thus eliminating the high costs & difficulties involved in manufacturing the currently used massive doses of MV for cancer therapy. Such oMV producing plasmid DNA molecules can will not be recognized by anti-MV immunity and so will help overcoming the problem of pre-existing anti-MV immunity.
[0074] This invention also comprises means for designing the said replicating and non-replicating viruses. In one aspect of this invention, the said means comprise DNA molecules. The said DNA molecules comprise plasmids.
[0075] In a further aspect, this invention comprises recombinant Measles virus genome cloned with two or more therapeutically effective genes.
[0076] In a further aspect, this invention comprises plasmids useful for producing non-replicating measles viruses which contain non-viral genes including therapeutically useful genes along with a variable number of MV-genes to ensure a pre-determined level of expression.
[0077] This invention illustrates synthesis of replicating MV derivatives comprising recombinant MV derivatives that also code for 2 to 4 non-MV genes like human granulocyte macrophage colony stimulating factor (GMCSF) which is known to induce anti-tumour immune responses, prostate specific acid phosphatase (PAP) which will help enhance the specificity of induced immune response, serve as a marker to determine the replicative capacity of rMV-GP as a function of phosphatase enzyme activity, exhibit an enhanced potency of anti-cancer effect due to incorporation of cytocidal genes like Cytosine deaminase and the dominant negative mutant of Cyclin G1.
[0078] This invention also comprises synthesis of non-replicating MV derivatives, designated/named for the purpose of this specification as “Virosomes”. Depending on the composition of their genome, the virosomes comprise three different types (1) those coding exclusively non-MV genes, (2) those coding for MV-N and MV-P genes along with non-MV genes and (3) those coding for MV-N, MV-P and MV-L genes along with the non-MV genes. These three virosomes are useful for expressing non-MV genes in infected cells at low, intermediate and high levels respectively.
[0079] The concept of Virosomes is illustrated by producing GFP virosomes. Ability of different types of Virosomes to express non-MV genes at different levels is illustrated by producing Dengue Virosomes which code for Dengue virus pr-M and E proteins either exclusively or in combination with MV-N, MV-P and MV-L proteins.
[0080] One virosome comprises of a genome that codes for dengue virus prM and E proteins and green fluorescent protein but NO measles virus gene.
[0081] The second synthesized Virosome contains a genome that codes for MV-N, MV-P and MV-L proteins along with Dengue virus preM and E proteins and the Green fluorescent protein.
[0082] The third synthesized Virosome contains a genome that codes for a truncated prM and E proteins of Dengue virus and the Green fluorescent protein. These Dengue virosomes have been shown to be capable of inducing in animals, an anti-Dengue immunity (
[0083] In a further aspect of this invention an Oncolytic Virosome (nr-MV-HF-GCG) has also been synthesized a. This virosome comprises of a genome that codes for MV-N, MV-P, MV-H and MV-F proteins along with other non-MV genes which have therapeutically beneficial effects. Such virosomes will offer new more effective and safer MV derivatives for cancer therapy.
[0084] It is an embodiment of this invention that replicating MV derivatives like rMV-GP, rMV-GC, rMV-GsPP, rMV-GsPC, rMV-GsPDP and rMV-GsPDC induce the death of cancer cell lines like T47D, A549 or PC-3 but do not adversely affect non-cancerous cells as illustrated with cells like Vero cells.
[0085] This invention also embodies the demonstration that plasmid DNA molecules which are useful to produce replicating MV derivatives like rMV-GP and the Helper plasmid (Seq ID #18) together, are sufficient to induce cell death in PC-3 cells in a manner similar to oncolytic MV and may be useful to circumvent the problem of pre-existing anti-MV immunity that hinders MV virotherapy.
[0086] In a further aspect this invention comprises pharmaceutical compositions comprising viruses or DNA molecules. This invention also comprises use of viruses or DNA molecules as therapeutic agents for diseases. The diseases include cancer and Dengue. Thus, this invention discloses replicating derivative of MV that induces cancer cell death and Virosomes effective against Dengue.
[0087] This invention also discloses non-replicating derivative of MV that mediates transfer of different therapeutically useful genes into cancerous and other human cells and will be useful either as therapeutic agents or agents capable of inducing desired immune responses.
[0088] This invention also embodies a reagent kit for producing the said non-replicating MV derivatives.
[0089] In another aspect this invention comprises a method of treating cancer by administering an oncolytic measles virus or DNA molecules producing the said oncolytic measles virus to a patient so as to reduce the number of cancer cells wherein the said cancer cells are part of a tumour.
[0090] In yet another aspect this invention comprises a method of reducing the number of cancer cells, wherein the cancer cells are part of a tumour, by administering an oncolytic virus or DNA molecules producing the said oncolytic measles virus to the patient.
[0091] This invention also comprises a method of producing recombinant replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid.
[0092] This invention discloses a method of producing a non-replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid and a packaging cell line.
[0093] This invention also embodies a cell line derived from Vero cells that expresses the M, F and H proteins of Measles virus stably and is useful as a packaging cell line for the production of non-replicating derivatives of measles virus described in non-replicating derivatives of measles virus. This invention also embodies a cell line derived from Vero cells that expresses the M protein of MV stably and is useful as a packaging cell line for the production of non-replicating MV derivatives which do not contain the H and F proteins of MV.
[0094] This invention embodies a method of producing recombinant replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid wherein the helper plasmid expresses the N, P and L proteins of measles virus and is identical to Seq ID #18.
[0095] This invention also discloses a method of producing recombinant derivatives of measles virus wherein the cloning plasmids codes for the entire genome of measles virus modified suitably to include additional transcription unit that codes for a non-measles virus gene at a location immediately upstream of the N protein gene.
[0096] This invention embodies a method of producing recombinant derivatives of measles virus wherein the cloning plasmid codes for the entire genome of measles virus modified suitably to include non-measles virus genes as part of the different genes of measles virus.
[0097] This invention also comprises a method where in the Cloning plasmid is derived from the plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles protein coding DNA sequences in one or both of the multiple cloning sites (MCS) provided.
[0098] This invention further comprises a method where in the Cloning plasmids for producing recombinant derivatives of measles virus may code for a genome comprising exclusively of non-measles genes expressed while being a part of a measles virus genome-like replicon. This cloning plasmid may be derived from plasmid pMTX-P1T (Seq ID #1) by cloning non-MV genes in to one or both of the 2 multiple cloning sites (MCS) provided in this plasmid.
[0099] This invention also discloses a method wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome-like replicon. This plasmid may be derived from Seq ID #8) OR a non-replicating derivative of MV that contains a genome coding for the fusogenic glycoproteins like MV-H & MV-F proteins and a combination of other genes such as suicide genes, pro-drug activating enzyme coding genes, or genes that code for cytokines & proteins which induce anti-tumour immunity.
[0100] This invention comprises one or more DNA molecules useful for producing variants of non-replicating derivatives of MV termed as Virosomes—Cloning plasmids—Seq ID #1, Seq ID #4, Seq ID #7, Seq ID #20,
[0101] This invention further comprises a method of producing non-replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid and a packaging cell line where in the cloning plasmid codes for a genome comprising of non-measles virus genes and the N, P and/or L proteins of measles virus in the form of a measles virus genome-like replicon and the said cloning plasmid is derived from the plasmid pMTX-P1T-Intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles genes in to one or both of the multiple cloning sites (MCS) provided in these plasmids.
[0102] This invention discloses a method of producing recombinant derivatives of measles virus where in the helper plasmid codes for the N, P and L proteins of Measles virus and is identical to Sequence ID #18.
[0103] This invention comprises a replicating derivative of MV that codes for 2 or more non-MV genes which may either enhance the potential of the virus for inducing anti-cancer immunity or its cancer therapeutic effect. Such genes may include but not be limited to a cytokine and immunoregulatory cell surface molecule like sPD-1 or CTLA4, a tumour associated antigen, and genes that affects the cancer phenotype or induces cancer cell death (e.g. dominant negative mutant of Cyclin G1). Thus, MV derivatives encoding 2, 3 or 4 different non-MV genes are described.
[0104] This invention also embodies a replicating derivative of MV wherein the cytokine consists of one or more of GMCSF and other cytokines.
[0105] This invention discloses a replicating derivative of MV wherein the tumour associated antigen is prostatic acid phosphatase (PAP) or any other tumor associated antigen.
[0106] This invention discloses a replicating derivative of MV wherein the immuno-regulatory cell surface molecule is soluble PD-1 molecule.
[0107] This invention discloses a replicating derivative of MV wherein the cytocidal gene is cytosine deaminase.
[0108] This invention comprise a replicating derivative of MV wherein the cytokine is human GMCSF and the tumour associated antigen is human prostatic acid phosphatase (PAP).
[0109] This invention also comprises a method of treating cancer by administering replicating derivative of MV wherein the cytokine is human GMCSF and the tumour associated antigen is human prostatic acid phosphatase (PAP).
[0110] This invention further comprises a method of treating cancer by administering recombinant measles virus made by a method wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome like replicon further wherein the plasmid may be derived from Seq ID #8 and more specifically from Seq ID #20.
[0111] This invention discloses a pharmaceutical composition of a non-replicating virus and method to use it for treatment of one or more diseases; the pharmaceutical composition comprising, at least, the non-replicated virus and a sodium chloride or a balanced salt solution in a buffered base.
[0112] This invention also discloses a pharmaceutical composition of a replicating virus & method to use it for treatment of one or more diseases further comprising a cancer; the pharmaceutical composition comprising, at least, sodium chloride or balanced salt solution in a buffered base.
[0113] This invention embodies a pharmaceutical composition comprising one or more of DNA molecules useful for producing replicating and/or non-replicating derivatives of measles virus for therapeutic benefit, the said pharmaceutical composition comprising of water containing EDTA, salt and an agent promoting entry of DNA into animal cells.
[0114] This invention also embodies a method of using DNA molecules useful for producing the said replicating and/or non-replicating derivatives of measles virus for therapeutic benefit. The method comprising of administering a pharmaceutical composition comprising the DNA molecules useful for producing the said replicating and/or non-replicating derivatives of measles virus, water containing EDTA, salt and an agent promoting entry of DNA into animal cells.
[0115] This invention also comprises a method of treating disease by transfer genes that code for therapeutically useful proteins and/or RNA molecules into human cells by administering the recombinant non-replicating measles viruses produced by a method that comprises use of a single Helper plasmid and a Cloning plasmid and a MV packaging cell line where in (a) the Cloning plasmid is derived from the plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles protein coding DNA sequences in one or both of the multiple cloning sites (MCS) provided, or (b) where in the cloning plasmid may code for a genome comprising exclusively of non-measles genes expressed in the form of a measles virus genome like replicon, further wherein the cloning plasmid may be derived from plasmid pMTX-P1T (Seq ID #1) by cloning non-MV genes in to one or both of the 2 multiple cloning sites (MCS) provided in this plasmid; or (c) wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome like replicon further wherein the said plasmid may be derived from Seq ID #8.
[0116] This invention embodies non-replicating virus coding for Dengue virus subviral particles comprised of preM and E genes and a method for using this as a vaccinating agent for prevention of Dengue.
[0117] Below are given examples which are only illustrative of working of this invention and are not be construed as limiting the scope of the disclosure of this invention or the means/reagents used for the examples or conditions used for the examples. Any variation that is an obvious variation and equivalents are considered to be included within the scope of the disclosure of this invention.
Examples
1. Cells and Viruses
[0118] Vero (African green monkey kidney) cells were procured from the National Center for Cell Sciences (NCCS), Pune and grown as monolayers in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS). MVAC (Measles Virus Live I.P.) manufactured by Serum Institute of India was purchased off the counter from Emke Medicals by Applicant. To prepare a seed stock, Vero or MRC5 cells (NCCS, Pune) were seeded in 25 sq. cm flasks at 105 cells/flask and incubated overnight at 37 C in 5% CO2. Cells were washed with HBSS and seeded with MV-E at a multiplicity of infection (MOI) of 0.1 and incubated for 7 days. Culture supernatant was removed at every 24 hrs and replaced with DMEM containing 2% FCS. Virus from the harvested supernatants was pooled together, quantitated by TCID50 method. Culture supernatants containing the maximum virus titre were pooled together and used as seed stock.
2. Plasmids
[0119] The method described in this invention essentially envisages co-transfecting a Cloning plasmid and a Helper plasmid into different cell lines like vero cells which are conducive to measles virus propagation and producing the desired type of measles virus. The various Cloning plasmids which may be used for this purpose are described in details below.
[0120] Cloning Plasmids
[0121] The two plasmid expression system used here was earlier described in WO/2013/046216 and comprises of a helper plasmid that expresses the N, P and L proteins of Measles virus and a Cloning plasmid that is useful to express an artificial replicon in which up to 2 proteins can be cloned. The cloning plasmid pUC-P1P-Rep-P1T which was earlier described in WO/2013/046216 as sequence ID #6 was modified using standard molecular biology techniques as follows:
[0122] 2.1 Cloning Plasmid Vectors—for Producing Non-Replicating MV Derivatives (Virosomes)
[0123] 2.1.1 pMTX-P1T: Commercially available pIRES (Clonetech Takara) was digested with BgI II and Hpa I and processed to create blunt end. The 4172 bp fragment corresponding to the nucleotide numbers 1930 to 6102 was isolated and processed with klenow fragment of E coli DNA polymerase I to generate blunt ends. This was then ligated with T4 DNA ligase to the 969 base pair fragment corresponding to the sequence ID no. 3 (WO/2013/046216) which was removed from the sequence ID no 6 (WO/2013/046216) by digesting with Sac I and Hind III and processed with Klenow fragment of E coli DNA polymerase I to produce blunt ends. The resulting plasmid was called pNeo_P1T. The plasmid pNeo_P1T was then digested with Bst BI and Stu I and the larger fragment was purified. This was then manipulated in silico so that the Neomycin resistance gene open reading frame was replaced by protein coding region for mouse Dihydrofolate reductase (DHFR) enzyme (NP-034179.1,Genbank) and the resultant sequence (termed DHFR cassette) synthesized using the gene synthesis method (Genscript Inc, USA). and digested with Bst BI and Stu I. This Bst BI and Stu I digested DHFR cassette then was ligated into the larger fragment of Bst BI and Stu I digested pNeo_P1T to generate pMTX_P1T. The resulting pMTX_P1T plasmid contains the replicon coding gene under the control of RNA polymerase I promoter and DHFR as a selection marker (
[0124] 2.1.2 pMTX-P1T-Intermediate: This pMTX-P1T plasmid was modified further. This pMTX-P1T plasmid was digested with Pst I and the smaller fragment corresponding to the MVstart to MCS2 was discarded. A DNA corresponding to the Sequence ID no 2 was synthesized using the gene synthesis technology (Genscript Inc, USA), digested with Pst I and ligated into the larger fragment of Pst I digested pMTX-P1T to generate the plasmid pMTX-P1T-MVstart-Age-MCS1-N/P-MCS2. This pMTX-P1T-MVstart-Age-MCS1-N/P-MCS2 plasmid was digested with Age I. The region corresponding to sequence ID no. 3 was amplified by polymerase chain reaction (PCR) and extended by adding the nucleotides “TCTCGACGCGTACATGTAGCGCTCGCACCGGT” (SEQ ID NO. 29). This resulting PCR amplified DNA was digested with Age I and cloned into Age I digested P1T-MVstart-Age-MCS1-N/P-MCS2 to generate “pMTX-P1T-Intermediate” plasmid (Seq ID no. 4).
[0125] 2.1.3 pMTX-P1T-High: The plasmid pMTX-P1T-Intermediate was digested with Pml I and Eco RI and the larger fragment was purified. A DNA corresponding to a sequence starting from the Pml I site in L protein coding region of MV (AY486084) up to the end of MV genome was PCR amplified using primers specific to the Pml I site containing region of L protein and the 3′ end of MV genomic sequence extended to contain Eco RI site to obtain a Pml-L2-EcoRI fragment. This was digested with Pml I and Eco RI and cloned into the larger fragment of Pml I & Eco RI digested pMTX-P1T. The Eco RI site immediately downstream of the L2 fragment was then removed by in vitro mutagenesis to generate a pMTX-P1T-Intermediate-L2 plasmid. A DNA corresponding to H/L intergenic region followed by the 5′ part of L coding region up to Pml I enzyme site (sequence ID no. 6) was then PCR amplified from plasmid encoding MV genomic RNA (WO/2013/046216) and digested with Pml I enzyme. This was then ligated into Pml I digested pMTX-P1T-Intermediate-L2 plasmid to produce “pMTX-P1T-High” (Seq ID No. 7).
[0126] 2.1.4 pMTX-P1T-NP-RE1_FH_RE2_RE3: Plasmid pMV was used to produce this plasmid. The L protein coding region from pMV was replaced by an oligonucleotide coding for restriction enzyme sites Mlu I and Afe I by in vitro mutagenesis to produce pMV-del-L. Sequence corresponding to MV-M protein was replaced by oligonucleotide linker for Eco RI and Nru I to produce pMV-del-LM. Plasmid pMV-del-LM was then digested with Afe I and Not I and the smaller fragment discarded. This was then replaced with a Modified “Afe I to Not I fragment” that introduces an additional ATU region containing the sites for restriction enzyme sites for Mlu I and Xho I into the MV backbone. This a plasmid that expresses a MV replicon that codes for N, P, F and H proteins of MV along with 3 additional transcriptional units which can be modified by insertion of up to 3 non-MV proteins(Seq ID 8).
[0127] 2.1.5 Cloning Plasmids to be Used for Producing Specific Virosomes
[0128] 2.1.5.1 Dengue Virosome Cloning plasmids: The sequence coding for the Dengue virus like particles containing the preM and Envelope (E) proteins of Dengue virus serotype 2 along with a signal peptide (as described by Wang and co-workers (2009) [43] flanked by Asc I enzyme site was synthesized using Gene synthesis technology (Genscript Inc, USA) and cloned in between the Asc I & Xho I sites of pMTX-P1T to produce pMTX-P1T-D2. An orientation that showed that 5′ end of D2 gene was towards the 5′ end of the replicon coded by pMTX-P1T was selected.
[0129] Similarly, a nucleotide sequence corresponding to the eGFP protein was PCR amplified from the pUC-P1T plasmid (WO/2013/046216) using gene specific primers with Pac I enzyme site. The resulting GFP coding segment was then cloned into the Pac I site present in the MCS2 of pMTX-P1T to produce pMTX-P1T-D2G plasmid. An orientation that showed that 5′ end of GFP gene was immediately downstream of D2 protein gene was selected. (Seq ID #21)
[0130] The same cloning strategy was used to clone D2 and GFP coding genes into pMTX-P1T-intermediate and pMTX-P1T-high to produce “pMTX-P1T-intermediate-D2G” and “pMTX-P1T-high-D2G” plasmids.
[0131] 2.1.5.2 Chimeric Dengue Virosome Coding Plasmid
[0132] The coding region for the Dengue virus prM region of Dengue virus was identified from the plasmid pMTX-P1T-D2G and 273 bases corresponding to the pr region (Seq ID #21) were deleted using in vitro mutagenesis to generate pMTX-P1T-D2Gdelpr plamid. 2.1.5.2 GFP Virosome coding plasmid: Plasmid pUC-P1T (WO/2013/046216) was digested with Asc I enzyme and the sequence corresponding to the eGFP protein cloned into the MCS1 of pMTX-P1T at Asc I site to produce pMTX-P1T-G plasmid.
[0133] 2.1.5.3 Oncolytic Virosomes: Sequence corresponding to Cytosine deaminase (CytD) reported by Erbs et al, (2000) [44] appended with sequences for Mlu I site at both ends was assembled in the order 5′-Mlu I-CytD-Afe I-Mlu 1-3′. Sequence corresponding to the cytotoxic dominant negative Cyclin G1 (dnG1) protein was derived from the Cyclin G1 sequence reported by Gordon et al (2000) [45] and appended at 5′ and 3′ ends with suitable restriction enzyme sites in the order 5′-Eco RI-dnG1-Nru I-Eco RI-3′. The resultant Cyt D and dnG1 sequences were synthesized using gene synthesis technology (Genscript Inc, USA). On the other hand, GMCSF coding sequence was PCR amplified from the GMCSF-ires-PAP coding DNA usng a forward gene specific primer containing XhoI site and a reverse gene specific primer containing the sites for Xho 1 and Pml 1 enzyme at the 5′ ends.
[0134] PCR amplified GMCSF coding region was digested with Xho 1 and Pml 1 and ligated into similarly digested pMTX-P1T-NP-RE1-FH-RE2-RE3 to produce pNPFH_GMCSF. Sequence corresponding to Cyt D protein was digested with Mlu I and Afe I and ligated into similarly digested pNPFH-GMCSF to produce pNPFH-GMCSF-CytD. Finally plasmid pNPFH-GMCSF-CytD was the digested with Eco RI and Nru I and ligated to similarly digested dnG1 coding fragment to produce pNPFH_GCdnG1 to produce pNPFH_GCdnG. Plasmid pNPFH_GCdnG (or pNPFH-GCG) (Seq ID 20) codes for a MV replicon that codes for the N, P, F and H proteins of MV and GMCSF, Cytosine Deaminase and cytotoxic mutant of Cyclin G1.
[0135] 2.2 Cloning Plasmids—Useful for Producing Replicating Measles Virus Coding Derivatives
[0136] 2.2.1 pMV— Measles virus coding plasmid: A plasmid encoding the entire cDNA of MV genomic RNA (AY486084) was described in WO/2013/046216. This plasmid was digested with Spe I enzyme and the smaller 5802 bp Spe I fragment consisting of the nucleotide nos 3373 to 9175 from the MV genome (AY486084.1, Genbank) was isolated. Similarly the plasmid pMTX-P1T-High was then digested with Spe I and the larger 14564 bp fragment was purified. These two fragments were then ligated with T4 DNA ligase and the orientation with correct sequence orientation w.r.t. MV genomic RNA was selected to obtain the pMTX-P1T-MV plasmid. This plasmid was used to introduce additional genes and/or protein coding regions at various locations within the MV genomic sequence (Seq ID No 9). Additionally, cDNA coding for MV antigenomic RNA containing a cis-acting hammerhead ribozyme (HH) at the 5′ end and the hepatitis delta virus ribozyme (HDV) at the 3′ end and containing Afe I and Pme I enzyme sites at its 5′ and 3′ end in the order 5′-AfeI-PmeI-HH-MV antigenomic cDNA-HDV-PmeI-3′ was synthesized by gene synthesized technology and cloned at the Eco RV site of pUC57 and an orientation wherein the Hind III site from the multiple cloning site of pUC57 was located upstream of the N protein coding gene was selected. This plasmid was also called as pMV and is represented by Seq ID #28.
[0137] 2.2.2 Additional transcriptional unit (ATU) coding DNA fragments: The nucleotide sequences corresponding to the protein coding regions of human GMCSF (NM000758.3; Genbank), prostatic acid phosphatase (PAP) (BC016344.1; Genbank), the GTX homeodomain IRES element described by Chappell et al, (2000) [46], Cytosine deaminase (AF 312392, Genbank), soluble human programmed cell death 1 (L27440. Genbank) and the porcine Tischovirus 2A peptide described by Szymczak et al (2004)[47] were then assembled into bi-cistronic (1) bi-cistronic (e.g. GMCSF-ires-PAP (Seq ID 10) and GMCSF-ires-CytD (Seq ID 11), (2) tri-cistronic (e.g. GMCSF-ires-sPD1-2a-PAP (Seq ID 12), GMCSF-ires-sPD1-2a-CytD (Seq ID 13)), and tetra-cistronic (e.g. GMCSF-ires-sPD1-2aDnG1-ires-PAP, Seq ID 14, GMCSF-ires-sPD1-2aDnG1-ires-CytD, Seq ID 15) constructs in silico as shown in
[0138] These were then assembled into additional transcriptional units by appending selected regions from the MV genomic RNA (AY486084) as described in Table 2 to produce ATU coding DNA fragments. Resultant fragments were synthesized by gene synthesis technology (Genscript Inc, USA).
TABLE-US-00001 Order of assembly of the Regions selected from the MV genomic fragments with ATU No RNA multicistronic constructs ATU -1 (1) MV start (ntd # 1 to 107), (2) N/P 5′-HindIII-Mvstart-MGC- intergenic region (ntd # 1686-1807), (3) N/P-N upto Bam-3′ Part of the N protein open reading frame upto Bam HI (ntd # 108 to 174) ATU - 2 (1) N/P intergenic region (ntd # 1686 to 5′-N/P intergenic-MGC-N/P 1806), (2) N-P intergenic region along with intergenic with part of P-3′ a part of MV-P gene (ntd # 1686 to 1957 ATU - 3 (1) Porf end (ntd # 3265 to 3330), (2) N/P 5′-Porf end-N/P intergenic- intergenic region (ntd # 1686 to 1806), (3) MGC-P/M intergenic-3′ P/M intergenic region (ntd # 3331 to 3440), ATU - 4 (1)F/H intergenic region (ntd 7111 to 5′-F/H intergenic-GMCSF- 7247), and (2) F/H intergenic region (ntd ires-PAP-F/H intergenic-3′ 7111 to 7247) ATU - 5 (1) H/L intergenic region (ntd # 9175 to 5′-H/L intergenic-GMCSF- 9233), (2) N/P intergenic region (ntd # ires-PAP-N/P intergenic- 1686 to 1806), (3) part of the L protein Lorf-3′ coding region (ntd # 9234 to 9577)
[0139] The resulting sequences were cloned into the plasmid coding for MV genomic RNA as described to produce plasmids coding for MV containing additional genes at different locations of the MV genome.
[0140] 2.2.3 Modified pUC57 plasmids: First the Aat II site present in the pUC57 vector was removed replacing the A present at position 2642 with G residue by site directed mutagenesis. The resulting plasmid was called pUC-delAat. Plasmid pUC57-delAat was then digested with Eco RI and Hind III to remove the multiple cloning site (MCS) and treated with the klenow fragment of E coli DNA polymerase I to produce blunt ended pUC57. This was then ligated with each one of the following oligonucleotide linkers to produce different modified pUC57 plasmids
TABLE-US-00002 Sr Plasmid No Oligonucleotide sequence name 2 Spe I linker pUC-Spe 3 5′-GACGTCATGCCCTGCAGG-3′ pUC-AS (SEQ ID NO. 30) 4 5′-CCTGCAGGATGCACTAGT-3′ pUC-SS (SEQ ID NO. 31)
[0141] 2.2.4 Plasmids Coding for MV Genomic RNA Containing ATU at Different Locations:
[0142] Plasmids encoding the MV genomic RNA containing an additional ATU coding for 2 or more non-MV genes inserted at different locations of the MV genome were synthesized from pMV, pATU-GP and pUC57 using standard molecular biology techniques as shown in
[0143] 2.2.4.1 Inserting ATU upstream of N gene (pMV-GP): A plasmid encoding the entire MV genomic RNA including an additional ATU coding for bi-cistronic gene coding for GMCSF and PAP proteins was synthesized from pMV (Seq ID #9), pATU-GP (Seq ID 10) and pUC57 using standard molecular biology techniques.
[0144] The plasmid pMV was then digested with Aat II and Sbf I and the smaller 3989 bp fragment that codes for part of the RNA pol I promoter and the MV-N was removed and re-circularised by ligating it with an oligonucleotide linker for Aat II and Sbf I (5′-GACGTCATGCCCTGCAGG-3′) (SEQ ID NO. 30) to produce pMV-AS. The plasmid pMV-AS was then digested with Bam HI and Hin dIII and the larger 3613 bp fragment was selected.
[0145] Similarly, the ATU-GP DNA was then digested with Bam HI and Hind III and the ATU coding 2151 bp fragment was then cloned into the Bam HI & Hin DIII digested pMV-AS plasmid to generate pUC-with-ATU plasmid. This ATU coding region from pUC-with-ATU plasmid was then removed by digestion with Aat II and Sbf I and cloned into Aat II and Sbf I digested pMV plasmid to generate pMV-GP plasmid. The resulting pMV-GP contains an additional transcription unit coding for GMCSF & PAP proteins immediately upstream of MV-N protein coding region (Seq ID #16). The same strategy was used to synthesize a plasmid encoding the genome of MV containing GMCSF and Cytosine deaminase genes (pMV-GC, (Seq ID no 17). The plasmids encoding tri- (Seq ID 23 and Seq ID 25) and tetra-cistronic (Seq ID 24, Seq ID 26) genes upstream of the N gene of MV were produced using similar strategy from Seq ID 12, Seq ID 13, Seq ID 14 and Seq ID 15 respectively.
[0146] 2.2.4.2 Insertion of ATU upstream of P gene (pMV-GP-ATU2): Plasmid pMV was digested with Sac II, the resulting 6213 bp fragment was purified and circularized by re-ligation with T4 DNA polymerase to produce pSacII-of-MV. This plasmid was digested with Sbf I and Xba I and the larger fragment purified. This was ligated to ATU2 DNA (described in 2.2.2.2 above) digested with Sbf I and Xba I to produce pN-ATU2-P. Plasmid pN-ATU2-P was digested with Sac II and the smaller ATU coding fragment was ligated into the larger 14153 bp fragment of pMV digested with Sac II to produce pMV-GP-ATU2. This plasmid contains ATU inserted upstream of P gene of MV.
[0147] 2.2.4.3 Insertion of ATU upstream of M gene (pMV-GP-ATU3): Plasmid pMV was digested with Spe I and the larger 14 kb fragment was circularized by re-ligation with T4 DNA polymerase to produce pNPL. Plasmid pNPL was digested with Sbf I and Spe I and the resulting 1415 bp fragment was purified cloned into pUC-SS digested with Spe I and Sbf I to produce pUC_PL. Plasmid pUC_PL was then digested with Eco RV and Spe I and the larger fragment purified. This was then ligated to ATU3 DNA digested with Eco RV and Spe I to produce pP-ATU3-L. Plasmid pP-ATU-L was digested with Sbf I and Spe I and the ATU coding region cloned into pNPL to produce pNP-ATU-L. Plasmid pNP-ATU-L was the digested with Spe I and ATU coding fragment was ligated to the 5802 bp fragment produced by digesting pMV with Spe I to produce pMV-GP-ATU3. This plasmid contains ATU inserted upstream of M gene of MV.
[0148] 2.2.4.4 Insertion of ATU upstream of H gene (pMV-GP-ATU4): Plasmid pMV was digested with Pac I. Similarly, ATU4 DNA (described in 2.2.2.4 above) was digested Pac I and ligated with Pac I digested pMV to produce pMV-GP-ATU4. This plasmid contains ATU inserted upstream of H gene of MV.
[0149] 2.2.4.5 Insertion of ATU upstream of L gene (pMV-GP-ATU5): ATUS DNA (described in 2.2.2.5 above) was digested with Spe I and Eco RI and ligated into the larger fragment produced by digesting pNLP (described 2.3.3.3 above) to produce pNP-ATU-L. The 5802 bp fragment produced by digesting pMV with Spe I was then ligated to pNP-ATU-L digested with Spe I to produce pMV-GP-ATUS. This plasmid contains ATU inserted upstream of L gene of MV.
[0150] 2.2 Helper plasmid: RNA was prepared from the purified MVAC (Measles Virus Live I.P.) as manufactured by Serum Institute of India, which was purchased off the counter from Emke Medicals by Applicant, using the GeneJet RNA purification kit (Fermentas) according to the manufacturer's protocol. 1 μg RNA was reverse transcribed using random hexamers and amplified using primers specific for the N (F: 5′-GCTAGCATGGCCACACTTTTAAGG-3′ (SEQ ID NO. 32) and R 5′-GCGGCCGCCTAGTCTAGAAGATT-3′ (SEQ ID NO. 33)), P (F 5′-GCTAGCATGGCAGAAGAGCAGG-3′ (SEQ ID NO. 34), 5′-GCGGCCGCCTACTTCATTATTATC-3′ (SEQ ID NO. 35)) and L (F 5-GCTAGCATGGACTCGCTATCTGTCAAC-3 (SEQ ID NO. 36), 5-GCGGCCGCTTAGTCCTTAATCAG-3 (SEQ ID NO. 37)) protein coding regions using Superscript III (Invitrogen) as described by Martin et al, (2006) and Combredet et al (2003) using standard molecular cloning techniques. Amplified cDNAs were cloned in between the Nhe I and Not Isites of pIRES vector (Clonetech) to generate pIRES_N, pIRES_P and pIRES_L plasmids.
[0151] N protein sequence was then amplified and sub-cloned in between the Nhe I and Xho I sites to obtain pIRES_N. P protein sequence was then amplified from pIRES_P and cloned into the Eco RI and Mlu I sites tocreate pIRES_NP. Finally, the L sequence was amplified from pIRES_L and cloned into pIRES_NP between the Sal I and Not I sites to obtain pIRES_NPL. In this form, this plasmid will express N and L proteins but not P. Therefore an oligonucleotide corresponding to the mammalian HTX homeobox internal ribosomal entry site reported by Chappell et al (2000) [46] was inserted in between the MV-N and MV-P protein coding regions by site directed mutagenesis. Resulting plasmid pNiPL expresses MV-N, MV-P and MV-L in transfected cells (
3. Generation of a Packaging Cell Line for Non-Replicating Viruses
[0152] The DNAs corresponding to the coding regions of MV-M, MV-F and MV-H proteins were PCR amplified using gene specific primers using Pfu polymerase (Invitrogen) according to manufacturer's protocol. These amplified genes were then cloned into suitably digested pCDNA3.1(−) (Invitrogen, USA) plasmid vector. Clones encoding MV-M, MV-F and MV-H proteins were identified by digestion with specified restriction enzymes and confirmed by single pass sequence determination (data not shown) (
[0153] Vero.sub.MFH cell line: Plasmids encoding MV-M, MV-F and MV-H genes were linearised by digestion with Not I enzyme and mixed in equal quantities and used to transfect Vero cells (3 ug in each well of Vero cells plated in 6 well plates) in Lipofectamine 2000 (Invitrogen). Transfection was allowed for 4 hrs and culture medium changed to DMEM containing 10% FCS. Cells were incubated for 24 hrs at 37 C in 5% CO2. At the end of 24 hrs, culture medium was removed and replaced by DMEM containing 10% FCS and 500 uM Geneticin. The incubation was continued at 37 C in 5% CO2 with frequent changing to fresh Geneticin containing medium for next 3 weeks. At the end of 3 weeks, colonies of Geneticin resistant cells were trypsinized and cultured as cells expressing MV-M, MV-F and MV-H proteins. These cells were diluted and plated in 96 well plate at 1 cell per plate and allowed to grow in DMEM containing 10% FCS and 500 uM Geneticin. The ability of these cells to express MV-M, MV-F and MV-H proteins was ascertained by SDS-polyacrylamide gel electrophoresis of the cell lysate followed by western blot with antibodies reactive to corresponding proteins (
[0154] Vero.sub.M cell line: Plasmid encoding MV-M gene was linearised by digestion with Not I enzyme transfected into Vero cells (3 ug in each well of Vero cells plated in 6 well plates). Transfection was allowed for 4 hrs and culture medium changed to DMEM containing 10% FCS. Cells were incubated for 24 hrs at 37 C in 5% CO2. At the end of 24 hrs, culture medium was removed and replaced by DMEM containing 10% FCS and 500 uM Geneticin. The incubation was continued at 37 C in 5% CO2 with frequent changing to fresh medium for next 3 weeks. At the end of 3 weeks, colonies of Geneticin resistant cells were trypsinized and cultured as cells expressing MV-M protein. These cells were diluted and plated in 96 well plate at 1 cell per plate and allowed to grow in DMEM containing 10% FCS and 500 uM Geneticin. The ability of these cells to express MV-M proteins was ascertained by SDS-polyacrylamide gel electrophoresis of the cell lysate followed by western blot with antibodies reactive to MV-M protein. These were tested for their ability to support production of Virosomes (MV like particles) and selected for use as a packaging cell line to produce non-replicating MV derivatives lacking the H and F proteins of MV. The resulting cell line was called Vero.sub.M
4. Production of Replicating Measles Viruses
[0155] Actively growing Vero cells were trypsinized and plated into 6 well plates in DMEM containing 10% FCS. After incubating at 37 C in 5% CO2 for 24 hrs, culture medium was removed and cells washed with HBSS. Cells were then co-transfected with 3 ug of Virus coding plasmid (any one of the MV coding plasmids from pMV (Seq ID 9), pMV-GP (Seq ID 16), pMV-GC (Seq ID 17) or pMV GsPP (Seq ID 23), pMV-GsPDP (Seq ID 24), pMV-GsPC (Seq ID 25), pMV-GsPDP (Seq ID 26), or pMV-GP-ATU2 to pMV-GP-ATU5 plasmids) and Helper plasmid (pINPL) (1:1.5) in Lipofectamine 2000 according to manufacturer's protocol. Transfection was allowed to occur for 4 hrs and culture medium replaced with DMEM containing 10% FCS. Twenty four hours after transfection, culture medium was replaced with DMEM containing 2% FCS and incubation continued. The cells were observed daily for the appearance of cytopathic effect typical of MV. At the end of 7 days, cells showing the appearance of large syncytia were trypsinized and mixed with fresh Vero cells and re-plated in 6 well plates. Incubation was continued at 37 C in 5% CO2 with daily observation for the appearance of the typical cytopathic effect (CPE) characteristic of MV (
[0156] Replicating MV derivatives containing tri-cistronic ATU (virus coding plasmid corresponding to Seq ID #23 and Seq ID #25) and tetra-cistronic ATU (virus coding plasmids corresponding to Seq ID #24 and Seq ID #26) inserted upstream of the N protein coding region of MV were produced using the same method.
5. Production of Non-Replicating Derivatives of Measles Virus (Virosomes)
[0157] 5.1 Measles Virosomes: The VeroMFH cell line was maintained in DMEM supplemented with 10% FCS and 500 uM Geneticine. Actively growing VeroMFH cells were trypsinized and plated into 6 well plate at a density of 80000 cells/well and incubated for 24 hrs at 37 C in 5% CO2. They were then co-transfected with a Cloning plasmid that codes for MV replicon RNA (pMTX-P1T-GH) that expresses a MV replicon coding for GFP and Helper plasmid (pINPL) in Lipofectamine 2000 according to manufacturer's protocol. (3 ug DNA per well @ 2 ug pMTX-P1T-G+1 ug Helper plasmid). Transfection was allowed to occur for 2 hrs and culture medium replaced with DMEM supplemented with 10% FCS and cells were allowed to recover for 24 hrs. Culture medium was then removed and replaced with fresh DMEM containing 10% FCS and 750 uM Geneticine and incubated further. Culture medium was replaced every 48 hours.
[0158] Non-replicating measles viruses (Virosomes) were released into culture medium from day 4 onwards and the titres (as determined by the transfer of GFP expression into fresh Vero cells) was observed from day 5 and peaked after day 7. The presence of Virosomes was confirmed by (1) the ability of culture supernatant to infect fresh Vero cells and induce GFP expression by microscopy (
[0159] 5.2 Dengue Virosomes: Similarly, virosomes coding for the Dengue virus subviral particles were also produced using the cloning plasmids— (1) D2 Virosomes—produced using pMTX-P1T-D2G; (3) D2-intermediate-Virosomes—produced using pMTX-P1T-Intermediate-D2G; (4) D2-High-Virosomes—produced using pMTX-P1T-High-D2G. Dot blot analysis of virosomes showed that both Dengue & GFP virosomes contained the MV proteins (e.g. MV-P). On the other hand, Dengue virosomes contained Dengue virus E protein but not the GFP virosomes (
5.3 Measles Virosomes
[0160] Similarly, Measles virosomes were also prepared by co-transfecting Vero.sub.MFH cells with pMTXP1T-NP-RE1-FH-RE2-RE3 (Seq ID 8) and the Helper plasmid (Seq ID 18). They were concentrated by ultra-centrifugation at 100,000×g and washed with PBS and used to immunize Balb/C mice. Serum isolated from these mice was found to protect Vero cells from infection with MV (
5.3 Chimeric Dengue Virosomes
[0161] Chimeric Dengue virosomes that display Dengue virus E protein, but not the H and F glycoproteins and also contain a genome coding for Dengue virus prM and E proteins were produced using pMTX-P1T-D2Gdelpr Plasmid as the cloning plasmid. Briefly, freshly seeded and active growing Vero.sub.M cells were co-transfected with pMTX-P1T-D2Gdelpr and the Helper plasmid and incubated for 7 days in DMEM containing 10% fetal calf serum. Culture supernatants containing chimeric Dengue virosomes were collected. Chimeric Dengue Virosomes were concentrated by ultracentrifugation at 100,000×g and used to immunize mice. The presence of Dengue virus E protein in these virosomes was determined by first immuoprecipitating it with anti-Dengue virus E protein antibody followed by DS-polyacrylamide electrophoresis and detection with western blot analysis using the serum from mice immunized or vice versa (
[0162] 5.3 Non-replicating Oncolytic Virosomes: On the other hand, non-replicating oncolytic virosomes that coded for MV-H and MV-F proteins and also the human GMCSF and PAP proteins were produced using the pNPFH_GCdnG/pNPFH-GCG plasmid.
6. rMV-GP Kills Cancer Cells Like PC-3 Cells Selectively but has No Toxic Effect on Non-Cancerous Cells
[0163] The oncolytic effect of rMV-GP was tested using the prostate cancer cell lines— PC-3 and LnCAP. PC-3 and LnCAP cell lines were procured from the National Center for Cell Sciences, Pune, INDIA and maintained respectively in Ham's F12K medium and RPMI1640 supplemented with glutamine and 10% fetal bovine serum.
[0164] Actively growing cells were plated in 24 well plates at a density of 40000 cells/well and incubated overnight at 370 C in 5% CO2. After the cells settled well, cells were washed with HBSS and infected with different concentrations of SBPL-0100 diluted in OptiMEM for 2 hr. Virus was then replaced with complete respective culture medium with 2% FBS and incubated at 37 C in 5% CO2 until a typical MV cytopathic effect (CPE) and/or cell death was observed. At the end of incubation, culture medium was replaced with fresh culture medium containing MTT dye (0.5 mg/mL) and incubated further for 4 hrs. Culture supernatant was then removed and replaced with DMSO to solubilize the reduced MTT formazan crystals. Plates were read of optical density at 570 nm and cytotoxicity caused by the virus was determined. As shown in
[0165] 6.1 Incorporation of Genes Producing Anti-Cancer Effect is Essential to Increase the Oncolytic Potency of Oncolytic MV
[0166] Replicating MV derivatives expressing 3 (rMV-GsPP coding for GMCSF, sPD-1 and PAP) and 4 (rMV-GsPPD coding for GMCSF, sPD-1, PAP and DnG1) were also synthesized as mentioned earlier. Freshly plated, actively growing Vero cells were infected with MV derivatives encoding 0 (MV), 2(rMV-GP), 3(rMV-GsPP) and 4 (rMV-GsPDP) non-MV genes and incubated for 72 hrs. At the end of this period, cell extracts were prepared, proteins separated by SDS-electrophoresis and subjected to western blot analysis for detecting proteins corresponding to human GMCSF, sPD-1, PAP and DnG1 using antibodies specific to human GMCSF (MAB215-SP, R&D Systems, USA), PD-1 (AF1086-SP, R&D Systems, USA), PAP (MAB6240-SP, R&D Systems, USA) and Cyclin G1 (SC-7865, Santacruz, USA) proteins. As expected, extracts from rMV-GsPDP infected Vero cells showed the presence of all 4 proteins; extracts from rMV-GsPP infected Vero cells showed the presence of GMCSF, sPD-1 and PAP; extracts from rMV-GP infected cells showed the presence of GMCSF and PAP and extracts from MV infected cells did not express any of the proteins GMCSF, PAP, sPD-1 and DnG1. On the other hand, all four infected cell extracts exhibited the presence of MV-H protein (
[0167] The oncolytic activity of these viruses was then tested on different cancer cell lines according to the method described above.
8. DNA Induced Oncolytic Effect
[0168] The rMV-GP produced using the 2 plasmids can induce selective oncolytic effect in cancer cell lines. The ability of DNA molecules which are useful for production of rMV-GP were then tested for their ability to induce a similar cytotoxic effect.
[0169] Actively growing PC-3 cells were trypsinized and split into 24 well plates at a density of 40000 cells/well and incubated at 370 C in 5% CO2 overnight. After 24 hrs, cells were transfected with different quantities (3 ug/well to 0.03 ug/well) of plasmid mixture (pIN2PL+pSB-043R) in Xfect according to manufacturer's instructions. Four hours after transfection, culture medium was replaced with DMEM containing glutamine and 10% FCS and incubated over night. Twenty four hours after transfection, the culture medium was replaced by fresh culture medium containing 2% FCS and incubation continued. Every 24 hrs, cells were observed microscopically for the appearance of typical MV cytopathic effect and/or cell death. At the end of 6 days post transfection, Culture medium was replaced with fresh culture medium containing 0.5 mg/mL MTT and incubated for 4 hrs. At the end of the incubation, culture medium was removed and replaced with DMSO to solubilize the reduced MTT formazan crystals. Culture plates were then measured for optical density at 570 nm and cytotoxicity caused by the DNA molecules determined.
9. Virosome Mediated Gene Transfer
[0170] The rMV-GP produced using the 2 plasmids can induce selective oncolytic effect in cancer cell lines. The ability of DNA molecules which are useful for production of rMV-GP were then tested for their ability to induce a similar cytotoxic effect.
[0171] Actively growing vero cells were trypsinized and seeded into chamber slides (4 chambers/slide) at a density of 40000 cells/chamber and incubated over night at 37 C in 5% CO2. Culture medium was then removed and washed with HBSS. Cells were layered with 0.5 mL of Virosomes (derived from pMTX-P1T-D2 plasmid) containing culture supernatant and incubated for 2 hrs at 37 C in 5% CO2. At the end of incubation, culture medium was replaced with fresh DMEM containing 5% fetal calfserum and incubation continued for 72 hrs. At the end of 72 hours, slides were stained with DAPI and observed under fluorescent microscope for presence of GFP. Simultaneously, culture supernatants from virosome infected vero cells was collected and centrifuged at 100,000×g. Pellet obtained from this supernatant was analysed for the presence of Dengue virus like particles using dot blot analysis.
[0172] GFP expression in virosome infected cells indicated successful transfer of GFP expression by Virosomes into vero cells. Similarly, a positive immunoblot with anti-Dengue virus E protein indicated that virosomes transferred Dengue VLP coding gene into vero cells and this Dengue VLP was expressed into culture medium as expected. It was further observed that virosomes derived from the different cloning plasmids (pMTX-P1T-D2 or pMTX-P1T-high-D2 expressed different levels of DVLP in culture supernatants. As expected, pMTX-P1T-D2 derived virosomes produced lower levels of DVLP than pMTX-P1t-high-D2 derived virosomes.
10: Cancer Therapeutic Effect of rMV-GP in Mice
[0173] The in vivo oncolytic effect of rMV-GP was tested in SCID mice according to the protocol described in Grote et al, (2003) [49]. Briefly, four-week-old CB17 SCID mice (procured from Vivolabs, Hyderabad, INDIA) were housed in individual ventilated cages (IVC) at INTOX Pvt. Ltd., Pune, INDIA and provided with food and water ad libidum. Mice received s.c. injections in the flank region with 10.sup.7 viable PC-3 tumour cells. After the tumours had grown up to a volume of approximately 100 cubic mm, they were injected with 106 TCID50 rMV-GP in a total volume of 100 μl every 3rd day for 5 weeks. As controls, tumours were injected daily with the same volume of UV-inactivated virus. Tumour measurements were made every alternate day in two diameters, and the tumour volume was calculated according to the formula V=a.sup.2b/2 where a is the shortest and b the longest diameter. Mice whose tumours reached a volume of 2.5 cm3 or had begun to invade surrounding tissues were euthanized. The experimental protocol was approved by the Institutional Animal Ethics Committee of INTOX Pvt. Ltd.
11: Immunopotentiating Effect of rMV-GP
[0174] The biological activity of GMCSF expressed from rMV-GP was determined using the TF-1 cell bioassay of Kitamura et al (1989). Briefly, actively growing TF-1 erythroleukemia cell line was plated at 5×10.sup.4 cells/well in 24 well plate and incubated at 37 C in 5% CO2. Lysates of tumour cells infected with rMV-GP were then prepared in RIPA buffer and added to wells containing TF-1 cells (50 uL of cell extract). Cells were incubated at 37 C in 5% CO2 for 48 hrs and growth measured using MTT assay. Quantity of bioactive GMCSF produced by rMV-GP infected cells was estimated by mapping the results on a standard curve obtained by exposing TF-1 cells to standard GMCSF. Culture supernatants obtained from vero cells infected with rMV-GsPP and GsPPD were also found to contain GMCSF as detected by TF-1 cell bioassay (Data not shown).
12: Plasmid Induced Cancer Therapeutic Effect in Mice
[0175] The in vivo oncolytic effect of rMV-GP was tested in SCID mice according to the protocol described in Grote et al, (2003) [49]. Briefly, four-week-old CB17 SCID mice (procured from Vivolabs, Hyderabad, INDIA) were housed in individual ventilated cages (IVC) at INTOX Pvt. Ltd., Pune, INDIA and provided with food and water ad libidum. Mice received s.c. injections in the flank region with 10.sup.7 viable PC-3 tumour cells. After the tumours had grown up to a volume of approximately 100 cubic mm, they were injected with 10 ug of a mixture of the Helper plasmid and pMV-GP (1.3:1) in 100 μl saline every 3rd day for 5 weeks. As controls, tumours were injected daily with the same volume of saline containing 10 ug pUC plasmid was used. Tumour measurements were made every alternate day in two diameters, and the tumour volume was calculated according to the formula V=a.sup.2b/2 where a is the shortest and b the longest diameter. Mice whose tumours reached a volume of 2.5 cm3 or had begun to invade surrounding tissues were euthanized. The experimental protocol was approved by the Institutional Animal Ethics Committee of INTOX Pvt. Ltd.
REFERENCES
[0176] 1. Bluming, A. Z. and J. L. Ziegler, Regression of Burkitt's lymphoma in association with measles infection. Lancet, 1971. 2(7715): p. 105-6. [0177] 2. Gross, S., Measles and leukaemia. Lancet, 1971. 1(7695): p. 397-8. [0178] 3. Pasquinucci, G., Possible effect of measles on leukaemia. Lancet, 1971. 1(7690): p. 136. [0179] 4. Zygiert, Z., Hodgkin's disease: remissions after measles. Lancet, 1971. 1(7699): p. 593. [0180] 5. McDonald, C. J., et al., A measles virus vaccine strain derivative as a novel oncolytic agent against breast cancer. Breast Cancer Res Treat, 2006. 99(2): p. 177-84. [0181] 6. Heinzerling, L., et al., Oncolytic measles virus in cutaneous T-cell lymphomas mounts antitumor immune responses in vivo and targets interferon-resistant tumor cells. Blood, 2005. 106(7): p. 2287-94. [0182] 7. Kunzi, V., et al., Recombinant measles virus induces cytolysis of cutaneous T-cell lymphoma in vitro and in vivo. J Invest Dermatol, 2006. 126(11): p. 2525-32. [0183] 8. Lin, E. H., et al., Fusogenic membrane glycoproteins induce syncytia formation and death in vitro and in vivo: a potential therapy agent for lung cancer. Cancer Gene Ther, 2010. 17(4): p. 256-65. [0184] 9. Peng, K. W., et al., Systemic therapy of myeloma xenografts by an attenuated measles virus. Blood, 2001. 98(7): p. 2002-7. [0185] 10. Galanis, E., et al., Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Res, 2010. 70(3): p. 875-82. [0186] 11. Msaouel, P., A. Dispenzieri, and E. Galanis, Clinical testing of engineered oncolytic measles virus strains in the treatment of cancer: an overview. Curr Opin Mol Ther, 2009. 11(1): p. 43-53. [0187] 12. Russell, S. J., et al., Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clin Proc, 2014. 89(7): p. 926-33. [0188] 13. Blechacz, B. and S. J. Russell, Measles virus as an oncolytic vector platform. Curr Gene Ther, 2008. 8(3): p. 162-75. [0189] 14. Radecke, F., et al., Rescue of measles viruses from cloned DNA. EMBO J, 1995. 14(23): p. 5773-84. [0190] 15. Parks, C. L., et al., Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J Virol, 2001. 75(2): p. 910-20. [0191] 16. Parks, C. L., et al., Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. J Virol, 2001. 75(2): p. 921-33. [0192] 17. Dorig, R. E., et al., The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell, 1993. 75(2): p. 295-305. [0193] 18. Hsu, E. C., et al., CDw150(SLAM) is a receptor for a lymphotropic strain of measles virus and may account for the immunosuppressive properties of this virus. Virology, 2001. 279(1): p. 9-21. [0194] 19. Anderson, B. D., et al., High CD46 receptor density determines preferential killing of tumor cells by oncolytic measles virus. Cancer Res, 2004. 64(14): p. 4919-26. [0195] 20. Rama, A., et al., On advances in cancer suicide genes therapy. SOJ Genet Sc, 2014. 1(1): p. 1-6. [0196] 21. Liu, T. J., et al., Growth suppression of human head and neck cancer cells by the introduction of a wild-type p53 gene via a recombinant adenovirus. Cancer Res, 1994. 54(14): p. 3662-7. [0197] 22. Gibson, S. A., et al., Induction of apoptosis in oral cancer cells by an anti-bcl-2 ribozyme delivered by an adenovirus vector. Clin Cancer Res, 2000. 6(1): p. 213-22. [0198] 23. Martin, L. A. and M. Dowsett, BCL-2: a new therapeutic target in estrogen receptor-positive breast cancer? Cancer Cell, 2013. 24(1): p. 7-9. [0199] 24. Wong, R. J., et al., Oncolytic herpesvirus effectively treats murine squamous cell carcinoma and spreads by natural lymphatics to treat sites of lymphatic metastases. Hum Gene Ther, 2002. 13(10): p. 1213-23. [0200] 25. Dingli, D., et al., Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood, 2004. 103(5): p. 1641-6. [0201] 26. Bossow, S., et al., Armed and targeted measles virus for chemovirotherapy of pancreatic cancer. Cancer Gene Ther, 2011. 18(8): p. 598-608. [0202] 27. Hartkopf, A. D., et al., Enhanced killing of ovarian carcinoma using oncolytic measles vaccine virus armed with a yeast cytosine deaminase and uracil phosphoribosyltransferase. Gynecol Oncol, 2013. 130(2): p. 362-8. [0203] 28. Kaufmann, J. K., et al., Chemovirotherapy of malignant melanoma with a targeted and armed oncolytic measles virus. J Invest Dermatol, 2013. 133(4): p. 1034-42. [0204] 29. Grossardt, C., et al., Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Hum Gene Ther, 2013. 24(7): p. 644-54. [0205] 30. Engeland, C. E., et al., CTLA-4 and PD-L1 checkpoint blockade enhances oncolytic measles virus therapy. Mol Ther, 2014. 22(11): p. 1949-59. [0206] 31. Rushmere, N. K., et al., Analysis of the level of mRNA expression of the membrane regulators of complement, CD59, CD55 and CD46, in breast cancer. Int J Cancer, 2004. 108(6): p. 930-6. [0207] 32. Iankov, I. D., et al., Infected cell carriers: a new strategy for systemic delivery of oncolytic measles viruses in cancer virotherapy. Mol Ther, 2007. 15(1): p. 114-22. [0208] 33. Miest, T. S., et al., Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Mol Ther, 2011. 19(10): p. 1813-20. [0209] 34. Bateman, A., et al., Fusogenic membrane glycoproteins as a novel class of genes for the local and immune-mediated control of tumor growth. Cancer Res, 2000. 60(6): p. 1492-7. [0210] 35. Higuchi, H., et al., Viral fusogenic membrane glycoprotein expression causes syncytia formation with bioenergetic cell death: implications for gene therapy. Cancer Res, 2000. 60(22): p. 6396-402. [0211] 36. Liniger, M., et al., Recombinant measles viruses expressing single or multiple antigens of human immunodeficiency virus (HIV-1) induce cellular and humoral immune responses. Vaccine, 2009. 27(25-26): p. 3299-305. [0212] 37. Liniger, M., et al., Induction of neutralising antibodies and cellular immune responses against SARS coronavirus by recombinant measles viruses. Vaccine, 2008. 26(17): p. 2164-74. [0213] 38. Wang, Z., et al., Recombinant measles viruses expressing heterologous antigens of mumps and simian immunodeficiency viruses. Vaccine, 2001. 19(17-19): p. 2329-36. [0214] 39. Brandler, S., et al., Measles vaccine expressing the secreted form of West Nile virus envelope glycoprotein induces protective immunity in squirrel monkeys, a new model of West Nile virus infection. J Infect Dis, 2012. 206(2): p. 212-9. [0215] 40. Brandler, S., et al., A recombinant measles vaccine expressing chikungunya virus-like particles is strongly immunogenic and protects mice from lethal challenge with chikungunya virus. Vaccine, 2013. 31(36): p. 3718-25. [0216] 41. Brandler, S., et al., Pediatric measles vaccine expressing a dengue antigen induces durable serotype-specific neutralizing antibodies to dengue virus. PLoS Negl Trop Dis, 2007. 1(3): p. e96. [0217] 42. Billeter, M. A., H. Y. Naim, and S. A. Udem, Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Curr Top Microbiol Immunol, 2009. 329: p. 129-62. [0218] 43. Wang, P. G., et al., Efficient assembly and secretion of recombinant subviral particles of the four dengue serotypes using native prM and E proteins. PLoS One, 2009. 4(12): p. e8325. [0219] 44. Erbs, P., et al., In vivo cancer gene therapy by adenovirus-mediated transfer of a bifunctional yeast cytosine deaminase/uracil phosphoribosyltransferase fusion gene. Cancer Res, 2000. 60(14): p. 3813-22. [0220] 45. Gordon, E. M., et al., Inhibition of metastatic tumor growth in nude mice by portal vein infusions of matrix-targeted retroviral vectors bearing a cytocidal cyclin G1 construct. Cancer Res, 2000. 60(13): p. 3343-7. [0221] 46. Chappell, S. A., G. M. Edelman, and V. P. Mauro, A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc Natl Acad Sci USA, 2000. 97(4): p. 1536-41. [0222] 47. Szymczak, A. L., et al., Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat Biotechnol, 2004. 22(5): p. 589-94. [0223] 48. Liu, Y., et al., Tetravalent recombinant dengue virus-like particles as potential vaccine candidates: immunological properties. BMC Microbiol, 2014. 14(1): p. 233. [0224] 49. Grote, D., R. Cattaneo, and A. K. Fielding, Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Res, 2003. 63(19): p. 6463-8.