COMPOSITION FOR THE PREVENTION OR TREATMENT OF RESPIRATORY DISEASES CAUSED BY FINE DUST COMPRISING AGASTACHE RUGOSA AND LICORICE EXTRACT
20230270811 · 2023-08-31
Assignee
Inventors
- Jeong Ho GEUM (Seoul, KR)
- Hye Rim KIM (Seoul, KR)
- Jin Hak KIM (Seoul, KR)
- Su Young CHOI (Gyeonggi-do, KR)
Cpc classification
A23L33/105
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a composition for the prevention or treatment of respiratory diseases containing an Agastache rugosa and licorice extract as an active ingredient, and more specifically, the present invention relates to a composition for the prevention or treatment of respiratory diseases caused by fine dust containing an extract, in which Agastache rugosa and licorice are mixed at a weight ratio of 1:1 to 6:1, as an active ingredient.
The Agastache rugosa and licorice extract of the present invention has the efficacies of reducing cough through inhibition of TRPV1 activity, reducing lung inflammation through inhibition of CXCR1 and CXCR2 activities and GR-1+CD11b+ cell ratio reduction, and suppressing sputum production through inhibition of MUC5AC activity. In particular, since it is confirmed that the efficacy of the Agastache rugosa and licorice complex mixture is maximized at a specific mixing ratio, it can be widely utilized as a composition for the prevention or treatment of respiratory diseases caused by fine dust.
Claims
1.-8. (canceled)
9. A pharmaceutical composition for preventing, ameliorating, or treating a respiratory disease, comprising an Agastache rugosa extract as an active ingredient.
10. The pharmaceutical composition of claim 9, wherein the respiratory disease is induced by inhalation of fine dust and is one or more selected from the group consisting of respiratory inflammatory pulmonary disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, acute and chronic bronchitis, emphysema, pneumonia, bronchial asthma, bronchiectasis, emphysema, pulmonary tuberculosis sequelae, acute respiratory distress syndrome, and pulmonary fibrosis.
11. The pharmaceutical composition of claim 9, wherein the Agastache rugosa extract reduce cough through inhibition of TRPV1 activity, reduce lung inflammation through inhibition of CXCR1 or CXCR2 activity, or GR-1+CD11b+ cell ratio reduction, or suppress sputum production through inhibition of MUC5AC activity.
12. A health functional food product for preventing or ameliorating a respiratory disease, comprising an Agastache rugosa extract.
13. The health functional food product of claim 12, wherein the respiratory disease is induced by inhalation of fine dust and is one or more selected from the group consisting of respiratory inflammatory pulmonary disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, acute and chronic bronchitis, emphysema, pneumonia, bronchial asthma, bronchiectasis, emphysema, pulmonary tuberculosis sequelae, acute respiratory distress syndrome, and pulmonary fibrosis.
14. The health functional food product of claim 12, wherein the Agastache rugosa extract reduce cough through inhibition of TRPV1 activity, reduce lung inflammation through inhibition of CXCR1 or CXCR2 activity, or GR-1+CD11b+ cell ratio reduction, or suppress sputum production through inhibition of MUC5AC activity.
15. A method for preventing, ameliorating, or treating a respiratory disease, comprising administering an Agastache rugosa extract to a subject in need thereof at an effective amount.
16. The method of claim 15, wherein the respiratory disease is induced by inhalation of fine dust and is one or more selected from the group consisting of respiratory inflammatory pulmonary disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, acute and chronic bronchitis, emphysema, pneumonia, bronchial asthma, bronchiectasis, emphysema, pulmonary tuberculosis sequelae, acute respiratory distress syndrome, and pulmonary fibrosis.
17. The method of claim 15, wherein the Agastache rugosa extract reduce cough through inhibition of TRPV1 activity, reduce lung inflammation through inhibition of CXCR1 or CXCR2 activity, or GR-1+CD11b+ cell ratio reduction, or suppress sputum production through inhibition of MUC5AC activity.
18. A method for producing the health functional food product for preventing or ameliorating a respiratory disease of claim 12, comprising preparing an Agastache rugosa extract; and making the health functional food product with the extract.
19. The method of claim 18, wherein the respiratory disease is induced by inhalation of fine dust and is one or more selected from the group consisting of respiratory inflammatory pulmonary disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, acute and chronic bronchitis, emphysema, pneumonia, bronchial asthma, bronchiectasis, emphysema, pulmonary tuberculosis sequelae, acute respiratory distress syndrome, and pulmonary fibrosis.
20. The method of claim 18, wherein the Agastache rugosa extract reduce cough through inhibition of TRPV1 activity, reduce lung inflammation through inhibition of CXCR1 or CXCR2 activity, or GR-1+CD11b+ cell ratio reduction, or suppress sputum production through inhibition of MUC5AC activity.
Description
DESCRIPTION OF DRAWINGS
[0020]
[0021]
[0022]
[0023]
[0024]
MODES OF THE INVENTION
[0025] Hereinafter, the present invention will be described in detail.
[0026] In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating a respiratory disease containing an Agastache rugosa and licorice extract as an active ingredient.
[0027] The respiratory disease may be induced by inhalation of fine dust and may be one or more selected from the group consisting of respiratory inflammatory pulmonary disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, acute and chronic bronchitis, pneumonia, bronchial asthma, bronchiectasis, emphysema, pulmonary tuberculosis sequelae, acute respiratory distress syndrome, and pulmonary fibrosis.
[0028] The Agastache rugosa and licorice extract may be mixed with Agastache rugosa and licorice at a weight ratio of 1:1 to 6:1, and preferably, at a weight ratio of 4:1. In addition, while Agastache rugosa and licorice were mixed together to extract (a complex extract) in the present invention, an Agastache rugosa extract and a licorice extract may be prepared separately and then used by mixing depending on the purpose.
[0029] The pharmaceutical composition for preventing or treating a respiratory disease according to the present invention may further include a natural extract that has an effect of preventing, treating, or ameliorating respiratory diseases, a fraction thereof, or a compound thereof, in addition to Agastache rugosa and licorice.
[0030] As a solvent for extracting the Agastache rugosa or licorice, water or an organic solvent such as ethanol or alcohol having a carbon number of 1 to 4. hexane, ethyl acetate, and the like may be used alone in combination. Preferably, the Agastache rugosa and licorice extract of the present invention may be extracted by ethanol.
[0031] In a specific embodiment of the present invention, an Agastache rugosa and licorice extract was prepared using ethanol such that the mixing ratio of Agastache rugosa to licorice was 1:1 to 6:1. respectively, and as Experimental Example 4 and comparative example, an Agastache rugosa-only extract and a licorice-only extract were prepared.
[0032] In another specific embodiment of the present invention, the efficacy of an Agastache rugosa and licorice extract on preventing or ameliorating various respiratory symptoms caused by fine dust was confirmed. First, as a result of confirming the expression level of TRVP-1 known as a cough receptor, it was confirmed that the TRPV1 inhibitory activity was high in the treatment groups of Agastache rugosa and licorice complex extracts (Experimental Examples 1 to 3), compared to an Agastache rugosa-only extract (Experimental Example 4) and a licorice-only extract (Comparative Example). In particular, it was confirmed that the efficacy of suppressing cough was maximized in a complex extract in which Agastache rugosa and licorice were mixed at a ratio of 4:1 (
[0033] In still another specific embodiment of the present invention, as a result of confirming the expression levels of CXCR1 and CXCR2 which are lung inflammatory factors in order to confirm the efficacy of ameliorating the infiltration of neutrophils, which is a characteristic of respiratory diseases caused by fine dust, it was confirmed that the CXCR1 and CXCR2 inhibitory activities were high in the treatment groups of the Agastache rugosa and licorice complex extracts (Experimental Groups 1 to 3), compared to the Agastache rugosa-only extract (Experimental Example) and the licorice-only extract (Comparative Example) (
[0034] In addition, as a result of confirming the Gr-1+CD11b cell ratio in lung tissue in order to confirm that the Agastache rugosa and licorice extract suppressed lung inflammation in vivo. it was confirmed that low CD11b+/Gr-1+ leukocyte ratios were shown in the treatment groups of the Agastache rugosa and licorice complex extracts (Experimental Groups 1 to 3), compared to the Agastache rugosa-only extract (Experimental Example) and the licorice-only extract (Comparative Example) (
[0035] That is, since it was confirmed that the Agastache rugosa and licorice extract not only inhibited CXCR1 and CXCR2 expressions, but also significantly reduced the ratio of CD11b+/Gr-1+ cells (neutrophils) in the lung tissue, it was confirmed to have efficacy for ameliorating the infiltration of neutrophils, which is a characteristic of respiratory diseases caused by fine dust.
[0036] In still another specific embodiment of the present invention, as a result of confirming the MUC5AC mRNA expression levels in the lung tissue in order to confirm that sputum production was suppressed by the Agastache rugosa and licorice extract, it was confirmed that the inhibition of MUC5AC activity was high in the treatment groups of the Agastache rugosa and licorice complex extracts (Experimental Groups 1 to 3), compared to the Agastache rugosa-only extract (Experimental Example 4) and the licorice-only extract (Comparative Example) (
[0037] Therefore, since the Agastache rugosa and licorice extract of the present invention can treat or ameliorate respiratory diseases through reducing cough through inhibition of TRPV1 activity; reducing lung inflammation through inhibition of CXCR1 or CXCR2 activity, or GR-1+CD11b+ cell ratio reduction; and suppressing sputum production through inhibition of MUC5AC activity, the Agastache rugosa and licorice extract of the present invention can be widely utilized in the prevention or treatment of respiratory diseases.
[0038] The pharmaceutical composition of the present invention may be formulated into various forms according to respective conventional methods. For example, it may be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and the like, and may be used in the form of external preparations, suppositories, and sterile injectable solutions. Depending on each formulation, pharmaceutically acceptable carriers, excipients, and diluents may be further included. In addition, it may be formulated and used in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and the like, and sterile injectable solutions according to a conventional method.
[0039] Examples of the carriers, excipients, and diluents include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil, and the like. When formulating the pharmaceutical composition or making a dosage form thereof, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like, which are generally used.
[0040] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like. These solid preparations are prepared by mixing at least one excipient in the composition, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. In addition, lubricants such as magnesium stearate talc are used in addition to simple excipients. Liquid preparations for oral use may include suspensions, intravenous solutions, emulsions, syrups, and the like, and in addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives, and the like may be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations. suppositories, and the like. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases of suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, and the like may be used.
[0041] As used herein, the term ‘administration’ means to provide the pharmaceutical composition of the present invention to a subject in any suitable way. The pharmaceutical composition of the present invention may be administered at an amount of an active ingredient or a pharmaceutical composition that induces a biological or medical response in a tissue system of an animal or a human, which is considered by researchers, veterinarians, doctors, or other clinicians, that is, at a clinically effective amount which is an amount that induces relief of symptoms of the disease or disorder to be treated. It is apparent to those skilled in the art that the therapeutically effective dose and the number of administrations with respect to the pharmaceutical composition of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered may be easily determined by those skilled in the art, and may be adjusted depending on the type of disease, the severity of the disease, the content of active ingredients and other ingredients contained in the composition, the type of formulation, the patient's age, weight, general health status, gender, and diet, administration time, routes of administration and secretion rates of the composition, treatment period, and various factors including drugs used concurrently. The pharmaceutical composition of the present invention may be administered at an amount of 1 mg/kg/day to 10.000 mg/kg/day, may be administered once a day, or may be divided and administered several times.
[0042] In still another aspect, the present invention relates to a health functional food composition for preventing or ameliorating a respiratory disease containing an Agastache rugosa and licorice extract as an active ingredient.
[0043] Since the Agastache rugosa and licorice extract of the present invention has efficacies of suppressing cough, suppressing lung inflammation through inhibiting the infiltration of neutrophils, and suppressing sputum, it may be used in a health functional food composition for preventing or ameliorating a respiratory disease, which is specifically as described above.
[0044] The formulation of the health functional food of the present invention may be in the form of powders, granules, pills, tablets, and capsules, as well as general foods or beverages.
[0045] The type of the food is not particularly limited, and examples of foods to which the substance may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, and dairy products including ice cream, various soups, beverages, teas, drinks, alcoholic beverages, vitamin complexes, and the like, and may contain all foods in the conventional meanings.
[0046] In general, when preparing a food or beverage, the composition may be added at an amount of 15 parts by weight or less, and preferably, 10 parts by weight or less, based on 100 parts by weight of the raw material. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the above amount may be the same or below the above range, and since the composition of the present invention has no problem in terms of safety, it may be used at an amount at or above the above range.
[0047] The beverage among the health functional foods according to the present invention may contain various flavoring agents, natural carbohydrates, or the like, as additional components as in a conventional beverage. The natural carbohydrates described above may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, erythritol, and the like. As the sweetener, natural sweeteners such as thaumatin and a stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like may be used. The ratio of the natural carbohydrate may be about 0.01 g to 0.04 g, and preferably, about 0.02 g to 0.03 g per 100 mL of the beverage according to the present invention.
[0048] In addition to the above, the health functional food according to the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages. In addition, the composition for improving sleep according to the present invention may contain natural fruit juice, fruit juice drinks, and fruit flesh for the production of vegetable drinks. These ingredients may be used independently or in combination. The ratio of these additives is not limited, but is generally selected from the range of 0.01 to 0.1 parts by weight compared to 100 parts by weight of the health functional food of the present invention.
[0049] Hereinafter, preferred exemplary embodiments are provided to help understanding of the present invention. However, the following examples are only provided to understand the present invention more easily, and the contents of the present invention are not limited by the following examples.
Example 1: Preparation of Agastache rugosa Extract and Licorice Extract
[0050] 1-1: Preparation of Agastache rugosa extract (Experimental Example 4)
[0051] 100 g of dried Agastache rugosa was added to 1.5 L of 30% ethanol and extracted at 70° C. for 4 hours. The extracted sample was filtered under reduced pressure with Whatman No. 2 filter paper, and the filtered extract was concentrated by a vacuum rotary concentrator and dried to prepare an Agastache rugosa extract.
[0052] 1-2: Preparation of Licorice Extract (Comparative Example)
[0053] It was performed in the same manner as in Example 1, except that 100 g of dried licorice was used, and as a result, a licorice extract was prepared.
[0054] 1-3. Preparation of Agastache rugosa and Licorice Extract (Weight Ratio of 1:1) (Experimental Example 1)
[0055] It was performed in the same manner as in Example 1, except that 50 g of dried Agastache rugosa and 50 g of dried licorice were used, and as a result, an Agastache rugosa and licorice extract (ratio of 1:1) was prepared.
[0056] 1-4. Preparation of Agastache rugosa and Licorice Extract (Weight Ratio of 4:1) (Experimental Example 2)
[0057] It was performed in the same manner as in Example 1, except that 80 g of dried Agastache rugosa and 20 g of dried licorice were used, and as a result, an Agastache rugosa and licorice extract (ratio of 4:1) was prepared.
[0058] 1-5. Preparation of Agastache rugosa and Licorice Extract (Weight Ratio of 6:1) (Experimental Example 3)
[0059] It was performed in the same manner as in Example 1, except that 86 g of dried Agastache rugosa and 14 g of dried licorice were used, and as a result, an Agastache rugosa and licorice extract (ratio of 6:1) was prepared.
Example 2: Confirmation of Cough Reducing Effect of Agastache rugosa and Licorice Extract
[0060] In the present invention, the expression level of TRPV-1 known as a cough receptor was determined in order to confirm the cough-reducing efficacy of the Agastache rugosa and licorice extract.
[0061] First, MH-S cells which are alveolar macrophages were cultured in RPMI 1640 medium containing 10% FBS, 100 U/mL of penicillin, and 100 μg/mL of streptomycin at a condition of 37° C. and 5% CO.sub.2. Cells were placed in a 6-well plate to be at 5×10.sup.5 cells/mL, and a mixture (CFA) that was prepared by dissolving 50 mg/mL of coal and 50 mg/mL of fly ash in DMSO was treated at a concentration of 200 μg/mL to induce a reaction by fine dust for 1 hour. Afterwards, the Agastache rugosa-only extract (Experimental Example 4), the licorice-only extract (Comparative Example), and the Agastache rugosa and licorice extracts (Experimental Examples 1 to 3) prepared in Example 1 above were treated at a concentration of 60 μg/mL in a solution in which DMSO and PBS were mixed at 1:1 to culture for 6 hours at a condition of 37° C. and 5% CO.sub.2, respectively.
[0062] After culturing for 6 hours, total RNA was isolated by treating a triazole (Ambion TRIzol® reagent; Grand Island, USA), and then cDNA was synthesized using a cDNA synthesis kit (ReverTraAce cDNA Synthesis kit; Toyobo, Japan). By using 100 ng of cDNA, qPCR was performed at a condition of 2 minutes at 50° C., 2 minutes at 95° C., 15 seconds at 95° C. for 40 repetitions, and 1 minute at 60° C. TaqMan-TRPV1 (Mm01246302_m1, FAM-MGB dye-labeled) and GAPDH (Mm99999915_g1, FAM-MGB dye-labeled) were purchased from Thermo Fisher Scientific to perform qPCR.
TABLE-US-00001 TABLE 1 Synergy effect according to mixing ratios of Agastache rugosa and licorice extracts (TRPV1 inhibitory activity) Mixing Mixing Expected Measured Synergy (measured ratio of amount of Mixing percentage of percentage of percentage of Agastache Agastache amount of inhibition inhibition inhibition/expected rugosa and rugosa licorice (expected (actual percentage of licorice (g) (g) efficacy) efficacy) inhibition) 0:1 0 100 21.0% 21.0% 100.0% 1:0 100 0 21.1% 21.1% 100.0% 1:1 50 50 21.1% 26.2% 124.5% 4:1 80 20 21.0% 34.4% 163.8% 6:1 86 14 21.0% 32.1% 152.6%
[0063] The expected percentage of inhibition for the Agastache rugosa and licorice extract was measured according to Mathematical Formula 1 below.
Expected percentage of inhibition (%)=[(measured percentage of inhibition of Agastache rugosa-only extract (%))×mixing amount of Agastache rugosa (g)/100]+[(measured percentage of inhibition of licorice-only extract (%))×mixing amount of licorice (g)/100] [Mathematical Formula 1]
[0064] As a result, as shown in
[0065] In addition, as shown in Table 1, it was confirmed that the TRPV1 inhibitory activity was increased depending on the mixing of the Agastache rugosa extract and the licorice extract, and in particular, it was confirmed that the TRPV1 inhibitory activity was most excellent when the Agastache rugosa and licorice extract was mixed at a weight ratio of 4:1.
Example 3: Confirmation of Inhibitory Effect of Agastache rugosa and Licorice Complex Extract on Lung Inflammation
[0066] In the present invention, CXCR1 and CXCR2 expression levels were determined in order to confirm whether the Agastache rugosa and licorice complex extract inhibits lung inflammation.
[0067] First, MH-S cells which are alveolar macrophages were cultured in RPMI 1640 medium containing 10% FBS, 100 U/mL of penicillin, and 100 μg/mL of streptomycin at a condition of 37° C. and 5% CO.sub.2. Cells were placed in a 6-well plate to be at 5×10.sup.5 cells/mL, and a mixture (CFA) that was prepared by dissolving 50 mg/mL of coal and 50 mg/mL of fly ash in DMSO was treated at a concentration of 200 μg/mL to induce a reaction by fine dust for 1 hour. Afterwards, the Agastache rugosa-only extract (Experimental Example 4), the licorice-only extract (Comparative Example), and the Agastache rugosa and licorice complex extracts (Experimental Examples 1 to 3) prepared in Example 1 above were treated at a concentration of 60 μg/mL in a solution in which DMSO and PBS were mixed at 1:1 to culture for 6 hours at a condition of 37° C. and 5% CO.sub.2, respectively.
[0068] After culturing for 6 hours, total RNA was isolated by treating a triazole (Ambion TRIzol® reagent; Grand Island, USA), and then cDNA was synthesized using a cDNA synthesis kit (ReverTraAce cDNA Synthesis kit; Toyobo, Japan). By using 100 ng of cDNA and primers of Table 2 below, qPCR was performed at conditions of 2 minutes at 50° C., 2 minutes at 95° C., 15 seconds at 95° C. for 40 repetitions, and 1 minute at 60° C.
TABLE-US-00002 TABLE 2 Primer sequences Name of SEQ target gene Primer sequences (5′.fwdarw.3′) ID NO CXCR1 Forward direction AATCTGTTGTGGCTTCACCCA 1 Reverse direction GCTATCTTCCGCCAGGCATAT 2 CXCR2 Forward direction AGCAAACACCTCTACTACCCTCTA 3 Reverse direction GGGCTGCATCAATTCAAATACCA 4 GAPDH Forward direction TGAAGCAGGCATCTGAGGG 5 Reverse direction CGAAGGIGGAAGAGTGGGAG 6
TABLE-US-00003 TABLE 3 Inhibition of CXCR1 activity according to mixing ratios of Agastache rugosa and licorice extracts Mixing Mixing Expected Measured Synergy (measured ratio of amount of Mixing percentage of percentage of percentage of Agastache Agastache amount of inhibition inhibition inhibition/expected rugosa and rugosa licorice (expected (actual percentage of licorice (g) (g) efficacy) efficacy) inhibition) 0:1 0 100 32.1% 32.1% 100.0% 1:0 100 0 78.4% 78.4% 100.0% 4:1 80 20 69.1% 79.5% 115.0%
TABLE-US-00004 TABLE 4 Inhibition of CXCR2 activity according to mixing ratios of Agastache rugosa and licorice extracts Mixing Mixing Expected Measured Synergy (measured ratio of amount of Mixing percentage of percentage of percentage of Agastache Agastache amount of inhibition inhibition inhibition/expected rugosa and rugosa licorice (expected (actual percentage of licorice (g) (g) efficacy) efficacy) inhibition) 0:1 0 100 −2.2% −2.2% 100.0% 1:0 100 0 9.3% 9.3% 100.0% 4:1 80 20 7.0% 20.5% 264.6%
[0069] As a result, as shown in
Example 4: Confirmation of the Effect of Reducing Gr-1+CD11b+ Cell Ratio in the Lune Tissue by the Agastache Rugosa and Licorice Complex Extract
[0070] In the present invention, the Gr-1+CD11b cell ratio was determined in the lung tissue, in order to confirm whether the Agastache rugosa and licorice complex extract inhibits lung inflammation in vivo.
[0071] First, with 8 Balb/c male mice per group, in all groups excluding the normal group, a fine dust mixture (CFA) was prepared by mixing 10 mg/mL of coal, 10 mg/mL of fly ash, and 5 mg/mL of a diesel exhaust particle (DEP) mixture, which are components of fine dust, such that the final concentration of alum was 1%. The prepared fine dust mixture was directly injected into the airway and nose of the experimental animals by 100 μL each on day 3, day 6, and day 9 after the start of the experiment using the intranasal tracheal (INT) injection method.
[0072] Comparative Example and Experimental Examples 1 to 4 were diluted with a 0.5% sodium carboxymethyl cellulose (CMC, 419273, Sigma-Aldrich) solution at a concentration of 100 mg/kg and was orally administered every day for 11 days. On day 12 after the start of the experiment, autopsy was performed to analyze lung tissue.
[0073] A specific fluorescence fluorescent antibody staining method was performed using a CD11b antibody (553310, BD Biosciences, USA) and a Gr-1 antibody (553128, BD Biosciences, USA) with a fluorescent label bound to the lung tissue, and fluorescence-activated cell sorting (FACS, BD Biosciences, USA) was used to measure the ratio of leukocytes (CD11b+/Gr-1+leukocyte) expressing CD11b and Gr-1 among the total leukocytes.
TABLE-US-00005 TABLE 5 Inhibitory activity of CD11b+/Gr-1+ cell ratios according to the mixing ratios of Agastache rugosa and licorice extracts Mixing Mixing Expected Measured Synergy (measured ratio of amount of Mixing percentage of percentage of percentage of Agastache Agastache amount of inhibition inhibition inhibition/expected rugosa and rugosa licorice (expected (actual percentage of licorice (g) (g) efficacy) efficacy) inhibition) 0:1 0 100 20.6% 20.6% 100.0% 1:0 100 0 17.4% 17.4% 100.0% 4:1 80 20 19.96% 42.9% 237.7%
[0074] As a result, as shown in
Example 5: Confirmation of the Effect of Suppressing Sputum Production by the Agastache Rugosa and Licorice Complex Extract
[0075] In the present invention, the MUC5AC mRNA expression levels were determined in the lung tissue, in order to confirm whether sputum production was suppressed by the Agastache rugosa and licorice complex extract.
[0076] First, 500 mL of RNAzolB (Tel-Test, Friendswood, USA) was added to the lung tissue extracted in Example 4 above and pulverized until dissolved. After adding 50 mL of CHCl.sub.3 to the mixed suspension, it was mixed again for 15 seconds. It was left on ice for 15 minutes and centrifuged at 13,000 rpm. About 200 mL of the supernatant was recovered and the same amount of 2-propanol (I9516, Sigma-Aldrich. USA) was mixed, slowly shaken, and left on ice for 15 minutes. It was centrifuged again at 13,000 rpm, washed with 80% ethanol, and dried in vacuum for 3 minutes to extract RNA. The extracted RNA was dissolved in 20 mL of distilled water treated with diethyl pyrocarbonate (DEPC, 750023, Thermo Scientific, USA), inactivated at 75° C., and used for cDNA synthesis.
[0077] 2 μg of the prepared total RNA was placed in 2U/tubeDNase I (AB0620, Thermo Scientific, USA) to react at 37° C. for 30 minutes, and then denatured at 75° C. for 10 minutes. After adding 2.5 mL of 10 mM dNTPs mix (4030, TaKaRa, Japan), 1 mL of random sequence hexanucleotides (N8080127, Thermo Scientific, USA), 1 mL of RNase inhibitor (2313A, TaKaRa, Japan), 1 mL of 100 mM DTT (4029, TaKaRa, Japan), and 4.5 mL of 5×RTbuffer (M5313, Promega, USA), 4.5 mL of M-MLV RT (M1701, Promega, USA) were added again, and the final volume was adjusted to 20 mL by DEPC-treated distilled water. After mixing well, the mixture was centrifuged at 2,000 rpm for 5 seconds and reacted for 60 minutes in a 37° C. heating block (Multi-blok heater, TRIPUNITHURA, USA) to synthesize cDNA. Then, it was left at 95° C. for 5 minutes, and synthesized cDNA was used for PCR by inactivating M-MLV RT. Sper-Taqman PCR Master mix (4304437, Applied Biosystems, USA) was used, and it was reacted such that the final concentration of the primer (refer to Table 6) was 200 nM. For the conditions of RT-PCR, predenaturation was performed at 50° C. for 2 minutes, 94° C. for 10 minutes, and 95° C. for 0.15 minutes for 40 cycles, and 60° C. for 1 minute. GAPDH (4352339E, Thermo Scientific, USA) was used as the internal standard.
TABLE-US-00006 TABLE 6 Primer sequences Name of SEQ target gene Primer sequences (5′.fwdarw.3′) ID NO MUC5AC Forward direction AGAATATCTTTCAGGACCCCTGCT 7 Reverse direction ACACCAGTGCTGAGCATACTTTT 8 GAPDH-VIC Probe CATGTTCCAGTATGACTCCACTCACG 9
TABLE-US-00007 TABLE 7 Inhibition of MUC5AC activity according to the mixing ratios of Agastache rugosa and licorice extracts Mixing Mixing Expected Measured Synergy (measured ratio of amount of Mixing percentage of percentage of percentage of Agastache Agastache amount of inhibition inhibition inhibition/expected rugosa and rugosa licorice (expected (actual percentage of licorice (g) (g) efficacy) efficacy) inhibition) 0:1 0 100% 35.7% 35.7% 100.0% 1:0 100% 0 45.0% 45.0% 100.0% 4:1 80% 20% 41.9% 64.5% 149.4%
[0078] As a result, as shown in
INDUSTRIAL APPLICABILITY
[0079] The Agastache rugosa and licorice extract of the present invention has the efficacies of reducing cough, reducing lung inflammation, and suppressing sputum production, and in particular, since it is confirmed that the efficacy of the Agastache rugosa and licorice complex mixture is maximized at a specific mixing ratio, it can be widely utilized as a composition for the prevention or treatment of respiratory diseases caused by fine dust.