COMPOSITION FOR AUGMENTING STEMNESS AND USE THEREOF

20230270788 · 2023-08-31

Assignee

Inventors

Cpc classification

International classification

Abstract

The present application pertains to a sialyloligosaccharide for augmenting the stemness of stem cells and a use thereof and provides a composition for augmenting stemness of stem cells, a method of culturing stem cells in a medium containing a sialyloligosaccharide, a method of augmenting stemness of stem cells, a stem cell with augmented stemness, obtained by the method, and a cell therapy composition including the stem cells as an active ingredient. The composition or the method according to one or more embodiments may suppress the aging of stem cells and may maintain and augment stemness.

Claims

1. (canceled)

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. (canceled)

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. A method of augmenting sternness of stem cells, comprising adding a sialyloligosaccharide to the stem cells, wherein the sialyloligosaccharide comprises 3′-sialyllactose, 6′-sialyllactose, 3′-sialyllactosamine, 6′-sialyllactosamine, 3′-sialyl-3-fucosyllactose, sialyllacto-N-tetraose, disialyllactose, or a combination thereof.

26. (canceled)

27. The method of claim 25, wherein the adding of the sialyloligosaccharide further comprises adding a human milk oligosaccharide.

28. The method of claim 27, wherein the human milk oligosaccharide comprises lacto-N-tetraose, 2′-fucosyllactose, 3-fucosyllactose, lacto-N-neotetraose, LS-tetrasaccharide b, LS-tetrasaccharide c, disialyllacto-N-tetraose, or a combination thereof.

29. (canceled)

30. (canceled)

31. (canceled)

32. A stem cell having augmented sternness using the method of claim 25.

33. A composition for cell therapy, comprising the stem cell having augmented sternness using the method of claim 25 or a dilution thereof as an active ingredient.

34. (canceled)

35. (canceled)

36. (canceled)

37. The method of claim 25, wherein the stem cells are induced pluripotent stem cells, embryonic stem cells, or adult stem cells.

38. The method of claim 37, wherein the adult stem cells are stem cells derived from a tissue selected from the group consisting of umbilical cord, umbilical cord blood, synovial membrane, bone marrow, fat, muscle, nerve, skin, amniotic membrane, and placenta.

39. The method of claim 25, wherein the stem cells may be cells of autologous, allogeneic or xenogeneic origin.

40. The method of claim 25, wherein the adding of the sialyloligosaccharide is performed by adding a sialyloligosaccharide at a concentration in a range of about 0.1 μM to about 400 μM.

41. The method of claim 25, wherein the sialyloligosaccharide is added in a stem cell culturing medium.

42. The method of claim 41, wherein the medium further comprises an antioxidant selected from the group consisting of selenium, ascorbic acid, vitamin E, catechin, lycopene, beta-carotene, coenzyme Q-10 (CoQ-10), resveratrol, T-BHQ, oltipraz, Alnus japonica extract, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and a combination thereof.

43. The method of claim 41, wherein the medium further comprises an additional component selected from the group consisting of N-acetyl-L-cysteine (NAC), insulin or insulin-like factor, hydrocortisone, dexamethasone, basic fibroblast growth factor (bFGF), heparan sulfate, 2-mercaptoethanol, epidermal growth factor (EFG), B-27, activin A, BMP-4, oncostatin M (OSM), hepatocyte growth factor (HGF), and a combination thereof.

44. The method of claim 41, comprising subculturing stem cells, wherein the method maintains the stemness after 3 to 12 passages.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0087] FIG. 1 shows the results of confirming influence of a sialyllactose on cell viability of bone marrow-derived mesenchymal stem cells according to concentrations of a sialyllactose by CCK-8 assay, wherein FIG. 1A shows the results of treating the stem cells with 3′-sialyllactose, FIG. 1B shows the results of treating the stem cells with 6′-sialyllactose, and FIG. 1C shows the results of treating the stem cells with a mixture of 3′-sialyllactose and 6′-sialyllactose;

[0088] FIG. 2 shows the results of confirming influence of a sialyllactose on cell viability of adipose-derived mesenchymal stem cells according to concentrations of a sialyllactose by CCK-8 assay, wherein FIG. 2A shows the results of treating the stem cells with 3′-sialyllactose, FIG. 2B shows the results of treating the stem cells with 6′-sialyllactose, and FIG. 2C shows the results of treating the stem cells with a mixture of 3′-sialyllactose and 6′-sialyllactose;

[0089] FIG. 3 shows the results of confirming influence of a sialyllactose on cell viability of umbilical cord blood-derived mesenchymal stem cells according to concentrations of a sialyllactose by CCK-8 assay, wherein FIG. 3A shows the results of treating the stem cells with 3′-sialyllactose, FIG. 3B shows the results of treating the stem cells with 6′-sialyllactose, and FIG. 3C shows the results of treating the stem cells with a mixture of 3′-sialyllactose and 6′-sialyllactose;

[0090] FIG. 4 shows the results of confirming influence of a sialyllactose on stemness of bone marrow-derived mesenchymal stem cells, wherein FIG. 4A shows the results of confirming mRNA levels of OCT4, FIG. 4B shows the results of confirming mRNA levels of SOX2, FIG. 4C shows the results of confirming mRNA levels of NANOG, and FIG. 4D shows the results of confirming protein expression levels of OCT4, SOX2, and NANOG;

[0091] FIG. 5 shows the results of confirming influence of a sialyllactose on stemness of adipose-derived mesenchymal stem cells, wherein FIG. 5A shows the results of confirming mRNA levels of OCT4, FIG. 5B shows the results of confirming mRNA levels of SOX2, FIG. 5C shows the results of confirming mRNA levels of NANOG, and FIG. 5D shows the results of confirming protein expression levels of OCT4, SOX2, and NANOG;

[0092] FIG. 6 shows the results of confirming influence of a sialyllactose on stemness of umbilical cord blood-derived mesenchymal stem cells, wherein FIG. 6A shows the results of confirming mRNA levels of OCT4, FIG. 6B shows the results of confirming mRNA levels of SOX2, FIG. 6C shows the results of confirming mRNA levels of NANOG, and FIG. 6D shows the results of confirming protein expression levels of OCT4, SOX2, and NANOG;

[0093] FIG. 7 shows the results of confirming influence of 3′-sialyllactose on senescence of bone marrow-derived mesenchymal stem cells, wherein FIG. 7A shows the results of confirming changes in expressions at mRNA levels of p16 and p53, which are cell senescence factors, FIG. 7B shows the results of confirming changes in expressions at protein levels of p16 and p53, and FIG. 7C shows the results of analyzing cell senescence using SA-β-gal;

[0094] FIG. 8 shows the results of confirming influence of 3′-sialyllactose on proliferation of bone marrow-derived mesenchymal stem cells, and these are the results of confirming changes in expressions of CCNA2 and CDK2, which are genes involved in cell cycle progression and proliferation;

[0095] FIG. 9 shows the results of confirming influence of 3′-sialyllactose on cell viability of bone marrow-derived mesenchymal stem cells per subculturing passage;

[0096] FIG. 10 shows the results of confirming influence of a sialyllactose on cell viability of induced pluripotent stem cell-derived hepatic organoid cells, and these are the results of confirming the cell viability by CCK-8 assay;

[0097] FIG. 11 shows the results of confirming influence of a sialyllactose on maturity of induced pluripotent stem cell-derived hepatic organoid cells, and these are the results of comparing ratios of expressions of CYP3A4 and CYP3A7; and

[0098] FIG. 12 shows the results of confirming influence of a sialyllactose on maturity of induced pluripotent stem cell-derived hepatic organoid cells, and these are the results of comparing ratios of expressions of ALB and AFP.

MODE OF DISCLOSURE

[0099] Hereinafter, the present disclosure will now be described in greater detail with reference to the accompanying Examples below. However, these Examples are for illustrative purposes only, and should not be construed as being limited to the scope of the inventive concept.

Example 1. Culturing Stem Cells

[0100] In Example 1, human bone marrow-derived mesenchymal stem cells (hBMSCs), human adipose tissue-derived mesenchymal stem cells (hATMSCs), human cord blood-derived mesenchymal stem cells (hCBMSCs), and induced pluripotent stem cells-derived hepatic organoid were used in this experiment. Dulbecco's Modified Eagle's Mediums (DMEM Low Glucose, available from HyClone in Logan, Utah, USA) including 10% fetal bovine serum (available from T&I in Gangwon, Korea), 1% antibiotics (penicillin/streptomycin, available from Gibco in Grand Island, NY, USA) were used as culture mediums of hBMSCs, hATMSCs, and hCBMSCs. After treating 3′-sialyllactose (available from GeneChem), 6′-sialyllactose (available from GeneChem), and a mixture of 3′-sialyllactose and 6′-sialyllactose, each in an amount of 100 μM, the culturing solutions were replaced every 3 days. The negative control was performed in the same manner after adding triple distilled water into the culturing solution. Also, a Hepatocyte Culture Medium (available from Lonza) including an endothelial cell growth medium-2 (available from Lonza), 2.5% FBS, 100 nM dexamethasone (available from Sigma-Aldrich), 20 ng/ml OSM (available from R&D system), and 10 ng/ml HGF (available from PeproTech) was used as the culturing solution of hepatic organoid, and the culturing solution was replaced every 3 days.

Example 2. Confirmation of Cell Viability According to Sialyloligosaccharide Treatment

[0101] In Example 2, influence of a sialyloligosaccharide on cell viability of stem cells was to be confirmed. Particularly, 3′-sialyllactose, 6′-sialyllactose, and a combination thereof were each treated on the subcultured stem cells in a concentration of 0, 50, 100, 200, or 400 μM, and the cell viability per concentration was verified by cell counting kit-8 (CCK-8) analysis. In particular, of hBMSCs, hATMSCs, and hCBMSCs were seeded in a 96-well plate. Then, the stem cells were treated with 3′-sialyllactose (GeneChem), 6′-sialyllactose (GeneChem), and a mixture of 3′-sialyllactose and 6′-sialyllactose in a concentration of 0, 50, 100, 200, or 400 μM and cultured in a DMEM low glucose medium (HyClone) including 1% antibiotics free of fetal bovine serum (T&I). Next, the viabilities of the cultured cells were confirmed by CCK-8 (Dojindo Laboratories, Kumamoto, Japan) analysis.

[0102] FIGS. 1 to 3 show the results of confirming influence of each of the stem cells on the cell viability after treating 3′-sialyllactose, 6′-sialyllactose, and a mixture of 3′-sialyllactose and 6′-sialyllactose of each concentration in hBMSCs (FIG. 1), hATMSCs (FIG. 2), and hCBMSCs (FIG. 3). As a result, the stem cells did not negatively influence the cell viability in all the concentrations, but when the stem cells were treated with a sialyllactose in a concentration of 100 μM, it was confirmed that the cell viability increased significantly. Therefore, a sialyllactose concentration of the treatment was 100 μM in the following experiments.

Example 3. Confirmation of Stemness According to Sialyloligosaccharide Treatment

[0103] In Example 3, influence of a sialyloligosaccharide on stemness of stem cells was to be confirmed. Particularly, after treating mesenchymal stem cells with each of 3′-sialyllactose, 6′-sialyllactose, and a combination thereof, mRNAs of OCT4, SOX2, and NANOG, which are stem cell markers of the mesenchymal stem cells, and changes in expression at protein levels were each measured by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and western blot. In particular, total RNAs were isolated from the cells collected after culturing the cells in the same manner as in Example 1, and change in mRNA expression of the isolated total RNAs was confirmed by qRT-PCR using OCT4 primers available from Bioneer (Daejeon, Korea), SOX2 primers available from Bioneer (P200205), and NANOG primers. Sequences of the used OCT4 and NANOG primers are shown in Table 1.

TABLE-US-00001 TABLE 1 Primer Sequence SEQ ID Primer Name (5′->3′) NO: OCT4 forward GCAAGCCCTCATTTCACCA 1 OCT4 reverse GCCCATCACCTCCACCAC 2 NANOG forward TTTGTGGGCCTGAAGAAAACT 3 NANOG reverse AGGGCTGTCCTGAATAAGCAG 4

[0104] FIGS. 4 to 6 show the results confirming influence of a sialyllactose on stemness of stem cells. As a result, it was confirmed that compared to stem cells cultured without a sialyllactose, hBMSCs (FIG. 4), hATMSCs (FIG. 5), and hCBMSCs (FIG. 6) cultured after being treated with 3′-sialyllactose, 6′-sialyllactose, and a mixture of 3′-sialyllactose and 6′-sialyllactose had all significantly increased expression at mRNA and protein levels of OCT4, SOX2, and NANOG, which are the marker genes for confirming stem ness.

[0105] From the test results, it was confirmed that the sialyloligosaccharide treatment before, during, and after culturing of the stem cells may significantly augment stemness of stem cells.

Example 4. Confirmation of Reduction in Senescence of Stem Cells According to 3′-Sialyllactose Treatment

[0106] In Example 4, influence of a sialyloligosaccharide on senescence of stem cells was to be confirmed. Particularly, after treating the hBMSC stem cells with 3′-sialyllactose, changes in expression at mRNA and protein levels of p16 and p53, which are cell senescence factors after subculturing were each measured by qRT-PCT and Western Blot. In particular, total RNAs were isolated from the cells collected after culturing the cells in the same manner as in Example 1, and change in mRNA expression of the isolated total RNAs was confirmed by qRT-PCR using p16 primers (P260189, available from Bioneer) and p53 primers (P250999, available from Bioneer) verified by Bioneer (Daejeon, Korea).

[0107] FIG. 7 shows the results of confirming influence of 3′-sialyllactose on senescence of stem cells. As a result, as senescence of hBMSCs subcultured without 3′-sialyllactose treatment proceeded, the expressions at mRNA and protein levels of p16 and p53 increased, but the stem cells subcultured after being treated with 3′-sialyllactose showed very low expression at mRNA and protein levels of p16 and p53, which confirmed decreased expressions of p16 and p53.

[0108] Also, in order to confirm a degree of senescence of the stem cells after being treated with 3′-sialyllactose (GeneChem), senescence-associated beta-galactosidase staining was performed on hBMSCs of 10 passages, treated with 100 μM of 3′-sialyllactose. In particular, after fixing the cells in formalin, the resultant washed with PBS, and 1 mg/mL of a β-gal staining solution X-Gal, 40 mM of a citric acid-sodium phosphate buffer solution, 150 mM of NaCl, 2 mM of MgCl.sub.2, 5 mM of potassium ferrocyanide, and 5 mM of potassium ferricyanide (pH 6.0, available from Sigma-Aldrich, St. Louis, USA) were add to the resultant and reacted at 37° C. Then, degrees of senescence activity of the aged cells (blue, positive) and cells not showing activity of senescence (negative) were confirmed using Eclipse TS100 (available from Nikon USA, Melville, N.Y., USA).

[0109] As a result of the cell senescence analysis using SA-β-gal, the hBMSCs subcultured without 3′-sialyllactose treatment had increased SA-β-gal activity as the senescence proceeded, whereas the stem cells subcultured after 3′-sialyllactose treatment showed low SA-β-gal activity, which confirmed a decrease in the SA-β-gal activity.

[0110] From the test results, it was confirmed that the sialyloligosaccharide treatment before, during, and after culturing of the stem cells may significantly reduce senescence of stem cells.

Example 5. Confirmation of Increase in Proliferation of Stem Cells According to 3′-Sialyllactose Treatment

[0111] In Example 5, influence of a sialyloligosaccharide on proliferation of stem cells was to be confirmed. Particularly, hBMSCs having low proliferation ability were treated with 3′-sialyllactose, and changes in expressions of cyclin A2 (CCNA2), which is a gene involved in cell cycle progression and proliferation and cyclin-dependent kinase 2 (CDK2) were confirmed. In particular, total RNAs were isolated from the cells collected after culturing the cells in the same manner as in Example 1, and change in mRNA expression of the isolated total RNAs was confirmed by qRT-PCR using CCNA primers (P212796, available from Bioneer) and CDK2 primers (P2136765, available from Bioneer) verified by Bioneer (Daejeon, Korea).

[0112] FIG. 8 shows the results of confirming influence of 3′-sialyllactose on proliferation of hBMSCs. As a result, it was confirmed that expressions of CCNA2 and CDK2 were reduced as the senescence of the stem cells without 3′-sialyllactose treatment proceeded, but expressions of CCNA2 and CDK2 of the stem cells with 3′-sialyllactose treatment significantly increased.

[0113] From the test results, it was confirmed that the sialyloligosaccharide treatment before, during, and after culturing of the stem cells may significantly increase proliferation of stem cells.

Example 6. Confirmation of Increase in Viability of Stem Cells According to Number of Passages According to 3′-Sialyllactose Treatment

[0114] In Example 6, influence of a sialyloligosaccharide on viability of stem cells according to cell subculturing passages was to be confirmed. Particularly, hBMSCs subcultured for 4, 7, 10, and 12 passages were treated with 3′-sialyllactose in a concentration of 100 μM, and the cell viability was confirmed by cell counting kit-8 assay (CCK-8) analysis. In particular, the hBMSCs were seeded in a 96-well plate. Then, the stem cells were treated with 3′-sialyllactose (GeneChem) in a concentration of 100 μM and cultured in a DMEM low glucose medium (HyClone) including 1% antibiotics free of fetal bovine serum (T&I). Viabilities of the cultured cells were confirmed by the CCK-8 analysis.

[0115] FIG. 9 shows the results of confirming influence of 3′-sialyllactose on viability of stem cells. As a result, it was confirmed that the cell viability of the stem cells treated with 3′-sialyllactose significantly increased.

[0116] From this test result, it was confirmed that self-renewal of stem cells is deteriorated according to subculturing passages, but sialyloligosaccharide treatment may significantly suppress deterioration of proliferating ability according to subculturing passages.

Example 7. Confirmation of Increase in Viability of Organoid According to Sialyllactose Treatment

[0117] In Example 7, influence of a sialyloligosaccharide on induced pluripotent stem cells-derived hepatic organoids was to be confirmed. Particularly, after subculturing the hepatic organoids, the organoids were stabilized in a hepatic medium (HM) for a day and treated with 3′-sialyllactose and 6′-sialyllactose in concentrations of 0, 0.1, 1, 10, and 100 μM for 6 days, and then the cell viabilities of the organoids on the 7th day were confirmed by the CCK analysis.

[0118] FIG. 10 shows the results of confirming influence of a sialyllactose on cell viability of induced pluripotent stem cells-derived hepatic organoids. As a result, it was confirmed that the cell viability of hepatic organoids treated with 3′-sialyllactose in concentrations of 0.1, 1, 10, and 100 μM and hepatic organoids treated with 6′-sialyllactose in concentrations of 0.1, 1, 10, and 100 μM significantly increased.

[0119] From the test results, it was confirmed that the sialyloligosaccharide treatment during culturing of the induced pluripotent stem cells-derived hepatic organoids may significantly increase proliferation of the hepatic organoids.

Example 8. Confirmation of Increase in Maturity of Organoid According to Sialyllactose Treatment

[0120] In Example 8, influence of a sialyloligosaccharide on maturity of induced pluripotent stem cells-derived hepatic organoids was to be confirmed. Particularly, after subculturing the hepatic organoids, the organoids were stabilized in a hepatic medium (HM) for a day and treated with 3′-sialyllactose and 6′-sialyllactose in concentrations of 0, 0.1, 1, 10, and 100 μM for 6 days, and then total RNAs were isolated from the hepatic organoids on the 7th day. The changes in expressions at mRNA level of CYP3A4, CYP2A7, ALB, and AFP, which are markers of metabolic maturity, were each measured by qRT-PCR, and the expression ratios were compared to confirm the metabolic maturity.

[0121] FIGS. 11 and 12 show the results of confirming influence of a sialyllactose on cell maturity of induced pluripotent stem cells-derived hepatic organoids. As a result, it was confirmed that ratios of CYP3A4/CYP3A7 of the hepatic organoids treated with 3′-sialyllactose in concentrations of 1 and 10 μM and ratios of ALB/AFP of the hepatic organoids treated with 3′-sialyllactose in concentrations of 1, 10, and 100 μM were significantly increased and that ratios of ALB/AFP of the hepatic organoids treated with 6′-sialyllactose in concentrations of 0.1 and 100 μM were significantly increased.

[0122] From the test results, it was confirmed that the sialyloligosaccharide treatment during culturing of the induced pluripotent stem cells-derived hepatic organoids may significantly increase metabolic maturity of the hepatic organoids.

[0123] It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art may readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. Therefore, it should be understood that the embodiments described above are illustrative in all aspects and should not be construed as limiting the scope of the present invention.