NOVEL PNA OLIGOMER, USE THEREOF FOR DETECTING DNA METHYLATION, AND METHOD FOR DETECTING DNA METHYLATION USING SAME

20220162681 · 2022-05-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a modified PNA oligomer for detecting gene methylation. By using a PNA probe modified by introducing a methyl group-specific substituent to the gamma position, N-terminus or C-terminus of the PNA, the present invention may be used for a method for detecting using a difference in physical properties between a gene and a non-methylated gene caused by an interaction between the probe and methyl groups of the gene.

    Claims

    1. A peptide nucleic acid (PNA) oligomer represented by the following Formula 1: ##STR00009## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA oligomer are able to be the same or different from each other).

    2. The PNA oligomer of claim 1, wherein the hydrophobic substituent of Formula 1 is each independently selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.30 aryl group, a C.sub.3-C.sub.30 heteroaryl group, an amino acid comprising a hydrophobic group, and a combination thereof, and any one or more of hydrogen atoms of the hydrophobic substituent are able to be replaced by a halogen element, any one or more of carbon atoms of the alkyl group, the alkenyl group, or the alkynyl group is able to be replaced by O or S, and the heteroaryl group comprises any one or more selected from B, N, O, S, P(═O), Si, and P.

    3. The PNA oligomer of claim 1, wherein the hydrophobic substituent of R.sub.1 in Formula 1 comprises any one or more selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, and a C.sub.3-C.sub.30 alkynyl group.

    4. The PNA oligomer of claim 1, wherein the hydrophobic substituent of R.sub.1 in Formula 1 is a C.sub.8-C.sub.18 alkyl group.

    5. The PNA oligomer of claim 2, wherein the amino acid comprising a hydrophobic group each independently comprises any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), cysteine (Cys), methionine (Met), alanine (Ala), glycine (Gly), threonine (Thr), and tryptophan (Trp).

    6. A PNA probe for detecting a methylated gene, the PNA probe being represented by the following Formula 1: ##STR00010## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA oligomer are able to be the same or different from each other).

    7. The PNA probe of claim 6, wherein the hydrophobic substituent of Formula 1 is each independently selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.30 aryl group, a C.sub.3-C.sub.30 heteroaryl group, an amino acid comprising a hydrophobic group, and a combination thereof, and any one or more of hydrogen atoms of the hydrophobic substituent are able to be replaced by a halogen element, any one or more of carbon atoms of the alkyl group, the alkenyl group, or the alkynyl group are able to be replaced by O or S, and the heteroaryl group comprises any one or more selected from B, N, O, S, P(═O), Si, and P.

    8. The PNA probe of claim 6, wherein the hydrophobic substituent of R.sub.1 in Formula 1 comprises any one or more selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, and a C.sub.3-C.sub.30 alkynyl group.

    9. The PNA probe of claim 6, wherein the hydrophobic substituent of R.sub.1 in Formula 1 is a C.sub.8-C.sub.18 alkyl group.

    10. The PNA probe of claim 6, wherein the amino acid comprising a hydrophobic group each independently comprises any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), cysteine (Cys), methionine (Met), alanine (Ala), glycine (Gly), threonine (Thr), and tryptophan (Trp).

    11. The PNA probe of claim 6, further comprising any one selected from the group consisting of a reporter and a quencher, or a combination of two thereof.

    12. The PNA probe of claim 6, which is a PNA probe comprising a reporter bound to the C-terminus thereof and a quencher bound to the N-terminus thereof, or a PNA probe comprising a reporter bound to the N-terminus thereof and a quencher bound to the C-terminus thereof.

    13. A method for detecting a methylated gene using the PNA probe defined in claim 6.

    14. The method of claim 13, which comprises: preparing a first mixture comprising a non-methylated gene and a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of the non-methylated gene; preparing a second mixture comprising a target gene for methylation analysis, which comprises the same base sequence as the base sequence of the non-methylated gene, and the PNA probe represented by the following Formula 1; changing temperatures of the first mixture and the second mixture; and analyzing a melting curve by measuring melting temperatures (Tm) of the first mixture and the second mixture according to the temperature change: ##STR00011## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    15. The method of claim 14, wherein the analyzing of the melting curve comprises judging a gene to be methylated when it is assumed that ΔTm is greater than or equal to 3° C. when the ΔTm is measured:
    Tm=Tm.sub.(Target Gene for Methylation Analysis)−Tm.sub.(Non-methylated Gene Comprising the Same Base Sequence as Target Gene for Methylation Analysis)].

    16. The method of claim 13, which comprises: preparing a first mixture comprising a non-methylated gene and a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of the non-methylated gene; preparing a second mixture comprising a target gene for methylation analysis, which comprises the same base sequence as the base sequence of the non-methylated gene, and the PNA probe represented by the following Formula 1; subjecting the first mixture and the second mixture to a polymerase chain reaction (PCR); and measuring a cycle threshold (ΔCt) value of the PCR:
    Ct=Ct.sub.(Target Gene for Methylation Analysis)−Ct.sub.(Non-methylated Gene Comprising the Same Base Sequence as Target Gene for Methylation Analysis)] ##STR00012## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    17. A kit for use in the method for detecting a methylated gene defined in claim 3, comprising a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of a gene whose methylation is able to occur: ##STR00013## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    18. A method for detecting gene methylation, comprising: mixing the PNA probe defined in claim 11 with a biological sample to hybridize the PNA probe with a target gene included in the biological sample; applying heat to the resulting mixture at a temperature higher than a melting temperature (Tm) of a hybrid of a non-methylated gene and the PNA probe and lower than a hybrid of a methylated gene and the PNA probe; and removing the hybrid of the non-methylated gene and the PNA probe melted at the temperature, wherein the gene methylation is detected through an imaged fluorescence signal of the hybrid of the methylated gene and the PNA probe.

    19. A kit for use in the method for detecting a methylated gene defined in claim 4, comprising a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of a gene whose methylation is able to occur: ##STR00014## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    20. A kit for use in the method for detecting a methylated gene defined in claim 5, comprising a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of a gene whose methylation is able to occur: ##STR00015## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    21. A kit for use in the method for detecting a methylated gene defined in claim 6, comprising a PNA probe represented by the following Formula 1, which is able to specifically bind to a base sequence of a gene whose methylation is able to occur: ##STR00016## (wherein, R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases comprising adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe are able to be the same or different from each other).

    Description

    DESCRIPTION OF DRAWINGS

    [0039] FIG. 1 is a graph showing melting curves for Comparative Example 1(A) and Example 1(B) of the present invention.

    [0040] FIG. 2 is a graph showing the results of PCR amplification curves for methylation detection for Example 2(A) and Comparative Example 2(B) of the present invention.

    [0041] FIG. 3 is a schematic diagram showing a technique for distinguishing the presence of methylation for Examples and Comparative Examples of the present invention.

    BEST MODE

    [0042] Hereinafter, the present invention will be described in detail. Unless otherwise defined, the terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. The drawings and embodiments of this specification are provided for one of ordinary skill in the art to easily understand and practice the present invention, and thus the contents that may unnecessarily obscure the subject matter of the present invention may be omitted from the drawings and embodiments. In this case, the present invention is not limited to the drawings and embodiments.

    [0043] The term “methylation” used herein refers to a process of attaching a methyl group to bases constituting a gene. Preferably, the presence of methylation used herein refers to the presence of methylation that occurs on cytosine of a certain CpG site of a certain gene.

    [0044] The term “Epi-sPNA” (epigenome-specific PNA) used herein may refer to a PNA that may interact with a methyl group of methylated cytosine of a target gene, that is, a PNA that is modified by binding of a hydrophobic substituent at a predetermined position.

    [0045] A PNA oligomer used herein may refer to a polymer obtained by polymerizing two or more PNA monomers via a peptide bond.

    [0046] The term “specific binding” used herein may refer to a complementary binding of 70% or more of a base sequence of PNA to a methylated and non-methylated gene, preferably may refer to a complementary binding of 80% or more, more preferably 90% or more, and the most preferably 95% or more of a base sequence of PNA to a methylated and non-methylated gene.

    [0047] The present invention provides a peptide nucleic acid (PNA) oligomer represented by the following Formula 1:

    ##STR00005##

    [0048] wherein R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe may be the same or different from each other. Preferably, n may be an integer ranging from 8 to 24, but the present invention is not particularly limited thereto.

    [0049] Specifically, the non-natural nucleobases may include purine, 2,6-diaminopurine, 7-deazaadenine, 7-deazaguanine, N.sup.4N.sup.4-ethanocytosine, N.sup.6N.sup.6-ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C.sub.3-C.sub.6)-alkanyluracil, 5-(C.sub.3-C.sub.6)-alkynylcytosine, 5-fluorouracil, and pseudoisocytosine, but the present invention is not particularly limited thereto.

    [0050] The PNA oligomer according to the present invention may be in a form in which a hydrophobic substituent is bound to a certain position of the backbone of PNA, that is, may be in a form in which a hydrophobic substituent is bound to the gamma position, N-terminus, C-terminus, or both termini of the basic backbone of PNA, preferably in a form in which a hydrophobic substituent is bound to the gamma position of the basic backbone of PNA. At least one hydrophobic substituent may be continuously or intermittently bound to the PNA probe.

    [0051] The hydrophobic substituent of Formula 1 signified in the present invention is each independently selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.30 aryl group, a C.sub.3-C.sub.30 heteroaryl group, an amino acid including a hydrophobic group, and a combination thereof, any one or more of hydrogen atoms of the hydrophobic substituent may be replaced by a halogen element, any one or more of carbon atoms of the alkyl group, the alkenyl group, or the alkynyl group may be replaced by O or S, and the heteroaryl group may include any one or more selected from B, N, O, S, P(═O), Si, and P.

    [0052] Specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.18 aryl group, and a C.sub.4-C.sub.15 heteroaryl group, and the heteroaryl group may preferably include N, but the present invention is not particularly limited thereto.

    [0053] More specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.6-C.sub.20 alkyl group, a C.sub.6-C.sub.20 alkenyl group, and a C.sub.6-C.sub.20 alkynyl group. The hydrophobic substituent of R.sub.1 in Formula 1 may be preferably selected from a C.sub.8-C.sub.18 alkyl group, a C.sub.8-C.sub.18 alkenyl group, or a C.sub.8-C.sub.18 alkynyl group. However, hydrophobic substituents are not particularly limited as long as they may bind to the backbone of PNA to induce a hydrophobic interaction with methyl groups.

    [0054] The hydrophobic substituent bound to the gamma position, any one terminus, or both termini of the PNA oligomer may increase a binding force to a target gene without any steric hindrance through a hydrophobic interaction with methyl groups of the target gene.

    [0055] Also, the amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), cysteine (Cys), methionine (Met), alanine (Ala), glycine (Gly), threonine (Thr), and tryptophan (Trp). Preferably, the amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), and cysteine (Cys), but the present invention is not particularly limited thereto.

    [0056] A hydrophobic interaction between a hydrophobic group bound to a side chain of the amino acid and a methyl group bound to the methylated gene may show stronger intermolecular binding force, compared to the non-methylated gene.

    [0057] The present invention provides a peptide nucleic acid (PNA) probe for detecting a methylated gene, which is represented by the following Formula 1:

    ##STR00006##

    [0058] wherein R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe for detecting a methylated gene may be the same or different from each other. Preferably, n may be an integer ranging from 8 to 24, but the present invention is not particularly limited thereto.

    [0059] The hydrophobic substituent of Formula 1 is each independently selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.30 aryl group, a C.sub.3-C.sub.30 heteroaryl group, an amino acid including a hydrophobic group, and a combination thereof, any one or more of hydrogen atoms of the hydrophobic substituent may be replaced by a halogen element, any one or more of carbon atoms of the alkyl group, the alkenyl group, or the alkynyl group may be replaced by O or S, and the heteroaryl group may include any one or more selected from B, N, O, S, P(═O), Si, and P.

    [0060] Specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.18 aryl group, and a C.sub.4-C.sub.15 heteroaryl group, and the heteroaryl group may preferably include N, but the present invention is not particularly limited thereto.

    [0061] More specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.6-C.sub.20 alkyl group, a C.sub.6-C.sub.20 alkenyl group, and a C.sub.6-C.sub.20 alkynyl group. The hydrophobic substituent of R.sub.1 in Formula 1 may be preferably selected from a C.sub.8-C.sub.18 alkyl group, a C.sub.8-C.sub.18 alkenyl group, or a C.sub.8-C.sub.18 alkynyl group. However, hydrophobic substituents are not particularly limited as long as they may bind to the backbone of PNA to induce a hydrophobic interaction with methyl groups.

    [0062] The amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), cysteine (Cys), methionine (Met), alanine (Ala), glycine (Gly), threonine (Thr), and tryptophan (Trp). Preferably, the amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), and cysteine (Cys), but the present invention is not particularly limited thereto.

    [0063] A hydrophobic interaction between a hydrophobic group bound to a side chain of the amino acid and a methyl group bound to the methylated gene may show stronger intermolecular binding force, compared to the non-methylated gene.

    [0064] The hydrophobic substituent bound to the gamma position, any one terminus, or both termini of the PNA probe may increase a binding force to a target gene without any steric hindrance through a hydrophobic interaction with methyl groups of the target gene.

    [0065] The expression “for detecting a methylated gene” means that a degree of methylation of a gene may be measured to diagnose cancer at an early stage, or may be used as a part of a gene test to predict a pattern of cancer progression after surgery and predict the response to drugs.

    [0066] Therefore, the methylated gene may be a cancer-specific methylated DNA, for example, p14, p16, or Cyclin D, which is involved in the cell cycle regulation, Twist or E-cadherin, which is involved in the cell adhesion, MGMT or h-MLH, which is involved in the DNA repair, or RASSF1α, DAPK, HIN-1, or RARβ, which is involved in a cell signaling pathway, but the present invention is not particularly limited thereto.

    [0067] The cancer may include any one selected from the group consisting of breast cancer, prostate cancer, bladder cancer, colon cancer, lung cancer, pancreatic cancer, acute promyelocytic leukemia, ovarian cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, lymphoma, gastric cancer, non-small-cell lung cancer, liver cancer, esophagus cancer, small intestine cancer, endometrial carcinoma, renal cancer, skin cancer, bone cancer, thyroid cancer, and spinal cord tumor, but the present invention is not particularly limited thereto.

    [0068] The PNA probe for detecting a methylated gene according to the present invention may hybridize with a gene having a complementary base sequence to form a double strand. A PNA/DNA double strand is more stable than a DNA/DNA double strand. This is because the DNA/DNA double strand includes a repulsive force of negative charges due to the basic backbone structure of negatively charged DNA, whereas a binding force is not offset by the repulsive force because the PNA is electrically neutral.

    [0069] The PNA probe for detecting a methylated gene according to the present invention may be based on the principle that it further enhances binding stability to a methylated target gene to inhibit amplification of the target gene and has a relatively weak binding force to a non-methylated gene to amplify the non-methylated gene.

    [0070] However, the present invention is not limited thereto, and a methylated gene may be detected without amplification of the gene using a ΔTm value reflecting a difference between a binding force of the PNA probe to the methylated target gene and a binding force of the PNA probe to the non-methylated gene.

    [0071] Specifically, guanine bases of the PNA bind to cytosine bases corresponding to their complementary bases, and the complementary binding forms a strong intermolecular attraction when a guanine or cytosine base binds to three hydrogen atoms. In this case, the methylated cytosine is a cytosine residue whose methyl group is bound to the 5th carbon atom of a pyrimidine ring, wherein the methyl group serves as an electron donating group (EDG) so that the methylated cytosine may form a stronger hydrogen bond with a guanine base complementary to the methylated cytosine.

    [0072] The PNA probe for detecting a methylated gene according to the present invention may not only form a stronger hydrogen bond to the methylated cytosine compared to the non-methylated cytosine but may also make a stronger intermolecular interaction with the methylated cytosine as a modified PNA to which a hydrophobic substituent is bound, compared to the normal form of PNA. For example, because the methyl group has a hydrophobic property, cytosine to which the methyl group is bound may induce a hydrophobic interaction with the PNA probe to which the hydrophobic substituent is bound to form a stronger intermolecular attraction with a hydrogen bond between cytosine and guanine.

    [0073] The PNA probe may further include any one selected from the group consisting of a reporter and a quencher, or a combination of two thereof. As a preferred example, the PNA probe may be a PNA probe including a reporter bound to the C-terminus thereof and a quencher bound to the N-terminus thereof, or a PNA probe including a reporter bound to the N-terminus thereof and a quencher bound to the C-terminus thereof.

    [0074] According to the present invention, the reporter is a fluorescence donor that emits light with a wavelength ranging from 400 nm to 800 nm, and may include any one or more selected from the group consisting of fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, oregon green, Alexa Fluor, FAM (6-carboxyfluorescein), Texas red, HEX (2,4,5,7-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, ROX, TET, TRITC, TEMRA, CY3, and CY5, but the present invention is not particularly limited thereto.

    [0075] According to the present invention, the quencher is a fluorescence acceptor that absorbs luminous energy from the reporter, and may include any one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), Eclipse, DDQ, QSY, Blackberry Quencher, BHQ1, BHQ2, Dabcyl (4,4-Dimethylamino-azobenzene-4-carboxylic acid), Iowa black, FQ, and IRDye QC-1, but the present invention is not particularly limited thereto.

    [0076] Because the PNA probe according to the present invention includes any one selected from the group consisting of a reporter and a quencher, or a combination of two thereof, a fluorescence signal is generated when the PNA probe is hybridized with a non-methylated gene or a target gene for methylation analysis to form a hybrid. According to one embodiment of the present invention, the PNA probe includes any one selected from the group consisting of a reporter and a quencher, or a combination of two thereof, but the present invention is not particularly limited thereto. The reporter or quencher may be bound to the non-methylated gene or the target gene for methylation analysis.

    [0077] When a temperature of the hybrid is gradually changed, the PNA probe and the gene, both of which have a double strand, are rapidly melted at a proper melting temperature to quench a fluorescence signal. In this case, a temperature at a moment when the fluorescence signal is quenched may refer to Tm. The presence of gene methylation may be checked by measuring ΔTm between the non-methylated gene and the PNA probe or ΔTm between the target gene for methylation analysis and the PNA probe.

    [0078] The present invention provides a method for detecting the presence of gene methylation using the PNA probe for detecting a methylated gene. Specifically, the present invention provides a method for detecting a methylated gene, which includes: preparing a first mixture including a non-methylated gene and a PNA probe represented by the following Formula 1, which may specifically bind to a base sequence of the non-methylated gene; preparing a second mixture including a target gene for methylation analysis, which includes the same base sequence as the base sequence of the non-methylated gene, and the PNA probe represented by the following Formula 1; changing temperatures of the first mixture and the second mixture; and analyzing a melting curve by measuring melting temperatures (Tm) of the first mixture and the second mixture according to the temperature change:

    ##STR00007##

    [0079] wherein R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe may be the same or different from each other. Preferably, n may be an integer ranging from 8 to 24, but the present invention is not particularly limited thereto.

    [0080] The hydrophobic substituent of Formula 1 is each independently selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.30 aryl group, a C.sub.3-C.sub.30 heteroaryl group, an amino acid including a hydrophobic group, and a combination thereof, any one or more of hydrogen atoms of the hydrophobic substituent may be replaced by a halogen element, any one or more of carbon atoms of the alkyl group, the alkenyl group, or the alkynyl group may be replaced by O or S, and the heteroaryl group may include any one or more selected from B, N, O, S, P(═O), Si, and P.

    [0081] Specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.3-C.sub.30 alkyl group, a C.sub.3-C.sub.30 alkenyl group, a C.sub.3-C.sub.30 alkynyl group, a C.sub.6-C.sub.18 aryl group, and a C.sub.4-C.sub.15 heteroaryl group, and the heteroaryl group may preferably include N, but the present invention is not particularly limited thereto.

    [0082] More specifically, the hydrophobic substituent of R.sub.1 in Formula 1 may include any one or more selected from the group consisting of a C.sub.6-C.sub.20 alkyl group, a C.sub.6-C.sub.20 alkenyl group, and a C.sub.6-C.sub.20 alkynyl group. The hydrophobic substituent of R.sub.1 in Formula 1 may be preferably selected from a C.sub.8-C.sub.18 alkyl group, a C.sub.8-C.sub.18 alkenyl group, or a C.sub.8-C.sub.18 alkynyl group. However, hydrophobic substituents are not particularly limited as long as they may bind to the backbone of PNA to induce a hydrophobic interaction with methyl groups.

    [0083] The amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), cysteine (Cys), methionine (Met), alanine (Ala), glycine (Gly), threonine (Thr), and tryptophan (Trp). Preferably, the amino acid including a hydrophobic group may each independently include any one selected from the group consisting of isoleucine (Ile), valine (Val), leucine (Leu), phenylalanine (Phe), and cysteine (Cys), but the present invention is not particularly limited thereto.

    [0084] A hydrophobic interaction between a hydrophobic group bound to a side chain of the amino acid and a methyl group bound to the methylated gene may show a stronger intermolecular binding force, compared to the non-methylated gene.

    [0085] The temperature change may be in a range of 30° C. to 95° C., preferably in a range of 40° C. to 90° C.

    [0086] The melting of the double strand may be achieved at a relatively high temperature due to the formation of the strong intermolecular attraction between the methylated cytosine of the target gene and the PNA probe. Specifically, the binding of Epi-sPNA to a gene having non-methylated cytosines is made only via a basic hydrogen bond. On the other hand, Epi-sPNA and a gene including methylated cytosines are bound via a hydrophobic interaction in addition to the basic hydrogen bond. As a result, a difference in denaturation temperatures between the hydrogen bond and the hydrophobic interaction is greater than or equal to 3° C. Therefore, when ΔTm is shown to be greater than or equal to 3° C., the gene may be judged to be methylated. Preferably, the difference in denaturation temperature may be greater than or equal to 5° C., more preferably greater than or equal to 10° C. When the gene includes methylated cytosines, the denaturation temperature becomes higher due to the stronger binding force. However, this temperature difference may vary depending on the number of methylated cytosines, but the present invention is not particularly limited thereto.

    [0087] According to the present invention, the melting curve analysis may be performed using a fluorescence melting curve analysis (FMCA) method, but the present invention is not particularly limited thereto.

    [0088] The fluorescence melting curve analysis may be performed by analyzing a melting curve using a fluorescent material. In this case, each of the mixtures may further include a fluorescence-labeled material. The target gene, the non-methylated gene, or the Epi-sPNA may include a fluorescence-labeled material. Preferably, the Epi-sPNA may include a fluorescence-labeled material. The fluorescence-labeled material may be any one selected from a reporter and a quencher, or a combination of two thereof. In addition, the fluorescence-labeled material may be an intercalating fluorescent material.

    [0089] In the present invention, the reporter refers to a material that absorbs and emits light with a certain wavelength to emit fluorescence, that is, a material with which a probe is labeled to check that a target nucleic acid is hybridized with the probe, and the quencher refers to a material that absorbs light emitted from the reporter material to reduce fluorescence intensity.

    [0090] The intercalating fluorescent material may be selected from the group consisting of an acridine homodimer and derivatives thereof, Acridine Orange and derivatives thereof, 7-aminoactinomycin D (7-AAD) and derivatives thereof, actinomycin D and derivatives thereof, 9-amino-6-chloro-2-methoxyacridine (ACMA) and derivatives thereof, DAPI and derivatives thereof, dihydroethidium and derivatives thereof, ethidium bromide and derivatives thereof, an ethidium homodimer-1 (EthD-1) and derivatives thereof, an ethidium homodimer-2 (EthD-2) and derivatives thereof, ethidium monoazide and derivatives thereof, hexidium iodide and derivatives thereof, bisbenzimide (Hoechst 33258) and derivatives thereof, Hoechst 33342 and derivatives thereof, Hoechst 34580 and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 and derivatives thereof, propidium iodide (PI) and derivatives thereof, and Cy-dye derivatives.

    [0091] Specifically, the Epi-sPNA may include a reporter and a quencher. Because the Epi-sPNA includes the reporter and the quencher, a fluorescence signal may be generated after the Epi-sPNA is hybridized with a gene by complementary binding to the gene, and the fluorescence signal is quenched when the complementary binding of the Epi-sPNA to the gene is dissociated at a denaturation temperature as the temperature of the hybridized mixture increases. The presence of gene methylation may be determined through the melting curve analysis obtained from the fluorescence signal and the quenched signal according to this temperature change.

    [0092] The temperature of each of the mixtures may be changed from 30° C. to 95° C., preferably from 40° C. to 90° C. at a rate of 0.1° C./s to 20° C./s, preferably at a rate of 0.2° C./s to 15° C./s, and more preferably at a rate of 0.5° C./s to 10° C./s. When the temperature of each of the mixtures reaches any certain temperature, the PNA/DNA double strands are separated by dissociation of the complementary binding. In this case, the temperature is a melting temperature (Tm), and the melting temperature may be checked by disappearance of the fluorescence signal.

    [0093] The analyzing of the melting curve may include judging a gene to be methylated when it is assumed that ΔTm is greater than or equal to 3° C. when the ΔTm is measured. Preferably, the ΔTm may be greater than or equal to 5° C. More preferably, the ΔTm may be greater than or equal to 10° C. In this case, the ΔTm satisfies the following equation: ΔTm=Tm (Target Gene for Methylation Analysis)−Tm (Non-methylated Gene Including the Same Base Sequence as Target Gene for Methylation Analysis). Because the binding force between the methylated cytosine and the Epi-sPNA is stronger than the binding force between the non-methylated cytosine and the Epi-sPNA, the melting temperature becomes higher when the Epi-sPNA is bound to the methylated cytosine.

    [0094] The method for detecting gene methylation according to the present invention enables easy detection of gene methylation only by measuring the Tm according to the temperature change of each of the mixtures without amplification of the gene in the step of measuring Tm according to the temperature change to analyze a melting curve.

    [0095] According to one embodiment of the present invention, the method for detecting a methylated gene may include preparing a first mixture including a non-methylated gene and a PNA probe represented by the following Formula 1, which may specifically bind to a base sequence of the non-methylated gene; preparing a second mixture including a target gene for methylation analysis, which includes the same base sequence as the base sequence of the non-methylated gene, and the PNA probe represented by the following Formula 1; subjecting the first mixture and the second mixture to a polymerase chain reaction (PCR); and measuring a cycle threshold (ΔCt) value of the PCR. In this case, the cycle threshold (ΔCt) value satisfies the following equation: ΔCt=Ct (Target Gene)−Ct (Non-methylated Gene Including the Same Base Sequence as Target Gene).

    [0096] The gene-amplified product obtained by a polymerase chain reaction (PCR) may be determined by the intercalating fluorescent material. In particular, a real-time PCR (RT-PCR uses a fluorescent dye to observe the entire reaction. In this case, the fluorescent dye increases proportionally as the amplified product is accumulated in every amplification cycle. At the beginning of amplification, an increase in fluorescence is not detected, but the accumulated fluorescence intensity is detected by the machine as the amplifications are performed predetermined times or more. Then, the fluorescence significantly increases so that an increase in the fluorescence can be detected over the background level. The number of amplification cycles at this time is referred to as a cycle threshold (Ct).

    [0097] Specifically, the gene may be amplified through the PCR in the present invention. The Epi-sPNA probe hybridized with the methylated gene binds more strongly to the methylated gene due to the strong action of intermolecular attraction caused by the hydrogen bond and the hydrophobic interaction, compared to when the Epi-sPNA probe is hybridized with the non-methylated gene. As a result, because the gene amplification is inhibited, the Ct value is found to be high. That is, the presence of methylation may be checked by determining a ΔCt value obtained by subtracting a Ct value of the same gene in a control sample from a Ct value of a target gene.

    [0098] According to the method for detecting gene methylation according to the present invention, the ΔCt may be greater than 0.5. Preferably, the ΔCt may be greater than 1.

    [0099] The present invention provides a kit for use in the method for detecting a methylated gene according to the present invention, which includes a PNA probe represented by the following Formula 1, which may specifically bind to a base sequence of a gene whose methylation may occur:

    ##STR00008##

    [0100] wherein R.sub.1 is a hydrophobic substituent, R.sub.2 is hydrogen or a hydrophobic substituent, R.sub.3 is a hydroxyl group or a hydrophobic substituent, Base is any one base selected from natural or non-natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, n is an integer ranging from 5 to 30, and respective structural units included in the PNA probe may be the same or different from each other. Preferably, n may be an integer ranging from 8 to 24, but the present invention is not particularly limited thereto.

    [0101] The present invention provides a method for detecting gene methylation, which includes mixing the PNA probe with a biological sample to hybridize the PNA probe with a target gene included in the biological sample; applying heat to the resulting mixture at a temperature higher than a melting temperature (Tm) of a hybrid of a non-methylated gene and the PNA probe and lower than a hybrid of a methylated gene and the PNA probe; and removing the hybrid of the non-methylated gene and the PNA probe melted at the temperature, wherein the gene methylation is detected through an imaged fluorescence signal of the hybrid of the methylated gene and the PNA probe.

    [0102] By using a difference in the binding temperature between the PNA probe and the methylated gene or the non-methylated gene, a biological sample corresponding to tissues and cells including a gene to be detected may be allowed to bind in vitro to the PNA probe including a fluorescent material. The presence of methylation of the target gene in the corresponding biological sample may be detected by detecting a fluorescence signal at a certain temperature at which the binding of the PNA probe to the methylated gene having a high binding temperature is maintained and the binding of the PNA probe to the non-methylated gene having a low binding temperature may be dissociated.

    [0103] Hereinafter, the present invention will be described with reference to examples thereof. However, it should be understood that the following examples are illustrative only to describe the present invention in more detail, but are not intended to limit the scope of the present invention.

    MODE FOR INVENTION

    <Example 1> Analysis of Binding Temperature of Epi-sPNA Probe to Non-Methylated or Methylated Target DNA

    [0104] An Epi-sPNA probe (0.1 μM; Seasun Biomaterials, Korea) of SEQ ID NO: 2, a non-methylated DNA oligomer (0.1 μM; Integrated DNA Technologies, USA) of SEQ ID NO: 3, a methylated DNA oligomer (0.1 μM; Integrated DNA Technologies, USA) of SEQ ID NO: 4, and 10 μL of a 2×PCR amplification solution (Seasun Biomaterials, Korea) were added to 7 μL of distilled water, and mixed. Thereafter, the mixture was reacted at 95° C. for 5 minutes, cooled to 40° C., and heated at a rate of 2° C./s by 1° C. from 40° C. to 90° C. using a real-time PCR machine (CFX96™ Real-time PCR System, Bio-Rad, USA). Then, the melting curve analysis was performed by measuring the PCR product at a fluorescence wavelength of 510 nm without a gene amplification process. The sequences used in this experiment are listed in Table 1 below.

    <Comparative Example 1> Analysis of Binding Temperature of Non-Methylated or Methylated Target DNA Bound to Normal PNA Probe

    [0105] This experiment was performed in the same manner as in Example 1, except that the normal PNA probe of SEQ ID NO: 1 was used instead of the Epi-sPNA probe.

    TABLE-US-00001 TABLE 1 SEQ ID Sequence NO Name Sequence (N′ .fwdarw. C′) Note 1 PNA_1 Dabcyl-ACCCCGCGATCA-O-K(FAM) Normal PNA 2 Epi-sPNA Dabcy1-ACCCCG″CG″ATCA-O-K(FAM) MS PNA 3 DNA_UC CCAGCTGCGCGTTGACCGCGGGGTCCGACATGA Non- TGGCTGG methylated target DNA 4 DNA_MC CCAGCTGCGCGTTGACCGCGGGGTCCGACATGA Methylated TGGCTGG target DNA G″: Guanine base modified by hydrophobic substituent C: Methylated cytosine base O: Linker G: Base complementary to methylated cytosine base K: Lysine

    [0106] FIG. 1A is a graph showing the results for Comparative Example 1, and FIG. 1B is a graph showing the results for Example 1. It was revealed that the ΔTm was 1° C. in the case of Comparative Example 1, and the ΔTm was 13° C. in the case of Example 1 using the Epi-sPNA probe. Based on these results, it can be seen that the sensitivity and specificity were able to be remarkably enhanced during the detection of methylation because a stronger binding force to the methylated DNA was applied to the modified Epi-sPNA to which the hydrophobic substituent was bound, compared to the non-modified PNA.

    <Example 2> Analysis of ΔCt of Non-Methylated or Methylated Target DNA Bound to Epi-sPNA Probe

    [0107] PCR amplification was performed using 45 ng of genomic DNA, DNA primers of SEQ ID NOS: 5 and 6 (0.1 μM), an Epi-sPNA probe of SEQ ID NO: 2 (0.1 μM), and 10 μL of a 1×PCR amplification solution (Seasun Biomaterials, Korea). The PCR amplification conditions were as follows. The resulting mixture was reacted at 95° C. for 5 minutes, followed by a total of 25 cycles at 95° C. for 30 seconds, at 58° C. for 30 seconds, and at 72° C. for 30 seconds, and then reacted at 72° C. for 5 minutes using a real-time PCR machine (CFX96™ Real-time PCR System, Bio-Rad, USA). Then, the mixture was reacted at 72° C. for 5 minutes.

    [0108] Human HCT116 DKO Non-Methylated DNA (Cat #D5014-01, Zymo Research, USA) was used as the non-methylated target DNA, and Human HCT116 DKO Methylated DNA (Cat #D5014-02, Zymo Research, USA) was used as the methylated DNA.

    <Comparative Example 2> Analysis of ΔCt of Non-Methylated or Methylated Target DNA Using SYBR Green Intercalating Dye

    [0109] DNA and primers were used under the same conditions as in Example 2, and PCR was performed using an SYBR green dye (1×) as the intercalating dye instead of the Epi-sPNA. PCR was also performed under the same PCR conditions as in Example 2.

    TABLE-US-00002 TABLE 2 SEQ ID Sequence NO Name Sequence (N′ .fwdarw. C′) Note 5 Sep_F GCCGCAGCAGCCAGCCA Forward Primer 6 SepR_C2 ACCAGCCATCATGTCGGACC Reverse Primer

    [0110] FIG. 2A is a graph showing the results of PCR amplification curves for detection of DNA methylation using the Epi-sPNA probe. Here, a ΔCt value was shown to be 3. FIG. 2B is a graph showing the results of PCR amplification curves using an intercalating dye. Here, the ΔCt value is normalized according to the concentration of the target DNA. As a result, the ΔCt value was shown to be 0.

    [0111] These results show that the amplification of the target gene was inhibited due to the strong interaction with methylated cytosines when the Epi-sPNA probe was used, compared to the non-methylated gene. From the results, it can be seen that the presence of gene methylation was able to be detected by measuring the ΔCt values.