Inhibitors of the Artemin Pathway for Treatment of Cancer
20230270861 · 2023-08-31
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A61N2005/1098
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61N5/10
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
A61K41/0038
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K41/00
HUMAN NECESSITIES
A61K31/4995
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
A61N5/10
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
This disclosure relates to compositions and methods for treating cancer by modulating the artemin pathway.
Claims
1. A method of treating cancer in a subject, comprising: a) administering to the subject an effective amount of at least one of a radiotherapy and a checkpoint inhibitor; and b) administering to the subject an effective amount of an inhibitor of the artemin pathway.
2. The method of claim 1, wherein the method comprises administering a radiotherapy.
3. The method of claim 1, wherein the method comprises administering a checkpoint inhibitor.
4. The method of claim 1, wherein the method comprises administering a radiotherapy and a checkpoint inhibitor.
5. The method of claim 1, 3, or 4, wherein the checkpoint inhibitor is an antibody or antigen-binding fragment thereof.
6. The method of claim 1, 3, or 4, wherein the checkpoint inhibitor is a peptide.
7. The method of claim 1, 3, or 4, wherein the checkpoint inhibitor is a small molecule.
8. The method of claim 1, 3, or 4, wherein the checkpoint inhibitor inhibits PD-L1.
9. The method of claim 8, wherein the checkpoint inhibitor is an anti-PD-L1 antibody or antigen-binding fragment thereof.
10. The method of claim 8, wherein the checkpoint inhibitor is a peptide.
11. The method of claim 8, wherein the checkpoint inhibitor is a small molecule.
12. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is an antibody or an antigen-binding fragment thereof.
13. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is a small molecule.
14. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is a gene editing composition.
15. The method of claim 14, wherein the gene editing composition comprises CRISPR/Cas9.
16. The method of claim 14, wherein the gene editing composition inhibits RET or GFRα3.
17. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway inhibits artemin.
18. The method of claim 17, wherein the artemin inhibitor is an anti-artemin antibody or antigen-binding fragment thereof.
19. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway inhibits GFRα3.
20. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway inhibits RET.
21. The method of claim 20, wherein the RET inhibitor is one or more of vandetanib, cabozantinib, RXDX-105, lenvatinib, sorafenib, sunitinib, dovitinib, alectinib, ponatinib, regorafenib, nintedanib, apatinib, motesanib, BLU-667, or LOXO-292.
22. The method of claim 21, wherein the RET inhibitor is LOXO-292.
23. The method of any of claims 1-4, wherein the cancer is lung cancer, colon cancer, or melanoma.
24. The method of claim 1, 3, or 4, wherein the checkpoint inhibitor and the inhibitor of the artemin pathway are in the same composition.
25. The method of claim 1 or 4, wherein the checkpoint inhibitor and/or the inhibitor of the artemin pathway are administered subsequent to the radiotherapy.
26. The method of claim 25, wherein the checkpoint inhibitor and/or the inhibitor of the artemin pathway are administered 3-10 days subsequent to the start of the administration of the radiotherapy.
27. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is administered simultaneously with the checkpoint inhibitor and/or the radiotherapy.
28. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is administered subsequent to the checkpoint inhibitor and/or the radiotherapy.
29. The method of claim 28, wherein the inhibitor of the artemin pathway is administered no more than 7 days subsequent to the checkpoint inhibitor and/or the radiotherapy.
30. The method of any of claim 1, 3, or 4, wherein the checkpoint inhibitor is administered to the subject at more than one time.
31. The method of claim 30, wherein the checkpoint inhibitor is administered every other week.
32. The method of claim 31, wherein the checkpoint inhibitor is administered simultaneously with the radiotherapy.
33. The method of claim 31, wherein the checkpoint inhibitor is administered subsequent to the radiotherapy.
34. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is administered to the subject at more than one time.
35. The method of claim 34, wherein the inhibitor of the artemin pathway is administered every other day.
36. The method of claim 35, wherein the inhibitor of the artemin pathway is administered for 14 days simultaneously with and subsequent to radiotherapy.
37. The method of claim 34, wherein the inhibitor of the artemin pathway is administered every day.
38. The method of claim 37, wherein the inhibitor of the artemin pathway is administered until remission is achieved.
39. The method of any of claim 1, 3, or 4, wherein the checkpoint inhibitor is administered intravenously.
40. The method of any of claims 1-4, wherein the inhibitor of the artemin pathway is administered intratumorally.
41. The method of any of claims 1-4, further comprising c) reducing the size of a tumor or inhibiting growth of a tumor in the subject.
42. A method of treating cancer in a subject, comprising: a) administering to the subject an effective amount of ionizing radiation, an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof, and an effective dose of an anti-artemin antibody or an antigen-binding fragment thereof; and b) reducing the size of a tumor or inhibiting growth of a tumor in the subject.
43. A method of treating cancer in a subject, comprising: a) administering to the subject an effective amount of ionizing radiation and an effective amount of LOXO-292; and b) reducing the size of a tumor or inhibiting growth of a tumor in the subject.
44. A method of treating cancer in a subject, comprising: a) administering to the subject an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof and an effective amount of LOXO-292; and b) reducing the size of a tumor or inhibiting growth of a tumor in the subject.
45. A composition, comprising: a) an effective amount of a checkpoint inhibitor; b) an effective amount of an inhibitor of the artemin pathway; and c) a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof.
46. The composition of claim 45, wherein the checkpoint inhibitor is an antibody or an antigen-binding fragment thereof.
47. The composition of claim 45, wherein the checkpoint inhibitor is a peptide.
48. The composition of claim 45, wherein the checkpoint inhibitor is a small molecule.
49. The composition of claim 45, wherein the inhibitor of the artemin pathway is an antibody or an antigen-binding fragment thereof.
50. The composition of claim 45, wherein the inhibitor of the artemin pathway is a small molecule.
51. The composition of claim 45, wherein the inhibitor of the artemin pathway is a gene editing composition.
52. The composition of claim 45, wherein the checkpoint inhibitor is a PD-L1 inhibitor.
53. The composition of claim 45, wherein the inhibitor of the artemin pathway is LOXO-292.
54. A composition, comprising: a) an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof; b) an effective amount of an anti-artemin antibody or an antigen-binding fragment thereof; and c) a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof.
55. A composition, comprising: a) an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment; b) an effective amount of LOXO-292; and c) a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The accompanying drawings are included to provide a further understanding of the methods and compositions of the disclosure, and are incorporated in and constitute a part of this specification. The drawings illustrate one or more embodiment(s) of the disclosure, and together with the description serve to explain the principles and operation of the disclosure.
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088] Representative data are shown from two or three experiments. Data are represented as mean±SD. *p<0.05, **p<0.01, and ***p<0.001.
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0104] It is to be understood that the particular aspects of the specification are described herein are not limited to specific embodiments presented, and can vary. It also will be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting. Moreover, particular embodiments disclosed herein can be combined with other embodiments disclosed herein, as would be recognized by a skilled person, without limitation.
[0105] All publications, patents, and patent applications cited herein are hereby expressly incorporated by reference in their entirety for all purposes.
Definitions
[0106] Before describing the methods and compositions of the disclosure in detail, a number of terms will be defined. As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, reference to “a therapeutic target” means one or more therapeutic targets.
[0107] Throughout this specification, unless the context specifically indicates otherwise, the terms “comprise” and “include” and variations thereof (e.g., “comprises,” “comprising,” “includes,” and “including”) will be understood to indicate the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other component, feature, element, or step or group of components, features, elements, or steps. Any of the terms “comprising,” “consisting essentially of,” and “consisting of” can be replaced with either of the other two terms, while retaining their ordinary meanings.
[0108] Percentages disclosed herein can vary in amount by ±10, 20, or 30% from values disclosed and remain within the scope of the contemplated disclosure.
[0109] Unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values herein that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0110] As used herein, ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. For example, “about 5%” means “about 5%” and also “5%.” The term “about” can also refer to ±10% of a given value or range of values. Therefore, about 5% also means 4.5%-5.5%, for example.
[0111] As used herein, the terms “or” and “and/or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and/or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”
[0112] “Pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, typically suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio or which have otherwise been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
[0113] As used herein, the terms “therapeutic amount,” “therapeutically effective amount,” or “effective amount” can be used interchangeably and refer to an amount of a compound that becomes available through the appropriate route of administration to treat a patient for a disorder, a condition, or a disease. The amount of a compound which constitutes a “therapeutic amount,” “therapeutically effective amount,” or “effective amount” will vary depending on the compound, the disorder and its severity, and the age of the subject to be treated, but can be determined routinely by one of ordinary skill in the art.
[0114] “Treating” or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, preferably a human, and includes: [0115] i. inhibiting a disease or disorder, i.e., arresting its progression; [0116] ii. relieving a disease or disorder, i.e., causing regression of the disorder; [0117] iii. slowing progression of the disorder; and/or [0118] iv. inhibiting, relieving, ameliorating, or slowing progression of one or more symptoms of the disease or disorder. For example, the terms “treating,” “treat,” or “treatment” refer to either preventing, providing symptomatic relief, or curing a patient's disorder, condition, or disease.
[0119] As used herein, the terms “patient” and/or “subject” and/or “individual” can be used interchangeably and refer to an animal. For example, the patient, subject, or individual can be a mammal, such as a human to be treated for a disorder, condition, or a disease.
[0120] As used herein, the terms “disorder,” “condition,” or “disease” refer to cancers, and in some embodiments, associated comorbidities.
[0121] It is noted that terms like “preferably,” “commonly,” and “typically” are not utilized herein to limit the scope of the methods and compositions as described herein or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention.
[0122] As used herein, the term “cancer” refers to any type of cancerous cell or tissue as well as any stage of a cancer from precancerous cells or tissues to metastatic cancers. For example, as used herein, cancer can refer to a solid cancerous tumor, leukemia, and/or a neoplasm.
[0123] As used herein, the term “radiotherapy” refers to administration of at least one “radiotherapeutic agent” to a subject having a tumor or cancer and refers to any manner of treatment of a tumor or cancer with a radiotherapeutic agent. A radiotherapeutic agent includes, for example, ionizing radiation including, for example, external beam radiotherapy, stereotactic radiotherapy, virtual simulation, 3-dimensional conformal radiotherapy, intensity-modulated radiotherapy, ionizing particle therapy, and radioisotope therapy.
[0124] As used herein, the term “inhibit” means to slow down or reduce the activity of a protein, enzyme, or other agent. “Inhibit” can include complete elimination of a protein or its activity. The term “inhibit” can further mean to prevent functional interaction of one or more compounds, molecules, or proteins. For example, an inhibitor can prevent a receptor from accepting its ligand or prevent activation of the receptor when accepting its ligand.
Overview
[0125] The present inventors have unexpectedly discovered that combining radiotherapy or checkpoint inhibitor immunotherapy with artemin pathway blockade significantly enhances the efficacy of both radio- and immunotherapies compared to monotherapy or a combination of radiotherapy and immunotherapy alone.
[0126] Provided herein are methods for treating cancer using a combination of inhibition of the artemin pathway with one or both of radiotherapy and checkpoint inhibition. Embodiments of the present disclosure include methods of treating cancer in a subject comprising administering to the subject an effective dose of at least two of the following: a radiotherapy, a checkpoint inhibitor, and an inhibitor of the artemin pathway. In some embodiments, the method comprises administering a radiotherapy and an inhibitor of the artemin pathway. In some embodiments, the method comprises administering a checkpoint inhibitor and an inhibitor of the artemin pathway. In some embodiments, the method comprises administering a radiotherapy, a checkpoint inhibitor, and an inhibitor of the artemin pathway.
[0127] In some embodiments of the present disclosure, a method of treating cancer in a subject includes administering to the subject an effective amount of ionizing radiation, an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof, and an effective dose of an anti-artemin antibody or an antigen-binding fragment thereof, and reducing the size of a tumor or inhibiting growth of the tumor in the subject. In some embodiments of the present disclosure, a method of treating cancer in a subject includes administering to the subject an effective amount of ionizing radiation and an effective amount of LOXO-292, and reducing the size of a tumor or inhibiting growth of the tumor in the subject. Additionally, in some embodiments of the present disclosure a method of treating cancer in a subject includes administering to the subject an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof and an effective amount of LOXO-292, and reducing the size of a tumor or inhibiting growth of the tumor in the subject.
[0128] Also provided herein are compositions for treating cancer. In some embodiments of the present disclosure, a composition can include an effective amount of a checkpoint inhibitor, an effective amount of an inhibitor of the artemin pathway, and a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof.
[0129] In some embodiments of the present disclosure, a composition can include an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment thereof, an effective amount of an anti-artemin antibody or an antigen-binding fragment thereof, and a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof. In some embodiments of the present disclosure a composition can include an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment, an effective amount of a RET inhibitor, and a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof. In some embodiments of the present disclosure, a composition can include an effective amount of an anti-PD-L1 antibody or an antigen-binding fragment, an effective amount of LOXO-292, and a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof. Radiotherapy
[0130] Radiotherapy is based on ionizing radiation delivered to a target area that results in death of tumor cells. The present disclosure contemplates a variety of radiotherapy approaches. Radiotherapy that can be used herein can include the application of radiation from sources including cesium, palladium, iridium, iodine, and/or cobalt. Radiation is usually delivered as ionizing radiation delivered from a linear accelerator or an isotopic source, such as a cobalt. Specific linear accelerators (LINACs) contemplated for use herein include Cyberknife® and TomoTherapy®. Particle radiotherapy from cyclotrons, such as delivery of protons or carbon nuclei, can also be employed. In addition, radioisotopes such as .sup.32P or radium-223 can be delivered systemically. External radiotherapy can be systemic radiation in the form of stereotactic radiotherapy, total nodal radiotherapy, or whole body radiotherapy. However, radiation can also be focused to a particular site, such as the location of the tumor or the solid cancer tissues (for example, abdomen, lung, liver, lymph nodes, head, etc.).
[0131] The radiation dosage regimen is generally defined in terms of gray (Gy) or sieverts (Sv), time, and fractionation, and can be readily defined by a skilled radiation oncologist. The amount of radiation a subject receives will depend on various considerations, but two important considerations are 1) the location of the tumor in relation to other critical structures or organs of the body, and 2) the extent to which the tumor has spread. One illustrative example of a course of treatment for a subject undergoing radiation therapy includes a treatment schedule taking place over a 5 to 8 week period, with a total dose of 50 to 80 Gy administered to the subject in a single daily fraction of 1.8 to 2.0 Gy, 5 days a week. One Gy refers to 100 rad of dose.
[0132] Radiotherapy can also include implanting radioactive seeds inside or next to a site designated for radiotherapy and is termed brachytherapy (or internal radiotherapy, endocurietherapy, or sealed source therapy). For prostate cancer, there are currently two types of brachytherapy: permanent and temporary. In permanent brachytherapy, radioactive (iodine-125 or palladium-103) seeds can be implanted into the prostate gland using ultrasound for guidance. Illustratively, about 40 to 100 seeds are implanted, and the number and placement are generally determined by a computer-generated treatment plan known in the art specific for each subject. Temporary brachytherapy uses a hollow source placed into the prostate gland that is filled with radioactive material (iridium-192) for about 5 to about 15 minutes, for example. Following treatment, the needle and radioactive material are removed. This procedure is repeated two to three times over a course of several days.
[0133] Radiotherapy can also include radiation delivered by external beam radiation therapy (EBRT), including, for example, a linear accelerator (a type of high-powered X-ray machine that produces very powerful photons that penetrate deep into the body); proton beam therapy where photons are derived from a radioactive source such as iridium-192, caesium-137, radium-226 (no longer used clinically), or colbalt-60; Hadron therapy; multi-leaf collimator (MLC); and intensity modulated radiation therapy (IMRT). During EBRT, a brief exposure to the radiation is given for a duration of several minutes, and treatment is typically given once per day, 5 days per week, for about 5 to 8 weeks. No radiation remains in the subject after treatment. There are several ways to deliver EBRT, including, for example, three-dimensional conformal radiation therapy where the beam intensity of each beam is determined by the shape of the tumor. Illustrative dosages used for photon-based radiation are measured in Gy, and in an otherwise healthy subject (that is, little or no other disease states present such as high blood pressure, infection, diabetes, etc.) for a solid epithelial tumor ranges from about 60 to about 80 Gy, and for a lymphoma ranges from about 20 to about 40 Gy. Illustrative preventative (adjuvant) doses are typically given at about 45 to about 60 Gy in about 1.8 to about 2 Gy fractions for breast, head, and neck cancers.
[0134] When radiation therapy is a local modality, radiation therapy as a single line of therapy is unlikely to provide a cure for those tumors that have metastasized distantly outside the zone of treatment. Thus, the use of radiation therapy with other modality regimens, including chemotherapy, can have important beneficial effects for the treatment of metastasized cancers.
[0135] Radiation therapy has also been combined temporally with chemotherapy to improve the outcome of treatment. There are various terms to describe the temporal relationship of administering radiation therapy and chemotherapy, and the following examples are non-limiting illustrative treatment regimens generally known by those skilled in the art. “Sequential” radiation therapy and chemotherapy refers to the administration of chemotherapy and radiation therapy separately in time. “Simultaneous” radiation therapy and chemotherapy refers to the administration of chemotherapy and radiation therapy at the same time or more typically on the same day. “Simultaneous” administration can also refer to multiple treatments that overlap in time even if they are not co-administered at the same time or even consistently on the same day—for example, if a first treatment is given every other day and a second treatment is administered on the “off” days for the first treatment over a period, or if a first treatment is given every four days and a second treatment every three days over a period. “Alternating” radiation therapy and chemotherapy refers to the administration of radiation therapy on the days in which chemotherapy would not have been administered if it were given alone.
[0136] It should be noted that therapeutically effective doses of radiotherapy can be determined by a radiation oncologist skilled in the art and can be based on, for example, whether the subject is receiving chemotherapy, if the radiation is given before or after surgery, the type and/or stage of cancer, the type of radiotherapy to be used, the location of the tumor, and the age, weight and general health of the subject.
Checkpoint Inhibitors
[0137] Checkpoint inhibitors work by blocking immune checkpoints that shut down immune responses and protect themselves. These molecules are able to unleash new immune responses against cancer as well as enhance existing responses to promote elimination of cancer cells. In some embodiments of the present disclosure, checkpoint inhibitors can be administered to a subject to reduce tumor-induced Ter-cell accumulation in a CD8+ T cell and IFN-γ-dependent manner. Checkpoint inhibitors are perhaps the most well-known, and most widely successful, immunomodulators developed so far. Several therapies available or in development target Cytotoxic T-Lymphocyte-Associated protein 4 (CTLA-4, also called CD152) or the Programmed Death 1 (PD-1) pathway. There are a variety of other checkpoint targets, including the following: Adenosine A2A receptor (A2AR), B7-H3 or CD276, B7-H4 or VTCN1, B and T Lymphocyte Attenuator (BTLA) or CD272, Herpesvirus Entry Mediator (HVEM), Indoleamine 2,3-dioxygenase (IDO), tryptophan 2,3-dioxygenase (TDO), Killer-cell Immunoglobulin-like Receptor (KIR), Lymphocyte Activation Gene-3 (LAG3), nicotinamide adenine dinucleotide phosphate NADPH oxidase isoform 2 (NOX2), T-cell Immunoglobulin domain and Mucin domain 3 (TIM-3), V-domain Ig suppressor of T cell activation (VISTA), Sialic acid-binding immunoglobulin-type lectin 7 (SIGLEC7) or CD328, and Sialic acid-binding immunoglobulin-type lectin 9 (SIGLEC9) or CD329. The present disclosure contemplates inhibitors targeting all of these checkpoints and administration of one or more checkpoint inhibitors to a subject in need thereof. In some embodiments of the present disclosure, the checkpoint inhibitor is an antibody or antigen-binding fragment thereof. In some embodiments, the checkpoint inhibitor is a peptide. In other embodiments, the checkpoint inhibitor is a small molecule.
[0138] The present disclosure contemplates compositions and methods targeting Programmed Death-Ligand 1 (PD-L1). Antibodies, peptides, or small molecules serving as inhibitors of PD-L1 can include Atezolizumab (Tecentriq), Avelumab (Bavencio), Durvalumab (Imfinzi), KN035, CK-301, AUNP12, CA-170, BMS-986189, and other compositions. In some embodiments of the present disclosure, the checkpoint inhibitor inhibits PD-L1. In some embodiments, the PD-L1 inhibitor is an antibody or antigen-binding fragment thereof. In some embodiments, the PD-L1 inhibitor is a peptide. In some embodiments, the PD-L1 inhibitor is a small molecule.
Inhibitors of the Artemin Pathway
[0139] The present disclosure further contemplates compositions and methods that involve inhibition of artemin and other molecules in the artemin pathway. Inhibitors of the artemin pathway can be reversible or irreversible. They can be proteins, including antibodies, or nucleic acids, or small molecules. The inhibitors of the artemin pathway contemplated by the present disclosure can target artemin itself, its receptors, or its co-receptors. For example, the inhibitors can target RET or GFR-alpha 3 (or “GFRα3”). The present disclosure contemplates the administration of LOXO-292, which is a small molecule inhibitor of RET, to a subject in need thereof. The inhibitors of the artemin pathway can also be compositions targeting cells that secrete artemin—for example, antibodies that target tumor-induced CD45-Ter119+CD71+ erythroid progenitor cells (EPCs), also known as Ter-cells. The inhibitors of the artemin pathway can also be gene editing compositions. For example, the inhibitors can be a CRISPR/Cas9 composition, or series of compositions, that knocks out RET and/or GFRα3. This disclosure contemplates use of inhibitors of the artemin pathway that perform inhibition of the pathway ex vivo or in vivo. In vivo mechanisms of achieving a CRISPR/Cas9 knock out of RET and/or GFRα3 can include viral and/or non-viral delivery mechanisms. Examples of viral delivery mechanisms include adeno-associated viral vectors (AAV) and lentiviral vectors. Examples of non-viral delivery mechanisms include cell-penetrating peptides (CPPs), lipid nanoparticles (LNPs), polymer-based particles, and inorganic encapsulating materials, such as zeolitic imidazole frameworks (ZIFs) or colloidal gold nanoparticles. In some embodiments, the CRISPR/CAS9 components are targeted to tumor cells. Targeting can be achieved by intratumoral delivery and/or molecular targeting. In some embodiments, the knockout of RET and/or GFRα3 may be partial/incomplete (i.e., not occurring in all cells in situ); radiosensitization and better response to checkpoint inhibitors are still anticipated in attenuating the pathway.
[0140] In some embodiments of the present disclosure, the inhibitor of the artemin pathway is an antibody or antigen-binding fragment thereof that specifically binds one or more molecules in the artemin pathway to interrupt its function. In other embodiments, the inhibitor of the artemin pathway is a small molecule. In other embodiments, the inhibitor of the artemin pathway is a gene editing composition. In some embodiments, the gene editing composition comprises CRISPR/Cas9. In some embodiments, the gene editing composition inhibits RET. In some embodiments, the inhibitor of the artemin pathway inhibits artemin. In some embodiments, the artemin inhibitor is an anti-artemin antibody or an antigen-binding fragment thereof. In some embodiments, the inhibitor of the artemin pathway inhibits GFRα3. In some embodiments, the inhibitor of the artemin pathway inhibits RET. In some embodiments, the inhibitor of RET is a multikinase inhibitor (MKI). In some embodiments, the inhibitor of RET is specific to mutant RET. In some embodiments, the inhibitor of RET targets oncogenic RET. In other embodiments, the inhibitor of RET targets wild-type RET. In some embodiments, the RET inhibitor is vandetanib, cabozantinib, RXDX-105, lenvatinib, sorafenib, sunitinib, dovitinib, alectinib, ponatinib, regorafenib, nintedanib, apatinib, motesanib, BLU-667, or LOXO-292. In some embodiments, the RET inhibitor is LOXO-292. Some embodiments of the present disclosure comprise more than one inhibitor of the artemin pathway. For example, some embodiments include both a small molecule inhibitor of the pathway and an anti-artemin antibody. The cancer treated by the embodiments in the present disclosure can be any cancer. In some embodiments, the cancer is melanoma, cervical cancer, breast cancer, ovarian cancer, prostate cancer, testicular cancer, urothelial carcinoma, bladder cancer, non-small cell lung cancer, small cell lung cancer, sarcoma, colorectal adenocarcinoma, gastrointestinal stromal tumors, gastroesophageal carcinoma, colorectal cancer, pancreatic cancer, kidney cancer, hepatocellular cancer, malignant mesothelioma, leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, transitional cell carcinoma, neuroblastoma, plasma cell neoplasms, Wilm's tumor, glioblastoma, retinoblastoma, or hepatocellular carcinoma. The cancer can be refractive to other treatments, such as chemotherapy, radiotherapy, and/or checkpoint inhibitors.
Therapeutic Compositions
[0141] The therapeutic compositions of the present disclosure can take a form suitable for virtually any mode of administration, including, for example, injection, transdermal, oral, topical, ocular, buccal, systemic, nasal, rectal, vaginal, etc., or a form suitable for administration by inhalation or insufflation. Compositions that can be delivered intravenously and/or intratumorally are also contemplated herein. In some embodiments of the present disclosure, a checkpoint inhibitor is administered intravenously. In some embodiments, the inhibitor of the artemin pathway is administered intratumorally.
[0142] Compositions containing active pharmaceutical ingredients may also contain one or more inactive pharmaceutical excipients and other substances. The therapeutic compositions described herein can include a pharmaceutically acceptable carrier, solvent, adjuvant, diluent, or combination thereof. These ingredients can include, but are not limited to, lubricants, solubilizers, alcohols, binders, controlled release polymers, enteric polymers, disintegrants, colorants, flavorants, sweeteners, antioxidants, preservatives, pigments, additives, fillers, suspension agents, surfactants (for example, anionic, cationic, amphoteric and nonionic), and the like. Various FDA-approved topical inactive ingredients are found at the FDA's “The Inactive Ingredients Database” that contains inactive ingredients specifically intended as such by the manufacturer, whereby inactive ingredients can also be considered active ingredients under certain circumstances, according to the definition of an active ingredient given in 21 CFR 210.3(b)(7). Alcohol is a good example of an ingredient that may be considered either active or inactive depending on the product formulation.
[0143] The therapeutic compositions described herein, or pharmaceutical compositions thereof, will generally be used in an amount effective to achieve the intended result (“effective dose” or “effective amount”), for example, in an amount effective to treat or prevent the particular disease being treated (e.g., a therapeutically effective amount) and thereby provide a therapeutic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated and/or eradication or amelioration of one or more of the symptoms associated with the underlying disorder such that the patient reports an improvement in feeling or condition, notwithstanding that the patient may still be afflicted with the underlying disorder. Therapeutic benefit also generally can include halting or slowing the progression of the disease.
[0144] The amount of therapeutic composition administered can be based upon a variety of factors, including, for example, the particular condition being treated, the mode of administration, whether the desired benefit is prophylactic and/or therapeutic, the severity of the condition being treated and the age and weight of the patient, the genetic profile of the patient, and/or the bioavailability of the particular therapeutic composition, etc.
[0145] Determination of an effective dosage of compound(s) for a particular use and mode of administration is well within the capabilities of those skilled in the art. Effective dosages can be estimated initially from in vitro activity and metabolism assays. For example, an initial dosage of a therapeutic composition for use in animals can be formulated to achieve a circulating blood or serum concentration of the therapeutic composition that is at or above an EC.sub.50 of the particular therapeutic composition as measured in an in vitro assay. Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular therapeutic composition via the desired route of administration is well within the capabilities of skilled artisans. Initial dosages of therapeutic compositions can also be estimated from in vivo data, such as animal models. Animal models useful for testing the efficacy of the therapeutic composition to treat or prevent the various diseases described above are well known in the art. Animal models suitable for testing the bioavailability of the therapeutic composition are also well known. Skilled artisans can routinely adapt such information to determine dosages of particular therapeutic compositions suitable for human administration.
[0146] Dosage amounts can be in the range of from about 0.0001 mg/kg/day, 0.001 mg/kg/day, or 0.01 mg/kg/day to about 100 mg/kg/day, but can be higher or lower, depending upon, among other factors, the activity of the therapeutic agent, the bioavailability of the therapeutic composition, other pharmacokinetic properties, the mode of administration and various other factors, including particular diseases being treated, the site of the disease within the body, the severity of the disease, the genetic profile, age, health, sex, diet, and/or weight of the subject. Dosage amount and interval can be adjusted individually to provide levels of the therapeutic compositions sufficient to maintain therapeutic and/or prophylactic effects. For example, the therapeutic compositions can be administered once per week, several times per week (e.g., every other day), once per day or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated and the judgment of the prescribing physician. In cases of local administration or selective uptake, such as local topical administration, the effective local concentration of therapeutic compositions may not be related to plasma concentration. Skilled artisans will be able to optimize effective dosages without undue experimentation.
[0147] The present disclosure contemplates different modes of administration, dosage amounts, intervals, and treatment durations. These variables can be interdependent, and the treatment regimen will depend on the judgment of the prescribing physician. In some embodiments, the mode of administration for one or more of the compositions is intratumoral injection (“intratumoral”). In some embodiments, the mode of administration for one or more of the compositions is oral. In some embodiments, the mode of administration for one or more of the compositions is intravenous. In some embodiments, the interval of administration (“interval”) for one or more of the compositions is every other day. In some embodiments, the interval of administration for one or more of the compositions is every day, or daily. In some embodiments, the treatment duration lasts until cancer remission is achieved. In some embodiments, the treatment duration is about 14 days. In some embodiments, the treatment duration is about 14 days following IR. In some embodiments, the interval of administration and treatment duration for one or more of the compositions is administration in a single, one-time dose.
[0148] In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of the inhibitor of artemin pathway is intratumoral, about 10 mg/kg body weight, every other day for about 14 days following IR. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of an anti-artemin antibody is intratumoral, about 10 mg/kg body weight, every other day for about 14 days after IR. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of an anti-GFRα3 antibody (see e.g., U.S. Patent Application No. 2018/0340029A1, which is incorporated by reference) is intravenous, about 0.01-20 mg/kg body weight, administered in a single dose. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of an anti-GFRα3 antibody is intravenous, about 0.02-7 mg/kg body weight, administered in a single dose. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of an anti-GFRα3 antibody is intravenous, about 0.03-5 mg/kg body weight, administered in a single dose. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of an anti-GFRα3 antibody is intravenous, about 0.05-3 mg/kg body weight, administered in a single dose. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of the RET inhibitor is oral, about 5 mg/kg body weight, every day for about 10-20 days. In some embodiments, the mode of administration, dosage amount, interval, and treatment duration of LOXO-292 is oral, about 5 mg/kg, every day for about 10-20 days. The checkpoint inhibitors and inhibitors of the artemin pathway of the present disclosure can be in a single composition or can be in separate compositions. In some embodiments, the checkpoint inhibitor and the inhibitor of the artemin pathway are in the same composition. If the inhibitors are in separate compositions, they can be administered simultaneously or with a delay between administrations. In some embodiments, second or subsequent inhibitors can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or 60 minutes or longer (or any range derivable therein) after the first inhibitor is administered. In some embodiments, second or subsequent inhibitors can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 24 hours or longer (or any range derivable therein) after the first inhibitor is administered. In some embodiments, subsequent inhibitors can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 days or longer (or any range derivable therein) after the first inhibitor is administered. In some embodiments, subsequent inhibitors can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 weeks or longer (or any range derivable therein) after the first inhibitor is administered. In some embodiments, subsequent inhibitors can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years or longer (or any range derivable therein) after the first inhibitor is administered.
Methods
[0149] Methods of treating diseases are contemplated herein that utilize the therapeutic compositions and pharmaceutical compositions described herein.
[0150] The methods of the present disclosure contemplate a variety of treatment regimens. The treatment regimens contemplated can include administration of one or more radiotherapy, checkpoint inhibitor, and/or inhibitor of the artemin pathway. Each of the radiotherapy or radiotherapies, checkpoint inhibitor(s), and inhibitor(s) of the artemin pathway can be administered one or more times. In some embodiments, the compositions are administered 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times or more.
[0151] The present disclosure contemplates sequential treatment regimens that in involve more than one therapy. In some embodiments, the treatment regimen involves one or more of radiotherapy, checkpoint inhibitor(s), and inhibitor(s) of the artemin pathway being administered “subsequent to” one or more of radiotherapy, checkpoint inhibitor(s), and inhibitor(s) of the artemin pathway. In some embodiments, “subsequent to” indicates that the subsequent treatment or group of treatments is administered subsequent to the initiation or start of the earlier treatment. In some embodiments, “subsequent to” indicates that the subsequent treatment or group of treatments is administered subsequent to the completion or final administration of the earlier treatment.
[0152] In some embodiments, the regimen comprises introducing radiotherapy to the subject before the checkpoint inhibitor and/or the inhibitor of the artemin pathway. In some embodiments of the present disclosure, the inhibitor of the artemin pathway is administered before checkpoint inhibitor(s) and/or radiotherapy. In some embodiments of the present disclosure, the checkpoint inhibitor and/or the inhibitor of the artemin pathway are administered subsequent to the radiotherapy. In some embodiments, the checkpoint inhibitor and/or the inhibitor of the artemin pathway are administered about 3-10 days subsequent to the start of the administration of the radiotherapy. In some embodiments, the inhibitor of the artemin pathway is administered subsequent to the checkpoint inhibitor and/or the radiotherapy. In some embodiments, the inhibitor of the artemin pathway is administered no more than about 7 days subsequent to the checkpoint inhibitor and/or the radiotherapy. Regimens in which two or more of radiotherapy, a checkpoint inhibitor, and an inhibitor of the artemin pathway administered simultaneously are also contemplated. In some embodiments, the inhibitor of the artemin pathway is administered simultaneously with the checkpoint inhibitor and/or the radiotherapy.
[0153] In some embodiments, the checkpoint inhibitor is administered to the subject at more than one time. In some embodiments, the checkpoint inhibitor is administered every other week. In some embodiments, the checkpoint inhibitor is administered every other week simultaneously with the radiotherapy. In some embodiments, the checkpoint inhibitor is administered every other week subsequent to the radiotherapy. In some embodiments, the inhibitor of the artemin pathway is administered to the subject at more than one time. In some embodiments, the inhibitor of the artemin pathway is administered every other day. In some embodiments, the inhibitor of the artemin pathway is administered every other day for about 14 days simultaneously with and subsequent to radiotherapy. In some embodiments, the inhibitor of the artemin pathway is administered every day. In some embodiments, the inhibitor of the artemin pathway is administered every day until remission is achieved.
[0154] The methods of the present disclosure can be used in combination with additional, distinct cancer therapies. In some embodiments, a distinct cancer therapy can include surgery, radiotherapy, chemotherapy, toxin therapy, immunotherapy, cryotherapy, and/or gene therapy. The methods of the present disclosure contemplate a variety of subject responses and endpoints for treating cancer. In some embodiments of the present disclosure, treating cancer is further defined as reducing the size of a tumor or inhibiting growth of a tumor. In some embodiments, the subject response can include reduced levels of artemin protein in tumor, spleen, and/or serum or artemin mRNA in tumor and/or spleen. In some embodiments, the subject response can include a reduced number of nodules. In some embodiments, the subject response can include a reduced number of Ter-cells in the spleen, and/or a reduced number of Ter-cells in circulation. In some embodiments, the subject response can include reduced expression of GFRα3 on tumor cells.
Kits
[0155] As used herein, a kit may be a packaged collection of related materials, including, for example, a plurality of packages including a single and/or a plurality of dosage forms along with instructions for use.
[0156] In some embodiments, a kit includes one or more compositions in a dosage form and instructions for administering the compositions intravenously or intratumorally, or as otherwise disclosed herein. In some embodiments, the kit includes compositions comprising one or more of a checkpoint inhibitor and an inhibitor of the artemin pathway.
EXAMPLES
[0157] The Examples that follow are illustrative of specific embodiments of the disclosure, and various uses thereof. They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any way.
Example 1: Study of Artemin Pathway Modulation and Cancer Therapy
Summary
[0158] Tumor-induced CD45-Ter119+CD71+ erythroid progenitor cells (EPCs), termed “Ter-cells,” promote tumor progression by secreting artemin, a neurotropic peptide that activates RET signaling. This example demonstrates that both local tumor ionizing radiation (IR) and anti-PD-L1 treatment decreased tumor-induced Ter-cell abundance and artemin secretion outside the irradiation field and in an interferon (IFN) and CD8+ T cell-dependent manner. Recombinant erythropoietin (EPO) treatment, which was used for anemia in cancer patients who were subsequently reported to have poor outcomes of radiotherapy, promoted resistance to radiotherapy or anti-PD-L1 therapies and restored Ter-cell and artemin levels. Blockade of artemin, potential artemin signaling partners, or depletion of Ter-cells augmented the anti-tumor effects of both IR and anti-PD-L1 therapies. Analysis of samples from patients who received radio-immunotherapy demonstrated that IR-mediated reduction of Ter-cells, artemin, and one of the artemin receptors were each associated with tumor regression. Patients with melanoma who received immunotherapy had favorable outcomes associated with decreased artemin receptor levels. These findings not only demonstrate a novel out-of-field, or “abscopal” mechanism mediated by adaptive immunity that governs radiocurability, but also identify multiple targets that can improve outcomes following radiotherapy and immunotherapy.
Introduction
[0159] Increasing interest has focused on cancer neuroscience and neurotropic ligands that support malignant progression. A population of erythroid lineage cells marked by CD45−CD71+Ter119+, termed “Ter-cells,” represents the majority of splenocytes in animals with advanced solid tumors and is associated with tumor progression in human hepatocellular carcinoma.
[0160] Tumor-induced Ter-cells secrete artemin, a neurotropic factor that belongs to the glial cell line-derived neurotropic factor (GDNF) family of ligands (GFL) whose other members include: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), and persephin (PSPN). These GFLs share some similar functions and signaling pathways, through receptors GFRα1-4. The ARTN homodimer binds to GFRα3-receptor as its exclusive ligand. However, in some tissues, a highly promiscuous GFRα1 receptor, which mainly associates with GDNF, is also activated by ARTN and NRTN. GFL-GFRα complexes activate the downstream proto-oncogenic trans-membrane RET (REarranged during Transfection) receptor tyrosine kinase by dimerization and phosphorylation. Following phosphorylation, RET activates multiple signaling pathways including RAS/ERK1/2, NGF/TRKA, and PI3K/AKT, pathways that mediate survival, differentiation, and proliferation of cancer cells. Under certain physiological conditions; however, RET-independent GDNF signaling has also been reported, including via neural cell adhesion molecules (NCAMs) or integrins. Recent studies have supported artemin-induced GFRα3-RET activation as a therapeutic target due to its role in promoting cell survival, tumor proliferation, metastasis, and resistance to cytotoxic therapy through possible activation of BCL2 and Twist1 pathways.
[0161] Radiation therapy is widely used in the treatment of diverse types of cancers. Recent investigations have demonstrated the importance of the immune system in mediating the anti-tumor effects of radiotherapy. Ionizing radiation (IR) mediates anti-tumor immunity through maturation of dendritic cells (DCs) and activation of T cells by enhancing DNA-sensing mediated type I/II IFN production. Investigations of immune checkpoint inhibitors, such as PD-1 inhibitors have primarily focused on enhancing T-cell function in part through increased type II IFN production. The promise of immunotherapies and combined treatments with radiotherapy warrant further research to understand the interactions between these therapies and tumor-promoting pathways.
[0162] Erythropoietin (EPO) was used in clinical trials in cancer patients receiving radiotherapy to increase red cell mass to overcome hypoxia, which is a known limiting factor in radiotherapy. Local tumor control (radio-resistance) and survival rates were not improved, however, and in some instances were worse than the control arm (not receiving EPO). These trials suggested that red blood precursor cell proliferation might be involved; and therefore, the interaction of Ter-cells, radiotherapy, and tumors was investigated. Here, it is shown that IR and anti-PD-L1 immunotherapy decreased Ter-cells and artemin levels in both pre-clinical tumor models and patients. Conversely, Ter-cells, artemin, and EPO attenuated the efficacies of both therapies. It was further determined that targeting the Ter-artemin axis enhanced the efficacy of IR and immunotherapy in model systems and that Ter-cell, artemin and artemin receptor levels are associated with outcomes in patients receiving radiotherapy, radio-immunotherapy, and immunotherapy.
Methods
[0163] Mice. C57BL/6J wild type (WT), Ifnar1 knockout (IFNAR KO), Rag1 knockout (Rag KO), Ifng knockout (IFN-γ KO), and Ifngr1 knockout (IFNGR KO) mice were purchased from Jackson Laboratory. PD-L1 KO mice were kindly provided by L. Chen of Yale University, New Haven. All experimental groups included randomly chosen female littermates approximately 8 weeks old and of the same strain. All mice were maintained and used in accordance with guidelines established by the Institute of Animal Care and Use Committee of The University of Chicago.
[0164] Cells and reagents. MC38 and B16-SIY tumor cell lines were kindly provided by Dr. Xuanming Yang of The University of Chicago and grown in DMEM medium containing 10% FBS, at 37° C. and 5% CO.sub.2. LLC cells were obtained from ATCC (CRL-1642). CRISPR/Cas9 was used to generate RET stable knockout MC38 cell lines, and a retrovirus overexpression system was used to generate OTI-zsGreen expressing MC38 cell line. Recombinant mouse artemin (1085-AR), EPO (959-ME), and mouse artemin antibody (AF1085) were purchased from R&D Systems. Recombinant mouse IFN-γ (315-05) was purchased from Peprotech. Depleting/blocking antibodies against PD-L1 (BE0101), CD8α (BE0004-1), IFNAR-1 (BE0241), CD4 (BP0003-1), Ter119 (BE0183), and IFN-γ (BE0055) were purchased from BioXcell. Anti-artemin was purchased from R&D (AF1085). PB-anti-CD45 (103126), FITC-anti-CD45 (103108), PE/CY7-anti-CD71 (113812), PE-anti-CD71 (113808), APC-anti-Ter119 (116212), PE-anti-H-2Kb (116507), PE-anti-CD4 (116005), and APC/CY7-anti-CD8 (100714) were purchased from Biolegend. AF488-anti-GFRα3 (SC-398618 AF488) was purchased from SantaCruz. LOXO-292 (C-1911) was purchased from Chemgood. CD8 T cell selection kit (18953) was purchased from Stemcell, and CD45 selection kit (8802-6865-74) was purchased from Thermo Fisher Scientific®.
[0165] Tumor models and treatments. 1×10.sup.6 MC38, LLC, or B16-SIY tumor cells were subcutaneously injected into the flank of mice. On day 10 after tumor inoculation, tumors were either irradiated with one dose of 20 Gy or mice received sham treatment. For anti-PD-L1 treatment experiments, 200 μg anti-PD-L1 (10F.9G2) or isotype control was given by i.p. every three days for a total of four times starting on day 10 after tumor inoculation. For type I IFN blockade experiments, 200 μg anti-IFNAR1 were intratumorally injected on days 0 and 2 after irradiation. For CD4 or CD8 T cell depletion experiments, 200 μg anti-CD4 or anti-CD8 mAb was delivered four times by i.p. injection every 3 days starting 1 day before therapies. Artemin-neutralizing antibody was delivered i.t. at 1 μg/mouse starting on day of irradiation, every 2 days for 7 doses. For Ter-cell depletion, anti-ter119 was injected i.p. at 20 μg/mouse every 2 days for 4 doses. For Ter-cell or artemin treatment groups, mice were administered 1×10.sup.7 purified Ter cells i.v. every other day for a total of three doses, or mice were treated with 0.5 μg/mouse artemin i.t. every other day starting on day 0 of therapies throughout the studies. For EPO treatment groups, mice were treated with 20 U/mouse EPO i.v. every other day throughout the studies, starting on day 0 of the therapies. IFN-γ was administered through intrasplenic injection on day 15 post tumor implantation at 2 μg/mouse for 1 dose. LOXO-292 was administered by oral gavaging at 100 μg/mouse/day throughout the entire studies, starting on day 0 of the therapies. Spleens were harvested on day 20 or at indicated times post-inoculation for analysis of spleen size or splenic cells. Tumor size was monitored and calculated with the formula for area (length×width).
[0166] Flow Cytometry. Tumor and lung tissues were cut into small pieces and digested by 1 mg/mL collagenase IV (Sigma) and 0.2 mg/mL DNase I (Sigma) for 1 hr at 37° C. Spleens, lymph nodes, and bone marrow were ground prior to analysis. Single cell suspensions were blocked with anti-FcR (2.4G2, BioXcell) and then stained with fluorescence-labeled antibodies. Flow cytometry was performed on BD LSR Fortessa at The University of Chicago core facility and data were analyzed with FlowJo software.
[0167] ELISA. Tumor tissues were homogenized in PBS with protease inhibitor followed by the addition of Triton X-100. Serum was collected on day 20 post-tumor inoculation or at indicated times. The concentration of artemin or TGF-β was measured with artemin ELISA Kit (E03A0032 for mouse and E01A0032 for human, BlueGene Biotechnology), or TGF-β1 Mouse ELISA Kit (BMS608-4, Invitrogen).
[0168] Western Blot Analysis. Whole-cell protein was extracted with Triton-X100 buffer (150 mM sodium chloride, 50 mM Tris, 1% Triton-X100; pH 8.0) with proteinase inhibitors (Thermo Scientific®). Immuno-blotting analyses were performed as previously described (Hou, Y., Liang, H., Rao, E., Zheng, W., Huang, X., Deng, L., Zhang, Y., Yu, X., Xu, M., Mauceri, H., et al. (2018). Non-canonical NF-kappaB Antagonizes STING Sensor-Mediated DNA Sensing in Radiotherapy. Immunity 49, 490-503 e494). The amount of loaded protein was normalized to GAPDH (60004-1-Ig, Proteintech Group) or actin (8226, Abcam).
[0169] Real-time PCR assay. mRNA from tumor cells or splenocytes was isolated using TRIzol according to the manufacturer's instructions (Invitrogen). cDNA was synthesized from pd(N)6-primed mRNA reverse transcription using M-MLV superscript reverse transcriptase. Real-time PCR kits (SYBR Premix Ex Taq™, DRR041A) were purchased from Takara Bio Inc. PCR was performed using a CFX96 (Bio-Rad). mRNA specific for the housekeeping gene GAPDH was measured and used as an internal control. The primers for artemin were 5′-TAC TGC ATT GTC CCA CTG CCT CC-3′ (SEQ ID NO: 1) for the upstream primer (UP) and 5′-TCG CAG GGT TCT TTC GCT GCA CA-3′ (SEQ ID NO: 2) for the downstream primer (DP); GAPDH: 5′-AGA CCA GCC TGA GCA AAA GA-3′ (SEQ ID NO: 3) for UP and 5′-CTA GGC TGG AGT GCA GTG GT-3′ (SEQ ID NO: 4) for DP.
[0170] Statistical analysis. Analyses were performed using GraphPad Prism software 6. Data were analyzed by one-way ANOVA with Multiple Comparison Test or Student's t-test. P values <0.05 were considered statistically significant.
Results
[0171] Local irradiation decreases tumor-induced Ter-cell accumulation in the murine spleen. The observations that tumor-induced erythroid progenitor cells (EPCs) correlate with a poor prognosis suggest that tumor progression might be inhibited by targeting EPCs or their secretable products. It was observed initially that tumor-bearing mice developed splenomegaly, and that spleen size normalized following irradiation of flank tumors (
[0172] To characterize the process by which IR modulates Ter-cell abundance in the spleen, the kinetics of IR-mediated Ter-cell reduction was assessed, and it was determined that the number of Ter-cells began decreasing 7 days following IR, reaching complete normalization to baseline size at day 10 (
[0173] Ter-cells promote tumor progression by secreting artemin, an oncogenic factor associated with chemo- and radio-resistance. Artemin expression following IR was examined, and it was determined that IR decreased both artemin mRNA expression in the mouse spleen and protein levels in the serum (
[0174] IFNs and T cells are required for the effect of irradiation on Ter-cells. The mechanism by which local tumor irradiation decreased Ter-cell accumulation in the mouse spleen was explored. Although it has been reported that tumor-derived TGF-β mediates the generation of Ter-cells in the spleen, it was determined that irradiation of local tumors did not decrease TGF-β levels in the serum (
[0175] Type I IFNs promote T cell responses by both enhancing the function of antigen presenting cells (APCs) to process and present antigens and promoting the survival of T cells. Given that T cells are in part responsible for the systemic effects of IR and are abundant in the spleen, the role of T cells in Ter-cell reduction was examined. IR did not decrease Ter-cell abundance in Rag1 KO mice, in which T cells are deficient (
[0176] Having established that CD8.sup.+ T cells play a role in the IR-induced reduction of Ter-cells, factors produced by these CD8.sup.+ cells were investigated. It was found that IR increased IFN-γ production in CD8.sup.+ T cells in the spleen (
[0177] To further assess the role of IFN-γ, tumor-bearing mice were treated with exogenous IFN-γ through intra-splenic injection, and it was determined that IFN-γ increased apoptosis of Ter-cells 3 days after treatment (
[0178] PD-L1 blockade reduces tumor-induced Ter-cell accumulation in a CD8.sup.+ T cell- and IFN-γ dependent manner. Immunotherapies, including PD-L1/PD-1 blockade, are promising treatments for many cancers. PD-L1/PD-1 blockade enhances the immune functions of CD8.sup.+ T cells, including IFN-γ production and cytotoxic activity. It was hypothesized that PD-L1 blockade might control tumor-induced splenic Ter-cell accumulation by a similar mechanism as radiation which is reported to induce T cell priming. Tumor-bearing mice were treated with either intraperitoneal administration of PD-L1 blocking antibody (αPD-L1) or IR and found that each treatment decreased tumor-associated splenomegaly (
[0179] Ter-cells and artemin impair the therapeutic effect of radio- and immunotherapy. Next, the role of Ter-cells and artemin on the therapeutic effects of IR and PD-L1 blockade was investigated. Using the colony formation assay, it was found that Ter-cells and artemin increased the radio-resistance of mouse MC38 tumor cells (
[0180] Recombinant human erythropoietin (rhEPO) has been used for the treatment of anemia in cancer patients during chemotherapy or radiotherapy. Several clinical trials have reported on the detrimental effects of rhEPO on survival benefit in cancer patients treated by RT via unknown mechanisms. To determine whether EPO impairs the effect of radiotherapy indirectly by enhancing Ter-cell production and artemin secretion, it was first determined whether rmEPO increased Ter-cells in mouse spleen. The results indicate that administration of EPO through i.v. and s.c. routes increased spleen size and Ter-cell accumulation in naive mice (
[0181] Disrupting the Ter-cell/artemin axis promotes the therapeutic effect of both RT and immunotherapy. Ter-cells impair the therapeutic effects of IR and PD-L1 blockade through artemin secretion (
[0182] Next, whether blocking artemin enhances the anti-tumor treatment response was investigated. Intratumoral administration of artemin neutralizing antibody promoted the effect of IR and PD-L1 blockade (
[0183] Radiation and immunotherapy responders exhibit treatment-induced Ter-cell reduction. Since artemin-secreting splenic Ter-cells are enriched in some cancer patients, and artemin levels correlated with poor prognosis in several different types of cancer patients, it was investigated whether differential responses to oncologic therapies were related to Ter-cell and artemin levels in cancer patients. Expression of one artemin receptor, GFRα3, was previously shown to be induced by artemin and correlated with serum artemin levels in cancer patients. Therefore, expression levels of GFRα3 were examined in a variety of human cancers from The Cancer Genome Atlas (TCGA), and it was found that GFRα3 was highly expressed in non-small cell lung cancer (NSCLC), colorectal cancer, and melanoma. In patients with NSCLC treated with chemoradiation therapy, it was found that the level of post-treatment circulating artemin protein decreased in those patients who had no evidence of disease recurrence following treatment, whereas artemin levels increased or were unchanged in those patients who developed disease recurrence (
Conclusions
[0184] Findings. Local irradiation decreases tumor-induced Ter-cell accumulation in mouse spleen. IFNs and T cells are required for the effect of irradiation on Ter-cells. PD-L1 blockade reduces tumor-induced Ter-cell accumulation in a CD8+ T cell and IFN-γ-dependent manner. PD-L1 blockade reduces tumor-induced Ter-cells accumulation in spleen.
[0185] Ter-cells and artemin curtail the therapeutic effects of both RT and immunotherapy. Disrupting the Ter-artemin axis restored and enhanced the efficacy of both radiotherapy and anti-PD-L1 therapy. Suppression of the Ter/artemin axis is associated with response to RT and immune checkpoint blockade in cancer patients. GFRα3 knock down and RET knock out in tumor cells results in better tumor control by either IR or anti-PD-L1 treatment. RT and PD-L1 blockade reduces the expression of GFRα3 on tumor cells in vivo.
[0186] Further conclusions. These experiments demonstrated that radiotherapy and PD-L1 blockade reduced tumor-induced Ter-cells and artemin (
[0187] These results demonstrate that IFN-γ is a necessary factor mediating Ter-cell death for the following reasons: 1) IR induced higher IFN-γ expression in splenic T cells; 2) IR did not induce high levels of apoptosis of Ter-cells in IFN-γ deficient mice compared with that of WT mice; and 3) intra-splenic injection of IFN-γ led to increased apoptosis of Ter-cells in the spleen of WT tumor-bearing mice. Increased abundance of T cells was also observed, as well as higher levels of MHC class I molecules on Ter-cells in spleens treated with IFN-γ. The mechanism may be direct induction of Ter-cell apoptosis and/or MHC I directed killing by T cells. Proinflammatory infections, including oncolytic virus therapy, which are able to increase IFN-γ production in spleen, are likely to inhibit Ter-cell accumulation and subsequently benefit tumor control. Increased ROS activity in CD45.sup.+Ter119.sup.+CD71.sup.+ EPCs has been described compared with CD45.sup.−Ter119.sup.+CD71.sup.+ Ter-cells, and it was reported that only the CD45.sup.− EPCs exhibit overexpression of genes in the ROS pathway. In comparison, CD45.sup.− Ter-cells have very low ROS levels; therefore, it is unlikely that ROS mediate Ter-cell apoptosis in these studies.
[0188] Although it was found that in mouse models using LLC and MC38 tumors, the spleen was the major (but not the exclusive) organ contributing to tumor-induced Ter-cell accumulation, it should be noted that the spleen is not a primary hematopoietic organ in humans except in certain disease states or stress conditions. For example, it was found that in mice, tumors increased Ter-cells in the liver, which decreased in response to IR and PD-L1 blockade, whereas bone marrow-derived Ter-cells showed no change in response to tumor inoculation or treatments (
[0189] Concerning the main contributor of artemin in tumor and blood, these findings mirrored those of other studies: artemin protein levels in the serum were significantly reduced after splenectomy in tumor-bearing mice. Other studies have found that in mice bearing artemin-knock-out tumors, splenic Ter-cell induction, serum artemin, and HCC growth were not significantly changed at the protein level, as compared with WT tumor controls. These results suggest tumor cells, which do express artemin, are not the main source of artemin in the serum. When tumors were irradiated or treated with anti-PD-L1, artemin protein levels in serum and total tumor homogenates decreased dramatically along with a reduction of Ter-cells, despite an artemin RNA increase in tumor cells. The results also indicate that artemin from the Ter-cells are the main contributor to artemin production in the serum and tumor microenvironment of tumor-bearing mice.
[0190] These findings have immediate clinical relevance. Here, it is reported that EPO administration increased Ter-cells in the spleen and liver of naive mice and abrogated IR- and anti-PD-L1-mediated reduction of Ter-cells and artemin, thereby blocking anti-tumor responses. Depletion of Ter-cells abrogated the adverse effects of EPO on the therapeutic efficacy of both IR and anti-PD-L1. Taken in the context of the other results, these findings suggest that unfavorable clinical outcomes following the administration of EPO and radiotherapy may be related to increases in Ter-cell abundance in cancer patients. Furthermore, EPO may exert indirect effects on T-cell functions via Ter-cells and their artemin production, as shown in
[0191] These results identify multiple strategies for targeting the Ter-cell/artemin axis to potentially improve the efficacy of both radiotherapy and immunotherapy, including Ter-cell depletion, artemin neutralization, and RET inhibition. An immediate potential translation is the use of selective RET inhibitors, including LOXO-292 and BLU-677, that have produced improved outcomes for patients with RET fusion-positive cancers. It was found that LOXO-292 promoted the effects of IR and PD-L1 blockade on both local tumor and spontaneous metastasis in a murine LLC model. Therefore, RET inhibitors might work as sensitizers to improve the efficacy of radiotherapy and immunotherapy by inhibiting RET tyrosine kinase activity driven by either gain-function mutations or a ligand of artemin secreted by tumor-induced Ter-cells.
Example 2: Study of Artemin Pathway Modulation and Immune Cells
Summary
[0192] The artemin pathway has a significant effect on immune cells. Artemin reduces CD8 T cell effector function, increases the Treg percentage in CD4 T cells, induces expression of PD-L1 on DCs and MDSCs, and induces GFRα3 expression on NK cells.
Introduction
[0193] In light of the role of artemin in cancer treatment, further exploration of the effects of artemin pathway modulation on immune cells, including T cells, was warranted. The studies performed helped to elucidate the role played by artemin in creating an environment that suppresses T cells. Furthermore, the results demonstrate that the artemin pathway acts through multiple downstream binding partners.
Methods
[0194] In vitro testing: CD8 T cell treatment with artemin. CD8 T cells were isolated from spleens of naïve mice. CD8 T cells were cultured with T cell activation beads for 3 days and labeled with DNA dye cellTrace violet, followed by co-culturing with 150 ng/mL recombinant artemin for 24 hours. T cells were then washed and stimulated by stimulation cocktail and protein transport cocktail for 6 hours before being subjected to intracellular antibody staining.
[0195] In vivo testing: MC38 murine colon cancer treatment with artemin. Established MC3 8 murine colon cancer tumors were treated with artemin by intra-tumoral injection. Tumors were digested into single cell suspension, stimulated and stained with intracellular antibodies. Cells were analyzed by flow cytometry.
[0196] Quantitative PCR (qPCR). Expression of possible artemin receptors GFRα1 (primers: SEQ ID NOs: 5, 6), GFRα3 (primers: SEQ ID NOs: 7, 8), Syndecan 3 (primers: SEQ ID NOs: 9, 10), NCAM (primers: SEQ ID Nos: 11, 12), and RET (SEQ ID Nos: 13, 14) was analyzed by qPCR in CD8 T cells and bone marrow derived MDSCs during co-culture with artemin.
[0197] Radiation (IR) treatment analysis. We treated established Lewis lung carcinoma (LLC) tumors with control, artemin, IR, and artemin+IR (20 Gy IR). Flow cytometry with staining of GFRα1, GFRα3 and NCAM receptors was performed.
Results
[0198] Artemin directly inhibits T cell proliferation and attenuates T cell effector function in vitro at 200 ng/mL. Artemin treatment at 200 ng/mL resulted in reduced CD8 T cell proliferation (
[0199] Artemin affects T cell function in vivo. Artemin administration did not alter frequency of total CD8 T cell among CD45+ cells (
[0200] Artemin does not affect exhaustion status of intratumoral T cells. Artemin treatment did not change the expression of exhaustion markers PD-1, LAG3, and T cell immunoglobulin and mucin domain-containing protein 3 (TIM3) (
[0201] Artemin increases Treg percentage in CD4 T cells. While CD4 T helper cell numbers were not significantly changed, Treg percentage in CD4 T cells was significantly increased. (
[0202] Artemin can induce expression of PD-L1 on some immune cell types. Artemin induced PD-L1 expression on dendritic cells (CD11C+) and MDSCs (CD11b+Ly6C+) (
[0203] Artemin can induce expression of multiple receptors. Induction of GFRα3 was observed in CD8 T cells, and induction of GFRα1 was observed in MDSC cells (
Conclusions
[0204] Findings. Artemin directly attenuates CD8 T cell proliferation and effector function in vitro and in vivo. Furthermore, artemin upregulates PD-L1 expression in DCs and MDSCs in MC38 tumors. Artemin upregulates GFRα3 in CD8 T cells and GFRα1 in MDSC cells.
[0205] Further conclusions. Artemin diminishes cytotoxic effector function of T cells in both in vitro and in vivo studies. While artemin may not be able to deepen the exhaustion state of T cells, it can result in a more suppressive tumor microenvironment which contributes to inhibiting T cell effector function. As other family members in GNDF family do, artemin may rely on distinct partners to transduce signals in different cell types responding to different environment stimuli. Therefore, compared to downstream approaches, blocking artemin signaling might be a more efficient and focused method to alleviate artemin-mediated inhibition of anti-tumor immunity.
TABLE-US-00001 SEQUENCES SEQ ID NO: Name Sequence 1 artemin upstream TACTGCATTGTCCCACTGCCTCC primer 2 artemin downstream TCGCAGGGTTCTTTCGCTGCACA primer 3 GAPDH upstream AGACCAGCCTGAGCAAAAGA primer 4 GAPDH downstream CTAGGCTGGAGTGCAGTGGT primer 5 mGFRa1_q_F CACTCCTGGATTTGCTGATGT 6 mGFRa1_q_R AGTGTGCGGTACTTGGTGC 7 mGFRa3_q_F AGAGAACAGGTTTGTGAACAGC 8 mGFRa3_q_R CAGCGGCCTGCTTAAACTG 9 mSdc3_q_F AGAGGCCGGTGGATCTTGA 10 mSdc3_q_R CTCCTGCTCGAAGTAGCCAGA 11 mNCAM_q_F ACCACCGTCACCACTAACTCT 12 mNCAM_q_R TGGGGCAATACTGGAGGTCA 13 mRET_q_F TCTATGGCGTCTACCGTACAC 14 mRET_q_R GGGAAACCACCATTGCGGAT 5 mGFRa1_q_F CACTCCTGGATTTGCTGATGT 6 mGFRa1_q_R AGTGTGCGGTACTTGGTGC 7 mGFRa3_q_F AGAGAACAGGTTTGTGAACAGC 8 mGFRa3_q_R CAGCGGCCTGCTTAAACTG 9 mSdc3_q_F AGAGGCCGGTGGATCTTGA 10 mSdc3_q_R CTCCTGCTCGAAGTAGCCAGA 11 mNCAM_q_F ACCACCGTCACCACTAACTCT 12 mNCAM_q_R TGGGGCAATACTGGAGGTCA 13 mRET_q_F TCTATGGCGTCTACCGTACAC 14 mRET_q_R GGGAAACCACCATTGCGGAT