Method for Constructing Ptgds Gene Knockout Rat Model with Spontaneous Kidney Yin Deficiency
20230270087 · 2023-08-31
Inventors
Cpc classification
C12N15/873
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
C12Q1/6888
CHEMISTRY; METALLURGY
International classification
C12Q1/6888
CHEMISTRY; METALLURGY
Abstract
The present disclosure belongs to the technical field of bioengineering, and relates to a method for constructing a Ptgds gene knockout rat model with spontaneous kidney yin deficiency. The method includes the following steps: 1) designing target sequences Ptgds-sgRNA1/2; 2) purifying Cas9mRNA and the Ptgds-sgRNA1/2; 3) conducting targeted knockout on a sequence fragment in the Ptgds gene using a CRISPR/Cas9 system; 4) injecting the purified Cas9mRNA, the purified Ptgds-sgRNA1/2, and a Ptgds knockout gene into rat embryos to obtain neonatal rats; 5) conducting genetic identification to select heterozygous rats; and 6) conducting breeding on the heterozygous rats with wild-type rats for multiple generations to obtain the Ptgds gene knockout rat model. In the present disclosure, the method has a high accuracy of gene modification, a targeting specificity, and a short experimental period.
Claims
1. A method for constructing a Ptgds gene knockout rat model with spontaneous kidney yin deficiency, comprising the following steps: 1) designing two target sequences Ptgds-sgRNA1 and Ptgds-sgRNA2 at a Ptgds gene locus; 2) obtaining purified Cas9mRNA, purified Ptgds-sgRNA1, and purified Ptgds-sgRNA2 by in vitro transcription; 3) conducting targeted knockout on a 2,944 bp sequence fragment in the Ptgds gene using a CRISPR/Cas9 system to obtain a Ptgds knockout gene; 4) injecting the purified Cas9mRNA, the purified Ptgds-sgRNA1, the purified Ptgds-sgRNA2, and the Ptgds knockout gene into rat embryos, and transplanting the embryos into fallopian tubes of surrogate recipient rats to obtain neonatal rats; 5) conducting genetic identification on the neonatal rats to select heterozygous rats; and 6) conducting breeding on the heterozygous rats with wild-type rats for multiple generations, and subjecting offspring rats obtained from each generation to gene identification until obtaining homozygous rats, the obtained homozygous rats are Ptgds gene knockout rat model.
2. The method according to claim 1, wherein in step 1), the Ptgds-sgRNA1 has a nucleotide sequence set forth in SEQ ID NO: 1; and the Ptgds-sgRNA2 has a nucleotide sequence set forth in SEQ ID NO: 3.
3. The method according to claim 2, wherein in step 3), the sequence fragment comprises an intron sequence fragment and an exon sequence fragment.
4. The method according to claim 3, wherein in step 3), the intron sequence fragment has a nucleotide sequence set forth in SEQ ID NO: 5; and the exon sequence fragment has a nucleotide sequence set forth in SEQ ID NO: 6.
5. The method according to claim 4, wherein the gene identification in step 5) and step 6) comprises the following steps: S1) extracting a genomic DNA from the neonatal rat; S2) conducting PCR amplification with specific primers using the genomic DNA as a template to obtain an amplification product; S3) conducting electrophoresis detection on the amplification product using agarose gel; and S4) identifying the heterozygous rats or the homozygous rats according to an electrophoresis result.
6. The method according to claim 5, wherein in step S2), the specific primers comprise primers of Ptgds-L-S, Ptgds-L-A, Ptgds- R-S, and Ptgds-R-A, with nucleotide sequences set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively.
7. The method according to claim 6, wherein in step S2), a reaction system of the PCR amplification comprises: 2.5 μl of a template DNA at 500 ng/μl, 2.5 μl of each of the Ptgds-L-S, the Ptgds-L-A, the Ptgds-R-S, and the Ptgds-R-A that are at 10 μmol/L, 5 μl of a 10× buffer, 5 μl of dNTP at 2.5 mmol/L, 0.5 μl of Eazy-taq, and supplementing to 50 μl with water; and the PCR amplification comprises: pre-denaturation at 98° C. for 2 min; denaturation at 98° C. for 20 sec×30; annealing at 55° C. for 20 sec×30; extension at 72° C. for 10 sec×30; terminal extension at 72° C. for 5 min; and cooling at 16° C. for 2 min.
8. The method according to claim 7, wherein the step 6) specifically comprises the following steps: 6.1) using the heterozygous rats selected in step 5) as F0-generation heterozygous rats, caging with the wild-type rats, conducting gene identification on obtained offspring I, and selecting heterozygous rats from the offspring I as F1-generation rats; 6.2) caging the F1-generation rats with the wild-type rats, conducting gene identification on obtained offspring II, and selecting heterozygous rats from the offspring II as F2-generation rats; and 6.3) using rats generated by conducting self-breeding within a group of F2-generation rats as F3-generation rats, and conducting gene identification to select homozygous rats in F3-generation as Ptgds gene knockout rat model.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0048] The method for constructing model in present disclosure is further described in detail below with reference to the accompanying drawings and examples.
[0049] The present disclosure provides a method for constructing a Ptgds gene knockout rat model with spontaneous kidney yin deficiency, including the following steps:
[0050] 1) two target sequences Ptgds-sgRNA1 and Ptgds-sgRNA2 at a Ptgds gene locus is designed.
[0051] 2) purified Cas9mRNA, purified Ptgds-sgRNA1, and purified Ptgds-sgRNA2 were obtained by in vitro transcription.
[0052] 3) CRISPR/Cas9 system to conduct targeted knockout on a 2,944 bp sequence fragment in the Ptgds gene to obtain a Ptgds knockout gene.
[0053] 4) The purified Cas9mRNA, the purified Ptgds-sgRNA1, the purified Ptgds-sgRNA2, and the Ptgds knockout gene are injected into rat embryos, and the embryos are transplanted into fallopian tubes of surrogate recipient rats to obtain neonatal rats.
[0054] 5) Gene identification was conducted on the neonatal rats to select heterozygous rats.
[0055] 6) Multi-generation reproduction between heterozygous rats and wild-type rats was conducted, and offspring rats obtained from each generation are subjected to gene identification until homozygous rats are genetically identified as the Ptgds gene knockout rat model.
[0056] In the present disclosure, in step 1), the Ptgds-sgRNA1 has a nucleotide sequence set forth in SEQ ID NO: 1; and the Ptgds-sgRNA2 has a nucleotide sequence set forth in SEQ ID NO: 3.
[0057] In the present disclosure, in step 3), the sequence fragment includes an intron sequence fragment and an exon sequence fragment.
[0058] In the present disclosure, in step 3), the intron sequence fragment has a nucleotide sequence set forth in SEQ ID NO: 5; and the exon sequence fragment has a nucleotide sequence set forth in SEQ ID NO: 6.
[0059] In the present disclosure, the gene identification in step 5) and step 6) includes the following steps:
[0060] S1) a genomic DNA is extracted from the neonatal rat.
[0061] S2) PCR amplification was conducted with specific primers using the genomic DNA as a template to obtain an amplification product.
[0062] S3) electrophoresis detection was conducted on the amplification product using agarose gel.
[0063] S4) the heterozygous rats or the homozygous rats were identified according to an electrophoresis result.
[0064] In the present disclosure, in step S2), the specific primers include primers of Ptgds-L-S, Ptgds-L-A, Ptgds-R-S, and Ptgds-R-A, with nucleotide sequences set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively.
[0065] In the present disclosure, in step S2), a reaction system of the PCR amplification includes: 2.5 μl of a template DNA at 500 ng/μl, 2.5 μl of each of the Ptgds-L-S, the Ptgds-L-A, the Ptgds-R-S, and the Ptgds-R-A that are at 10 μmol/L, 5 μl of a 10× buffer, 5 μl of dNTP at 2.5 mmol/L, 0.5 μl of Eazy-taq, and supplementing to 50 μl with water; and
[0066] the PCR amplification includes: pre-denaturation at 98° C. for 2 min; denaturation at 98° C. for 20 sec×30; annealing at 55° C. for 20 sec×30; extension at 72° C. for 10 sec×30; terminal extension at 72° C. for 5 min; and cooling at 16° C. for 2 min.
[0067] In the present disclosure, step 6) specifically includes the following steps:
[0068] 6.1) the heterozygous rats selected in step 5) are used as F0-generation heterozygous rats, caged with the wild-type rats, then a gene identification is conducted on obtained offspring I, and the heterozygous rats are selected from the offspring I as F1-generation rats;
[0069] 6.2) the F1-generation rats with the wild-type rats are caged, then a genetic identification is conducted on obtained offspring II, and the heterozygous rats are selected from the offspring II as F2-generation rats; and
[0070] 6.3) rats generated by conducting self-breeding within the group of F2-generation rats are used as F3-generation rats, and a genetic identification is conducted to select homozygous rats as the Ptgds gene knockout rat model.
EXAMPLE
[0071] The following described a method for constructing a rat model by a specific example.
1. Ptgds Gene Information of SD Rats
[0072] In this example, a constructed rat Ptgds gene was located on chromosome 3 of the SD rats, with only one transcript: Ptgds-201.
[0073] Therefore, the model was constructed with the Ptgds-201 transcript as an object.
2. Ptgds Protein Information of SD Rats
[0074] As shown in
3. Construction Ideas of Gene Knockout Rat Model
[0075] A specific sgRNA (single-guide RNA) of the Ptgds gene of rat mediated the cleavage of DNA by a Cas9 nuclease to produce specific DSBs (Double-Stranded Breaks), and an entire encoding sequence of the gene was deleted.
[0076] Referring to
(1) Design of a Guide RNA (gRNA)
[0077] In this example, two target sequences Ptgds-sgRNA1 and Ptgds-sgRNA2 were designed at a Ptgds gene locus;
TABLE-US-00001 Ptgds-sgRNA1: (SEQ ID NO: 1)
[0078] In the above sequence, several genes in the box were PAM recognition sites, which were used to recognize a target sequence of a cleavage position; and a rat model was formed by injecting Ptgds-sgRNA1, Ptgds-sgRNA2 and CAS9 proteins into fertilized eggs to delete the PTGDS gene.
(2) Gene Sequence and Guide RNA Information
[0079] With a CRISPR/Cas9 system, an intron sequence fragment (15 bp, lowercase, bold and underline) associated with the Ptgds gene (SEQ ID NO:6, 2,935 bp, uppercase) and a sequence fragment (SEQ ID NO:13, 2,929 bp, uppercase, bold and underlined) between exon 1 and exon 7 of the Ptgds gene, that is, a sequence fragment with a total length of 2,944 bp was subjected to targeted knockout.
TABLE-US-00002 (SEQ ID NO: 11) tagcctttcaggaccaaatgttcaaggcacagatggttctttgtgttccctgctggggtcatgggacttggaaagggatggtaggtag ggcttgtgagaagcaggtcttagccataggtgggcagtgactagattttccagcagctgggaagctccagagtacacatccggcaccatgtgag gtatgtgggctttgctggcagggtggacaaggtctgagccacttctgcctctggagttggggaggggggacaggcagaggcctctgcctgccct gccctgctgacctgcccctgcccgttcttcactgaggtatggggctctgctggagcctcttacataatgaacagatgaggctgcagctggggcagc cgcccgccctccctcacaccagcatcacgagcctccagtgggcagtccttgggccttgggtggaggccaagcctggttcataaatagggtctcc acggtggcctctgctccatctgcccacagtcttccttgctttgcccacgttgctggCCTCAGGCTCAGACACCTGCTCTA CTCCAAGCAAATGGCTGCTCTTCCAATGCTGTGGACCGGGCTGGTCCTCTTGGGTC TCTTGGGATTTCCACAGACCCCAGCCCAGGGCCATGACACAGTGCAGCCCAACTTT CAACAAGACAAGGTGAGAGGGTCCCCTACCCCACACCCGAGGAAACAGAAACCTC AGGTCAGAGCCAGGCTTTCTCTCACAAGAGAGGGTGCGTTGGGCGCTGTCAGCCA TGGGAGCTGTCTGGAACCGCGCTGGCACACAGCCTGGTTGGTCCACCTGACTCCG CCAGGAATGTGGCTCTGATACCCACTTTACCGGAAGAGTAGACTGGGGCGAGCACT GGGACAAAGACGGGAGCTCAACATCCTGGGGAAGGAAGGGGTCAATGAGGCAATG AGCCAGCCTACTAGAGAGAGAGAGGGGCGTGGATGCTACCAGAACCTGTGTGTGG GAGGAGTCAGAGTAGGGAAGGCCAGCCCACTAGGGTCTGCCCATGAGGGGCGCAT GGTGCAGACCCGGGCATCCACTGGTCACAGTTCCTGGGGCGCTGGTACAGCGCGG GCCTCGCCTCCAATTCAAGCTGGTTCCGGGAGAAGAAAGAGCTACTGTTTATGTGC CAGACAGTGGTAGCTCCCTCCACAGAAGGCGGCCTCAACCTCACCTCTACCTTCCT AAGGTGAGACAAGGGGGTGTGGCAAGTTTCGGGACAGAAGGCCCCACAACCCTGT CTGGGGGACATCCTGGGGCTTGTTCCCTTACATCAGGGGTAATCTACCCACAGGAA AAACCAGTGTGAGACCAAGGTGATGGTACTGCAGCCGGCAGGGGTTCCCGGACAG TACACCTACAACAGCCCCCGTGAGTGAGCCACTTCCTTATCTGGGTAAATTCTGAG GTAAATGCTGGCAGACTGTGCAGCCCCCTGTCCCAAAAGGTGGGGATAATGGTCAC ACCACAAGGGTCAGTCATCCAAGACCAGACCTGATTGTGAATCTGCCTCAGGCACA CAGGGCTACCTCTCTCCAGGGACTTTGGCCTCTCTGAAACCCAGCCACATTCTTCC AGGCCCCTTTCCTGTCCAAATGAAATTTCCCAGTACTCTGCTGCCCAAGTGGGTCA CATACAGGCATTCCCCAAATCCTACCCACATTTCATAGCTCCTATCCAAGTACCTCTT TCCATGCCTCACCTGATCTATGGATTCCCACCAGAACCCTATTTCCTTGGCCTTCCT GCTATATTGTAACTCAGCCTGATGATTTCTTGAGTCTAAGTGTTTTCTGCCCTCTCCC CAAGATTCATGGTTTGGAGTTAGTGTTCAGGAAGGAAGCTAGAGATTGGGTGGTGG CCACCCAGGGGAGCACAGGGAAAGAAGCCAAAGCAGGGGTGGAGGAGGAAGGCC TGAGACCCTCCCCACAGAGAAGCCCACAAAGGCCACCCCCTCCAAGCAGAGGGAG ATAGTGATGTGGGAGCCACATGTCTTAATCAGTGTCATTTCTTGGGTTCCCAGACTG GGGCAGCTTCCACTCCCTCTCAGTGGTAGAAACCGACTACGATGAGTACGCGTTCC TGTTCAGCAAGGGCACCAAGGGCCCAGGCCAGGACTTCCGCATGGCCACCCTCTA CAGTAGGTATCCCAGCCCACAGGCCCACGCACAGGGCAGATGCCTGAGGTTGGAA ACAGACCAAGGCCTAACCCAGAGGACAGTAACGAAGGTGTGTGGGGGCAGGGCGA GGGCTTTTCACCTCCTGACACCGGCCCCTTCTTTATCTACCAGGCAGAGCCCAGCT TCTGAAGGAGGAACTGAAGGAGAAATTCATCACCTTTAGCAAGGACCAGGGCCTCA CAGAGGAGGACATTGTTTTCCTGCCCCAACCGGGTGAGGGAGGCTAAGCTGCTGA GGAGGGAATTAGTGCAGATTAGTGCAGCCTGTGGACTGGGGAGAGTGTGGCCGCC TACTAGTCCAGGGGCTCCAAGGAAAGAAATGGAGGTGTCAGTCTGTCCCGACAGTA CCTCGACCTGCAGCCCCCTTTATTGGGAACCCTCTTCCTGGTGGACACCTCGCTGC CCTGTCTGCCAGCCCCCTAGCTAGGGATTTAGGGGCACTAACAGATGGAGAAAGAC ACCTTTTATGTTTTAAAGAACAGATTGGAGCAGGAGTGGGATGGAGTCTGAAGTGT GGGGCTCAGCCTTGGGGAGGCTTCGTAAAGTCCAGGGAGAAGACAAAGTCCTGGT GACTGTGGGTCTAAGCCTGATACTGACTACTTCCCTGGGCTTCTTTCTCAACAGATA AGTGCATTCAAGAGTAAACACAGGTGAGAGAAGTCAGTCACAGGTAACACATGGTA AGTGCCATTTACTCACTCAACATAAGACCACTGAGTGCTCATGTGACCACGGAGTG CGGGCTGGGGTGGGGGGGATGCAGCTGCCCAAGGACTGTCCAAGTGAGACAGCCA GAGAGAAAGGACAGTTCCAATTCCAGTGGCAGGAATAGAGCTGATGGCCAAGGGT TCATGGGAGAAGGATAACAGCAATGGGAAGGGACCGCCCCATGAAGCCCATCCTGC AAAATGAGTCTCCAAGGAACCAGAATGGACAAGATCGGGAAGGGACTGGTGGCCA GGGATGGACATGGCGAGTCAGAGGGCTGGCTCCTCACCTGTGCTGTTGACTGAGA CTCTGAGACCATAGGCCCTGGAGGGATACCCTAGGAGGCCCTGGCCGGAAGTGTT GTTTGGGCCCCACTGGGCTCAGGGTGCTGCCCTCATCACTGATGGCTCTTGTTCTT CTGTGCAGGTGATGTGGCCTCAGGACTCCCGTGCTCTGTCACTCTTGAGACCCAAG CCCTGGCTCCCCAAAGACCTTCTCCGCCCTCCAGCTTTGCCTTGGTGGAGAAATAA AATCCAAAGCAAGTCagacctcggcttttgtctgtctgtcctccgggccatcactatagccctcttataaatttctcagtatgatgacca gatgggtgtttgtccctgctcaagtcctgagtaggaacagcctgaccaatgcatcaggttcagcgcctactctgcgtagaggggctgcaacctctat gtggtgacataccccaaccaagagagtcacaggtcctgcaagctgccagccacagccaggcctgggctgggctgcggggcgtcagtcacttaa ccgctaatcccttagacaagtctacccgtccatccagggagcctcggaccctgtaggttcttcaaggtatggataagaatctctggattaggcaat aaagttggaagggcaaaaaggagtcgtttaacagatagagtgggctggagaggctgcctgtacctctgctcctaccccagccctctgaccaga gccctagcatcaaaggcaccaaaaccacagatggccacccaattagtcccccttttcttccaaatttccacctgagcagctattcccaagtcctcatc tctttccctcctggttcatagtgagcaggtctcaggcccaagcagactacaccaagattcgggtcagcggagagggttgcctctgggaagtcttcct gaagaaaggggatacactatgcctgttctgacacccgagaagtgttaggcagccctcaggcctggaggtcacttgggctacctgcccctgactgc tgagttcctcacccctcccactggaaccatgagctgacagggtgtgatgtgggagtgcaagtcaatcagtggtctatcacactgggtgtgtcccag gg.
4. Design, In Vitro Transcription and Purification of gRNA
[0080] gRNA was designed through sequence alignment; since it was a large fragment deletion gene, two gRNAs were designed for each target site to be cut, but only one gRNA was used for each site, and the gRNA with a higher off-target score was preferentially used, that was, the sgRNA with a low off-target probability was selected; another gRNA was alternative, and the gene was knocked out using the alternative gRNA when the higher-scoring gRNAs failed to work.
[0081] The DNA fragment of sgRNA was amplified by PCR with a sgRNA-Vector as a template, and then recovered by gel as a template for in vitro transcription of sgRNA, and then recovered by the in vitro transcription of sgRNA and purification, and stored in a −80° C. refrigerator for later use.
5. Microinjection
[0082] The purified sgRNA and the Cas9-mRNA were injected into embryos of SD rat, and the embryos were transplanted into fallopian tubes of surrogate recipient rats to obtain neonatal rats.
6. Breeding of Gene Knockout Rats
[0083] Neonatal rats were obtained 21 d after embryo transfer, and genotype identification was completed about 2 weeks after birth.
(1) Genotype Identification of Rats
[0084] Genotyping of neonatal rats was analyzed by genotype identification. Rats around 14 d after birth were numbered by toe clipping method and subjected to genotype identification.
(2) Method for the Genotype Identification of Rats
[0085] Step 1: Extraction of genomic DNA
[0086] (1) Digestion
[0087] About a week after the rat was born, 0.5 cm of the rat toe was cut and placed in a 1.5 ml EP tube. After slight centrifugation, 500 μl and 0.5 μl of proteinase K (concentration: 20 mg/ml, dissolved in pH 7.4, 20 mmol/L Tris and 1 mmol/CaCl.sub.2, stored in a 50% glycerol buffer solution at −20° C.), were mixed well and digested in a 55° C. water bath overnight;
[0088] A formula of lysis solution included: 100 mmol/L Tris at pH 8.0, 5 mmol/L EDTA at pH 8.0, 0.5% SDS, and 1.17 g/100 ml NaCl.
(2) DNA Extraction by Isopropanol Precipitation
[0089] 1) The centrifuge tube was removed from the water bath and allowed to stand at room temperature for 10 min to 15 min, such that the sample was cooled to room temperature, the centrifuge tube was inverted to mix well, and centrifuged at 13,000 rpm at room temperature for 15 min.
[0090] 2) 400 μl of a supernatant was pipetted into another new centrifuge tube. An equal volume of isopropanol was added, and the tube was turned up and down gently to mix thoroughly. At this time, a white flocculent precipitate appeared, and the tube was centrifuged at 12,000 rpm for 10 min at room temperature, and the supernatant was discarded.
[0091] 3) The centrifuge tube was rinsed with 700 μl of cold 75% ethanol, and gently turned up and down to mix well. Centrifugation was conducted at 12,000 rpm for 5 min at room temperature, and all the supernatant was removed by suction.
[0092] 4) The centrifuge tube was inverted on absorbent paper to blot dry the ethanol. After air-drying, the DNA was dissolved with 50 μl of sterile ddH.sub.2O at 55° C. for 2 h (if not being used immediately, the DNA was stored at −20° C.).
[0093] 5) The concentration of DNA was detected, and 100 ng to 200 ng of the DNA was used as a PCR template.
[0094] Step 2: PCR amplification was conducted with specific primers using the genomic DNA as a template to obtain an amplification product; and
[0095] forward and reverse PCR primers were designed for about 200 bp to 300 bp of upstream and downstream regions of the target.
[0096] (1) The primer information was shown in Table 1.
TABLE-US-00003 TABLE 1 Specific primer results Primer Tm length Primer 5′---3′ (° C.) (bp) Ptgds-L-S (lowercase, bold, and GCAGGTCTTAGCCATAGGTG 55,+DMSO 609 shade of gray) (SEQ ID NO: 7) Ptgds-L-A (uppercase, bold, and TTTCTGTTTCCTCGGGTG shade of gray) (SEQ ID NO: 8) Ptgds-R-S GATGGCTCTTGTTCTTCTGTG 55 516 (SEQ ID NO: 9) Ptgds-R-A CCTTCCAACTTTATTGCCTAAT (SEQ ID NO: 10)
TABLE-US-00004 (SEQ ID NO: 12) tagcctttcaggaccaaatgttcaaggcacagatggttctttgtgttccctgctggggtcatgggacttggaaagggatggtaggtagg gcttgtgagaagcaggtcttagccataggtgggcagtgactagattttccagcagctgggaagctccagagtacacatccggcaccatgtgagg tatgtgggctttgctggcagggtggacaaggtctgagccacttctgcctctggagttggggaggggggacaggcagaggcctctgcctgccctg ccctgctgacctgcccctgcccgttcttcactgaggtatggggctctgctggagcctcttacataatgaacagatgaggctgcagctggggcagcc gcccgccctccctcacaccagcatcacgagcctccagtgggcagtccttgggccttgggtggaggccaagcctggttcataaatagggtctcca cggtggcctctgctccatctgcccacagtcttccttgctttgcccacgttgctggCCTCAGGCTCAGACACCTGCTCTAC TCCAAGCAAATGGCTGCTCTTCCAATGCTGTGGACCGGGCTGGTCCTCTTGGGTCT CTTGGGATTTCCACAGACCCCAGCCCAGGGCCATGACACAGTGCAGCCCAACTTTC AACAAGACAAGGTGAGAGGGTCCCCTACCCCACACCCGAGGAAACAGAAACCTCA GGTCAGAGCCAGGCTTTCTCTCACAAGAGAGGGTGCGTTGGGCGCTGTCAGCCAT GGGAGCTGTCTGGAACCGCGCTGGCACACAGCCTGGTTGGTCCACCTGACTCCGC CAGGAATGTGGCTCTGATACCCACTTTACCGGAAGAGTAGACTGGGGCGAGCACT GGGACAAAGACGGGAGCTCAACATCCTGGGGAAGGAAGGGGTCAATGAGGCAAT GAGCCAGCCTACTAGAGAGAGAGAGGGGCGTGGATGCTACCAGAACCTGTGTGTG GGAGGAGTCAGAGTAGGGAAGGCCAGCCCACTAGGGTCTGCCCATGAGGGGCGC ATGGTGCAGACCCGGGCATCCACTGGTCACAGTTCCTGGGGCGCTGGTACAGCGC GGGCCTCGCCTCCAATTCAAGCTGGTTCCGGGAGAAGAAAGAGCTACTGTTTATGT GCCAGACAGTGGTAGCTCCCTCCACAGAAGGCGGCCTCAACCTCACCTCTACCTTC CTAAGGTGAGACAAGGGGGTGTGGCAAGTTTCGGGACAGAAGGCCCCACAACCCT GTCTGGGGGACATCCTGGGGCTTGTTCCCTTACATCAGGGGTAATCTACCCACAG GAAAAACCAGTGTGAGACCAAGGTGATGGTACTGCAGCCGGCAGGGGTTCCCGGA CAGTACACCTACAACAGCCCCCGTGAGTGAGCCACTTCCTTATCTGGGTAAATTCT GAGGTAAATGCTGGCAGACTGTGCAGCCCCCTGTCCCAAAAGGTGGGGATAATGG TCACACCACAAGGGTCAGTCATCCAAGACCAGACCTGATTGTGAATCTGCCTCAGG CACACAGGGCTACCTCTCTCCAGGGACTTTGGCCTCTCTGAAACCCAGCCACATTC TTCCAGGCCCCTTTCCTGTCCAAATGAAATTTCCCAGTACTCTGCTGCCCAAGTGG GTCACATACAGGCATTCCCCAAATCCTACCCACATTTCATAGCTCCTATCCAAGTA CCTCTTTCCATGCCTCACCTGATCTATGGATTCCCACCAGAACCCTATTTCCTTGGC CTTCCTGCTATATTGTAACTCAGCCTGATGATTTCTTGAGTCTAAGTGTTTTCTGCC CTCTCCCCAAGATTCATGGTTTGGAGTTAGTGTTCAGGAAGGAAGCTAGAGATTGG GTGGTGGCCACCCAGGGGAGCACAGGGAAAGAAGCCAAAGCAGGGGTGGAGGAG GAAGGCCTGAGACCCTCCCCACAGAGAAGCCCACAAAGGCCACCCCCTCCAAGCA GAGGGAGATAGTGATGTGGGAGCCACATGTCTTAATCAGTGTCATTTCTTGGGTTC CCAGACTGGGGCAGCTTCCACTCCCTCTCAGTGGTAGAAACCGACTACGATGAGT ACGCGTTCCTGTTCAGCAAGGGCACCAAGGGCCCAGGCCAGGACTTCCGCATGGC CACCCTCTACAGTAGGTATCCCAGCCCACAGGCCCACGCACAGGGCAGATGCCTG AGGTTGGAAACAGACCAAGGCCTAACCCAGAGGACAGTAACGAAGGTGTGTGGGG GCAGGGCGAGGGCTTTTCACCTCCTGACACCGGCCCCTTCTTTATCTACCAGGCAG AGCCCAGCTTCTGAAGGAGGAACTGAAGGAGAAATTCATCACCTTTAGCAAGGAC CAGGGCCTCACAGAGGAGGACATTGTTTTCCTGCCCCAACCGGGTGAGGGAGGCT AAGCTGCTGAGGAGGGAATTAGTGCAGATTAGTGCAGCCTGTGGACTGGGGAGAG TGTGGCCGCCTACTAGTCCAGGGGCTCCAAGGAAAGAAATGGAGGTGTCAGTCTG TCCCGACAGTACCTCGACCTGCAGCCCCCTTTATTGGGAACCCTCTTCCTGGTGGA CACCTCGCTGCCCTGTCTGCCAGCCCCCTAGCTAGGGATTTAGGGGCACTAACAG ATGGAGAAAGACACCTTTTATGTTTTAAAGAACAGATTGGAGCAGGAGTGGGATG GAGTCTGAAGTGTGGGGCTCAGCCTTGGGGAGGCTTCGTAAAGTCCAGGGAGAAG ACAAAGTCCTGGTGACTGTGGGTCTAAGCCTGATACTGACTACTTCCCTGGGCTTC TTTCTCAACAGATAAGTGCATTCAAGAGTAAACACAGGTGAGAGAAGTCAGTCACA GGTAACACATGGTAAGTGCCATTTACTCACTCAACATAAGACCACTGAGTGCTCAT GTGACCACGGAGTGCGGGCTGGGGTGGGGGGGATGCAGCTGCCCAAGGACTGTC CAAGTGAGACAGCCAGAGAGAAAGGACAGTTCCAATTCCAGTGGCAGGAATAGAG CTGATGGCCAAGGGTTCATGGGAGAAGGATAACAGCAATGGGAAGGGACCGCCCC ATGAAGCCCATCCTGCAAAATGAGTCTCCAAGGAACCAGAATGGACAAGATCGGG AAGGGACTGGTGGCCAGGGATGGACATGGCGAGTCAGAGGGCTGGCTCCTCACCT GTGCTGTTGACTGAGACTCTGAGACCATAGGCCCTGGAGGGATACCCTAGGAGGC CCTGGCCGGAAGTGTTGTTTGGGCCCCACTGGGCTCAGGGTGCTGCCCTCATCAC TGATGGCTCTTGTTCTTCTGTGCAGGTGATGTGGCCTCAGGACTCCCGTGCTCTGT CACTCTTGAGACCCAAGCCCTGGCTCCCCAAAGACCTTCTCCGCCCTCCAGCTTTG CCTTGGTGGAGAAATAAAATCCAAAGCAAGTCagacctcggcttttgtctgtctgtcctccgggccatcactata gccctcttataaatttctcagtatgatgaccagatgggtgtttgtccctgctcaagtcctgagtaggaacagcctgaccaatgcatcaggttcagcgc ctactctgcgtagaggggctgcaacctctatgtggtgacataccccaaccaagagagtcacaggtcctgcaagctgccagccacagccaggcct gggctgggctgcggggcgtcagtcacttaaccgctaatcccttagacaagtctacccgtccatccagggagcctcggaccctgtaggttcttcaa ggtatggataagaatctctggattaggcaataaagttggaagggcaaaaaggagtcgtttaacagatagagtgggctggagaggctgcctgta cctctgctcctaccccagccctctgaccagagccctagcatcaaaggcaccaaaaccacagatggccacccaattagtcccccttttcttccaaatt tccacctgagcagetattcccaagtcctcatctctttccctcctggttcatagtgagcaggtctcaggcccaagcagactacaccaagattcgggtca geggagagggttgcctctgggaagtcttcctgaagaaaggggatacactatgcctgttctgacacccgagaagtgttaggcagccctcaggcctg gaggtcacttgggctacctgcccctgactgctgagttcctcacccctcccactggaaccatgagctgacagggtgtgatgtgggagtgcaagtca atcagtggtctatcacactgggtgtgtcccaggg.
(2) PCR Amplification
[0097] In this example, the reaction system and reaction conditions of PCR amplification were shown in Table 2.
TABLE-US-00005 TABLE 2 Reaction system and reaction conditions of PCR amplification PCR system PCR reaction conditions PCR Template DNA Pre-denaturation at 98° C. for 2 min (~500 ng/μl):2.5 μl Protocol Primer S/A (10 μM): each of 1 μl Denaturation at 98° C. for 20 sec dNTP(2.5 mmol/L): 5 μl Annealing at 55° C. for 20 sec {close oversize brace} 30× cycles 10x buffer: 5μ1 Extension at 72° C. for 10 sec Eazy-taq (5 μ/μL)): 0.5 μl Terminal extension at 72° C. for 5 min Supplementing to Cooling at 16° C. for 2 min 50 μl with ddH.sub.2O
[0098] (3) The electrophoresis detection was conducted on the amplification product using agarose gel.
1) Preparation of 3% Agarose Gel
[0099] 1.5 g of agarose was placed in a conical flask, added with 50 ml of a 1×TAE buffer (the TAE buffer was composed of Tris base, acetic acid, and EDTA) , and a small beaker was inverted at the bottle mouth. The mixture was boiled by heating in a microwave oven for 3 times until the agarose was completely melted, and shaken well to obtain a 3.0% agarose gel solution.
2) Gel Plate Preparation
[0100] A plexiglass inner tank (gel preparation tank) in the electrophoresis tank was washed, air-dried, and a gel preparation glass plate was added. The glass plate and edges of both ends of the inner tank were sealed using scotch tape to form a mold. The inner tank was placed in a horizontal position and a comb was placed in a fixed position. The agarose gel liquid cooled to about 65° C. was mixed well and poured on the inner tank glass plate carefully, such that the gel solution was slowly spread until a uniform layer of gel was formed on the entire surface of the glass plate. The glass plate was allowed to stand at room temperature until the gel was completely solidified, the comb was slightly pulled vertically and the scotch tape was removed, then the gel and the inner tank were put into an electrophoresis tank. 1×TAE running buffer was added until the gel plate was immersed.
3. Sample Loading
[0101] The DNA sample and the loading buffer were mixed on a spot plate or a parafilm, where a final dilution of the loading buffer was not less than lx. The samples were added to the sample grooves of the gel plate by a 10 μl micropipette separately. After adding a sample, the tip for sample loading was replaced to prevent contamination, and the gel surface around the sample well was not damaged when loading the samples. (Note: before loading the samples, a sequence of sample loading was recorded).
4) Electrophoresis
[0102] After loading the samples, the gel plate was immediately energized for electrophoresis, at a voltage of 60 V to 100 V, and the samples moved from a negative electrode (black) to a positive electrode (red). As the voltage increased, an effective separation range of the agarose gel decreased. When bromophenol blue moved to about 1 cm from a lower edge of the gel plate, the electrophoresis was terminated.
[0103] 5) After electrophoresis, the gel was removed and stained with a 1×TAE solution containing 0.5 μg/ml ethidium bromide for about 20 min, and then rinsed with water for 10 min.
6) Observation and Photography
[0104] The gel was observed under ultraviolet light, and the presence of DNA showed a red fluorescent band, which was then photographed and stored by a gel imaging system.
[0105] Step 3: identification and discrimination of rats
[0106] The heterozygous rats or the homozygous rats were identified according to the electrophoresis result.
[0107] Determination basis for PCR amplification results: negative (WT) Ptgds+/+ showed one band: 609 bp (a sequence length between L-S and L-A); heterozygote (HZ) Ptgds+/− showed two bands of 609 bp and 786 bp (the remaining sequence length after knockout of 2,944 bp in wild-type); homozygote (HO) Ptgds−/− showed one band: 786 bp.
[0108] In this example, 8 samples (denoted as D33 to D42) were selected, and the Ptgds gene knockout rats were obtained by the above method. The electrophoresis results of PCR amplification were shown in
TABLE-US-00006 TABLE 3 Results of phenotype determination of Ptgds knockout rats Sample D33 D34 D35 D36 D37 D38 D39 D42 L-A&L-S ✓ ✓ No No No ✓ ✓ ✓ (609 bp) R-A&L-S No No ✓ ✓ ✓ ✓ ✓ ✓ (786 bp) Interpretation WT WT HO HO HO HZ HZ HZ of results
[0109] According to the electrophoresis results of
[0110] Rats identified as heterozygous (Ptgds+/−) were bred as F0-generation heterozygous rats.
[0111] The F0-generation rats and wild-type SD rats were caged together, and the heterozygous rats identified from offspring were used as F1-generation rats; the F1-generation rats were continued to be caged with the wild-type SD rats, and the heterozygous rats identified from offspring were used as F2-generation rats; and rats produced by self-breding within the group of the F2-generation rats were used as F3-generation rats, and homozygous rats (Ptgds−/−) among them were used as the Ptgds gene knockout rat model. In reproduction of each generation, the phenotype of the Ptgds knockout rats in offspring was determined by the above-mentioned genetic identification method.
[0112] Breeding passages of F1-F3 lasted 16 months. There were 2 heterozygous rats (2 females) and 8 wild-type rats (3 females, 5 males) produced in the F0 generation; 2 heterozygous rats (1 female, 1 male) and 9 wild-type rats (4 females, 5 males) generation produced in the F1 generation; 5 heterozygous rats (3 females, 2 males) and 5 wild-type rats (2 females, 3 males) produced in the F2 generation; 33 offspring mice, including 4 homozygotes (2 females, 2 males, with a homozygous rate of about 12.12%), 19 heterozygotes (12 females, 7 males), and 9 wild-type mice (5 females, 4 males) bred in the F3 generation. During the breeding, 2 adult mice of F3 generation died, showing a mortality rate of about 6.06%. In the F3 generation, Ptgds wild-type (−/−, 9 rats): heterozygous type (+/−, 19 rats): homozygous type (+/+, 4 rats) had a ratio of approximately 2.25:4.75:1.
7. Determination of Kidney Yin Deficiency Indexes in Perimenopause
[0113] Perimenopausal kidney yin deficiency is a syndrome manifested by deficiency of kidney yin, lack of nourishment, and internal heat with yin deficiency. The main clinical manifestations are dizziness, tinnitus, insomnia and dreaminess, dysphoria in chestpalms-soles, waist and knee pains, hot flashes, and night sweats. A large number of experimental studies have shown that perimenopausal kidney yin deficiency is related to the dysfunction of the hypothalamic-pituitary-gonadal axis, mainly manifested as abnormal body weight, increased hot flash index, decreased renal function, abnormal blood glucose, lipid metabolism disorders, and disturbance of endocrine hormone levels (estrogen, thyroid hormone, and adrenal cortex hormone) related to the hypothalamic-pituitary-gonadal axis.
[0114] Therefore, the related indicators of “hypothalamus-pituitary-gonadal axis” in Ptgds knockout rats with different phenotypes were determined; and the results were subjected to one-way statistical analysis of variance by SPSS software, and p<0.05 indicated that there was a significant statistical difference between the groups.
(1) Determination of Body Weight and Organ Indexes
[0115] In perimenopausal women, due to the rapid depletion of estrogen in the body, may have abnormal weight gain caused by the disorder of fat metabolism. In perimenopausal patients with kidney yin deficiency, may also have typical degenerative changes in their internal organs. Therefore, in this study, body weight and organ index of rats were used as external indicators for the preliminary evaluation of perimenopausal fat metabolism disorder and organ degenerative changes in gene knockout rats.
[0116] Since the life span of this type of rats is shorter than that of wild-type rats (12-14 months old), three phenotypes of 8-month-old Ptgds knockout nulliparous female rats (middle-aged, negative, heterozygous and homozygous types) were anesthetized with a 2% sodium pentobarbital solution. The brain, uterus, kidney and spleen of rats were isolated, rinsed with normal saline, dried with filter papers, weighed, and the organ index was calculated (organ index %=organ weight/body weight×100%).
[0117] The results were shown in
[0118] Referring to
(2) Tail Temperature Measurement by Infrared Thermal Imaging
[0119] One week after bilateral oophorectomy of rats, a blood flow of the tail increased and showed a transient surge, and a skin temperature of the tail was proportional to the blood flow of the tail, and typical symptoms of perimenopausal hot flashes appeared. Therefore, the severity of hot flashes and the effectiveness of drugs in the treatment of hot flash symptoms were evaluated by measuring the rat tail temperature in real time.
[0120] The rat was immobilized in a immobilizer, and a tip of the rat tail was immobilized on a surface of a measuring table; a skin temperature at about 2 cm from the base of the tail of the rat within 6 h was measured with an infrared thermal imager. Data were recorded with a temperature logger, and sampled every 5 min. An average temperature of the first 15 min was used as a baseline value. After the rat was in a stable state in the immobilizer, the temperature value was recorded and a temperature change was evaluated (there were 15 data points, 6 evaluation points, a laboratory temperature was 25° C.±2° C., a measurement time was at 9:00 to 12:00).
[0121] The results were shown in
[0122] As can be seen from
(3) Determination of Function in Kidney, Pancreas, Thyroid and Uterus
[0123] Since kidney yin deficiency is related to the hyperfunction of the hypothalamus-pituitary-gonadal axis, the functions of the gonad-related organs (kidney, pancreas, thyroid and uterus) were firstly measured.
[0124] Rat serum samples were collected, and blood biochemical indicators were determined enzymatically to evaluate the kidneys, including: albumin (ALB), uric acid (UA), urea (UREA), blood glucose (GLU), total cholesterol (TC), triglyceride (TG), and creatinine (CREA).
[0125] The secretion function indexes of kidney, pancreas, thyroid and uterine glands were determined by an enzyme-linked immunosorbent assay (ELISA), including: kidney, uterine ERβ, serum adrenocorticotropic hormone (ACTH), corticosterone (CORT), insulin (INS), cyclic adenosine monophosphate (cAMP), and thyroid stimulating hormone (TSH).
[0126] The measurement results were shown in
[0127] The results of blood biochemical tests showed that the heterozygous and homozygous rats had abnormal renal function and blood lipid indexes compared with the wild-type rats, indicating that the two types of rats might have kidney damage and lipid metabolism disorders. The abnormal increase of renal function Na.sup.+-K.sup.+-ATPase, ACTH, CORT, immune cAMP and thyroid TSH further indicated that, the heterozygous and homozygous rats showed typical symptoms of kidney yin deficiency and abnormal renal function and hyperfunction of endocrine glands. Compared with wild-type rats, the decrease of ERβ level in uterus of heterozygous and homozygous rats indicated that the ovarian secretion function of rats was degenerated; this result was consistent with the decreased uterine organ index, indicating that Ptgds knockout rats could simulate the perimenopausal uterine and ovarian decline in rats. The abnormal increase of insulin levels in heterozygous and homozygous rats reflected the abnormal increase of blood glucose and the lipid metabolism disorder caused by insulin resistance in perimenopause.
(4) Morris Water Maze Test
[0128] Perimenopause patients with kidney yin deficiency may show typical symptoms of central degenerative diseases such as lapse of memory and senile dementia. Therefore, the memory and learning ability of Ptgds knockout rats were evaluated by a Morris water maze method. Experiments were conducted in a Morris water maze system, including a white plastic pool (130 cm in diameter, 50 cm in height, with a built-in PVC cylindrical escape platform), an automatic camera, and image tracking processing software.
[0129] Before the test, a 5-day positioning navigation training was conducted. That is, each rat (stained with yellow dye on a top of the head) was placed in titanium powder-dyed white water (23° C.±2° C.) with its head facing the pool wall at random quadrant points, and timing started at the moment of release; the timing was stopped when the rat touched the escape platform and stayed there for at least 3 sec. When finding the platform, the rats stayed on the platform for 10 sec; if the rat could not find the platform within 90 sec, the rats were guided to the platform and acclimated for 10 sec. After the formal experiment began, the original escape platform was removed; the second quadrant was used as a fixed water entry quadrant, and the escape latency, swimming distance, and times of crossing the platform of the rats were recorded within a specified time, to evaluate the learning and memory ability of the rats. The results were shown in
[0130] Referring to
[0131] In summary, the present disclosure is based on use of the CRISPR/Cas9 technology in targeted knockout of Ptgds gene in rats, thereby constructing a Ptgds −/− rat model to produce symptoms of the spontaneous kidney yin deficiency. Through breeding, PCR identification, and pathological index detection, the model can be further applied to pharmacodynamic evaluation. The model can provide a reliable and stable genetic engineering model for the study of perimenopausal symptoms of kidney yin deficiency, and lay a foundation for exploration of perimenopausal syndrome mechanism and evaluation of related drug treatment effects.
[0132] The foregoing are merely descriptions of the specific embodiments of the present disclosure, and the claimed scope of the present disclosure is not limited thereto. Any modification, equivalent replacement, improvement, etc. made within the technical scope of the present disclosure by those skilled in the art according to the spirit and principle of the present disclosure shall fall within the claimed scope of the present disclosure.
TABLE-US-00007 Sequence Listing Information: DTD Version: V1_3 File Name: GWP20220801139.xml Software Name: WIPO Sequence Software Version: 2.1.2 Production Date: 2022-12-13 General Information: Current application / Applicant file reference: GWP20220801139 Earliest priority application / IP Office: CN Earliest priority application / Application number: 202210191036.7 Earliest priority application / Filing date: 2022-02-25 Applicant name: Shaanxi University of Chinese Medicine Applicant name / Language: en Invention title: METHOD FOR CONSTRUCTING Ptgds GENE KNOCKOUT RAT MODEL WITH SPONTANEOUS KIDNEY YIN DEFICIENCY ( en ) Sequence Total Quantity: 13 Sequences: Sequence Number (ID): 1 Length: 23 Molecule Type: DNA Features Location/Qualifiers: - source, 1..23 > mol_type, other DNA > note, Ptgds-sgRNA1 > organism, synthetic construct Residues: ccacgttgct ggcctcaggc tca 23 Sequence Number (ID): 2 Length: 23 Molecule Type: DNA Features Location/Qualifiers: - source, 1..23 > mol_type, other DNA > note, Reverse complement of Ptgds-sgRNA1 > organism, synthetic construct Residues: tgagcctgag gccagcaacg tgg 23 Sequence Number (ID): 3 Length: 23 Molecule Type: DNA Features Location/Qualifiers: - source, 1..23 > mol_type, other DNA > note, Ptgds-sgRNA2 > organism, synthetic construct Residues: ccaaagcaag tcagacctcg gct 23 Sequence Number (ID): 4 Length: 23 Molecule Type: DNA Features Location/Qualifiers: - source, 1..23 > mol_type, other DNA > note, Reverse complement of Ptgds-sgRNA2 > organism, synthetic construct Residues: agccgaggtc tgacttgctt tgg 23 Sequence Number (ID): 5 Length: 15 Molecule Type: DNA Features Location/Qualifiers: - source, 1..15 > mol_type, other DNA > note, Nucleotide sequence of the intron sequence fragment > organism, synthetic construct Residues: tgcccacgtt gctgg 15 Sequence Number (ID): 6 Length: 2935 Molecule Type: DNA Features Location/Qualifiers: - source, 1..2935 > mol_type, other DNA > note, Nucleotide sequence of the exon sequence fragment > organism, synthetic construct Residues: cctcaggctc agacacctgc tctactccaa gcaaatggct gctcttccaa tgctgtggac 60 cgggctggtc ctcttgggtc tcttgggatt tccacagacc ccagcccagg gccatgacac 120 agtgcagccc aactttcaac aagacaaggt gagagggtcc cctaccccac acccgaggaa 180 acagaaacct caggtcagag ccaggctttc tctcacaaga gagggtgcgt tgggcgctgt 240 cagccatggg agctgtctgg aaccgcgctg gcacacagcc tggttggtcc acctgactcc 300 gccaggaatg tggctctgat acccacttta ccggaagagt agactggggc gagcactggg 360 acaaagacgg gagctcaaca tcctggggaa ggaaggggtc aatgaggcaa tgagccagcc 420 tactagagag agagaggggc gtggatgcta ccagaacctg tgtgtgggag gagtcagagt 480 agggaaggcc agcccactag ggtctgccca tgaggggcgc atggtgcaga cccgggcatc 540 cactggtcac agttcctggg gcgctggtac agcgcgggcc tcgcctccaa ttcaagctgg 600 ttccgggaga agaaagagct actgtttatg tgccagacag tggtagctcc ctccacagaa 660 ggcggcctca acctcacctc taccttccta aggtgagaca agggggtgtg gcaagtttcg 720 ggacagaagg ccccacaacc ctgtctgggg gacatcctgg ggcttgttcc cttacatcag 780 gggtaatcta cccacaggaa aaaccagtgt gagaccaagg tgatggtact gcagccggca 840 ggggttcccg gacagtacac ctacaacagc ccccgtgagt gagccacttc cttatctggg 900 taaattctga ggtaaatgct ggcagactgt gcagccccct gtcccaaaag gtggggataa 960 tggtcacacc acaagggtca gtcatccaag accagacctg attgtgaatc tgcctcaggc 1020 acacagggct acctctctcc agggactttg gcctctctga aacccagcca cattcttcca 1080 ggcccctttc ctgtccaaat gaaatttccc agtactctgc tgcccaagtg ggtcacatac 1140 aggcattccc caaatcctac ccacatttca tagctcctat ccaagtacct ctttccatgc 1200 ctcacctgat ctatggattc ccaccagaac cctatttcct tggccttcct gctatattgt 1260 aactcagcct gatgatttct tgagtctaag tgttttctgc cctctcccca agattcatgg 1320 tttggagtta gtgttcagga aggaagctag agattgggtg gtggccaccc aggggagcac 1380 agggaaagaa gccaaagcag gggtggagga ggaaggcctg agaccctccc cacagagaag 1440 cccacaaagg ccaccccctc caagcagagg gagatagtga tgtgggagcc acatgtctta 1500 atcagtgtca tttcttgggt tcccagactg gggcagcttc cactccctct cagtggtaga 1560 aaccgactac gatgagtacg cgttcctgtt cagcaagggc accaagggcc caggccagga 1620 cttccgcatg gccaccctct acagtaggta tcccagccca caggcccacg cacagggcag 1680 atgcctgagg ttggaaacag accaaggcct aacccagagg acagtaacga aggtgtgtgg 1740 gggcagggcg agggcttttc acctcctgac accggcccct tctttatcta ccaggcagag 1800 cccagcttct gaaggaggaa ctgaaggaga aattcatcac ctttagcaag gaccagggcc 1860 tcacagagga ggacattgtt ttcctgcccc aaccgggtga gggaggctaa gctgctgagg 1920 agggaattag tgcagattag tgcagcctgt ggactgggga gagtgtggcc gcctactagt 1980 ccaggggctc caaggaaaga aatggaggtg tcagtctgtc ccgacagtac ctcgacctgc 2040 agcccccttt attgggaacc ctcttcctgg tggacacctc gctgccctgt ctgccagccc 2100 cctagctagg gatttagggg cactaacaga tggagaaaga caccttttat gttttaaaga 2160 acagattgga gcaggagtgg gatggagtct gaagtgtggg gctcagcctt ggggaggctt 2220 cgtaaagtcc agggagaaga caaagtcctg gtgactgtgg gtctaagcct gatactgact 2280 acttccctgg gcttctttct caacagataa gtgcattcaa gagtaaacac aggtgagaga 2340 agtcagtcac aggtaacaca tggtaagtgc catttactca ctcaacataa gaccactgag 2400 tgctcatgtg accacggagt gcgggctggg gtggggggga tgcagctgcc caaggactgt 2460 ccaagtgaga cagccagaga gaaaggacag ttccaattcc agtggcagga atagagctga 2520 tggccaaggg ttcatgggag aaggataaca gcaatgggaa gggaccgccc catgaagccc 2580 atcctgcaaa atgagtctcc aaggaaccag aatggacaag atcgggaagg gactggtggc 2640 cagggatgga catggcgagt cagagggctg gctcctcacc tgtgctgttg actgagactc 2700 tgagaccata ggccctggag ggatacccta ggaggccctg gccggaagtg ttgtttgggc 2760 cccactgggc tcagggtgct gccctcatca ctgatggctc ttgttcttct gtgcaggtga 2820 tgtggcctca ggactcccgt gctctgtcac tcttgagacc caagccctgg ctccccaaag 2880 accttctccg ccctccagct ttgccttggt ggagaaataa aatccaaagc aagtc 2935 Sequence Number (ID): 7 Length: 20 Molecule Type: DNA Features Location/Qualifiers: - source, 1..20 > mol_type, other DNA > note, Primer Ptgds-L-S > organism, synthetic construct Residues: gcaggtctta gccataggtg 20 Sequence Number (ID): 8 Length: 18 Molecule Type: DNA Features Location/Qualifiers: - source, 1..18 > mol_type, other DNA > note, Primer Ptgds-L-A > organism, synthetic construct Residues: tttctgtttc ctcgggtg 18 Sequence Number (ID): 9 Length: 21 Molecule Type: DNA Features Location/Qualifiers: - source, 1..21 > mol_type, other DNA > note, Primer Ptgds-R-S > organism, synthetic construct Residues: gatggctctt gttcttctgt g 21 Sequence Number (ID): 10 Length: 22 Molecule Type: DNA Features Location/Qualifiers: - source, 1..22 > mol_type, other DNA > note, Primer Ptgds-R-A > organism, synthetic construct Residues: ccttccaact ttattgccta at 22 Sequence Number (ID): 11 Length: 4299 Molecule Type: DNA Features Location/Qualifiers: - source, 1..4299 > mol_type, other DNA > organism, synthetic construct Residues: tagcctttca ggaccaaatg ttcaaggcac agatggttct ttgtgttccc tgctggggtc 60 atgggacttg gaaagggatg gtaggtaggg cttgtgagaa gcaggtctta gccataggtg 120 ggcagtgact agattttcca gcagctggga agctccagag tacacatccg gcaccatgtg 180 aggtatgtgg gctttgctgg cagggtggac aaggtctgag ccacttctgc ctctggagtt 240 ggggaggggg gacaggcaga ggcctctgcc tgccctgccc tgctgacctg cccctgcccg 300 ttcttcactg aggtatgggg ctctgctgga gcctcttaca taatgaacag atgaggctgc 360 agctggggca gccgcccgcc ctccctcaca ccagcatcac gagcctccag tgggcagtcc 420 ttgggccttg ggtggaggcc aagcctggtt cataaatagg gtctccacgg tggcctctgc 480 tccatctgcc cacagtcttc cttgctttgc ccacgttgct ggcctcaggc tcagacacct 540 gctctactcc aagcaaatgg ctgctcttcc aatgctgtgg accgggctgg tcctcttggg 600 tctcttggga tttccacaga ccccagccca gggccatgac acagtgcagc ccaactttca 660 acaagacaag gtgagagggt cccctacccc acacccgagg aaacagaaac ctcaggtcag 720 agccaggctt tctctcacaa gagagggtgc gttgggcgct gtcagccatg ggagctgtct 780 ggaaccgcgc tggcacacag cctggttggt ccacctgact ccgccaggaa tgtggctctg 840 atacccactt taccggaaga gtagactggg gcgagcactg ggacaaagac gggagctcaa 900 catcctgggg aaggaagggg tcaatgaggc aatgagccag cctactagag agagagaggg 960 gcgtggatgc taccagaacc tgtgtgtggg aggagtcaga gtagggaagg ccagcccact 1020 agggtctgcc catgaggggc gcatggtgca gacccgggca tccactggtc acagttcctg 1080 gggcgctggt acagcgcggg cctcgcctcc aattcaagct ggttccggga gaagaaagag 1140 ctactgttta tgtgccagac agtggtagct ccctccacag aaggcggcct caacctcacc 1200 tctaccttcc taaggtgaga caagggggtg tggcaagttt cgggacagaa ggccccacaa 1260 ccctgtctgg gggacatcct ggggcttgtt cccttacatc aggggtaatc tacccacagg 1320 aaaaaccagt gtgagaccaa ggtgatggta ctgcagccgg caggggttcc cggacagtac 1380 acctacaaca gcccccgtga gtgagccact tccttatctg ggtaaattct gaggtaaatg 1440 ctggcagact gtgcagcccc ctgtcccaaa aggtggggat aatggtcaca ccacaagggt 1500 cagtcatcca agaccagacc tgattgtgaa tctgcctcag gcacacaggg ctacctctct 1560 ccagggactt tggcctctct gaaacccagc cacattcttc caggcccctt tcctgtccaa 1620 atgaaatttc ccagtactct gctgcccaag tgggtcacat acaggcattc cccaaatcct 1680 acccacattt catagctcct atccaagtac ctctttccat gcctcacctg atctatggat 1740 tcccaccaga accctatttc cttggccttc ctgctatatt gtaactcagc ctgatgattt 1800 cttgagtcta agtgttttct gccctctccc caagattcat ggtttggagt tagtgttcag 1860 gaaggaagct agagattggg tggtggccac ccaggggagc acagggaaag aagccaaagc 1920 aggggtggag gaggaaggcc tgagaccctc cccacagaga agcccacaaa ggccaccccc 1980 tccaagcaga gggagatagt gatgtgggag ccacatgtct taatcagtgt catttcttgg 2040 gttcccagac tggggcagct tccactccct ctcagtggta gaaaccgact acgatgagta 2100 cgcgttcctg ttcagcaagg gcaccaaggg cccaggccag gacttccgca tggccaccct 2160 ctacagtagg tatcccagcc cacaggccca cgcacagggc agatgcctga ggttggaaac 2220 agaccaaggc ctaacccaga ggacagtaac gaaggtgtgt gggggcaggg cgagggcttt 2280 tcacctcctg acaccggccc cttctttatc taccaggcag agcccagctt ctgaaggagg 2340 aactgaagga gaaattcatc acctttagca aggaccaggg cctcacagag gaggacattg 2400 ttttcctgcc ccaaccgggt gagggaggct aagctgctga ggagggaatt agtgcagatt 2460 agtgcagcct gtggactggg gagagtgtgg ccgcctacta gtccaggggc tccaaggaaa 2520 gaaatggagg tgtcagtctg tcccgacagt acctcgacct gcagccccct ttattgggaa 2580 ccctcttcct ggtggacacc tcgctgccct gtctgccagc cccctagcta gggatttagg 2640 ggcactaaca gatggagaaa gacacctttt atgttttaaa gaacagattg gagcaggagt 2700 gggatggagt ctgaagtgtg gggctcagcc ttggggagge ttcgtaaagt ccagggagaa 2760 gacaaagtcc tggtgactgt gggtctaagc ctgatactga ctacttccct gggcttcttt 2820 ctcaacagat aagtgcattc aagagtaaac acaggtgaga gaagtcagtc acaggtaaca 2880 catggtaagt gccatttact cactcaacat aagaccactg agtgctcatg tgaccacgga 2940 gtgcgggctg gggtgggggg gatgcagctg cccaaggact gtccaagtga gacagccaga 3000 gagaaaggac agttccaatt ccagtggcag gaatagagct gatggccaag ggttcatggg 3060 agaaggataa cagcaatggg aagggaccgc cccatgaagc ccatcctgca aaatgagtct 3120 ccaaggaacc agaatggaca agatcgggaa gggactggtg gccagggatg gacatggcga 3180 gtcagagggc tggctcctca cctgtgctgt tgactgagac tctgagacca taggccctgg 3240 agggataccc taggaggccc tggccggaag tgttgtttgg gccccactgg gctcagggtg 3300 ctgccctcat cactgatggc tcttgttctt ctgtgcaggt gatgtggcct caggactccc 3360 gtgctctgtc actcttgaga cccaagccct ggctccccaa agaccttctc cgccctccag 3420 ctttgccttg gtggagaaat aaaatccaaa gcaagtcaga cctcggcttt tgtctgtctg 3480 tcctccgggc catcactata gccctcttat aaatttctca gtatgatgac cagatgggtg 3540 tttgtccctg ctcaagtcct gagtaggaac agcctgacca atgcatcagg ttcagcgcct 3600 actctgcgta gaggggctgc aacctctatg tggtgacata ccccaaccaa gagagtcaca 3660 ggtcctgcaa gctgccagcc acagccaggc ctgggctggg ctgcggggcg tcagtcactt 3720 aaccgctaat cccttagaca agtctacccg tccatccagg gagcctcgga ccctgtaggt 3780 tcttcaaggt atggataaga atctctggat taggcaataa agttggaagg gcaaaaagga 3840 gtcgtttaac agatagagtg ggctggagag gctgcctgta cctctgctcc taccccagcc 3900 ctctgaccag agccctagca tcaaaggcac caaaaccaca gatggccacc caattagtcc 3960 cccttttctt ccaaatttcc acctgagcag ctattcccaa gtcctcatct ctttccctcc 4020 tggttcatag tgagcaggtc tcaggcccaa gcagactaca ccaagattcg ggtcagcgga 4080 gagggttgcc tctgggaagt cttcctgaag aaaggggata cactatgcct gttctgacac 4140 ccgagaagtg ttaggcagcc ctcaggcctg gaggtcactt gggctacctg cccctgactg 4200 ctgagttcct cacccctccc actggaacca tgagctgaca gggtgtgatg tgggagtgca 4260 agtcaatcag tggtctatca cactgggtgt gtcccaggg 4299 Sequence Number (ID): 12 Length: 4299 Molecule Type: DNA Features Location/Qualifiers: - source, 1..4299 > mol_type, other DNA > organism, synthetic construct Residues: tagcctttca ggaccaaatg ttcaaggcac agatggttct ttgtgttccc tgctggggtc 60 atgggacttg gaaagggatg gtaggtaggg cttgtgagaa gcaggtctta gccataggtg 120 ggcagtgact agattttcca gcagctggga agctccagag tacacatccg gcaccatgtg 180 aggtatgtgg gctttgctgg cagggtggac aaggtctgag ccacttctgc ctctggagtt 240 ggggaggggg gacaggcaga ggcctctgcc tgccctgccc tgctgacctg cccctgcccg 300 ttcttcactg aggtatgggg ctctgctgga gcctcttaca taatgaacag atgaggctgc 360 agctggggca gccgcccgcc ctccctcaca ccagcatcac gagcctccag tgggcagtcc 420 ttgggccttg ggtggaggcc aagcctggtt cataaatagg gtctccacgg tggcctctgc 480 tccatctgcc cacagtcttc cttgctttgc ccacgttgct ggcctcaggc tcagacacct 540 gctctactcc aagcaaatgg ctgctcttcc aatgctgtgg accgggctgg tcctcttggg 600 tctcttggga tttccacaga ccccagccca gggccatgac acagtgcagc ccaactttca 660 acaagacaag gtgagagggt cccctacccc acacccgagg aaacagaaac ctcaggtcag 720 agccaggctt tctctcacaa gagagggtgc gttgggcgct gtcagccatg ggagctgtct 780 ggaaccgcgc tggcacacag cctggttggt ccacctgact ccgccaggaa tgtggctctg 840 atacccactt taccggaaga gtagactggg gcgagcactg ggacaaagac gggagctcaa 900 catcctgggg aaggaagggg tcaatgaggc aatgagccag cctactagag agagagaggg 960 gcgtggatgc taccagaacc tgtgtgtggg aggagtcaga gtagggaagg ccagcccact 1020 agggtctgcc catgaggggc gcatggtgca gacccgggca tccactggtc acagttcctg 1080 gggcgctggt acagcgcggg cctcgcctcc aattcaagct ggttccggga gaagaaagag 1140 ctactgttta tgtgccagac agtggtagct ccctccacag aaggcggcct caacctcacc 1200 tctaccttcc taaggtgaga caagggggtg tggcaagttt cgggacagaa ggccccacaa 1260 ccctgtctgg gggacatcct ggggcttgtt cccttacatc aggggtaatc tacccacagg 1320 aaaaaccagt gtgagaccaa ggtgatggta ctgcagccgg caggggttcc cggacagtac 1380 acctacaaca gcccccgtga gtgagccact tccttatctg ggtaaattct gaggtaaatg 1440 ctggcagact gtgcagcccc ctgtcccaaa aggtggggat aatggtcaca ccacaagggt 1500 cagtcatcca agaccagacc tgattgtgaa tctgcctcag gcacacaggg ctacctctct 1560 ccagggactt tggcctctct gaaacccagc cacattcttc caggcccctt tcctgtccaa 1620 atgaaatttc ccagtactct gctgcccaag tgggtcacat acaggcattc cccaaatcct 1680 acccacattt catagctcct atccaagtac ctctttccat gcctcacctg atctatggat 1740 tcccaccaga accctatttc cttggccttc ctgctatatt gtaactcagc ctgatgattt 1800 cttgagtcta agtgttttct gccctctccc caagattcat ggtttggagt tagtgttcag 1860 gaaggaagct agagattggg tggtggccac ccaggggagc acagggaaag aagccaaagc 1920 aggggtggag gaggaaggcc tgagaccctc cccacagaga agcccacaaa ggccaccccc 1980 tccaagcaga gggagatagt gatgtgggag ccacatgtct taatcagtgt catttcttgg 2040 gttcccagac tggggcagct tccactccct ctcagtggta gaaaccgact acgatgagta 2100 cgcgttcctg ttcagcaagg gcaccaaggg cccaggccag gacttccgca tggccaccct 2160 ctacagtagg tatcccagcc cacaggccca cgcacagggc agatgcctga ggttggaaac 2220 agaccaaggc ctaacccaga ggacagtaac gaaggtgtgt gggggcaggg cgagggcttt 2280 tcacctcctg acaccggccc cttctttatc taccaggcag agcccagctt ctgaaggagg 2340 aactgaagga gaaattcatc acctttagca aggaccaggg cctcacagag gaggacattg 2400 ttttcctgcc ccaaccgggt gagggaggct aagctgctga ggagggaatt agtgcagatt 2460 agtgcagcct gtggactggg gagagtgtgg ccgcctacta gtccaggggc tccaaggaaa 2520 gaaatggagg tgtcagtctg tcccgacagt acctcgacct gcagccccct ttattgggaa 2580 ccctcttcct ggtggacacc tcgctgccct gtctgccagc cccctagcta gggatttagg 2640 ggcactaaca gatggagaaa gacacctttt atgttttaaa gaacagattg gagcaggagt 2700 gggatggagt ctgaagtgtg gggctcagcc ttggggaggc ttcgtaaagt ccagggagaa 2760 gacaaagtcc tggtgactgt gggtctaagc ctgatactga ctacttccct gggcttcttt 2820 ctcaacagat aagtgcattc aagagtaaac acaggtgaga gaagtcagtc acaggtaaca 2880 catggtaagt gccatttact cactcaacat aagaccactg agtgctcatg tgaccacgga 2940 gtgcgggctg gggtgggggg gatgcagctg cccaaggact gtccaagtga gacagccaga 3000 gagaaaggac agttccaatt ccagtggcag gaatagagct gatggccaag ggttcatggg 3060 agaaggataa cagcaatggg aagggaccgc cccatgaagc ccatcctgca aaatgagtct 3120 ccaaggaacc agaatggaca agatcgggaa gggactggtg gccagggatg gacatggcga 3180 gtcagagggc tggctcctca cctgtgctgt tgactgagac tctgagacca taggccctgg 3240 agggataccc taggaggccc tggccggaag tgttgtttgg gccccactgg gctcagggtg 3300 ctgccctcat cactgatggc tcttgttctt ctgtgcaggt gatgtggcct caggactccc 3360 gtgctctgtc actcttgaga cccaagccct ggctccccaa agaccttctc cgccctccag 3420 ctttgccttg gtggagaaat aaaatccaaa gcaagtcaga cctcggcttt tgtctgtctg 3480 tcctccgggc catcactata gccctcttat aaatttctca gtatgatgac cagatgggtg 3540 tttgtccctg ctcaagtcct gagtaggaac agcctgacca atgcatcagg ttcagcgcct 3600 actctgcgta gaggggctgc aacctctatg tggtgacata ccccaaccaa gagagtcaca 3660 ggtcctgcaa gctgccagcc acagccaggc ctgggctggg ctgcggggcg tcagtcactt 3720 aaccgctaat cccttagaca agtctacccg tccatccagg gagcctcgga ccctgtaggt 3780 tcttcaaggt atggataaga atctctggat taggcaataa agttggaagg gcaaaaagga 3840 gtcgtttaac agatagagtg ggctggagag gctgcctgta cctctgctcc taccccagcc 3900 ctctgaccag agccctagca tcaaaggcac caaaaccaca gatggccacc caattagtcc 3960 cccttttctt ccaaatttcc acctgagcag ctattcccaa gtcctcatct ctttccctcc 4020 tggttcatag tgagcaggtc tcaggcccaa gcagactaca ccaagattcg ggtcagcgga 4080 gagggttgcc tctgggaagt cttcctgaag aaaggggata cactatgcct gttctgacac 4140 ccgagaagtg ttaggcagcc ctcaggcctg gaggtcactt gggctacctg cccctgactg 4200 ctgagttcct cacccctccc actggaacca tgagctgaca gggtgtgatg tgggagtgca 4260 agtcaatcag tggtctatca cactgggtgt gtcccaggg 4299 Sequence Number (ID): 13 Length: 2929 Molecule Type: DNA Features Location/Qualifiers: - source, 1..2929 > mol_type, other DNA > note, A sequence fragment between exon 1 and exon 7 of Ptgds gene > organism, synthetic construct Residues: cctcaggctc agacacctgc tctactccaa gcaaatggct gctcttccaa tgctgtggac 60 cgggctggtc ctcttgggtc tcttgggatt tccacagacc ccagcccagg gccatgacac 120 agtgcagccc aactttcaac aagacaaggt gagagggtcc cctaccccac acccgaggaa 180 acagaaacct caggtcagag ccaggctttc tctcacaaga gagggtgcgt tgggcgctgt 240 cagccatggg agctgtctgg aaccgcgctg gcacacagcc tggttggtcc acctgactcc 300 gccaggaatg tggctctgat acccacttta ccggaagagt agactggggc gagcactggg 360 acaaagacgg gagctcaaca tcctggggaa ggaaggggtc aatgaggcaa tgagccagcc 420 tactagagag agagaggggc gtggatgcta ccagaacctg tgtgtgggag gagtcagagt 480 agggaaggcc agcccactag ggtctgccca tgaggggcgc atggtgcaga cccgggcatc 540 cactggtcac agttcctggg gcgctggtac agcgcgggcc tcgcctccaa ttcaagctgg 600 ttccgggaga agaaagagct actgtttatg toccagacag tggtagctcc ctccacagaa 660 ggcggcctca acctcacctc taccttccta aggtgagaca agggggtgtg gcaagtttcg 720 ggacagaagg ccccacaacc ctgtctgggg gacatcctgg ggcttgttcc cttacatcag 780 gggtaatcta cccacaggaa aaaccagtgt gagaccaagg tgatggtact gcagccggca 840 ggggttcccg gacagtacac ctacaacagc ccccgtgagt gagccacttc cttatctggg 900 taaattctga ggtaaatgct ggcagactgt gcagccccct gtcccaaaag gtggggataa 960 tggtcacacc acaagggtca gtcatccaag accagacctg attgtgaatc tgcctcaggc 1020 acacagggct acctctctcc agggactttg gcctctctga aacccagcca cattcttcca 1080 ggcccctttc ctgtccaaat gaaatttccc agtactctgc tgcccaagtg ggtcacatac 1140 aggcattccc caaatcctac ccacatttca tagctcctat ccaagtacct ctttccatgc 1200 ctcacctgat ctatggattc ccaccagaac cctatttcct tggccttcct gctatattgt 1260 aactcagcct gatgatttct tgagtctaag tgttttctgc cctctcccca agattcatgg 1320 tttggagtta gtgttcagga aggaagctag agattgggtg gtggccaccc aggggagcac 1380 agggaaagaa gccaaagcag gggtggagga ggaaggcctg agaccctccc cacagagaag 1440 cccacaaagg ccaccccctc caagcagagg gagatagtga tgtgggagcc acatgtctta 1500 atcagtgtca tttcttgggt tcccagactg gggcagcttc cactccctct cagtggtaga 1560 aaccgactac gatgagtacg cgttcctgtt cagcaagggc accaagggcc caggccagga 1620 cttccgcatg gccaccctct acagtaggta tcccagccca caggcccacg cacagggcag 1680 atgcctgagg ttggaaacag accaaggcct aacccagagg acagtaacga aggtgtgtgg 1740 gggcagggcg agggcttttc acctcctgac accggcccct tctttatcta ccaggcagag 1800 cccagcttct gaaggaggaa ctgaaggaga aattcatcac ctttagcaag gaccagggcc 1860 tcacagagga ggacattgtt ttcctgcccc aaccgggtga gggaggctaa gctgctgagg 1920 agggaattag tgcagattag tgcagcctgt ggactgggga gagtgtggcc gcctactagt 1980 ccaggggctc caaggaaaga aatggaggtg tcagtctgtc ccgacagtac ctcgacctgc 2040 agcccccttt attgggaacc ctcttcctgg tggacacctc gctgccctgt ctgccagccc 2100 cctagctagg gatttagggg cactaacaga tggagaaaga caccttttat gttttaaaga 2160 acagattgga gcaggagtgg gatggagtct gaagtgtggg gctcagcctt ggggaggctt 2220 cgtaaagtcc agggagaaga caaagtcctg gtgactgtgg gtctaagcct gatactgact 2280 acttccctgg gcttctttct caacagataa gtgcattcaa gagtaaacac aggtgagaga 2340 agtcagtcac aggtaacaca tggtaagtgc catttactca ctcaacataa gaccactgag 2400 tgctcatgtg accacggagt gcgggctggg gtggggggga tgcagctgcc caaggactgt 2460 ccaagtgaga cagccagaga gaaaggacag ttccaattcc agtggcagga atagagctga 2520 tggccaaggg ttcatgggag aaggataaca gcaatgggaa gggaccgccc catgaagccc 2580 atcctgcaaa atgagtctcc aaggaaccag aatggacaag atcgggaagg gactggtggc 2640 cagggatgga catggcgagt cagagggctg gctcctcacc tgtgctgttg actgagactc 2700 tgagaccata ggccctggag ggatacccta ggaggccctg gccggaagtg ttgtttgggc 2760 cccactgggc tcagggtgct gccctcatca ctgatggctc ttgttcttct gtgcaggtga 2820 tgtggcctca ggactcccgt gctctgtcac tcttgagacc caagccctgg ctccccaaag 2880 accttctccg ccctccagct ttgccttggt ggagaaataa aatccaaag 2929 END