SYNTHESIS METHOD OF TARGETED DRUG nCoVshRNA 2ACE2

Abstract

A synthesis method of a targeted drug nCoVshRNA.2ACE2 of a COVID-19 virus, which includes the following steps: designing a consensus RNAi sequence siRNA of the COVID-19 virus and a variant strain thereof; synthesizing two complementary siRNAs into a small hairpin-shaped shRNA with a loop, and synthesizing ACE2 or a cell penetrating peptide ACE2 with a receptor-binding domain (RBD) as a ligand; and ligating the ACE2 to a sense strand and an antisense strand of the shRNA separately to synthesize the nCoVshRNA.2ACE2 including a shRNA region and an ACE2 region. The bivalent ACE2 functions to neutralize the RBD and deliver the shRNA in a targeted manner; an “shRNA-ACE2-RBD-virus” complex bridged by the ACE2 allows the shRNA to enter target cells with virus infection, thereby avoiding a side effect of non-specific delivery of the shRNA to uninfected cells, as well as resisting the variant strain and neutralizing the virus with the ACE2.

Claims

1. A synthesis method of a targeted drug nCoVshRNA.2ACE2, comprising: synthesizing a shRNA with a sense strand siRNA and an antisense strand siRNA of an RNAi sequence, extending a terminus of the sense strand siRNA or the antisense strand siRNA constituting the shRNA, and ligating to a targeting vector to synthesize an siRNA drug that delivers the shRNA by the targeting vector.

2-10. (canceled).

11. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the RNAi sequence is a consensus conserved gene of a COVID-19 virus and a variant strain thereof, such that the shRNA synthesized with the sense strand siRNA and the antisense strand siRNA of the RNAi sequence is targeted to interfere with the conserved gene, resulting in a broad-spectrum RNAi effect.

12. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the process of synthesizing the shRNA comprises synthesizing two complementary siRNAs of 21 nt to 25 nt, and synthesizing a base sequence that acts as a spacer; ligating the siRNAs and the base sequence to form a hairpin-shaped shRNA with a loop that is in a middle position and separated by the base sequence; and ligating the targeting vector to each single strand of the shRNA.

13. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 11, wherein the process of synthesizing the shRNA comprises synthesizing two complementary siRNAs of 21 nt to 25 nt, and synthesizing a base sequence that acts as a spacer; ligating the siRNAs and the base sequence to form a hairpin-shaped shRNA with a loop that is in a middle position and separated by the base sequence; and ligating the targeting vector to each single strand of the shRNA.

14. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein a compound integrating the siRNA drug and an ACE2 vaccine is synthesized using ACE2 as a vector, for targeted delivery of the shRNA serving as a consensus RNAi target of a coronavirus; wherein the targeted delivery is such that the binding of the ACE2 in the nCoVshRNA.2ACE2 and a receptor binding domain (RBD) of an nCoV form a complex shRNA-ACE2-RBD-nCoV, such that the shRNA is delivered to target cytoplasm with nCoV infection, and the shRNA follows the ACE2 through an ACE2 receptor channel of a target cell and is delivered to the target cytoplasm due to a cell penetrating peptide effect of the ACE2; wherein the targeted drug is such that the ACE2 specifically delivers the shRNA to a target cell that is susceptible to the nCoV infection due to expression of an ACE2 receptor, such that the shRNA only enters the target cell that expresses the ACE2 receptor to mediate RNAi against the variant strain, and the nCoV infection of the target cell is directly inhibited through binding the ACE2 to the RBD; and, wherein the ACE2 vaccine is the nCoVshRNA.2ACE2 prepared by ligating the targeting vector ACE2 to each single strand of the shRNA, an essence of the vaccine being to ligate the ACE2 with antigenic properties into a dimer ACE2 by the shRNA with immunologic adjuvant properties, since the dimer ACE2 has a more complex antigenic structure than that of the ACE2 and the shRNA serves as an immunologic adjuvant, wherein the dimer ACE2 has stronger immunogenicity to stimulate the body to produce anti-ACE2, and the anti-ACE2 competes with the nCoV for binding to the ACE2 receptor of the target cell, thereby competitively inhibiting the nCoV infection of the target cell.

15. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 12, wherein a compound integrating the siRNA drug and an ACE2 vaccine is synthesized using ACE2 as a vector, for targeted delivery of the shRNA serving as a consensus RNAi target of a coronavirus; wherein the targeted delivery is such that the binding of the ACE2 in the nCoVshRNA.2ACE2 and a receptor binding domain (RBD) of an nCoV form a complex shRNA-ACE2-RBD-nCoV, such that the shRNA is delivered to target cytoplasm with nCoV infection, and the shRNA follows the ACE2 through an ACE2 receptor channel of a target cell and is delivered to the target cytoplasm due to a cell penetrating peptide effect of the ACE2; the targeted drug is such that the ACE2 specifically delivers the shRNA to a target cell that is susceptible to the nCoV infection due to expression of an ACE2 receptor, such that the shRNA only enters the target cell that expresses the ACE2 receptor to mediate RNAi against the variant strain, and the nCoV infection of the target cell is directly inhibited through binding the ACE2 to the RBD; and, wherein the ACE2 vaccine is the nCoVshRNA.2ACE2 prepared by ligating the targeting vector ACE2 to each single strand of the shRNA, an essence of the vaccine being to ligate the ACE2 with antigenic properties into a dimer ACE2 by the shRNA with immunologic adjuvant properties, since the dimer ACE2 has a more complex antigenic structure than that of the ACE2 and the shRNA serves as an immunologic adjuvant, wherein the dimer ACE2 has stronger immunogenicity to stimulate the body to produce anti-ACE2, and the anti-ACE2 competes with the nCoV for binding to the ACE2 receptor of the target cell, thereby competitively inhibiting the nCoV infection of the target cell.

16. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 13, wherein a compound integrating the siRNA drug and an ACE2 vaccine is synthesized using ACE2 as a vector, for targeted delivery of the shRNA serving as a consensus RNAi target of a coronavirus; wherein the targeted delivery is such that binding of the ACE2 in the nCoVshRNA.2ACE2 and a receptor binding domain (RBD) of an nCoV form a complex shRNA-ACE2-RBD-nCoV, such that the shRNA is delivered to target cytoplasm with nCoV infection, and the shRNA follows the ACE2 through an ACE2 receptor channel of a target cell and is delivered to the target cytoplasm due to a cell penetrating peptide effect of the ACE2; the targeted drug is such that the ACE2 specifically delivers the shRNA to a target cell that is susceptible to the nCoV infection due to expression of an ACE2 receptor, such that the shRNA only enters the target cell that expresses the ACE2 receptor to mediate RNAi against the variant strain, and, wherein the nCoV infection of the target cell is directly inhibited through binding the ACE2 to the RBD; and, wherein the ACE2 vaccine is the nCoVshRNA.2ACE2 prepared by ligating the targeting vector ACE2 to each single strand of the shRNA, an essence of the vaccine being to ligate the ACE2 with antigenic properties into a dimer ACE2 by the shRNA with immunologic adjuvant properties, since the dimer ACE2 has a more complex antigenic structure than that of the ACE2 and, wherein the shRNA serves as an immunologic adjuvant, and the dimer ACE2 has stronger immunogenicity to stimulate the body to produce anti-ACE2, the anti-ACE2 competes with the nCoV for binding to the ACE2 receptor of the target cell, thereby competitively inhibiting the nCoV infection of the target cell.

17. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the siRNA for synthesizing the shRNA comprises any one or more of RNAi sequences SEQ ID NO: 1 to SEQ ID NO: 58 of the COVID-19 virus.

18. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 14, wherein the siRNA for synthesizing the shRNA comprises any one or more of RNAi sequences SEQ ID NO: 1 to SEQ ID NO: 58 of the COVID-19 virus.

19. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 15, wherein the siRNA for synthesizing the shRNA comprises any one or more of RNAi sequences SEQ ID NO: 1 to SEQ ID NO: 58 of the COVID-19 virus.

20. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 16, wherein the siRNA for synthesizing the shRNA comprises any one or more of RNAi sequences SEQ ID NO: 1 to SEQ ID NO: 58 of the COVID-19 virus.

21. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the siRNA for synthesizing the shRNA comprises any one or more of: SEQ ID NO: 16 to SEQ ID NO: 18 or SEQ ID NO: 49 to SEQ ID NO: 51 targeting an N gene of the COVID-19 virus, SEQ ID NO: 20 to SEQ ID NO: 22 or SEQ ID NO: 52 to SEQ ID NO: 54 targeting an ORF1ab gene of the COVID-19 virus, SEQ ID NO: 30 to SEQ ID NO: 32 or SEQ ID NO: 56 to SEQ ID NO: 58 targeting an S gene of the COVID-19 virus; or the siRNA for synthesizing the shRNA comprises SEQ ID NO: 5.

22. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 17, wherein the siRNA for synthesizing the shRNA comprises any one or more of: SEQ ID NO: 16 to SEQ ID NO: 18 or SEQ ID NO: 49 to SEQ ID NO: 51 targeting an N gene of the COVID-19 virus, SEQ ID NO: 20 to SEQ ID NO: 22 or SEQ ID NO: 52 to SEQ ID NO: 54 targeting an ORF1ab gene of the COVID-19 virus, or SEQ ID NO: 30 to SEQ ID NO: 32 or SEQ ID NO: 56 to SEQ ID NO: 58 targeting an S gene of the COVID-19 virus; or the siRNA for synthesizing the shRNA comprises SEQ ID NO: 5.

23. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 18, wherein the siRNA for synthesizing the shRNA comprises any one or more of SEQ ID NO: 16 to SEQ ID NO: 18 or SEQ ID NO: 49 to SEQ ID NO: 51 targeting an N gene of the COVID-19 virus, SEQ ID NO: 20 to SEQ ID NO: 22 or SEQ ID NO: 52 to SEQ ID NO: 54 targeting an ORF1ab gene of the COVID-19 virus, or SEQ ID NO: 30 to SEQ ID NO: 32 or SEQ ID NO: 56 to SEQ ID NO: 58 targeting an S gene of the COVID-19 virus; or the siRNA for synthesizing the shRNA comprises SEQ ID NO: 5.

24. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 19, wherein the siRNA for synthesizing the shRNA comprises any one or more of: SEQ ID NO: 16 to SEQ ID NO: 18 or SEQ ID NO: 49 to SEQ ID NO: 51 targeting an N gene of the COVID-19 virus, SEQ ID NO: 20 to SEQ ID NO: 22 or SEQ ID NO: 52 to SEQ ID NO: 54 targeting an ORF1ab gene of the COVID-19 virus, or SEQ ID NO: 30 to SEQ ID NO: 32 or SEQ ID NO: 56 to SEQ ID NO: 58 targeting an S gene of the COVID-19 virus; or the siRNA for synthesizing the shRNA comprises SEQ ID NO: 5.

25. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 20, wherein the siRNA for synthesizing the shRNA comprises any one or more of: SEQ ID NO: 16 to SEQ ID NO: 18 or SEQ ID NO: 49 to SEQ ID NO: 51 targeting an N gene of the COVID-19 virus, SEQ ID NO: 20 to SEQ ID NO: 22 or SEQ ID NO: 52 to SEQ ID NO: 54 targeting an ORF1ab gene of the COVID-19 virus, or SEQ ID NO: 30 to SEQ ID NO: 32 or SEQ ID NO: 56 to SEQ ID NO: 58 targeting an S gene of the COVID-19 virus; or the siRNA for synthesizing the shRNA comprises SEQ ID NO: 5.

26. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the process of synthesizing the nCoVshRNA.2ACE2 comprises: ligating the ACE2 or a polypeptide thereof with the shRNA or the siRNA to form a compound, or inserting the shRNA or the siRNA into the ACE2 or the polypeptide thereof and ligating to form the compound; and modifying the compound with a liposome or lipid nanoparticles.

27. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the ACE2 comprises extracellular ACE2 at amino acids 1 to 740, transmembrane ACE2 at amino acids 741 to 763, intracellular ACE2 at amino acids 764 to 805, and an amino acid sequence-optimized ACE2 polypeptide.

28. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the ligating or the synthesizing comprises ligating the ACE2 with a 3′-end of the antisense strand and a 5′-end or a 3′-end of the sense strand of the shRNA; wherein the ligating or the synthesizing comprises conducting the ligating by chemical coupling or covalent coupling with a carboxyhydrazone bond, a disulfide bond, a phosphodiester bond, a phosphorodithioate bond, a thioether bond, an oxime bond, an amide bond, or a maleimide-thiol bond that have a spacer arm; and the ligating or the synthesizing comprises ligating the ACE2 or the RBD or ligating a polypeptide of the two separately on the sense strand and the antisense strand of the shRNA.

29. The synthesis method of a targeted drug nCoVshRNA.2ACE2 according to claim 1, wherein the nCoVshRNA.2ACE2 comprises the siRNA/shRNA prepared with any one or more of SEQ ID NO: 1 to SEQ ID NO: 58, a ligation product ACE2-siRNA/ACE2-shRNA with the ACE2, and a liposome complex of the siRNA, the ACE2-siRNA, or the ACE2-shRNA; the ACE2-siRNA/ACE2-shRNA comprises 2ACE2-shRNA3, 2ACE2-shRNA5, 2ACE2-shRNA8, and ACE2-siRNA; the liposome complex of the ACE2-siRNA/ACE2-shRNA comprises 2ACE2-shRNA3/ch1, 2ACE2-shRNA5/ch1, 2ACE2-shRNA8/ch1, 4ACE2-2shRNA3/ch1, or ACE2-siRNA/lip.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1 shows a technical circuit diagram for preparing nCoVshRNA.2ACE2 in the present disclosure;

[0035] FIG. 2 shows a structural representation of the nCoVshRNA.2ACE2 in the present disclosure;

[0036] FIG. 3 shows a schematic diagram of the nCoVshRNA.2ACE2 and use thereof in the present disclosure;

[0037] FIG. 4 shows a schematic diagram of ACE2-targeted delivery of a liposome-modified shRNA of the present disclosure; and

[0038] FIG. 5 shows a schematic diagram of ACE2-targeted delivery of a liposome-modified siRNA of the present disclosure.

[0039] In FIG. 1, after conserved gene screening, broad-spectrum anti-variant strain target siRNA screening by targeting conserved genes, shRNA synthesis, and ACE2 synthesis, the nCoVshRNA.2ACE2 or ACE2shRNA is finally synthesized.

[0040] In FIG. 2, 1 is a loop, 2 is a shRNA formed by two complementary sense and antisense strands, and 3 is two ACE2 polypeptides (proteins); the two ACE2 polypeptides are ligated to the sense and antisense strands of the shRNA, respectively. shRNA is protected by ACE2 and then delivered by the ACE2 to the virus RBD or the ACE2 receptor channel, and then specifically enters the target cytoplasm with the virus RBD through the ACE2 channel to degrade the target gene of virus.

[0041] In FIG. 3, 1 is the loop formed by the base sequence between the sense and antisense strands of the small hairpin shRNA; 2 is the shRNA formed by complementary combination of two sense and antisense strands of siRNA, where the siRNA takes the conserved gene of coronavirus as an interference target and has a targeted gene therapy effect of broad-spectrum anti-variant strain properties; 3 is the ACE2 ligated to the sense and antisense strands of the shRNA; 4 is the coronavirus; 5 is the RBD of a coronavirus S protein; 6 is the cells; 7 is the expressed ACE2 receptors; and 8 is the cells that do not express ACE2. As shown in FIG. 2, the nCoVshRNA.2ACE2 is composed of the loop 1, the shRNA 2, and the ACE2 3; the coronavirus 4 infects cells 7 through specific binding of its RBD 5 to ACE2 receptor 6, but the coronavirus 4 does not infect cells 8 that do not express ACE2; ACE2 3 in the nCoVshRNA.2ACE2, like ACE2 6 expressed by cells 7, can also bind to the RBD 5 of coronavirus 4, such that the ACE2 3 can compete with the ACE2 6 for binding to the RBD 5, such that the ACE2 3 has an ability to inhibit the virus 4 from infecting the cells 7; the nCoVshRNA.2ACE2 plays the role of a vaccine in a later stage, since the ACE2 3 can stimulate the host to produce anti-ACE2, and the anti-ACE2 can block the ACE2 6, thereby inhibiting the virus 4 from infecting cells 7; more importantly, through bridging of the ACE2 3, a complex of “shRNA 2-ACE2 3-RBD 5-virus 4” is formed, allowing shRNA 2 to enter cell 7 with virus 4, targeting to interfere with the replication of virus 4 in cells 7, avoiding toxic and side effects caused by the non-specific entry of the shRNA 2 into cells 8 that are not infected with virus 4.

[0042] In FIGS. 4, 1 and 2 are the loop and shRNA wrapped by liposome 4, respectively, where the shRNA is formed by the complementary combination of two sense and antisense strands of siRNA, and the siRNA takes the coronavirus conserved gene as an interference target; 3 is ACE2 exposed outside the liposome 4, plays a role in targeted delivery; liposome 4 protects shRNA and induces endocytosis; 5 is polyethylene glycol (PEG), the PEG can release siRNA slowly with long-term circulation. As shown in FIG. 3, a complex of ACE2-shRNA/Lip is formed.

[0043] In FIG. 5, 1 is the siRNA encapsulated by liposomes, 2 is a liposome layer, 3 is a PEG layer, and 4 is the ACE2. The siRNA acts as RNAi; the liposome protects siRNA and induces endocytosis; the PEG enables slow release and long-term circulation of siRNA; and the ACE2 is in the outermost layer and plays a role of targeted delivery of the siRNA. As shown in FIG. 4, a complex of ACE2-siRNA/Lip is formed.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0044] Below in conjunction with accompanying drawings 1, 2, 3, 4 and 5, the specific implementation method of the present disclosure is described in detail, but these exemplary descriptions do not constitute any limitation to the protection scope defined by the claims of the present disclosure.

I. Design of siRNA by Targeting Ultra-Conserved Genes, Conserved Genes, or Conserved Microsatellites

1. Design of Ultra-Conserved Genes, Conserved Genes, and Conserved Microsatellites

[0045] As shown in FIG. 1 of the technical circuit, a whole genome sequence (cDNA) of β-coronavirus (especially COVID-19 virus and its variant strains) is downloaded from the Genbank database (http://www.NCBI.nlm.nih.gov/genome/), the longest common subsequence is searched in the whole genome sequence to obtain the ultra-conserved genes or conserved genes; with Clustal W software, sequence alignment is conducted on the whole genome downloaded from the Genbank database, the similarity between different sequences is detected, and conserved microsatellite sequences are screened; with MEGA6.0 molecular evolution genetic analysis software, an amino acid germline molecular evolution tree is constructed by using neighbor-joining (N-J) on the downloaded coronavirus amino acid sequence, and molecular variation characteristics of the amino acid sequence were analyzed and optimized, so as to infer conserved genes sequence.

[0046] The following three longest and second longest ultra-conserved subsequences are obtained, with a length of 22 bp to 30 bp, which are comparable to a length of small RNAs, but these three subsequences are not included in higher organisms, especially human beings. A specific sequence is as follows:

TABLE-US-00001 (Subsequence 1) =  SEQ ID NO: 1 ttaatacgacctctctgttggattttgaca (30 bp); (Subsequence 2) =  SEQ ID NO: 2 ggttcgcaacttcacaca gagt (22 bp);  and (Subsequence 3) =  SEQ ID NO: 3 caggcgtttgttggttgattaa (22 bp).

[0047] The following three longest and second longest conserved subsequences are obtained, with a length of 22 bp to 30 bp, which are comparable to a length of small RNAs, but these three conserved subsequences are not included in higher organisms, especially human beings:

TABLE-US-00002 (Subsequence 1) =  SEQ ID NO: 4 gttttacgacaacgatgttggtttaggaca (30 bp); (Subsequence 2) =  SEQ ID NO: 5 ggttcggttgttatatacgata (22 bp); (Subsequence 3) =  SEQ ID NO: 6 ggttcagagagtctcctattta (22 bp).

[0048] The following five conserved microsatellite loci with repeated nucleotides are obtained, where microsatellites are CTCTCT, AGAGAG, AAAAAAA, TATATA, and CACACA, respectively:

2. Design of Common Target siRNA for COVID-19 Virus Variant Strains

[0049] A whole genome sequence (cDNA) of β-coronavirus (especially the COVID-19 virus and its variant strains) is downloaded from the Genbank database (http://www.NCBI.nlm.nih.gov/genome/); with Ambion's shRNA online design software (http://www.ambion.com/techlib/misc/siRNAtools.html) or DSIR and the like, multiple siRNA candidates are obtained with a length of about 19 nt; based on a Tm value of RNA binding and specificity alignment results, the siRNA is preferably selected. Therefore, RNAi sequences (siRNAs) of each strain and common RNAi sequences (common target siRNAs) of each strain are obtained from the E gene, M gene, N gene, ORF1ab gene, and S gene of 18 COVID-19 virus strains and their variant strains that are discovered so far. The common siRNAs of each strain are shown in Table 1, with sequences marked as SEQ ID NO: 7 to SEQ ID NO: 40. For example, the siRNAs (SEQ ID NO: 41 to SEQ ID NO: 58) marked in Tables 2 to 5 are the common target siRNAs of NC_045512.2, Delta strain, and Omicron strain, and the siRNAs without marking are their respective RNAi sequences (siRNAs). It is seen that although the earliest NC_045512.2 strain has mutated into the Delta strain and the recent Omicron strain, each strain, except for its own unique targeting interference sequence siRNA (parts without marking), still remains unchanged and theoretically has common conserved sequences SEQ ID NO: 41 to SEQ ID NO: 58 with a targeted interference effect.

TABLE-US-00003 TABLE 1  Common target siRNAs (SEQ ID NO: 7 to SEQ ID NO: 40) screened from 18 COVID-19 virus variant strains Common target siRNA  (ss sequence) of Off- Variant strain Region Position variant strains Score targets SEQ ID NO: (1) B.1.617.1, E gene 7 gtggtattcttgctagttaca 95.1 0 SEQ ID NO: 7 (2) B.1.1.529, M gene 35 ggatttgtcttctacaatttg 95.7 0 SEQ ID NO: 8 (3) B.1.1.7,  146 cgaacgctttcttattacaaa 94.8 0 SEQ ID NO: 9 (4) P.1,  130 cactgttgctacatcacgaac 94.8 0 SEQ ID NO: 10 (5) BA.2,  6 cctagtaataggtttcctatt 94.7 0 SEQ ID NO: 11 (6) B.1.351,  181 gcgtgtagcaggtgactcagg 94.3 0 SEQ ID NO: 12 (7) B.1.525,  18 gaccgcttctagaaagtgaac 93.3 0 SEQ ID NO: 13 (8) B.1.617.2, 109 caaggacctgcctaaagaaat 91 0 SEQ ID NO: 14 (9) C.1.2,  33 atggatttgtcttctacaatt 91.0 0 SEQ ID NO: 15 (10) B.1.621.1, N gene 137 cgtagtcgcaacagttcaaga 100.7 0 SEQ ID NO: 16 (11) B.1.621,  12 ggtggaccctcagattcaact 99.9 0 SEQ ID NO: 17 (12) P.2, 56 ggttcaccgctctcactcaac 91.4 0 SEQ ID NO: 18 (13) N.9,  39 cgggaacgtggttgacctaca 90.4 0 SEQ ID NO: 19 (14) C.37.1, ORFlab 7687 gcttatgtgtcaacctatact 106.6 0 SEQ ID NO: 20 (15) C.37,  gene 8304 ggttgaagcagttaattaaag 105.1 0 SEQ ID NO: 21 (16) B.1.427, 8613 cgatattacgcacaactaatg 104.6 0 SEQ ID NO: 22 (17) B.1.351.2, 10519 agaccatgttgacatactagg 104.4 0 SEQ ID NO: 23 (18) B.1.351.3 6719 ggttctttaatctactcaacc 104.4 0 SEQ ID NO: 24 1805 ggtggtgttgttcagttgact 104.3 0 SEQ ID NO: 25 1619 getcgtgttgtacgatcaatt 104.2 0 SEQ ID NO: 26 11328 agtgtataatgctagtttatt 103.9 0 SEQ ID NO: 27 4932 ggtacatgtcagcattaaatc 103.8 0 SEQ ID NO: 28 2935 gttagatgatgatagtcaaca 103.5 0 SEQ ID NO: 29 S gene 4 gattgtttaggaagtctaatc 103.6 0 SEQ ID NO: 30 29 gtctctagtcagtgtgttaat 101.5 0 SEQ ID NO: 31 33 ctactaatgttgttattaaag 99.8 0 SEQ ID NO: 32 6 ggtgttcttactgagtctaac 99.2 0 SEQ ID NO: 33 68 gaaacaaagtgtacgttgaaa 97.1 0 SEQ ID NO: 34 155 gttagatttcctaatattaca 96.7 0 SEQ ID NO: 35 7 ctgtgatgttgtaataggaat 94.9 0 SEQ ID NO: 36 271 ggagtcaaattacattacaca 94.6 0 SEQ ID NO: 37 12 gettactctaataactctatt 94.6 0 SEQ ID NO: 38 2 ggtaactgtgatgttgtaata 94.1 0 SEQ ID NO: 39 1 tggtaactgtgatgttgtaat 94.1 0 SEQ ID NO: 40

TABLE-US-00004 TABLE 2 siRNA candidate sequences of E gene of NC_045512.2, DELTA and OMICRON strains of COVID-19 virus Off- siRNA ID (E) Position ss sequence (siRNA) Score targets SEQ ID NO: NC_045512.2 1 16 ggaagagacaggtacgttaat 101.7 0 SEQ ID NO: 62 2 17 gaagagacaggtacgttaata 98 0 SEQ ID NO: 63 3 26 96.4 0 SEQ ID NO: 41 5 68 95.1 0 SEQ ID NO: 42 6 31 95 0 SEQ ID NO: 43 DELTA 1 16 ggaagagacaggtacgttaat 101.7 0 SEQ ID NO: 62 2 17 gaagagacaggtacgttaata 98 0 SEQ ID NO: 63 3 26 96.4 0 SEQ ID NO: 41 5 68 95.1 0 SEQ ID NO: 42 6 31 95 0 SEQ ID NO: 43 OMICRON 1 16 ggaagagataggtacgttaat 102.3 0 SEQ ID NO: 62 2 17 gaagagataggtacgttaata 98.6 0 SEQ ID NO: 63 3 68 95.1 0 SEQ ID NO: 42 4 31 95 0 SEQ ID NO: 43 5 26 94.9 1 SEQ ID NO: 41

TABLE-US-00005 TABLE 3 siRNA candidate sequences of M gene of NC_045512.2, DELTA and OMICRON strains of COVID-19 virus Off- siRNA ID (M) Position ss sequence(sirna) Score targets SEQ ID NO: NC_045512.2 1 200 gctgctgtttacagaataaat 103.4 0 SEQ ID NO: 64 2 13 cggtactattaccgttgaaga 97.4 0 SEQ ID NO: 65 3 230 97.2 0 SEQ ID NO: 44 4 90 95.7 0 SEQ ID NO: 45 5 518 94.8 0 SEQ ID NO: 46 6 502 94.8 0 SEQ ID NO: 47 9 61 94.7 0 SEQ ID NO: 48 DELTA 1 200 gctgctgtttacagaataaat 103.4 9 SEQ ID NO: 64 2 13 cggtactattaccgttgaaga 97.4 1 SEQ ID NO: 65 3 230 97.2 0 SEQ ID NO: 44 4 90 95.7 0 SEQ ID NO: 45 5 518 94.8 0 SEQ ID NO: 46 6 502 94.8 0 SEQ ID NO: 47 9 61 94.7 0 SEQ ID NO: 48 OMICRON 1 200 gctgctgtttacagaataaat 103.4 9 SEQ ID NO: 64 2 5 ggttccaacggtactattacc 99.5 0 SEQ ID NO: 66 3 3 cggtactattaccgttgaaga 97.4 1 SEQ ID NO: 65 4 230 97.2 0 SEQ ID NO: 44 5 90 95.7 0 SEQ ID NO: 45 6 518 94.8 0 SEQ ID NO: 46 7 502 94.8 0 SEQ ID NO: 47 9 61 94.7 0 SEQ ID NO: 48

TABLE-US-00006 TABLE 4 siRNA candidate sequences of N gene of NC_045512.2, DELTA and OMICRON strains of COVID-19 virus Off- siRNA ID (N) Position ss sequence(sirna) Score targets SEQ ID NO: NC_045512.2 1 260 cgaagagctaccagacgaatt 101.1 1 SEQ ID NO: 67 2 1150 gagacagaagaaacagcaaac 100.1 36 SEQ ID NO: 68 3 563 100.7 0 SEQ ID NO: 49 4 1198 ggatgatttctccaaacaatt 100.2 12 SEQ ID NO: 69 5 50 ggtggaccctcagattcaact 99.9 1 SEQ ID NO: 17 6 251 99.9 0 SEQ ID NO: 50 14 306 95.6 0 SEQ ID NO: 51 DELTA 1 260 cgaagagctaccagacgaatt 101.1 1 SEQ ID NO: 67 2 1150 gagacagaagaaacagcaaac 101.1 36 SEQ ID NO: 68 3 563 100.7 0 SEQ ID NO: 49 4 1198 ggatgatttctccaaacaatt 100.2 12 SEQ ID NO: 69 5 50 ggtggaccctcagattcaact 99.9 1 SEQ ID NO: 17 6 251 99.9 0 SEQ ID NO: 50 14 315 95.6 0 SEQ ID NO: 51 OMICRON 1 251 cgaagagctaccagacgaatt 101.1 1 SEQ ID NO: 67 2 1141 gagacagaagaaacagcaaac 101.1 36 SEQ ID NO: 68 3 554 100.7 0 SEQ ID NO: 49 4 1189 ggatgatttctccaaacaatt 100.2 12 SEQ ID NO: 69 5 50 ggtggaccctcagattcaact 99.9 1 SEQ ID NO: 17 6 242 99.9 0 SEQ ID NO: 50 14 306 95.6 0 SEQ ID NO: 51

TABLE-US-00007 TABLE 5 siRNA candidate sequences of ORFlab gene of NC_045512.2, DELTA and OMICRON strains of COVID-19 virus Off- siRNA ID (ORF) Position ss sequence(sirna) Score targets SEQ ID NO: NC_045512.2 1 13351 ggacgaagatgacaatttaat 111.5 0 SEQ ID NO: 70 2 5654 ggtgttgtttgtacagaaatt 107.7 0 SEQ ID NO: 71 3 17851 cctcagtgttgacactaaatt 107.2 0 SEQ ID NO: 72 4 7687 106.6 0 SEQ ID NO: 52 9 8304 105.1 0 SEQ ID NO: 53 13 8610 104.6 0 SEQ ID NO: 54 DELTA 1 13351 ggacgaagatgacaatttaat 111.5 7 SEQ ID NO: 70 2 5654 ggtgttgtttgtacagaaatt 107.7 3 SEQ ID NO: 71 3 17851 cctcagtgttgacactaaatt 107.2 6 SEQ ID NO: 72 4 7687 106.6 0 SEQ ID NO: 52 9 8304 105.1 0 SEQ ID NO: 53 13 8613 104.6 0 SEQ ID NO: 54 OMICRON 1 13339 ggacgaagatgacaatttaat 111.5 7 SEQ ID NO: 70 2 5654 ggtgttgtttgtacagaaatt 107.7 3 SEQ ID NO: 71 3 17839 cctcagtgttgacactaaatt 107.2 6 SEQ ID NO: 72 4 7684 106.6 0 SEQ ID NO: 52 9 8301 105.1 0 SEQ ID NO: 53 13 8610 104.6 0 SEQ ID NO: 54

TABLE-US-00008 TABLE 6 siRNA candidate sequences of S gene of NC_045512.2, DELTA and OMICRON strains of COVID-19 virus Off- siRNA ID (S) Position ss sequence(sirna) Score targets SEQ ID NO: NC_045512.2 1 1837 ggatgttaactgcacagaagt 105.8 0 SEQ ID NO: 73 2 1359 103.6 0 SEQ ID NO: 55 3 1074 gcaactgtgttgctgattatt 101.9 0 SEQ ID NO: 74 4 29 101.5 0 SEQ ID NO: 56 8 366 99.8 0 SEQ ID NO: 57 13 1646 99.2 0 SEQ ID NO: 58 DELTA 1 1359 103.6 0 SEQ ID NO: 55 2 1837 gggtgttaactgcacagaagt 102.4 0 SEQ ID NO: 75 3 1353 ggtatagattgtttaggaagt 102 0 SEQ ID NO: 76 5 29 101.5 0 SEQ ID NO: 56 9 366 99.8 0 SEQ ID NO: 57 13 1646 99.2 0 SEQ ID NO: 58 OMICRON 1 1350 103.6 0 SEQ ID NO: 55 2 1828 gggtgttaactgcacagaagt 102.4 0 SEQ ID NO: 75 3 1065 gcaactgtgttgctgattatt 101.9 1 SEQ ID NO: 74 4 29 101.5 0 SEQ ID NO: 56 8 360 99.8 0 SEQ ID NO: 57 12 1637 99.2 0 SEQ ID NO: 58

3. Screening of siRNA by Targeting Ultra-Conserved Genes, Conserved Genes, or Conserved Microsatellites

[0050] With the Clustal W software or other software, gene sequence alignment is conducted on the ultra-conserved genes, conserved genes, and conserved microsatellites with conventionally-screened siRNAs, to detect a similarity between different sequences; multiple pairs of siRNAs are designed, which are the ultra-conserved genes, conserved genes, or conserved microsatellites, as well as RNAi target sites (siRNAs by targeting ultra-conserved genes, conserved genes, or conserved microsatellites are designed).

[0051] (1) siRNA by targeting ultra-conserved genes and conserved microsatellites (S1/S2):

TABLE-US-00009 (Subsequence 1) =  SEQ ID NO: 1 ttaatacgacctctctgttggattttgaca (30 bp); (Subsequence 2) =  SEQ ID NO: 2 ggttcgcaacttcacaca gagt (22 bp);

[0052] (2) siRNA by targeting conserved genes and conserved microsatellites (S3/S4):

TABLE-US-00010 (Subsequence 3) =  SEQ ID NO: 5 ggttcggttgttatatacgata (22 bp); (Subsequence 4) =  SEQ ID NO: 6 ggttcagagagtctcctattta (22 bp).

[0053] Through the above design, siRNAs that theoretically resist coronavirus variant strains are obtained with ultra-conserved genes, conserved genes, or conserved microsatellites as interference targets, named siRNA1/2/3/4.

II. Validation of Common Target siRNAs

1. Synthesis of siRNA/shRNA

[0054] According to the RNAi mechanism, when siRNA effectively interferes with the mRNA expression of the S gene, an S protein-deficient virus that loses infectivity is formed. When the siRNA effectively interferes with the mRNA expression of the N gene, the packaging and replication of the virus may be inhibited. When siRNA effectively interferes with the mRNA expression of ORF1a or ORF1b gene, the synthesis of viral RNA polymerase (RdRp) or protein processing enzyme (3CLpro) may be affected. However, the M and E genes are membrane genes of the virus, with an inhibitory effect of their gene defects on the virus being not obvious. Therefore, siRNA targeting N gene (SEQ ID NO: 16 to SEQ ID NO: 18, SEQ ID NO: 49 to SEQ ID NO: 51), siRNA targeting ORF1ab gene (SEQ ID NO: 20 to SEQ ID NO: 22, SEQ ID NO: 52 to SEQ ID NO: 54), and siRNA targeting S gene (SEQ ID NO: 30 to SEQ ID NO: 32, SEQ ID NO: 56 to SEQ ID NO: 58), and SEQ ID NO: 1 to SEQ ID NO: 2 and SEQ ID NO: 5 to SEQ ID NO: 6 are selected for synthesis. In addition, according to polyclonal restriction enzyme cleavage site of a pSilencer4.1.CMV.neo interference vector, a shRNA template capable of expressing a hairpin structure is designed; each template is composed of two mostly complementary 55 bp single-stranded DNAs, and the single-stranded DNA can be annealed and complementary to form a double-stranded DNA with sticky ends of Bam HI and Hind III restriction sites for ligation with a linearized pSilencer4.1.CMV.neo. According to the designed siRNA and its shRNA template, a company is commissioned to synthesize the siRNA.

2. Construction of shRNA Expression Vector

[0055] The shRNA is ligated with the linearized interference vector pSilencer4.1.CMV.neo, and then identified to construct a shRNA expression plasmid, and transformed into DHSa to obtain the shRNA expression vector.

3. Identification of Effect of shRNA Expression (Interference) Vector

[0056] According to the synthesized siRNA/shRNA and its constructed expression plasmid, a corresponding target gene is selected for synthesis or PCR amplification, a fluorescent tag vector is constructed, and co-transfected into type II alveolar epithelial cells (AEC2s) or 293T cells separately with the shRNA expression plasmid, and the cells are identified. A conventional method of PCR amplification is as follows:

[0057] Primer design: upstream and downstream primers are designed, a start codon is added at a 5′-end of the upstream primer, and a homology arm is added to the 5′-end of the primer for homologous recombination with a vector in order to clone an amplification product into pEGFP-N1.

[0058] Target gene amplification: gene amplification, product recovery, and purification are conducted according to a gene amplification reaction system and reaction conditions provided by a Shanghai Sangon kit to obtain the amplification product.

[0059] Linearization of pEGFP-N1: a DH5a strain containing a pEGFP-N1 plasmid is resuscitated, the plasmid is extracted by the kit, the concentration is determined, restriction digestion is conducted, and a linearized vector is identified and recovered by 0.8% agarose gel electrophoresis.

[0060] An amplified target gene is ligated to a fluorescent tag vector (pEGFP-N1): the ligation is conducted with a GenScript's homologous recombination kit, and a ligated product can be stored at −20° C. for later use or transformed immediately.

[0061] Identification of effects of a shRNA interference vector: the interference vector (pSilencer-shRNA) and the fluorescent tag vector (pEGFP-N/S/ORF1ab) are co-transfected into 293T cells, where the interference vector and the tag vector have a mass ratio of 1:2, while a control is set up; the fusion expression of a GFP protein in the cells is observed 48 h after the transfection, and an interference effect is evaluated according to a fluorescence intensity.

[0062] Flow cytometry: to quantitatively analyze the interference effects of different interference vectors, flow cytometry is conducted to analyze a proportion of fluorescent protein-expressing cells in the total number of cells.

[0063] Westernbolt analysis: (1) cell collection and lysis: cells are lysed with RIPA; (2) SDS-PAGE protein electrophoresis: an SDS-PAGE gel is prepared, a sample is added to an equal volume of a 2×SDS buffer, boiled in boiling water for 5 min, treated in an ice bath for 2 min, and then centrifuged at 12,000×g for 10 min; (3) Western blot detection: after conducting transferring, blocking, primary antibody binding, washing, secondary antibody binding, and color development, results are observed.

[0064] RT-PCR detection of mRNA: relative fluorescence quantitative RT-PCR is conducted to detect a relative expression level of the target genes in transfected cells; according to a standard curve, a copy number of the target gene and a B-actin reference gene is converted from a CT value; a relative expression level of the viral gene mRNA (the number of copies of the target gene/the number of copies of the B-actin) is corrected with the B-actin reference gene, such that an interference effect is quantitatively evaluated.

4. Obtaining siRNA/shRNA with a High Silencing Efficiency

[0065] After design, synthesis, screening, iterative design, resynthesis, and verification at the cellular level, siRNAs with a high silencing efficiency are obtained. The siRNAs have sequences of SEQ ID NO: 1 (named shRNA1, the same below), SEQ ID NO: 2 (shRNA2), SEQ ID NO: 5 (shRNA3), SEQ ID NO: 16 (shRNA4) and SEQ ID NO: 49 (shRNA5) targeting the N gene, SEQ ID NO: 21 (shRNA6) and SEQ ID NO: 52 (shRNA7) targeting the ORF1ab gene, and SEQ ID NO: 30 (shRNA8) targeting the S gene, with silencing efficiencies of 78%, 76%, 88%, 89%, 89%, 84%, 91%, and 90%, respectively.

III. Synthesis of shRNA

[0066] According to the common targets (SEQ ID NO: 1 to SEQ ID NO: 58), SEQ ID NO: 5 (shRNA3), SEQ ID NO: 49 (shRNA5), and SEQ ID NO: 30 (shRNA8) with a shorter target gene sequence are selected, synthesized by a biological company. Each shRNA is synthesized with 2 complementary oligonucleotide siRNAs of 19 nt to 25 nt, and synthesizes a 9 nt base sequence that acts as a spacer; the siRNA (drug) and the base sequence are ligated into a double-stranded small hairpin shRNA with a loop formed by separation of intermediate base sequences; each single strand of the double-stranded shRNA can be ligated to an ACE2 polypeptide or protein, respectively.

[0067] For example, SEQ ID NO: 1 (shRNA1), SEQ ID NO: 2 (shRNA2), and SEQ ID NO: 5 (shRNA3) are synthesized into 5′-ttaatacgacctctctgttggattttgacattcaagagatgtcaaatccaacagagaggtcgtattaa-3′ (shRNA1) (SEQ ID NO: 77), 5′-ggttcgcaacttcacacagagtttcaagagaactctgtgtgaagttgcgaacc-3′ (shRNA2) (SEQ ID NO: 78) and 5′-ggtt cggt tgtta tatac gata ttcaagaga tatc gtata taaca accg aacc-3′ (shRNA3) (SEQ ID NO: 79), where “TTCAAGAGA” is a loop, and left and right sides thereof are complementary sense and antisense strands, and then a 3′- and/or 5′-end of the shRNA is ligated with the ACE2 protein or polypeptide separately. Similarly, preferably other siRNAs with a high silencing efficiency are synthesized into shRNAs.

IV. Design and Synthesis of Targeted Delivery Vector ACE2

1. Amino Acid Sequences of ACE2

[0068] The human ACE2 gene sequence information was searched from the GeneBank database (http://www.ncbi.nlm.gov/genbank); the ACE2 consists of 805 amino acids, where amino acids 1 to 740 (SEQ ID NO: 59) are located extracellularly, amino acids 741 to 763 (SEQ ID NO: 60) are located in a transmembrane region, and amino acids 764 to 805 (SEQ ID NO: 61) are located intracellularly. Among the 20 amino acids that make up the ACE2 protein, leucine accounts for 9.4%, cysteine and histidine account for 1.0% and 2.0%, respectively, and negatively-charged amino acid residues (aspartate+glutamate) and positively-charged amino acid residues (arginine+lysine) as a balance. SARS-CoV and SARS-CoV 2 interact with an extracellular catalytic domain of the ACE2 through virus RBD. This interaction can lead to endocytosis and membrane fusion, such that the SARS-CoV enters cells that highly express ACE2 or contain ACE2 receptors.

2. Receptor Function of ACE2

[0069] ACE2 is a lipid-soluble type I transmembrane glycoprotein with an amino-terminal catalytic domain and a carboxyl-terminal domain. The N-terminus is outside the cell membrane and the C-terminus is inside the cell membrane. This glycoprotein is divided into an N-terminal signal peptide region, a carboxypeptidase activation region, and a transmembrane region. When the Spike protein of coronavirus contacts a tip of a subdomain I of the catalytic domain of ACE2 (without affecting a subdomain II and a peptidase activity), an outer domain of the ACE2 is cleaved and the transmembrane domain is internalized, enabling further virus-host cell fusion. Therefore, it is believed that the transmembrane region is involved in the transport of virus-receptor complexes from the cell membrane to the cytoplasm.

3. Design of ACE2 of the Present Disclosure

[0070] From an amino acid sequence of ACE2 and a receptor function of ACE2, it can be seen that there are ACE2 receptor channels in the cell wall and cell membrane of ACE2-expressing cells. Full-length ACE2, transmembrane region ACE2, intracellular ACE2, and extracellular ACE2 each are a membrane-penetrating polypeptide with a function of targeted delivery of siRNA. The N-terminus of extracellular ACE2 has a function of neutralizing virus by binding to the coronavirus RBD. Therefore, full-length ACE2, extracellular ACE2 of amino acids 1 to 740, transmembrane ACE2 of amino acids 741 to 763, or intracellular ACE2 of amino acids 764 to 805, or ACE2 with optimized amino acid sequences can be designed and synthesized as a targeted delivery vector for siRNA.

4. Synthesis of ACE2 of the Present Disclosure

[0071] Two amino acids are dehydrated and condensed to form peptide bonds, and multiple amino acid residues are ligated by the peptide bonds to form polypeptides. A company can be entrusted to automatically synthesize peptides by a peptide synthesizer. Basically, amino acids are added in order according to a sequence of the polypeptide to be synthesized, such that the peptide chain is gradually extended from the C-terminal to the N-terminal residues; each amino acid residue is required to be condensed in the form of protection at one end and activation at the other end, and temporary protection groups on the amino group are removed after each round of peptide chain elongation, until all amino acid sequences of the target polypeptide are condensed. At present, a commonly used reaction for solid-phase synthesis of the polypeptides includes: in a closed explosion-proof glass reactor, amino acids are continuously added from the C-terminus-carboxy terminus to the N-terminus-amino terminus according to a known sequence, and synthesis is conducted to finally obtain the polypeptides. A synthesis method includes: (1) deprotection: removing the protective group of the amino group with an alkaline solvent; (2) activation and cross-linking: activating a carboxyl group of a next amino acid, cross-linking an activated single carboxyl group with a free amino group to form a peptide bond; and repeating these two steps until the polypeptide is synthesized.

V. Synthesis of nCoVshRNA.2ACE2 with ACE2 and shRNA

1. Design of nCoVshRNA2ACE2

[0072] Take the synthesis of shRNA and extracellular, transmembrane or intracellular ACE2 as an example: one end of the sense and antisense strands of the synthesized siRNA/shRNA is ligated to the loop (5′-TTCAAGAGA-3′), and the other end is ligated to ACE2 (C-terminus), so as to obtain a structure of “ACE2-siRNA sense strand-loop-siRNA antisense strand-ACE2”, which is expressed as “2ACE2-shRNA”. The two complementary sense and antisense strands can form a double strand, but the two ACE2 polypeptides cannot form the double strand. As shown in FIG. 2, there is a hairpin ligation product shRNA with two ACE2 polypeptides, two siRNA sense and antisense strands, and a loop. Since the virus RBD infects cells through the C-terminus binding to the N-terminus of ACE2, and the binding of ACE2 polypeptide to siRNA can increase the permeability, stability and interference effect of siRNA. Accordingly, as shown in FIG. 3, ACE2 in this design can neutralize the virus and prevent virus infection, and can deliver siRNA/shRNA to the virus RBD in a targeted manner to form a complex of “shRNA-ACE2-RBD-virus”. As a result, the shRNA is delivered by the virus, and the shRNA enters the target cells with virus infection, playing a role of targeted interference.

2. Synthesis of ACE2-shRNA-ACE2 (2ACE2-shRNA)

[0073] According to the design (FIG. 2), the entrusted company adopts the sequences of extracellular ACE2, SEQ ID NO: 5 (shRNA3), transmembrane ACE2, SEQ ID NO: 49 (shRNA5), and SEQ ID NO: 30 (shRNA8), by a conventional synthesis method of oligonucleotide, the polypeptide (ACE2) and oligonucleotide (shRNA/siRNA) are coupled to form a conjugate with a carboxyhydrazone bond, a disulfide bond, a phosphodiester bond, a phosphorodithioate bond, a thioether bond, an oxime bond, an amide bond, and a maleimide-thiol bond. The sense strand (5′- end and 3′-end) or antisense strand (3′-end) of polypeptides and oligonucleotides can be non-covalently or covalently cross-linked with a firmer covalent bond, a looser ionic bond, a hydrophobic bond, or the carboxyhydrazone bonds with a spacer arm to synthesize a polypeptide-oligonucleotide conjugate (POCs). At present, the POCs are generally synthesized by covalent crosslinking-liquid phase fragment synthesis, and various POCs are prepared. The method includes the following steps: synthesizing a polypeptide and an oligonucleotide separately on a solid-phase substrate, simultaneously peeling the polypeptide and the oligonucleotide from the solid-phase substrate, and coupling peeled polypeptide and oligonucleotide in a solution by a reactive group. Synthesis of POCs mainly includes: (1) Maleimide-thiol bond coupling: maleimide is modified on the polypeptide or oligonucleotide, thiol is modified on another monomer, and the two monomers are added into a same solution to obtain the POCs after a reaction. (2) Disulfide bond or thioether bond coupling: 5′- or 3′- positions of the oligonucleotide is modified with a thiol group, and then reacted with a polypeptide whose C-terminus is modified with a bromoacetyl group in a buffer solution of pH 7.0; the disulfide bond coupling can be directly oxidized by two thiol groups, or the thiol group can be activated by an activator such as dipyridyl disulfide and then coupled with another oligomer containing a thiol group; the disulfide bonds are commonly used to synthesize a conjugate of siRNA and polypeptides. (3) Oxime bond coupling: the aldehyde group reacts with the amino group to produce oxime; the reaction conditions are mild, with a high reaction efficiency, and a coupling product of double-stranded DNA and a specific polypeptide can be directly generated; meanwhile, two polypeptides can be simultaneously ligated to the 5′- and 3′-end of the nucleic acid through an oxime bond, by a bifunctional oligonucleotide with a polypeptide or a carbohydrate. This method does not require various protection processes and can be completed in one step, which is used to synthesize a “peptide-oligonucleotide-peptide” product. Specifically, the aldehyde group is introduced into the 5′- and 3′-end of the oligonucleotide, and then reacted with a hydroxylamine-modified polypeptide to obtain a “peptide-oligonucleotide-peptide” with a high yield. This one-step reaction of bifunctionalized oligonucleotides with polypeptides does not require any protection strategies and cross-linking reagents, and has a high yield under the slightly acidic environment. (4) Amide bond coupling: an oligomer containing activated carboxylic acid or thioester is reacted with another polymer modified with an amino group to obtain a product. (5) Hydrazone bond coupling: a hydrazine group is introduced into the polypeptide, a citric acid buffer with a pH value of 3 to 5 is added, and the mixture is reacted with an oligonucleotide modified with an acetaldehyde group. Thus, POCs ligated by hydrazone bonds are obtained and expressed as “2ACE2-shRNA3”, “2ACE2-shRNA5”, and “2ACE2-shRNA8”, respectively.

3. Purification of ACE2-shRNA-ACE2

[0074] Chromatographic methods are most commonly used for purification and analysis of the conjugate of peptides and oligonucleotides. According to complexity of the conjugates, different chromatographic methods should be selected for separation. The main methods include high-performance liquid chromatography (HPLC), reverse high-performance liquid chromatography (RP-HPLC), ion exchange chromatography (IEC, generally anion exchange chromatography), or two or more of which are used in series. Specifically, according to operating instructions, 2ACE2-shRNA3, 2ACE2-shRNA5, and 2ACE2-shRNA8 are extracted.

4. Synthesis of Other Compounds for Delivery of shRNA by Targeting ACE2

[0075] Similarly, shRNA (SEQ ID NO: 1 to SEQ ID NO: 58) can be ligated with intracellular ACE2 or codon-optimized ACE2 polypeptide to form compounds, including but not limited to “transmembrane ACE2-shRNA-transmembrane ACE2”, and “intracellular ACE2-shRNA-intracellular ACE2”; alternatively, the shRNA/siRNA is inserted into the middle of ACE2 polypeptide to synthesize “transmembrane ACE2-shRNA-extracellular ACE2”, and “intracellular ACE2-shRNA-extracellular ACE2”; similarly, compounds with ACE2 or ACE2-optimized polypeptides as targeted delivery vectors are designed, including but not limited to “ACE2-siRNA, extracellular ACE2-siRNA, transmembrane ACE2-siRNA, and intracellular ACE2-siRNA”.

VI. Liposome Modification of Compounds

[0076] Liposome (Lip) modification includes: adsorption of positively-charged liposomes with negatively-charged shRNA, formation of the thiol-maleimide bond with thiol and liposomes by thiolation of amino groups in the ACE2 polypeptides, or formation of the carbamate bond with amino groups of ACE2 and liposomes (FIG. 4 to FIG. 5).

Example 1 Preparation of Liposome-Modified Compound with Liposome DOTAP/Chol

(1) Preparation of Lipid Solution

[0077] DOTAP (MW=698.5): 10 mg/ml, 100 mg of an N-1-(2,3-di-oleoyloxy)propyl)-N,N,N-trimethylammoniumethyl sulfate (DOTAP) powder was added into a 10 ml volumetric flask, and a chloroform solution was added to reach a scale line.

[0078] Chol (MW=386): 5 mg/ml, 50 mg of a cholesterol (Chol) powder was added into a 10 ml volumetric flask, and a chloroform solution was added to reach a scale line.

[0079] m-PEG2000-DSPE (MW=2787): 10 mg/ml, 10 mg of a methoxy-polyethylene glycol-distearoyl phosphatidyl-ethanolamine (m-PEG2000-DSPE) powder was added to 1 ml of DEPC water, and dissolved completely by vortexing and sonication for 1 min.

[0080] Mal-PEG2000-DSPE (MW=2941.6): 10 mg/ml, 10 mg of a maleimide derivatized polyethylene glycol-distearoyl phosphatidyl-ethanolamine (Mal-PEG2000-DSPE) powder was added to 1 ml of DEPC water, and dissolved by vortexing and sonication for 1 min.

(2) Preparation of Liposome DOTAP/Chol (Lipid-Film Method)

[0081] The liposome DOTAP/Chol was prepared by a lipid-film method, at a lipid concentration of 10 mM. The method included the following steps: according to an amount of preparing 1 ml of the liposome DOTAP/Chol, 3 ml to 4 ml of chloroform solutions of DOTAP and Chol were separately added to a 500 ml conical flask at a ratio of DOTAP: Chol=1:1 (M:M); vacuum rotary evaporation was conducted at 37° C. for 45 mM to 60 mM to obtain a uniform lipid film, and traces of chloroform were blown out with high-purity nitrogen; 1 ml of DEPC water was added to shake to wash the lipid film from a bottle wall, to obtain a lipid suspension; after being fully hydrated, the lipid film was sonicated for 1 min, and extruded through 400 nm, 200 nm, 80 nm, and 50 nm of polycarbonate membranes in sequence for 10 to 20 times in each size, so as to obtain the liposome DOTAP/Chol.

(3) Thiolation of ACE2 and 2ACE2-shRNA

[0082] 2-IT (Traut'S reagent) was a common reagent for protein thiolation, and the thiolation was conducted at an N amino group of the ACE2 protein. The thiolation included the following steps: 2ACE2-shRNA and 2-IT (Traut'S reagent, 2-iminothiolane-HCl) were mixed evenly (the 2-IT and the 2ACE2-shRNA have a molar ratio of 200:1), and reacted at a room temperature for 2 h; excess 2-IT was removed by dialysis with a sufficient amount of the dialysate (1×PBS, 5 mM EDTA, pH=7.4) that was stored at 4° C. for each time, where the dialysis was conducted overnight by magnetic stirring and the dialysate was changed after 6 h to 8 h; a protein concentration and a degree of thiolation were determined by a BCA method and an Ellman method, respectively.

(4) Preparation of Liposome-Modified Compound with Liposome DOTAP/Chol

(A) Preparation by Negatively-Charged siRNA/shRNA Adsorbing Positively-Charged Liposomes

[0083] (1) 120 μl of the DOTAP/Chol liposome (10 mM) was added with 20 μl of the 2ACE2-shRNA (about 2 μg/μl, 40 μg) and 11 μl of DEPC water, and allowed to stand for 10 min at a room temperature to obtain a liposome-modified complex 2ACE2-shRNA/ch1.

[0084] (2) 90 μl of siRNA (24 μg, 20 mM) or 90 μl of shRNA (24 μg, 10 mM) was added with 57.6 μl of DEPC water, allowed to at a room temperature for 10 min, and added with 600 μl of the DOTAP/Chol liposome (50 mM) to obtain siRNA/ch1 and shRNA/ch1.

[0085] (3) The liposome-modified complex 2ACE2-shRNA/ch1 prepared in (1) and the liposome-modified complex siRNA/ch or shRNA/ch prepared in (2) were mixed equivalently to obtain a corresponding mixed liposome-modified complex.

(B) Preparation by Cross-Linking of Thiol Groups in ACE2 and Maleimide in PEG

[0086] To increase a circulation time and targeting specificity of the liposomes, various liposome-modified complexes prepared in (A) were further PEGylated and ACE2-modified to obtain a PEGylated liposome-modified complex with RBD as a ligand.

[0087] 9.53 μl (while setting 6.36 μl and 12.7 μl as a control) of 10 mg/ml MAL-DSPE-PEG was inserted into the liposome-modified complex 2ACE2-shRNA/ch1, siRNA/ch1, or shRNA/ch1 prepared in (A) separately (mixing the two separately), incubated in a 50° C. water bath for 10 min, and allowed to stand for 10 min at a room temperature; about 200 μg of thiolated ACE2 or 2ACE2-shRNA/ch1 was added to cross-link the thiol group on the thiolated amino group in the ACE2 with the maleimide in MAL-DSPE-PEG, to obtain ACE2-modified and PEGylated (PEGylation had PEG concentrations of 5 mol % PEG, 7.5 mol % PEG, and 10 mol % PEG, respectively). That is, the complex was electrostatically adsorbed to the liposome DOTAP/Chol with siRNA, shRNA, and/or 2ACE2-shRNA, wrapped on an outer layer with the MAL-DSPE-PEG, and then ligated with the ACE2 or 2ACE2-shRNA by the MAL-DSPE-PEG. The prepared liposome (ch)-modified complexes included ACE2-siRNA/ch1, ACE2-shRNA/ch1, ACE2-(2ACE2-shRNA/ch1), (2ACE2-shRNA)-siRNA/ch1, (2ACE2-shRNA)-shRNA/ch1, and (2ACE2-shRNA)-(2ACE2-shRNA/ch1), abbreviated as ACE2-siRNA/ch1, ACE2-shRNA/ch1, 3ACE2-shRNA/ch1, 2ACE2-shRNA/siRNA/ch1, 2ACE2-2shRNA/ch1, and 4ACE2-2shRNA/ch1, respectively. As shown in FIG. 3, the ACE2 played a role in targeted delivery of siRNA/shRNA; the liposome and the PEG functioned as protection of siRNA/shRNA, slow release of siRNA/shRNA, and intracellular transfection of siRNA/shRNA, or an immunologic adjuvant.

Example 2 Preparation of Liposome-Modified Compound with Liposome Liposomal

[0088] When pH is greater than 8, the amino group of ACE2 reacted with pNP-PEG-DPPE (PEG-PE) to form a stable carbamate bond conjugate, which was then inserted into an outer membrane of the liposomes in a targeted and quantitative manner to obtain a liposome-modified compound. In this example, ACE2 fragments and siRNA were used to prepare a liposome-modified compound for ACE2-targeted delivery of siRNA (ACE2-siRNA).

(1) Synthesis of ACE2

[0089] ACE2 or its fragments were synthesized using the ACE2 synthesis method described above.

(2) Synthesis of pNP-PEG-DPPE

[0090] 10 ml of a 20 mg/mL DPPE chloroform solution was placed in a 50 mL round-bottomed flask, and 0.65 mL of triethylamine (TEA) was added dropwise; about 4.0 g of a polyethylene glycol 3400 di-p-nitrophenyl carbonate [(pNP).sub.2-PEG.sub.3400] chloroform solution with a concentration of 200 mg/mL was added to an obtained mixture; the mixture was blown with nitrogen, sealed, protected from light, stirred magnetically overnight at a room temperature, the solvent was removed by evaporation under reduced pressure, and residual chloroform was removed in vacuum; 100 mL of a 0.01 mol/L HCl aqueous solution was added, and a transparent micellar solution was formed by an ultrasonic treatment. With the 0.01 mol/L HCl aqueous solution as an eluent, separation was conducted by CL-4B Sepharose to remove unreacted (pNP).sub.2-PEG.sub.3400 and released pNP; an eluate containing pNP-PEG-DPPE micelles was collected, lyophilized, and pNP-PEG-DPPE was characterized and quantified by TLC, HPLC, MS and NMR.

[0091] (3) Synthesis of ACE2-PEG-DPPE: 100 mg of the pNP-PEG-DPPE was dissolved in 10 mL of chloroform, placed in a 50 mL flask, and the chloroform was removed under reduced pressure on a rotary evaporator to form a lipid film, and the residual chloroform was removed by vacuum; 25 mg of ACE2 was dissolved in 4 mL of 0.01 mol/L HCl, a resulting mixture was added to a flask coated with the lipid film on the inner wall, incubated at a room temperature for 30 min, and shaken gently to disperse the lipid film. 20 mL of a 10 mum/L (pH 9.0) Tris buffer was added to a suspension, mixed well, and incubated at 4° C. overnight under nitrogen protection. The samples were placed in a dialysis bag with a molecular mass of 5 kD, dialyzed in the 10 mmol/L (pH 7.4) Tris buffer for about 4 h, and then dialyzed in deionized water at 4° C. for 24 h; the solution in the bag was lyophilized and stored in a −20° C. refrigerator.

[0092] (4) Synthesis of ACE2-siRNA/liposomal: chloroform solutions of egg yolk phospholipid (ePC), cholesterol (Ch), distearoyl ethanolamine-polyethylene glycol 2000 (PEG.sub.2000-DSPE), and dioleoyl trimethylamine propane (DOTAP) were mixed in a molar ratio of 60:34:3.0:3.0; to label the lipid film, Rho-PE with a molar ratio of 0.1% to a total lipid mass was added in the above mixture, and chloroform was removed under reduced pressure to form the lipid film. A certain amount of the siRNA was dissolved in DEPC-treated ultrapure water, where an amount of the siRNA should ensure that the positive charge of DOTAP was completely neutralized. The phospholipid film was hydrated with an aqueous solution containing siRNA in a 50° C. water bath for 30 min, to form an siRNA-encapsulated liposome. The preliminarily formed liposome was passed through 0.4 μm and 0.1 μm of polycarbonate nuclear pore membranes (Whatman) 10 times with a manual extrusion device (Avanti Polar Lipids), to prepare the liposomes with a uniform particle size. An appropriate amount of the ACE2-PEG-DPPE was dissolved in methanol, placed in a flask, and blow-dried with nitrogen to form a film; the prepared liposome suspension was added and treated in a water bath at 37° C. for 2 h, such that the ACE2-PEG-DPPE was inserted into an outer membrane of the liposome and the ACE2 accounted for 0.5% to 1.0% of the total lipid (the molar ratio could be adjusted appropriately); a liposome (ch/lip) complex ACE2-shRNA/siRNA/lip as shown in FIG. 3 to FIG. 4 was prepared after dynamic laser scattering, cryo-etching electron microscopy, and nucleic acid electrophoresis.

[0093] The nCoVshRNA.2ACE2 was synthesized from the ACE2 or its polypeptides with the shRNA/siRNA, and then further modified by the liposomes.

VII. Validation of the Compound (nCoVshRNA.2ACE2)

1. In Vitro Verification of Broad-Spectrum Antiviral Effect

(1) Preparation of Virus Solution

[0094] The virus strains were added to a DMEM medium (10% FBS) of Vero E6 cells grown to 30% confluence, and incubated in a 36° C., 5% CO.sub.2 incubator for 5 d to 7 d; when an cytopathic effect (CPE) occurred, the virus was isolated and then prepared by a medium into a 10.sup.3 TCID.sub.50/ml to 10.sup.5 TCID.sub.50/ml virus solution for later use. According to this, virus solutions of two variant strains B.1.617.1 and B.1.617.2 of the COVID-19 virus were prepared separately to verify whether the nCoVshRNA.2ACE2 was effective against two or more variant viruses containing a same conserved gene, so as to prove whether the shRNA/siRNA of the present disclosure had a broad-spectrum antiviral effect by targeting the conserved gene.

(2) Co-Culture of Compound (nCoVshRNA.2ACE2) with Virus

[0095] An experimental group and a control group were set up to test an effect of the compounds against the B.1.617.1 and B.1.617.2. Each group was inoculated with a 8-well plate, and 2×10.sup.5 Vero-E6 cells and 2 mL of a DMEM medium (10% FBS) were added to each well, and then incubated in a 36° C. and 5% CO.sub.2 incubator to 30% confluence, followed by changing the medium; meanwhile, the tested compound and the virus solutions of B.1.617.1, and B.1.617.2 strains were added.

[0096] The experimental groups included: a 2ACE2-shRNA3 group (0.1 nmol 2ACE2-shRNA3+0.6 ml virus solution), a 2ACE2-shRNA3/ch1 group (0.1 nmol 2ACE2-shRNA3/ch1+0.6 ml virus solution), a 4ACE2-2shRNA3/ch1 group (0.1 nmol 4ACE2-2shRNA3/ch1+0.6 ml virus solution), an ACE2-siRNA3/lip group (0.1 nmol ACE2-siRNA3/lip+0.6 ml virus solution); the control group included: a naked shRNA3 group (0.1 nmol naked shRNA3+0.6 ml virus solution), a naked siRNA3 group (0.1 nmol naked siRNA3+0.6 ml virus solution), an ACE2 control group (0.1 nmol ACE2+0.6 ml virus solution), a positive control group (0.6 ml virus solution), and a negative control group (0.6 ml DMEM medium) (Tables 1 to 6). Similarly, experiments with 2ACE2-shRNA5 and 2ACE2-shRNA8 were conducted (Tables 1a to 6a).

[0097] After 1 h, 24 h, and 72 h of incubation, a supernatant was collected from each group, and then diluted at 1:4, 1:12, 1:36, 1:108, 1:324, 1:972, 1:2916, and 1:8748 to conduct RT-PCR detection.

(3) Real-Time Fluorescent RT-PCR Detection of Viral RNA in Each Group

[0098] Viral nucleic acid extraction and nucleic acid (ORF1ab/N) detection were conducted according to kit instructions.

(4) Detection Results of Viral RNA

1) Test Results of Strain B.1.617.1

[0099] As shown in Table 1, after culturing the cells in each group for 1 h, a viral RNA titer of the negative control group was negative, a viral RNA titer of the positive control group was 1:36, and viral RNA titers of the other groups each were 1:12.

[0100] As shown in Table 2, after culturing the cells in each group for 24 h, a viral RNA titer of the negative control group was still negative, and a viral RNA titer of each control group was 1:324 to 1:2916; while viral RNA titers of the experimental groups each were 1:108, which were significantly lower than that of the positive control group and the ACE2 control group (p<0.01).

[0101] As shown in Table 3, after culturing the cells in each group for 72 h, a viral RNA titer in the negative control group was still negative, a viral RNA titer of each control group was greater than 1:2916, and a viral RNA titer of the control group was greater than 1:2916 to 1:8748; while a viral RNA titer of the experimental group was 1:324 to 1:972, which was significantly lower than that of the control group (p<0.01).

[0102] Tables 1 to 3 showed that the experimental group had an obvious anti-B.1.617.1 effect, indicating that shRNA or siRNA ligated to ACE2 could be delivered to target cells for RNA interference. However, the shRNA or siRNA that was not ligated to ACE2 could not enter the target cells, and could not play a role of RNA interference extracellularly. The results in Tables 1a to 3a were basically consistent with those in Tables 1 to 3.

TABLE-US-00011 TABLE 1 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.1 for 1 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + − − − − − − 2ACE2-shRNA3/ch1 + + − − − − − − 4ACE2-2shRNA3/ch1 + + − − − − − − ACE2-siRNA3/lip + + − − − − − − naked shRNA3 + + − − − − − − naked siRNA3 + + − − − − − − ACE2 control + + − − − − − − Positive control + + + − − − − − Negative control − − − − − − − −

TABLE-US-00012 TABLE 1a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.1 for 1 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + − − − − − − − 2ACE2-shRNA5/ch1 + − − − − − − − 2ACE2-shRNA8 + − − − − − − − 2ACE2-shRNA8/ch1 + − − − − − − − naked shRNA5 + − − − − − − − naked shRNA8 + − − − − − − − ACE2 control + − − − − − − − Positive control + + − − − − − − Negative control − − − − − − − −

TABLE-US-00013 TABLE 2 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.1 for 24 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + + + − − − − 2ACE2-shRNA3/ch1 + + + + − − − − 4ACE2-2shRNA3/ch1 + + + + − − − − ACE2-siRNA3/lip + + + + − − − − naked shRNA3 + + + + + − − − naked siRNA3 + + + + + − − − ACE2 control + + + + + + + − Positive control + + + + + + − − Negative control − − − − − − − −

TABLE-US-00014 TABLE 2a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.1 for 24 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + + + − − − − − 2ACE2-shRNA5/ch1 + + + − − − − − 2ACE2-shRNA8 + + + − − − − − 2ACE2-shRNA8/ch1 + + + − − − − − naked shRNA5 + + + + − − − − naked shRNA8 + + + + − − − − ACE2 control + + + + + + − − Positive control + + + + + − − − Negative control − − − − − − − −

TABLE-US-00015 TABLE 3 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.1 for 72 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + + + + + − − 2ACE2-shRNA3/ch1 + + + + + − − − 4ACE2-2shRNA3/ch1 + + + + + + − − ACE2-siRNA3/lip + + + + + − − − naked shRNA3 + + + + + + + − naked siRNA3 + + + + + + + + ACE2 control + + + + + + + + Positive control + + + + + + + + Negative control − − − − − − − −

TABLE-US-00016 TABLE 3a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.1 for 72 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + + + + − − − − 2ACE2-shRNA5/ch1 + + + + − − − − 2ACE2-shRNA8 + + + + − − − − 2ACE2-shRNA8/ch1 + + + + − − − − naked shRNA5 + + + + + + + − naked shRNA8 + + + + + + + − ACE2 control + + + + + + + + Positive control + + + + + + + + Negative control − − − − − − − −

2) Test Results of Strain B.1.617.2

[0103] As shown in Table 4, after culturing the cells in each group for 1 h, a viral RNA titer of the negative control group was negative, viral RNA titers of the positive control group and the ACE2 control group each were 1:36, and viral RNA titers of the other groups each were 1:12. As shown in Table 5, after culturing the cells in each group for 24 h, a viral RNA titer of the negative control group was still negative, and a viral RNA titer of each control group was 1:324 to 1:972; while viral RNA titers of the 4 experimental groups were 1:36 to 1:108, which were significantly lower than that in the control group (p<0.01). As shown in Table 6, after culturing the cells in each group for 72 h, a viral RNA titer of the negative control group was still negative, and a viral RNA titer of each control group was 1:2916 to 1:8748; while viral RNA titers of the 4 experimental groups were 1:324 in 2 groups and 1:972 in the other 2 groups, which were still significantly different from that in the control group (p<0.01). Tables 4 to 6 showed that the experimental group had an obvious anti-B.1.617.2 effect, indicating that shRNA or siRNA ligated to ACE2 could be delivered to target cells for RNA interference. However, the shRNA or siRNA that was not ligated to RBD could not enter the target cells, and could not play a role of RNA interference. The results in Tables 4a to 6a were basically consistent with those in Tables 4 to 6. Tables 1 to 6 and 1a to 6a showed that the experimental group (nCoVshRNA.2ACE2) had anti-B.1.617.1 and anti-B.1.617.2 effects, indicating that the nCoVshRNA.2ACE2 targeting conserved genes in the experimental group had a broad-spectrum anti-variant strain effect.

TABLE-US-00017 TABLE 4 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.2 for 1 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + − − − − − − 2ACE2-shRNA3/ch1 + + − − − − − − 4ACE2-2shRNA3/ch1 + + − − − − − − ACE2-siRNA3/lip + + − − − − − − naked shRNA3 + + − − − − − − naked siRNA3 + + − − − − − − ACE2 control + + + − − − − − Positive control + + + − − − − − Negative control − − − − − − − −

TABLE-US-00018 TABLE 4a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.2 for 1 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + − − − − − − − 2ACE2-shRNA5/ch1 + − − − − − − − 2ACE2-shRNA8 + − − − − − − − 2ACE2-shRNA8/ch1 + − − − − − − − naked shRNA5 + − − − − − − − naked shRNA8 + − − − − − − − ACE2 control + + − − − − − − Positive control + + − − − − − − Negative control − − − − − − − −

TABLE-US-00019 TABLE 5 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.2 for 24 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + + + − − − − 2ACE2-shRNA3/ch1 + + + − − − − − 4ACE2-2shRNA3/ch1 + + + + − − − − ACE2-siRNA3/lip + + + − − − − − naked shRNA3 + + + + + − − − naked siRNA3 + + + + + − − − ACE2 control + + + + + + − − Positive control + + + + + − − − Negative control − − − − − − − −

TABLE-US-00020 TABLE 5a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.2 for 24 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + + + − − − − − 2ACE2-shRNA5/ch1 + + − − − − − − 2ACE2-shRNA8 + + + − − − − − 2ACE2-shRNA8/ch1 + + + − − − − − naked shRNA5 + + + + − − − − naked shRNA8 + + + + − − − − ACE2 control + + + + + + + − Positive control + + + + + + − − Negative control − − − − − − − −

TABLE-US-00021 TABLE 6 Virus RNA RT-PCR detection results in medium after compound (shRNA3) co-cultured with strain B.1.617.2 for 72 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA3 + + + + + + − − 2ACE2-shRNA3/ch1 + + + + + − − − 4ACE2-2shRNA3/ch1 + + + + + + − − ACE2-siRNA3/lip + + + + + − − − naked shRNA3 + + + + + + + − naked siRNA3 + + + + + + + − ACE2 control + + + + + + + + Positive control + + + + + + + − Negative control − − − − − − − −

TABLE-US-00022 TABLE 6a Virus RNA RT-PCR detection results in medium after 2ACE2- shRNA5/8 co-cultured with strain B.1.617.2 for 72 h Viral RNA detection results of different dilutions in medium (+/−) Group 1:4 1:12 1:36 1:108 1:324 1:972 1:2916 1:8748 2ACE2-shRNA5 + + + + + − − − 2ACE2-shRNA5/ch1 + + + + − − − − 2ACE2-shRNA8 + + + + + − − − 2ACE2-shRNA8/ch1 + + + + − − − − naked shRNA5 + + + + + + + − naked shRNA8 + + + + + + + − ACE2 control + + + + + + + + Positive control + + + + + + + + Negative control − − − − − − − −

2. In Vivo Verification of Targeted Delivery Function of ACE2

(1) Animal Grouping and Inoculation

[0104] Animal grouping: female BALB/c mice in an SPF grade of 6 to 8 weeks and about 40 g were selected; taking the 2ACE2-shRNA3 as an example, the mice were randomly divided into a 2ACE2-shRNA3 (shRNA5/8) group (inoculated with 2ACE2-shRNA3+B.1.617.2), a 2ACE2-shRNA3/ch1 group (inoculated with 2ACE2-shRNA3/ch1+B.1.617.2), a 4ACE2-2shRNA3/ch1 group (inoculated with 4ACE2-2shRNA3/ch1+B.1.617.2), an ACE2-siRNA3/lip group (inoculated with ACE2-siRNA3/lip+B.1.617.2), a shRNA3 group (inoculated with shRNA3+B.1.617.2), a positive control group (inoculated with B.1.617.2+normal saline), and a negative control group (inoculated with normal saline only), with 20 mice in each group.

[0105] Animal inoculation: the mice each were inoculated with 40 μl of a B.1.617.2 strain virus solution with a titer of 10.sup.5/ml TCID.sub.50 by nasal spray, while the negative control group was inoculated with 40 μl of a normal saline by nasal spray. The mice were anesthetized by intraperitoneal injection of a 5% chloral hydrate solution, and 0.1 nmol of the 2ACE2-shRNA, 2ACE2-shRNA/ch1, 4ACE2-2shRNA/ch1, ACE2-siRNA/lip, and shRNA were slowly injected into the trachea of the mice separately. On the 7th day after infection, 10 mice in each group were sacrificed for virus detection; the remaining 10 mice in each group were used to observe antibodies.

(2) Detection of Virus at Percentage of Median Tissue Culture Infective Dose (TCID.SUB.50.) of Cells

[0106] A 10% homogenate was prepared from a lung tissue of the mice sacrificed on the 7th day after infection, and 100 pl of the homogenate was centrifuged to remove a supernatant, the homogenate was diluted 10-fold successively, and inoculated in a 96-well plate with VeroE6 growing in a single layer at 30 μl per well and 4 wells per dilution; the homogenate was gently shaken, adsorbed at 37° C. for 1 h, washed with a Hank's solution, added with a medium, and then incubated in a 37° C. CO.sub.2 incubator; a cytopathic effect (CPE) was observed, and a percentage of VeroE6 TCID.sub.50 in each group was calculated, where a higher percentage meant a higher virus content (Tables 7 to 13).

TABLE-US-00023 TABLE 7 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in 2ACE2-shRNA3 group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 26 14 14/40 35.0 10.sup.2 40 31 9  9/40 22.5 10.sup.3 40 33 7  7/40 17.5 10.sup.4 40 37 3  3/40 7.5

TABLE-US-00024 TABLE 8 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in 2ACE2-shRNA3/ch1 group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well rate ratio 10.sup.1 40 29 11 11/40 27.5 10.sup.2 40 31 9  9/40 22.5 10.sup.3 40 34 6  6/40 15.0 10.sup.4 40 38 2  2/40 5.0

TABLE-US-00025 TABLE 9 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in 4ACE2-2shRNA3/ch1 group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 27 13 13/40 32.5 10.sup.2 40 31 9  9/40 22.5 10.sup.3 40 35 5  5/40 12.5 10.sup.4 40 37 3  3/40 7.5

TABLE-US-00026 TABLE 10 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in ACE2-siRNA3/lip group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 28 12 12/40 30.0 10.sup.2 40 3 9  9/40 22.5 10.sup.3 40 34 6  6/40 15.0 10.sup.4 40 36 4  4/40 10.0

TABLE-US-00027 TABLE 11 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in shRNA3 group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 2 38 38/40 95.0 10.sup.2 40 4 36 36/40 90.0 10.sup.3 40 9 31 31/40 77.5 10.sup.4 40 13 27 27/40 67.5

TABLE-US-00028 TABLE 12 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in positive control group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 2 38 38/40 95.0 10.sup.2 40 3 37 37/40 92.5 10.sup.3 40 7 33 33/40 82.5 10.sup.4 40 11 29 29/40 72.5

TABLE-US-00029 TABLE 13 Percentage of TCID.sub.50 by VeroE6 in mice lung tissue homogenate in negative control group Number of Total Tissue inoculated cells observed results homogenate (4 wells × Normal Lesion Infection Infection dilution 10 cases) well well ratio rate 10.sup.1 40 38 2 2/40 5.0 10.sup.2 40 38 2 2/40 5.0 10.sup.3 40 39 1 1/40 2.5 10.sup.4 40 39 1 1/40 2.5

(3) Effect of ACE2-Targeted Delivery

[0107] As was seen from Tables 7 to 13, percentages of VeroE6 TCID.sub.50 (10.sup.1 in each well) induced by lung homogenate in each group were as follows: 2ACE2-shRNA3 group was 35.0%, 2ACE2-shRNA3/ch1 group was 27.5%, 4ACE2-2shRNA3/ch1 group was 32.5%, ACE2-siRNA3/lip group was 30.0%, shRNA3 group was 95.0%, positive control group was 95.0%, and negative control group was 5.0%. Since RNAi mainly occurred in the cytoplasm, shRNA3 in the shRNA3 group was not easy to pass through the cell membrane, so as to have a little effect on the RNAi, and results were consistent with the positive control group; meanwhile, the shRNA3 in the 2ACE2-shRNA3 group, 2ACE2-shRNA3/ch1 group, 4ACE2-2shRNA3/ch1 group, and ACE2-siRNA3/lip group had a better RNAi effect due to targeted delivery of the ACE2 to the target cytoplasm, and the percentage of VeroE6 TCID.sub.50 was significantly different from that of the positive control group (p<0.05).

[0108] A TCID.sub.50 assay was conducted separately on the 2ACE2-shRNA8 and 2ACE2-shRNA8/ch1 according to the TCID.sub.50 assay method above. The results showed that the 2ACE2-shRNA8 group, 2ACE2-shRNA8/ch1 group, shRNA8 group, positive control group, and negative control group had TCID.sub.50 of 25%, 17.5%, 82.5%, 95%, and 7.5%, respectively, and the TCID.sub.50 of experimental groups was significantly lower than that of the positive control group.

3. Detection and Functional Verification of ACE2-Ab

(1) Sample and Detection Method

[0109] The venous blood of the remaining 10 mice in each group was collected at the 2nd, 4th, and 6th weeks, a serum was separated, and sera of a same week in each group were mixed, and then stored at −20° C. for future use. The ACE2-Ab was determined by a double-antigen sandwich method according to instructions of the kit.

(2) Detection Results

[0110] It was seen from Table 14 that the ACE2-Ab in the lung tissue homogenate of mice in each experimental group (with ACE2) was significantly higher than that in the control group (without ACE2) (p<0.05), indicating that the ACE2 of experimental groups could stimulate the mice to produce ACE2-Ab, and a content of the ACE2-Ab was related to ACE2 molecular composition and liposome modification.

TABLE-US-00030 TABLE 14 ACE2-Ab detection results (ng/L) of mouse lung tissue homogenate in each experimental group (with ACE2) ACE2 Weeks and detection results Group molecule 2nd week 4th week 6th week P value 2ACE2-shRNA3 2 45.11 ± 16.27* 47.13 ± 14.12* 48.67 ± 15.46* *p < 0.05 2ACE2-shRNA3/ch1 2 55.18 ± 16.77* 69.17 ± 17.35* 73.78 ± 17.13* *p < 0.05 4ACE2-2shRNA/ch1 4 62.12 ± 15.17* 72.15 ± 17.33* 73.66 ± 16.27* *p < 0.05 ACE2-siRNA3/lip 1 41.22 ± 14.82  44.57 ± 16.19  46.16 ± 15.23  *p < 0.05 shRNA3 None 11.23 ± 5.76   12.615 ± 6.32    11.78 ± 5.75  

(3) Functional Verification of ACE2-Ab

[0111] The 2ACE2-shRNA group, 2ACE2-shRNA/ch1 group, 4ACE2-2shRNA/ch1 group, and ACE2-siRNA/lip group were used as experimental groups (all containing ACE2-Ab), while the shRNA group was used as a control group (containing virus but not ACE2-Ab). The sera of 2nd, 4th, and 6th week in each group after ACE2-Ab detection were mixed, a mixed serum in each group were double-diluted, and 30 μl of each diluted serum was inoculated in a 96-well plate with VeroE6 growing in a single layer; each experimental group was simultaneously inoculated with 30 μl of an undiluted mixed serum of the shRNA group, while the negative control group was inoculated with 30 μl of a normal saline only. The samples in each group were shaken and mixed well, adsorbed at 37° C. for 1 h, washed with the Hank's solution, added with a medium, and incubated in a 37° C. CO.sub.2 incubator; a cytopathic effect (CPE) was observed within 1 week, where “+” indicated the normal cell growth, as shown in Table 15.

TABLE-US-00031 TABLE 15 Results of antiviral infection caused by ACE2-Ab neutralization of ACE2 on surface of VeroE6 cells (+/CPE) Dilution of serum (ACE2-Ab) inhibiting virus-induced VeroE6 CPE Group 1:2 1:4 1:8 1:16 1:32 1:64 1:128 1:256 1:512 2ACE2-shRNA3 + + + + + CPE CPE CPE CPE 2ACE2-shRNA3/ch1 + + + + + CPE CPE CPE CPE 4ACE2-2shRNA3/ch1 + + + + + + CPE CPE CPE ACE2-siRNA3/lip + + + + + CPE CPE CPE CPE shRNA3 CPE CPE CPE CPE CPE CPE + + + Positive control CPE CPE CPE CPE CPE CPE CPE CPE CPE Negative control + + + + + + + + +

[0112] As was seen from Table 15, since the negative control group was not inoculated with virus, there was no CPE in each well of VeroE6; the positive control group was inoculated with the virus without ACE2-Ab neutralization (the mixed serum in shRNA3 group was not diluted), such that VeroE6 in each well produced CPE; since the shRNA3 group had no neutralization effect of ACE2-Ab, VeroE6 did not have CPE only after a virus-containing self-serum was diluted at 1:128; though the experimental groups were also inoculated with the virus like the positive control group, but due to the neutralization effect of ACE2-Ab, the VeroE6 showed CPE only when the serum (ACE2-Ab content) was diluted at not less than 1:64. It showed that the ACE2-Ab could neutralize the viral receptor ACE2 on the surface of VeroE6 cells, thereby producing an antiviral effect.

[0113] In the present disclosure, shRNA plays a role in anti-variant strain effects; ACE2 plays a role in targeted delivery of shRNA, bivalent binding to RBD, competitive inhibition of virus infection through RBD, protection of shRNA3, and stimulation of host to produce ACE2-Ab that can block ACE2. Moreover, multi-molecular ACE2 and adjuvant shRNA3 and liposomes each can promote the production and effect of ACE2-Ab.