Compositions for modulating C9ORF72 expression
11339393 · 2022-05-24
Assignee
Inventors
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are compositions and methods for reducing expression of C9ORF72 mRNA and protein in an animal with C9ORF72 specific inhibitors. Also disclosed herein are compositions and methods of selectively inhibiting a C9ORF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1A to the start site of exon 1B of a C9ORF72 pre-mRNA. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C9ORF72 specific inhibitors include antisense compounds.
Claims
1. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 consecutive nucleobases of a nucleobase sequence selected from SEQ ID NOs: 442-467.
2. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases complementary to an equal length portion of nucleobases 7860-7906 or 7907-7944 of SEQ ID NO: 2.
3. The compound of claim 2, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.
4. The compound of claim 3, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
5. The compound of claim 4, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
6. The compound of claim 4, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
7. The compound of claim 6, wherein the modified internucleoside linkage is a phosphorothioate linkage.
8. The compound of claim 5, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
9. The compound of claim 2, wherein at least one nucleobase of the modified oligonucleotide comprises a modified nucleobase.
10. The compound of claim 9, wherein the modified nucleobase is a 5-methylcytosine.
11. The compound of claim 2, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
12. The compound of claim 11, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar.
13. The compound of claim 11, wherein the modified sugar is a bicyclic sugar.
14. The compound of claim 13, wherein each bicyclic sugar comprises a chemical bridge between the 4′ and 2′ positions of the sugar, wherein each chemical bridge is independently selected from: 4′-CH(R)—O-2′ and 4′-(CH.sub.2).sub.2—O-2′, wherein R is independently selected from H, C.sub.1-C.sub.6 alkyl, and C.sub.1-C.sub.6 alkoxy.
15. The compound of claim 14, wherein at least one chemical bridge is 4′-CH(R)—O-2′ and wherein R is methyl.
16. The compound of claim 14, wherein at least one chemical bridge is 4′-CH(R)—O-2′ and wherein R is H.
17. The compound of claim 14, wherein at least one chemical bridge is 4′-CH(R)—O-2′ and wherein R is CH.sub.2—O—CH.sub.3.
18. The compound of claim 11, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group.
19. The compound of claim 11, wherein at least one modified sugar comprises a 2′-O-methyl group.
20. The compound of claim 12, wherein each modified sugar comprises a 2′-O-methoxyethyl group or a 2′-O-methyl group.
21. The compound of claim 2, wherein the modified oligonucleotide is a gapmer.
22. The compound of claim 2, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5′ wing segment consisting of 5 linked nucleosides; and a 3′ wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
23. The compound of claim 2, wherein the modified oligonucleotide comprises: a gap segment consisting of 8 linked deoxynucleosides; a 5′ wing segment consisting of 5 linked nucleosides; and a 3′ wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
24. The compound of claim 2, wherein the modified oligonucleotide comprises sugar modified nucleosides in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein, e=a 2′-O-methoxyethyl modified nucleoside, d=a 2′-deoxynucleoside, and k=a cEt nucleoside.
25. The compound of claim 2, wherein the modified oligonucleotide comprises internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein, s=a phosphorothioate linkage, and o=a phosphodiester linkage.
26. The compound of claim 2, wherein the modified oligonucleotide consists of 17, 18, 19, or 20 linked nucleosides.
27. The compound of claim 2, wherein the modified oligonucleotide has a nucleobase sequence complementary to a region of C9ORF72 other than a hexanucleotide repeat expansion, wherein the hexanucleotide repeat expansion comprises any of GGGCC, GGGGGG, GGGGCG, and GGGGGC.
28. A conjugated antisense compound comprising the compound of claim 2.
29. The compound of claim 2, consisting of the modified oligonucleotide.
30. A double-stranded compound comprising the compound of claim 2.
31. A conjugated antisense compound comprising the double-stranded compound of claim 30.
32. A composition comprising a compound according to claim 2 and at least one of a pharmaceutically acceptable carrier or diluent, wherein optionally the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS).
33. The composition according to claim 32, wherein the compound is a salt, wherein optionally the salt is a sodium salt.
Description
DETAILED DESCRIPTION
(1) It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of“or” means “and/or” unless stated otherwise. Additionally, as used herein, the use of “and” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
(2) The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this disclosure, including, but not limited to, patents, patent applications, published patent applications, articles, books, treatises, and GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
(3) Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis.
(4) Unless otherwise indicated, the following terms have the following meanings:
(5) “2′-O-methoxyethyl” (also 2′-MOE and 2′-OCH.sub.2CH.sub.2—OCH.sub.3 and MOE) refers to an O-methoxy-ethyl modification of the 2′ position of a furanose ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.
(6) “2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety.
(7) “2′-substituted nucleoside” means a nucleoside comprising a substituent at the 2′-position of the furanose ring other than H or OH. In certain embodiments, 2′-substituted nucleosides include nucleosides with bicyclic sugar modifications.
(8) “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5′ position. A 5-methylcytosine is a modified nucleobase.
(9) “About” means within +7% of a value. For example, if it is stated, “the compounds affected at least about 70% inhibition of C9ORF72”, it is implied that the C9ORF72 levels are inhibited within a range of 63% and 77%.
(10) “Administered concomitantly” refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
(11) “Administering” means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
(12) “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
(13) “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
(14) “Antibody” refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
(15) “Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
(16) “Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
(17) “Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.
(18) “Antisense mechanisms” are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
(19) “Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.
(20) “Base complementarity” refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
(21) “Bicyclic sugar” means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.
(22) “Bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring.
(23) “C9ORF72 associated disease” means any disease associated with any C9ORF72 nucleic acid or expression product thereof. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.
(24) “C9ORF72 associated RAN translation products” means aberrant peptide or di-peptide polymers translated through RAN translation (i.e., repeat-associated, and non-ATG-dependent translation). In certain embodiments, the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
(25) “C9ORF72 hexanucleotide repeat expansion associated disease” means any disease associated with a C9ORF72 nucleic acid containing a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG, GGGGGC, or GGGGCG repeated at least 24 times. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.
(26) “C9ORF72 nucleic acid” means any nucleic acid encoding C9ORF72. For example, in certain embodiments, a C9ORF72 nucleic acid includes a DNA sequence encoding C9ORF72, an RNA sequence transcribed from DNA encoding C9ORF72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding C9ORF72. “C9ORF72 mRNA” means an mRNA encoding a C9ORF72 protein.
(27) “C9ORF72 pathogenic associated mRNA variant” means the C9ORF72 mRNA variant processed from a C9ORF72 pre-mRNA variant containing the hexanucleotide repeat. A C9ORF72 pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon 1B, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, the level of a C9ORF72 pathogenic associated mRNA variant is measured to determine the level of a C9ORF72 pre-mRNA containing the hexanucleotide repeat in a sample.
(28) “C9ORF72 specific inhibitor” refers to any agent capable of specifically inhibiting the expression of C9ORF72 mRNA and/or C9ORF72 protein at the molecular level. For example, C9ORF72 specific inhibitors include nucleic acids (including antisense compounds), siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C9ORF72 mRNA and/or C9ORF72 protein. Similarly, in certain embodiments, C9ORF72 specific inhibitors may affect other molecular processes in an animal.
(29) “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
(30) “cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH.sub.3)—O-2′.
(31) “Constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH.sub.3)—O-2′ bridge.
(32) “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2′-O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2′-O-methoxyethyl modifications.
(33) “Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.
(34) “Co-administration” means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.
(35) “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
(36) “Comprise,” “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
(37) “Contiguous nucleobases” means nucleobases immediately adjacent to each other.
(38) “Designing” or“designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
(39) “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.
(40) “Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
(41) “Effective amount” in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
(42) “Efficacy” means the ability to produce a desired effect.
(43) “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
(44) “Foci” means a nuclear foci comprising a C9ORF72 transcript. In certain embodiments, a foci comprises at least one C9ORF72 transcript. In certain embodiments, C9ORF72 foci comprise transcripts comprising any of the following hexanucleotide repeats: GGGGCC, GGGGGG, GGGGGC, and/or GGGGCG.
(45) “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
(46) “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a “gap” and the external regions may be referred to as the “wings.”
(47) “Gap-narrowed” means a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2′-deoxyribonucleosides positioned between and immediately adjacent to 5′ and 3′ wing segments having from 1 to 6 nucleosides.
(48) “Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2′-deoxyribonucleosides positioned between and immediately adjacent to 5′ and 3′ wing segments having from 1 to 6 nucleosides.
(49) “Hexanucleotide repeat expansion” means a series of six bases (for example, GGGGCC, GGGGGG, GGGGCG, or GGGGGC) repeated at least twice. In certain embodiments, the hexanucleotide repeat expansion may be located in intron 1 of a C9ORF72 nucleic acid. In certain embodiments, a pathogenic hexanucleotide repeat expansion includes at least 24 repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C9ORF72 nucleic acid and is associated with disease. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. In certain embodiments, a wild-type hexanucleotide repeat expansion includes 23 or fewer repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C9ORF72 nucleic acid. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases.
(50) “Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
(51) “Identifying an animal having a C9ORF72 associated disease” means identifying an animal having been diagnosed with a C9ORF72 associated disease or predisposed to develop a C9ORF72 associated disease. Individuals predisposed to develop a C9ORF72 associated disease include those having one or more risk factors for developing a C9ORF72 associated disease, including, having a personal or family history or genetic predisposition of one or more C9ORF72 associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
(52) “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.
(53) “Individual” means a human or non-human animal selected for treatment or therapy.
(54) “Inhibiting C9ORF72” means reducing the level or expression of a C9ORF72 mRNA and/or protein. In certain embodiments, C9ORF72 mRNA and/or protein levels are inhibited in the presence of an antisense compound targeting C9ORF72, including an antisense oligonucleotide targeting C9ORF72, as compared to expression of C9ORF72 mRNA and/or protein levels in the absence of a C9ORF72 antisense compound, such as an antisense oligonucleotide.
(55) “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
(56) “Internucleoside linkage” refers to the chemical bond between nucleosides.
(57) “Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.
(58) “Locked nucleic acid” or “LNA” or “LNA nucleosides” means nucleic acid monomers having a bridge connecting two carbon atoms between the 4′ and 2′position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) α-L-Methyleneoxy (4′-CH.sub.2—O-2′) LNA, (B) β-D-Methyleneoxy (4′-CH.sub.2—O-2′) LNA, (C) Ethyleneoxy (4′-(CH.sub.2).sub.2—O-2′) LNA, (D) Aminooxy (4′-CH.sub.2—O—N(R)-2′) LNA and (E) Oxyamino (4′-CH.sub.2—N(R)—O-2′) LNA, as depicted below.
(59) ##STR00001##
(60) As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4′ and the 2′ position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(R.sub.1)(R.sub.2)].sub.n—, —C(R.sub.1)═C(R.sub.2)—, —C(R.sub.1)═N—, —C(═NR.sub.1)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.1).sub.2—, —S(═O).sub.x— and —N(R.sub.1)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.1 and R.sub.2 is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
(61) Examples of 4′-2′ bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: —[C(R.sub.1)(R.sub.2)].sub.n—, —[C(R.sub.1)(R.sub.2)].sub.n—O—, —C(R.sub.1R.sub.2)—N(R.sub.1)—O— or —C(R.sub.1R.sub.2)—O—N(R.sub.1)—. Furthermore, other bridging groups encompassed with the definition of LNA are 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, 4′—CH.sub.2—O-2′, 4′-(CH.sub.2).sub.2—O-2′, 4′—CH.sub.2—O—N(R.sub.1)-2′ and 4′-CH.sub.2—N(R.sub.1)—O-2′-bridges, wherein each R.sub.1 and R.sub.2 is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
(62) Also included within the definition of LNA according to the invention are LNAs in which the 2′-hydroxyl group of the ribosyl sugar ring is connected to the 4′ carbon atom of the sugar ring, thereby forming a methyleneoxy (4′-CH.sub.2—O-2′) bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (—CH.sub.2—) group connecting the 2′ oxygen atom and the 4′ carbon atom, for which the term methyleneoxy (4′-CH.sub.2—O-2′) LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4′-CH.sub.2CH.sub.2—O-2′) LNA is used. α-L-methyleneoxy (4′-CH.sub.2—O-2′), an isomer of methyleneoxy (4′-CH.sub.2—O-2′) LNA is also encompassed within the definition of LNA, as used herein.
(63) “Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
(64) “Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).
(65) “Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
(66) “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
(67) “Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.
(68) “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.
(69) “Modified sugar” means substitution and/or any change from a natural sugar moiety.
(70) “Monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
(71) “Motif” means the pattern of unmodified and modified nucleoside in an antisense compound.
(72) “Natural sugar moiety” means a sugar moiety found in DNA (2′-H) or RNA (2′-OH).
(73) “Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.
(74) “Non-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
(75) “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
(76) “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
(77) “Nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
(78) “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
(79) “Nucleoside” means a nucleobase linked to a sugar.
(80) “Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
(81) “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
(82) “Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
(83) “Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
(84) “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
(85) “Parenteral administration” means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.
(86) “Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.
(87) “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to C9ORF72 is a pharmaceutical agent.
(88) “Pharmaceutical composition” means a mixture of substances suitable for administering to as subject. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
(89) “Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
(90) “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
(91) “Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.
(92) “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
(93) “Prevent” or “preventing” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.
(94) “Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
(95) “Prophylactically effective amount” refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
(96) “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
(97) “Ribonucleotide” means a nucleotide having a hydroxy at the 2′ position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
(98) “Salts” mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
(99) “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
(100) “Shortened” or “truncated” versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted.
(101) “Side effects” means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
(102) “Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand.
(103) “Sites,” as used herein, are defined as unique nucleobase positions within a target nucleic acid.
(104) “Slows progression” means decrease in the development of the disease.
(105) “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
(106) “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
(107) “Subject” means a human or non-human animal selected for treatment or therapy.
(108) “Target” refers to a protein, the modulation of which is desired.
(109) “Target gene” refers to a gene encoding a target.
(110) “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
(111) “Target nucleic acid,” “target RNA,” and “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds.
(112) “Target region” means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
(113) “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.
(114) “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
(115) “Treat” or “treating” or “treatment” means administering a composition to effect an alteration or improvement of a disease or condition.
(116) “Unmodified nucleobases” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U).
(117) “Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).
(118) “Wing segment” means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
CERTAIN EMBODIMENTS
(119) Certain embodiments provide compositions and methods for decreasing total C9ORF72 mRNA and protein expression.
(120) Certain embodiments provide compositions and methods for decreasing C9ORF72 pathogenic associated mRNA variants.
(121) Certain embodiments provide methods for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with C9ORF72 in an individual in need thereof. Also contemplated are methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with C9ORF72. C9ORF72 associated diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, the neurodegenerative disease may be ALS or FTD. In certain embodiments, the neurodegenerative disease may be familial or sporadic.
(122) Certain embodiments provide compositions and methods for the treatment, prevention, or amelioration of a C9ORF72 hexanucleotide repeat expansion associated disease. In certain embodiments, the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
(123) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: SEQ ID NOs: 20-401 and 441-1545.
(124) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1107-1520 of SEQ ID NO: 2.
(125) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1111-1200 of SEQ ID NO: 2.
(126) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1211-1318 of SEQ ID NO: 2.
(127) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1326-1540 of SEQ ID NO: 2.
(128) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1331-1375 of SEQ ID NO: 2.
(129) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1368-1391 of SEQ ID NO: 2
(130) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of SEQ ID NO: 2.
(131) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1411-1440 of SEQ ID NO: 2.
(132) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1429-1481 of SEQ ID NO: 2.
(133) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1502-1539 of SEQ ID NO: 2.
(134) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1508-1539 of SEQ ID NO: 2.
(135) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7860-7906 of SEQ ID NO: 2.
(136) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7907-9744 of SEQ ID NO: 2.
(137) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7989-8038 of SEQ ID NO: 2.
(138) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8020-8135 of SEQ ID NO: 2.
(139) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8136-8161 of SEQ ID NO: 2.
(140) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8174-8211 of SEQ ID NO: 2.
(141) Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8213-8325 of SEQ ID NO: 2.
(142) In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.
(143) In certain embodiments, the modified oligonucleotide is a single-stranded modified oligonucleotide.
(144) In certain embodiments at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
(145) In certain embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
(146) In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
(147) In certain embodiments, at least one internucleoside linkage is a phosphodiester internucleoside linkage.
(148) In certain embodiments, at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.
(149) In certain embodiments, at least one nucleoside comprises a modified nucleobase.
(150) In certain embodiments, the modified nucleobase is a 5-methylcytosine.
(151) In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
(152) In certain embodiments, the at least one modified sugar is a bicyclic sugar.
(153) In certain embodiments, the bicyclic sugar comprises a chemical link between the 2′ and 4′ position of the sugar 4′-CH2-N(R)—O-2′ bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
(154) In certain embodiments, the bicyclic sugar comprises a 4′-CH2-N(R)—O-2′ bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
(155) In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl group.
(156) In certain embodiments, the modified sugar comprises a 2′-O(CH.sub.2).sub.2—OCH.sub.3 group.
(157) In certain embodiments, the modified oligonucleotide comprises:
(158) a gap segment consisting of 10 linked deoxynucleosides;
(159) a 5′ wing segment consisting of 5 linked nucleosides; and
(160) a 3′ wing segment consisting of 5 linked nucleosides;
(161) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
(162) In certain embodiments, the modified oligonucleotide comprises:
(163) a gap segment consisting of 8 linked deoxynucleosides;
(164) a 5′ wing segment consisting of 5 linked nucleosides; and
(165) a 3′ wing segment consisting of 5 linked nucleosides;
(166) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
(167) In certain embodiments, the modified oligonucleotide comprises sugar modifications in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein,
(168) e=a 2′-O-methoxyethyl modified nucleoside
(169) d=a 2′-deoxynucleoside, and
(170) k=a cEt nucleoside.
(171) In certain embodiments, the modified oligonucleotide comprises internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein,
(172) s=a phosphorothioate linkage, and
(173) o=a phosphodiester linkage.
(174) In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.
(175) In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides.
(176) In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides.
(177) In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides.
(178) Provided herein are compositions comprising the compound of any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
(179) Provided herein are methods comprising administering to an animal the compound or composition of any preceding claim.
(180) In certain embodiments, the animal is a human.
(181) In certain embodiments, administering the compound prevents, treats, ameliorates, or slows progression of a C9ORF72 associated disease, disorder or condition.
(182) In certain embodiments, administering the compound prevents, treats, ameliorates, or slows progression of a C9ORF72 hexanucleotide repeat expansion associated disease, disorder or condition.
(183) In certain embodiments, the disease, disorder or condition is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerellar degeneration (OPCD).
(184) In certain embodiments, the administering reduces nuclear foci.
(185) In certain embodiments, the administering reduces expression of C9ORF72 associated RAN translation products.
(186) In certain embodiments, the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
(187) Provided herein are uses of the compound or composition of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disorder.
(188) Provided herein are methods of selectively inhibiting a C9ORF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1A to the start site of exon 1B of a C9ORF72 pre-mRNA.
(189) Antisense Compounds
(190) Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
(191) In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
(192) In certain embodiments, an antisense compound targeted to a C9ORF72 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In certain embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. In certain embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides.
(193) In certain embodiments antisense oligonucleotides targeted to a C9ORF72 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated antisense compound targeted to a C9ORF72 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.
(194) When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5′ or 3′ end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5′ end and one subunit added to the 3′ end.
(195) It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
(196) Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
(197) Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
(198) Antisense Compound Motifs
(199) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
(200) Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
(201) Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE, and 2′-O—CH.sub.3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4′-(CH.sub.2)n-O-2′ bridge, where n=1 or n=2 and 4′-CH.sub.2—O—CH.sub.2-2′). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5′ wing region, “Y” represents the length of the gap region, and “Z” represents the length of the 3′ wing region. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5′ wing segment and the 3′ wing segment. Thus, no intervening nucleotides exist between the 5′ wing segment and gap segment, or the gap segment and the 3′ wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers described herein include, but are not limited to, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.
(202) In certain embodiments, the antisense compound has a “wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations described herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
(203) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid possess a 5-10-5 gapmer motif.
(204) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid possess a 5-8-5 gapmer motif.
(205) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid possess sugar modifications in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein,
(206) e=a 2′-O-methoxyethyl modified nucleoside
(207) d=a 2′-deoxynucleoside, and
(208) k=a cEt nucleoside.
(209) In certain embodiments, an antisense compound targeted to a C9ORF72 nucleic acid has a gap-narrowed motif. In certain embodiments, a gap-narrowed antisense oligonucleotide targeted to a C9ORF72 nucleic acid has a gap segment of 9, 8, 7, or 6 2′-deoxynucleotides positioned immediately adjacent to and between wing segments of 5, 4, 3, 2, or 1 chemically modified nucleosides. In certain embodiments, the chemical modification comprises a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4′ to 2′ bridge selected from among: 4′-(CH.sub.2).sub.n-0-2′ bridge, wherein n is 1 or 2; and 4′-CH.sub.2—O—CH.sub.2-2′. In certain embodiments, the bicyclic sugar is comprises a 4′-CH(CH.sub.3)—O-2′ bridge. In certain embodiments, the chemical modification comprises a non-bicyclic 2′-modified sugar moiety. In certain embodiments, the non-bicyclic 2′-modified sugar moiety comprises a 2′-O-methylethyl group or a 2′-O-methyl group.
(210) Target Nucleic Acids, Target Regions and Nucleotide Sequences
(211) Nucleotide sequences that encode C9ORF72 include, without limitation, the following: the complement of GENBANK Accession No. NM_001256054.1 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT_008413.18 truncated from nucleobase 27535000 to U.S. Pat. No. 27,565,000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. BQ068108.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DN993522.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. NM_145005.5 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 8), Sequence Identifier 4141_014_A (incorporated herein as SEQ ID NO: 9), and Sequence Identifier 4008_73_A (incorporated herein as SEQ ID NO: 10), and GENBANK Accession No. NW_001101662.1 truncated from nucleosides 8522000 to U.S. Pat. No. 8,552,000 (incorporated herein as SEQ ID NO: 19).
(212) It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
(213) In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3′ UTR, a 5′ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for C9ORF72 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5′ target site of one target segment within the target region to a 3′ target site of another target segment within the same target region.
(214) Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
(215) A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5′ target sites or 3′ target sites listed herein.
(216) Suitable target segments may be found within a 5′ UTR, a coding region, a 3′ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon.
(217) The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
(218) There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within a target region. In certain embodiments, reductions in C9ORF72 mRNA levels are indicative of inhibition of C9ORF72 expression. Reductions in levels of a C9ORF72 protein are also indicative of inhibition of target mRNA expression. Reduction in the presence of expanded C9ORF72 RNA foci are indicative of inhibition of C9ORF72 expression. Further, phenotypic changes are indicative of inhibition of C9ORF72 expression. For example, improved motor function and respiration may be indicative of inhibition of C9ORF72 expression.
(219) Hybridization
(220) In some embodiments, hybridization occurs between an antisense compound disclosed herein and a C9ORF72 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
(221) Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
(222) Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a C9ORF72 nucleic acid.
(223) Complementarity
(224) An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a C9ORF72 nucleic acid).
(225) Non-complementary nucleobases between an antisense compound and a C9ORF72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a C9ORF72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
(226) In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a C9ORF72 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
(227) For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
(228) In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a C9ORF72 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
(229) The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
(230) In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C9ORF72 nucleic acid, or specified portion thereof.
(231) In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C9ORF72 nucleic acid, or specified portion thereof.
(232) The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
(233) Identity
(234) The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
(235) In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
(236) In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
(237) In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Modifications
(238) A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
(239) Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
(240) Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
(241) Modified Internucleoside Linkages
(242) The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
(243) Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
(244) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a C9ORF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.
(245) In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid possess internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein,
(246) s=a phosphorothioate linkage, and
(247) o=a phosphodiester linkage.
(248) Modified Sugar Moieties
(249) Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R, R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5′-methyl or a 5′-vinyl group).
(250) Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH.sub.3, 2′-OCH.sub.2CH.sub.3, 2′—OCH.sub.2CH.sub.2F and 2′-O(CH.sub.2).sub.2OCH.sub.3 substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C.sub.1-C.sub.10 alkyl, OCF.sub.3, OCH.sub.2F, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2—O—N(R.sub.m)(R.sub.n), O—CH.sub.2—C(═O)—N(R.sub.m)(R.sub.n), and O—CH.sub.2—C(═O)N(R.sub.1)—(CH.sub.2).sub.2—N(R.sub.m)(R.sub.n), where each R.sub.l, R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
(251) As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4′-(CH.sub.2)—O-2′ (LNA); 4′-(CH.sub.2)—S-2′; 4′-(CH.sub.2).sub.2—O-2′ (ENA); 4′-CH(CH.sub.3)—O-2′ and 4′-CH(CH.sub.2OCH.sub.3)-0-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH.sub.3)(CH.sub.3)—O-2′ (and analogs thereof see published International Application WO/2009/006478, published Jan. 8, 2009); 4′-CH.sub.2—N(OCH.sub.3)-2′ (and analogs thereof see published International Application WO/2008/150729, published Dec. 11, 2008); 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4′-CH.sub.2—N(R)—O-2′, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH.sub.2—C—(═CH.sub.2)-2′ (and analogs thereof see published International Application WO 2008/154401, published on Dec. 8, 2008).
(252) Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Serial Nos. 60/989,574; 61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and 61/099,844; Published PCT International applications WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).
(253) In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4′ and the 2′ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(R.sub.a)(R.sub.b)].sub.n—, —C(R.sub.a)C(R.sub.b)—, —C(R.sub.a)═N—, —C(O)—, —C(═NR.sub.a)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;
(254) wherein:
(255) x is 0, 1, or 2;
(256) n is 1, 2, 3, or 4;
(257) each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
(258) In certain embodiments, the bridge of a bicyclic sugar moiety is —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.aR.sub.b)—N(R)—O— or —C(R.sub.aR.sub.b)—O—N(R)—. In certain embodiments, the bridge is 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, 4′—CH.sub.2—O-2′, 4′-(CH.sub.2).sub.2—O-2′, 4′—CH.sub.2—O—N(R)-2′ and 4′-CH.sub.2—N(R)—O-2′— wherein each R is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
(259) In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-2′ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4′-CH.sub.2—O-2′) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
(260) In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4′-CH.sub.2—O-2′) BNA, (B) 3-D-methyleneoxy (4′-CH.sub.2—O-2′) BNA, (C) ethyleneoxy (4′-(CH.sub.2).sub.2—O-2′) BNA, (D) aminooxy (4′-CH.sub.2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH.sub.2—N(R)—O-2′) BNA, and (F) methyl(methyleneoxy) (4′-CH(CH.sub.3)—O-2′) BNA, (G) methylene-thio (4′-CH.sub.2—S-2′) BNA, (H) methylene-amino (4′-CH.sub.2—N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH.sub.2—CH(CH.sub.3)-2′) BNA, and (J) propylene carbocyclic (4′-(CH.sub.2).sub.3-2′) BNA as depicted below.
(261) ##STR00002## ##STR00003##
wherein Bx is the base moiety and R is independently H, a protecting group or C.sub.1-C.sub.12 alkyl.
(262) In certain embodiments, bicyclic nucleosides are provided having Formula I:
(263) ##STR00004##
wherein:
(264) Bx is a heterocyclic base moiety;
(265) -Q.sub.a-Q.sub.b-Q.sub.c- is —CH.sub.2—N(R.sub.c)—CH.sub.2—, —C(═O)—N(R.sub.c)—CH.sub.2—, —CH.sub.2—O—N(R.sub.c)—, —CH.sub.2—N(R.sub.c)—O— or —N(R.sub.c)—O—CH.sub.2;
(266) R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and
(267) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
(268) In certain embodiments, bicyclic nucleosides are provided having Formula II:
(269) ##STR00005##
wherein:
(270) Bx is a heterocyclic base moiety;
(271) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
(272) Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
(273) In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ.sub.c, NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(═X)J.sub.c, and NJ.sub.eC(═X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.
(274) In certain embodiments, bicyclic nucleosides are provided having Formula III:
(275) ##STR00006##
wherein:
(276) Bx is a heterocyclic base moiety;
(277) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
(278) Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl (C(═O)—).
(279) In certain embodiments, bicyclic nucleosides are provided having Formula IV:
(280) ##STR00007##
wherein:
(281) Bx is a heterocyclic base moiety;
(282) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
(283) R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
(284) each q.sub.a, q.sub.b, q.sub.c and q.sub.d is, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6 aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;
(285) In certain embodiments, bicyclic nucleosides are provided having Formula V:
(286) ##STR00008##
wherein:
(287) Bx is a heterocyclic base moiety;
(288) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
(289) q.sub.a, q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(═O)OJ.sub.j, C(═O)NJ.sub.jJ.sub.k, C(═O)J.sub.j, O—C(═O)NJ.sub.jJ.sub.k, N(H)C(═NH)NJ.sub.jJ.sub.k, N(H)C(═O)NJ.sub.jJ.sub.k or N(H)C(═S)NJ.sub.jJ.sub.k;
(290) or q.sub.e and q.sub.f together are ═C(q.sub.g)(q.sub.h);
(291) q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.
(292) The synthesis and preparation of the methyleneoxy (4′-CH.sub.2—O-2′) BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
(293) Analogs of methyleneoxy (4′-CH.sub.2—O-2′) BNA and 2′-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2′-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-amino- and 2′-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
(294) In certain embodiments, bicyclic nucleosides are provided having Formula VI:
(295) ##STR00009##
wherein:
(296) Bx is a heterocyclic base moiety;
(297) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
(298) each q.sub.i, q.sub.j, q.sub.k and q.sub.l is, independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(═O)OJ.sub.j, C(═O)NJ.sub.jJ.sub.k, C(═O)J.sub.j, O—C(═O)NJ.sub.jJ.sub.k, N(H)C(═NH)NJ.sub.jJ.sub.k, N(H)C(═O)NJ.sub.jJ.sub.k or N(H)C(═S)NJ.sub.jJ.sub.k; and
(299) q.sub.i and q.sub.j or q.sub.l and q.sub.k together are ═C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.
(300) One carbocyclic bicyclic nucleoside having a 4′-(CH.sub.2).sub.3-2′ bridge and the alkenyl analog bridge 4′-CH═CH—CH.sub.2-2′ have been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).
(301) As used herein, “4′-2′ bicyclic nucleoside” or “4′ to 2′ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2′ carbon atom and the 4′ carbon atom of the sugar ring.
(302) As used herein, “monocylic nucleosides” refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
(303) As used herein, “2′-modified sugar” means a furanosyl sugar modified at the 2′ position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2′ modifications are selected from substituents including, but not limited to: O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nF, O(CH.sub.2).sub.nONH.sub.2, OCH.sub.2C(═O)N(H)CH.sub.3, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10. Other 2′-substituent groups can also be selected from: C.sub.1-C.sub.12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, F, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2′-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2′-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2′-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2′-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
(304) As used herein, a “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro HNA (F-HNA) or those compounds having Formula VII:
(305) ##STR00010##
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
(306) Bx is a heterocyclic base moiety;
(307) T.sub.a and T.sub.b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.a and T.sub.b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.a and T.sub.b is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3′-terminal group;
(308) q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and R.sub.2 is selected from hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
(309) In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is fluoro. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is H and R.sub.2 is methoxyethoxy.
(310) As used herein, “2′-modified” or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH. 2′-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2′ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2′substituents, such as allyl, amino, azido, thio, O-allyl, O—C.sub.1-C.sub.10 alkyl, —OCF.sub.3, O—(CH.sub.2).sub.2—O—CH.sub.3, 2′—O(CH.sub.2).sub.2SCH.sub.3, O—(CH.sub.2).sub.2—O—N(R.sub.m)(R.sub.n), or O—CH.sub.2—C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. 2′-modified nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.
(311) As used herein, “2′-F” refers to a nucleoside comprising a sugar comprising a fluoro group at the 2′ position.
(312) As used herein, “2′-OMe” or “2′-OCH.sub.3” or “2′-O-methyl” each refers to a nucleoside comprising a sugar comprising an —OCH.sub.3 group at the 2′ position of the sugar ring.
(313) As used herein, “MOE” or “2′-MOE” or “2′-OCH.sub.2CH.sub.2OCH.sub.3” or “2′-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a —OCH.sub.2CH.sub.2OCH.sub.3 group at the 2′ position of the sugar ring.
(314) As used herein, “oligonucleotide” refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
(315) Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
(316) Methods for the preparations of modified sugars are well known to those skilled in the art.
(317) In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
(318) In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2′-MOE. In certain embodiments, the 2′-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4′-CH(CH.sub.3)—O-2′) bridging group. In certain embodiments, the (4′-CH(CH.sub.3)—O-2′) modified nucleosides are arranged throughout the wings of a gapmer motif.
(319) Compositions and Methods for Formulating Pharmaceutical Compositions
(320) Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
(321) An antisense compound targeted to a C9ORF72 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C9ORF72 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.
(322) Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
(323) A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
(324) Conjugated Antisense Compounds
(325) Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
(326) Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
(327) Cell Culture and Antisense Compounds Treatment
(328) The effects of antisense compounds on the level, activity or expression of C9ORF72 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
(329) In Vitro Testing of Antisense Oligonucleotides
(330) Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
(331) In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
(332) One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
(333) Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
(334) Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
(335) Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
(336) The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
(337) RNA Isolation
(338) RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.
(339) Analysis of Inhibition of Target Levels or Expression
(340) Inhibition of levels or expression of a C9ORF72 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
(341) Quantitative Real-Time PCR Analysis of Target RNA Levels
(342) Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
(343) Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
(344) Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
(345) Probes and primers are designed to hybridize to a C9ORF72 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, Calif.).
(346) Analysis of Protein Levels
(347) Antisense inhibition of C9ORF72 nucleic acids can be assessed by measuring C9ORF72 protein levels. Protein levels of C9ORF72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human C9ORF72 are commercially available.
(348) In Vivo Testing of Antisense Compounds
(349) Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of C9ORF72 and produce phenotypic changes, such as, improved motor function and respiration. In certain embodiments, motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In certain embodiments, respiration is measured by whole body plethysmograph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF). Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, as well as central routes of administration such as intracerebroventricular or intrathecal. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in C9ORF72 nucleic acid expression are measured.
(350) Targeting C9ORF72
(351) Antisense oligonucleotides described herein may hybridize to a C9ORF72 nucleic acid in any stage of RNA processing. For example, described herein are antisense oligonucleotides that are complementary to a pre-mRNA or a mature mRNA. Additionally, antisense oligonucleotides described herein may hybridize to any element of a C9ORF72 nucleic acid. For example, described herein are antisense oligonucleotides that are complementary to an exon, an intron, the 5′ UTR, the 3′ UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C9ORF72 nucleic acid.
(352) In certain embodiments, antisense oligonucleotides described herein hybridize to all variants of C9ORF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to certain variants of C9ORF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to variants of C9ORF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to pre-mRNA variants containing the hexanucleotide repeat. In certain embodiments, pre-mRNA variants of C9ORF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
(353) In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C9ORF72. In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C9ORF72 equally. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of one or more variants of C9ORF72. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of variants of C9ORF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of pre-mRNA variants containing the hexanucleotide repeat. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of C9ORF72 pathogenic associated mRNA variants. In certain embodiments, pre-mRNA variants of C9ORF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG. In certain embodiments, the hexanucleotide repeat expansion forms nuclear foci. In certain embodiments, antisense oligonucleotides described herein are useful for reducing nuclear foci. Nuclear foci may be reduced in terms of percent of cells with foci as well as number of foci per cell.
(354) Selective Inhibition of Certain Pathogenic Associated Variants
(355) In certain examples herein, primer probe set RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat. The mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat (i.e., the “C9ORF72 pathogenic associated mRNA variant”). A pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon 1B, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). Oligonucleotides were designed in this region to selectively target the pre-mRNA variant containing the hexanucleotide repeat. RTS3905 measures an mRNA product (i.e. the C9ORF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.
(356) C9ORF72 Features
(357) Antisense oligonucleotides described herein may hybridize to any C9ORF72 variant at any state of processing within any element of the C9ORF72 gene. For example, antisense oligonucleotides described herein may hybridize to an exon, an intron, the 5′ UTR, the 3′ UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10. For example, antisense oligonucleotides may target any of the exons characterized below in Tables 1-5 for the various C9ORF72 variants described below. Antisense oligonucleotides described herein may also target variants not characterized below and such variants are characterized in GENBANK. Moreover, antisense oligonucleotides described herein may also target elements other than exons and such elements are characterized in GENBANK.
(358) TABLE-US-00001 TABLE 1 Functional Segments for NM_001256054.1 (SEQ ID NO: 1) Start site Stop site in in mRNA mRNA reference reference Exon start stop to SEQ to SEQ Number site site ID NO: 2 ID NO: 2 exon 1C 1 158 1137 1294 exon 2 159 646 7839 8326 exon 3 647 706 9413 9472 exon 4 707 802 12527 12622 exon 5 803 867 13354 13418 exon 6 868 940 14704 14776 exon 7 941 1057 16396 16512 exon 8 1058 1293 18207 18442 exon 9 1294 1351 24296 24353 exon 10 1352 1461 26337 26446 exon 11 1462 3339 26581 28458
(359) TABLE-US-00002 TABLE 2 Functional Segments for NM_018325.3 (SEQ ID NO: 4) Start site Stop site in in mRNA mRNA reference reference Exon start stop to SEQ to SEQ Number site site ID NO: 2 ID NO: 2 exon 1B 1 63 1510 1572 exon 2 64 551 7839 8326 exon 3 552 611 9413 9472 exon 4 612 707 12527 12622 exon 5 708 772 13354 13418 exon 6 773 845 14704 14776 exon 7 846 962 16396 16512 exon 8 963 1198 18207 18442 exon 9 1199 1256 24296 24353 exon 10 1257 1366 26337 26446 exon 11 1367 3244 26581 28458
(360) TABLE-US-00003 TABLE 3 Functional Segments for NM_145005.5 (SEQ ID NO: 6) Start site Stop site in in mRNA mRNA reference reference start stop to SEQ to SEQ Exon Number site site ID NO: 2 ID NO: 2 exon 1A 1 80 1137 1216 exon 2 81 568 7839 8326 exon 3 569 628 9413 9472 exon 4 629 724 12527 12622 exon 5B (exon 5 725 1871 13354 14500 into intron 5)
(361) TABLE-US-00004 TABLE 4 Functional Segments for DB079375.1 (SEQ ID NO: 7) Start site Stop site in in mRNA mRNA reference reference Exon start stop to SEQ to SEQ Number site site ID NO: 2 ID NO: 2 exon 1E 1 35 1135 1169 exon 2 36 524 7839 8326 exon 3 (EST ends 525 562 9413 9450 before end of full exon)
(362) TABLE-US-00005 TABLE 5 Functional Segments for BU194591.1 (SEQ ID NO: 8) Start site Stop site in in mRNA mRNA reference reference start stop to SEQ to SEQ Exon Number site site ID NO: 2 ID NO: 2 exon 1D 1 36 1241 1279 exon 2 37 524 7839 8326 exon 3 525 584 9413 9472 exon 4 585 680 12527 12622 exon 5B (exon 5 681 798 13354 13465 into intron 5)
Certain Indications
(363) In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk for developing a neurodegenerative disease, including, but not limited to, ALS or FTD. In certain embodiments, the individual has been identified as having a C9ORF72 associated disease. In certain embodiments, the individual has been identified as having a C9ORF72 hexanucleotide repeat expansion associated disease. In certain embodiments, provided herein are methods for prophylactically reducing C9ORF72 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a C9ORF72 nucleic acid.
(364) In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a C9ORF72 nucleic acid is accompanied by monitoring of C9ORF72 levels in an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention.
(365) In certain embodiments, administration of an antisense compound targeted to a C9ORF72 nucleic acid results in reduction of C9ORF72 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a C9ORF72 nucleic acid results in improved motor function and respiration in an animal. In certain embodiments, administration of a C9ORF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
(366) In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to C9ORF72 are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including ALS and FTD.
(367) Certain Combination Therapies
(368) In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to produce a synergistic effect.
(369) In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.
(370) In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include Riluzole (Rilutek), Lioresal (Lioresal), and Dexpramipexole.
(371) In certain embodiments, pharmaceutical agents that may be co-administered with a C9ORF72 specific inhibitor described herein include, but are not limited to, an additional C9ORF72 inhibitor. In certain embodiments, the co-adminstered pharmaceutical agent is administered prior to administration of a pharmaceutical composition described herein. In certain embodiments, the co-administered pharmaceutical agent is administered following administration of a pharmaceutical composition described herein. In certain embodiments the co-administered pharmaceutical agent is administered at the same time as a pharmaceutical composition described herein. In certain embodiments the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
(372) In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In other embodiments, the co-administration results in effects that are additive of the effects of the compounds when administered alone. In certain embodiments, the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound.
(373) Certain Amplicon Regions
(374) Certain antisense oligonucleotides described herein may target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these compounds.
(375) Certain Human Therapeutics
(376) The human C9ORF72 antisense oligonucleotides described herein are being evaluated as possible human therapeutics. Various parameters of potency, efficacy, and/or tolerability are being examined. Such parameters include in vitro inhibition of total C9ORF72 RNA expression, in vitro inhibition of C9ORF72 pathogenic associated RNA variant expression, in vitro dose response (IC50), in vivo inhibition of total or pathogenic RNA and/or protein in a transgenic animal containing a human C9ORF72 transgene in relevant tissues (e.g., brain and/or spinal cord), tolerability in mouse, tolerability in rat, and/or tolerability in a primate. Tolerability markers that may be measured include blood and serum chemistry parameters, CSF chemistry parameters, body and organ weights, general observations and/or behavioral tests, and/or biochemical markers such as GFAP and/or AIF1. Acute or long term tolerability may be measured.
(377) Certain Hotspot Regions
(378) 1. Nucleobases 1107-1520 of SEQ ID NO: 2
(379) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1107-1520 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1107-1520 are a hotspot region. In certain embodiments, nucleobases 1107-1520 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 17, 18, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers. In certain embodiments, the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(380) In certain embodiments, nucleobases 1107-1520 are targeted by the following ISIS numbers: 619042-619333, 672581-672714, 672735-672865, 672885-673015, 673035-673165, 673185-673315, and 673335-673465.
(381) In certain embodiments, nucleobases 1107-1520 are targeted by the following SEQ ID NOs: 21-31, 33-50, 52, 54-134, 138-248, 251-319, 325, 744-877, and 898-1028.
(382) In certain embodiments, nucleobases 1107-1520 are targeted by the following ISIS numbers: 619042-619333.
(383) In certain embodiments, nucleobases 1107-1520 are targeted by the following SEQ ID NOs: 21-31, 33-50, 52, 54-134, 138-248, 251-319, and 325.
(384) In certain embodiments, antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(385) In certain embodiments, antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(386) 2. Nucleobases 1111-1200 of SEQ ID NO: 2
(387) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1111-1200 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1111-1200 are a hotspot region. In certain embodiments, nucleobases 1111-1200 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(388) In certain embodiments, nucleobases 1111-1200 are targeted by the following ISIS numbers: 619042-619095.
(389) In certain embodiments, nucleobases 1111-1200 are targeted by the following SEQ ID NOs: 21, 26-31, 33-50, 52, 54-60, 75, 81, and 87-96.
(390) In certain embodiments, antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(391) In certain embodiments, antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(392) 3. Nucleobases 1211-1318 of SEQ ID NO: 2
(393) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1211-1318 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1211-1318 are a hotspot region. In certain embodiments, nucleobases 1211-1318 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(394) In certain embodiments, nucleobases 1211-1318 are targeted by the following ISIS numbers: 619096-619172.
(395) In certain embodiments, nucleobases 1211-1318 are targeted by the following SEQ ID NOs: 22-25, 70-74, 76-80, 82-86, 99-134, and 138-159.
(396) In certain embodiments, antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(397) In certain embodiments, antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(398) 4. Nucleobases 1326-1540 of SEQ ID NO: 2
(399) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1326-1540 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1326-1540 are a hotspot region. In certain embodiments, nucleobases 1326-1540 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 17, 18, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers. In certain embodiments, the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(400) In certain embodiments, nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354, and 672581-673484.
(401) In certain embodiments, nucleobases 1326-1540 are targeted by the following SEQ ID NOs: 97, 98, 160-248, 251-322, 325-343, and 744-1047.
(402) In certain embodiments, nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354.
(403) In certain embodiments, nucleobases 1326-1540 are targeted by the following SEQ ID NOs: 97, 98, 160-248, 251-322, and 325-343.
(404) In certain embodiments, antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(405) In certain embodiments, antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(406) 5. Nucleobases 1331-1375 of SEQ ID NO: 2
(407) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1331-1375 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1331-1375 are a hotspot region. In certain embodiments, nucleobases 1331-1375 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(408) In certain embodiments, nucleobases 1331-1375 are targeted by the following ISIS numbers: 619178-619203.
(409) In certain embodiments, nucleobases 1331-1375 are targeted by the following SEQ ID NOs: 165-190.
(410) In certain embodiments, antisense oligonucleotides targeting nucleobases 1331-1375 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(411) 6. Nucleobases 1368-1391 of SEQ ID NO: 2
(412) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1368-1391 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1368-1391 are a hotspot region. In certain embodiments, nucleobases 1368-1391 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(413) In certain embodiments, nucleobases 1368-1391 are targeted by the following ISIS numbers: 619215-619219.
(414) In certain embodiments, nucleobases 1368-1391 are targeted by the following SEQ ID NOs: 202-206.
(415) In certain embodiments, antisense oligonucleotides targeting nucleobases 1368-1391 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(416) 7. Nucleobases 1398-1424 of SEQ ID NO: 2
(417) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1398-1424 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1398-1424 are a hotspot region. In certain embodiments, nucleobases 1398-1424 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(418) In certain embodiments, nucleobases 1398-1424 are targeted by the following ISIS numbers: 619245-619252.
(419) In certain embodiments, nucleobases 1398-1424 are targeted by the following SEQ ID NOs: 232-239.
(420) In certain embodiments, antisense oligonucleotides targeting nucleobases 1398-1424 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(421) 8. Nucleobases 1411-1440 of SEQ ID NO: 2
(422) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1411-1440 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1411-1440 are a hotspot region. In certain embodiments, nucleobases 1411-1440 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(423) In certain embodiments, nucleobases 1411-1440 are targeted by the following ISIS numbers: 619258-619268.
(424) In certain embodiments, nucleobases 1411-1440 are targeted by the following SEQ ID NOs: 244-248, 251-255, and 325.
(425) In certain embodiments, antisense oligonucleotides targeting nucleobases 1411-1440 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(426) 9. Nucleobases 1429-1481 of SEQ ID NO: 2
(427) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1429-1481 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1429-1481 are a hotspot region. In certain embodiments, nucleobases 1429-1481 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(428) In certain embodiments, nucleobases 1429-1481 are targeted by the following ISIS numbers: 619276-619303.
(429) In certain embodiments, nucleobases 1429-1481 are targeted by the following SEQ ID NOs: 98 and 263-289.
(430) In certain embodiments, antisense oligonucleotides targeting nucleobases 1429-1481 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(431) 10. Nucleobases 1502-1539 of SEQ ID NO: 2
(432) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1502-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1502-1539 are a hotspot region. In certain embodiments, nucleobases 1502-1539 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(433) In certain embodiments, nucleobases 1502-1539 are targeted by the following ISIS numbers: 619335-619353.
(434) In certain embodiments, nucleobases 1502-1539 are targeted by the following SEQ ID NOs: 321, 322, and 326-342.
(435) In certain embodiments, antisense oligonucleotides targeting nucleobases 1502-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(436) 11. Nucleobases 1508-1539 of SEQ ID NO: 2
(437) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 1508-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1508-1539 are a hotspot region. In certain embodiments, nucleobases 1508-1539 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have “mixed backbones”). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.
(438) In certain embodiments, nucleobases 1508-1539 are targeted by the following ISIS numbers: 619341-619353.
(439) In certain embodiments, nucleobases 1508-1539 are targeted by the following SEQ ID NOs: 330-342.
(440) In certain embodiments, antisense oligonucleotides targeting nucleobases 1508-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo
(441) 12. Nucleobases 7860-7906 of SEQ ID NO: 2
(442) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7860-7906 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7860-7906 are a hotspot region. In certain embodiments, nucleobases 7860-7906 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(443) In certain embodiments, nucleobases 7860-7906 are targeted by the following ISIS numbers: 655135-655144.
(444) In certain embodiments, nucleobases 7860-7906 are targeted by the following SEQ ID NOs: 445-454.
(445) In certain embodiments, antisense oligonucleotides targeting nucleobases 7860-7906 achieve at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(446) 13. Nucleobases 7907-7944 of SEQ ID NO: 2
(447) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7907-7944 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7907-7944 are a hotspot region. In certain embodiments, nucleobases 7907-7944 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(448) In certain embodiments, nucleobases 7907-7944 are targeted by the following ISIS numbers: 655150-655156.
(449) In certain embodiments, nucleobases 7907-7944 are targeted by the following SEQ ID NOs: 460-467.
(450) In certain embodiments, antisense oligonucleotides targeting nucleobases 7907-7944 achieve at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, or at least 91% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(451) 14. Nucleobases 7989-8038 of SEQ ID NO: 2
(452) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7989-8038 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7989-8038 are a hotspot region. In certain embodiments, nucleobases 7989-8038 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester Internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(453) In certain embodiments, nucleobases 7989-8038 are targeted by the following ISIS numbers: 619411, 619412, 619420, 625183, 627833, and 655173-655180.
(454) In certain embodiments, nucleobases 7989-8038 are targeted by the following SEQ ID NOs: 20, 51, 53, and 484-493.
(455) In certain embodiments, antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, or at least 76% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(456) In certain embodiments, antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(457) 15. Nucleobases 8020-8135 of SEQ ID NO: 2
(458) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8020-8135 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8020-8135 are a hotspot region. In certain embodiments, nucleobases 8020-8135 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(459) In certain embodiments, nucleobases 8020-8135 are targeted by the following ISIS numbers: 619413, 619414, 625255, 627834, 655181-655208.
(460) In certain embodiments, nucleobases 8020-8135 are targeted by the following SEQ ID NOs: 135, 136, 494-511, and 517-528.
(461) In certain embodiments, antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, or at least 54% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(462) In certain embodiments, antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(463) 16. Nucleobases 8136-8161 of SEQ ID NO: 2
(464) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8136-8161 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8136-8161 are a hotspot region. In certain embodiments, nucleobases 8136-8161 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(465) In certain embodiments, nucleobases 8136-8161 are targeted by the following ISIS numbers: 655215-655217.
(466) In certain embodiments, nucleobases 8136-8161 are targeted by the following SEQ ID NOs: 535-537.
(467) In certain embodiments, antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, or at least 41% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(468) In certain embodiments, antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(469) 17. Nucleobases 8174-8211 of SEQ ID NO: 2
(470) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8174-8211 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8174-8211 are a hotspot region. In certain embodiments, nucleobases 8174-8211 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(471) In certain embodiments, nucleobases 8174-8211 are targeted by the following ISIS numbers: 655228-655234.
(472) In certain embodiments, nucleobases 8174-8211 are targeted by the following SEQ ID NOs: 548-554.
(473) In certain embodiments, antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, or at least 63% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(474) In certain embodiments, antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
(475) 18. Nucleobases 8213-8325 of SEQ ID NO: 2
(476) In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8213-8325 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8213-8325 are a hotspot region. In certain embodiments, nucleobases 8213-8325 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have “mixed backbones”).
(477) In certain embodiments, nucleobases 8213-8325 are targeted by the following ISIS numbers: 655235-655270.
(478) In certain embodiments, nucleobases 8213-8325 are targeted by the following SEQ ID NOs: 555-590.
(479) In certain embodiments, antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, or at least 51% reduction of total C9ORF72 mRNA and/or protein levels in vitro and/or in vivo.
(480) In certain embodiments, antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, or at least 98% reduction of C9ORF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
EXAMPLES
(481) Non-Limiting Disclosure and Incorporation by Reference
(482) While certain compounds, compositions, and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1: Antisense Inhibition of a Human C9ORF72 mRNA Variant in HepG2 Cells by MOE Gapmers
(483) Antisense oligonucleotides targeting a C9ORF72 nucleic acid were designed and tested for their effects on C9ORF72 mRNA in vitro. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. ISIS 576816 is a 5-10-5 MOE gapmer with phosphorothioate linkages throughout. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 (forward primer sequence GGGTCTAGCAAGAGCAGGTG, designated herein as SEQ ID NO: 13; reverse primer sequence GTCTTGGCAACAGCTGGAGAT, designated herein as SEQ ID NO: 14; probe sequence TGATGTCGACTCTTTGCCCACCGC, designated herein as SEQ ID NO: 15—a TAQ-man primer probe set) was used. RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat. The mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat is herein the “C9ORF72 pathogenic associated mRNA variant.” A pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon 1B (generally nucleotides 1107 to 1520 of the genomic sequence: SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000. Therefore, oligonucleotides were designed in this region selectively target the pre-mRNA variant containing the hexanucleotide repeat. RTS3905 measures an mRNA product (i.e. the C9ORF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat. The levels of the C9ORF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells. The oligonucleotide marked with an asterisk (*) targets the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides.
(484) The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and on the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment comprises a 2′-MOE group. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage.
(485) “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each antisense oligonucleotide listed in the Table below is targeted to either human C9ORF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1) or the human C9ORF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both. ‘n/a’ indicates that the antisense oligonucleotide does not target that particular gene sequence
(486) TABLE-US-00006 TABLE 6 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1 and 2 SEQ SEQ ID ID NO: 1 NO: 2 SEQ Start Start % ID ISIS NO Site Site Sequence Linkage inhibition NO 576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 40 20 619060 10 1146 CTTTCCTAGCGGGACACCGT soooossssssssssooss 34 21 619111 100 1236 AAAAGAGAAGCAACCGGGCA soooossssssssssooss 34 22 619112 101 1237 CAAAAGAGAAGCAACCGGGC soooossssssssssooss 38 23 619113 102 1238 CCAAAAGAGAAGCAACCGGG soooossssssssssooss 44 24 619114 103 1239 CCCAAAAGAGAAGCAACCGG soooossssssssssooss 100 25 619061 11 1147 TCTTTCCTAGCGGGACACCG soooossssssssssooss 100 26 619062 12 1148 CTCTTTCCTAGCGGGACACC soooossssssssssooss 20 27 619063 13 1149 TCTCTTTCCTAGCGGGACAC soooossssssssssooss 14 28 619064 14 1150 CTCTCTTTCCTAGCGGGACA soooossssssssssooss 9 29 619065 15 1151 CCTCTCTTTCCTAGCGGGAC soooossssssssssooss 12 30 619066 16 1152 ACCTCTCTTTCCTAGCGGGA soooossssssssssooss 0 31 619410* 160 7840 ATCCAAATGCTCCGGAGATA soooossssssssssooss 96 32 619067 17 1153 CACCTCTCTTTCCTAGCGGG soooossssssssssooss 0 33 619068 18 1154 GCACCTCTCTTTCCTAGCGG soooossssssssssooss 24 34 619069 19 1155 CGCACCTCTCTTTCCTAGCG soooossssssssssooss 39 35 619052 2 1138 GCGGGACACCGTAGGTTACG soooossssssssssooss 30 36 619070 20 1156 ACGCACCTCTCTTTCCTAGC soooossssssssssooss 14 37 619071 21 1157 GACGCACCTCTCTTTCCTAG soooossssssssssooss 7 38 619072 22 1158 TGACGCACCTCTCTTTCCTA soooossssssssssooss 50 39 619073 23 1159 TTGACGCACCTCTCTTTCCT soooossssssssssooss 0 40 619074 24 1160 TTTGACGCACCTCTCTTTCC soooossssssssssooss 55 41 619075 25 1161 GTTTGACGCACCTCTCTTTC soooossssssssssooss 12 42 619076 26 1162 TGTTTGACGCACCTCTCTTT soooossssssssssooss 65 43 619077 27 1163 CTGTTTGACGCACCTCTCTT soooossssssssssooss 28 44 619078 28 1164 GCTGTTTGACGCACCTCTCT soooossssssssssooss 18 45 619079 29 1165 CGCTGTTTGACGCACCTCTC soooossssssssssooss 14 46 619053 3 1139 AGCGGGACACCGTAGGTTAC soooossssssssssooss 23 47 619080 30 1166 TCGCTGTTTGACGCACCTCT soooossssssssssooss 100 48 619081 31 1167 GTCGCTGTTTGACGCACCTC soooossssssssssooss 23 49 619082 32 1168 TGTCGCTGTTTGACGCACCT soooossssssssssooss 0 50 619411 324 8004 TGGAGCCCAAATGTGCCTTA soooossssssssssooss 99 51 619083 33 1169 TTGTCGCTGTTTGACGCACC soooossssssssssooss 36 52 619412 332 8012 TCTGTCTTTGGAGCCCAAAT soooossssssssssooss 100 53 619084 34 1170 CTTGTCGCTGTTTGACGCAC soooossssssssssooss 28 54 619085 35 1171 ACTTGTCGCTGTTTGACGCA soooossssssssssooss 55 55 619086 36 1172 AACTTGTCGCTGTTTGACGC soooossssssssssooss 29 56 619087 37 1173 GAACTTGTCGCTGTTTGACG soooossssssssssooss 21 57 619088 38 1174 GGAACTTGTCGCTGTTTGAC soooossssssssssooss 100 58 619089 39 1175 CGGAACTTGTCGCTGTTTGA soooossssssssssooss 67 59 619054 4 1140 TAGCGGGACACCGTAGGTTA soooossssssssssooss 59 60 619090 40 1176 GCGGAACTTGTCGCTGTTTG soooossssssssssooss 8 61 619091 41 1177 GGCGGAACTTGTCGCTGTTT soooossssssssssooss 38 62 619092 42 1178 GGGCGGAACTTGTCGCTGTT soooossssssssssooss 16 63 619093 43 1179 TGGGCGGAACTTGTCGCTGT soooossssssssssooss 22 64 619094 44 1180 GTGGGCGGAACTTGTCGCTG soooossssssssssooss 24 65 619095 45 1181 CGTGGGCGGAACTTGTCGCT soooossssssssssooss 100 66 619055 5 1141 CTAGCGGGACACCGTAGGTT soooossssssssssooss 100 67 619056 6 1142 CCTAGCGGGACACCGTAGGT soooossssssssssooss 11 68 619057 7 1143 TCCTAGCGGGACACCGTAGG soooossssssssssooss 22 69 619096 75 1211 GACGGCTGACACACCAAGCG soooossssssssssooss 100 70 619097 76 1212 GGACGGCTGACACACCAAGC soooossssssssssooss 88 71 619098 77 1213 GGGACGGCTGACACACCAAG soooossssssssssooss 29 72 619099 78 1214 AGGGACGGCTGACACACCAA soooossssssssssooss 83 73 619100 79 1215 CAGGGACGGCTGACACACCA soooossssssssssooss 23 74 619058 8 1144 TTCCTAGCGGGACACCGTAG soooossssssssssooss 32 75 619101 80 1216 GCAGGGACGGCTGACACACC soooossssssssssooss 18 76 619102 81 1217 AGCAGGGACGGCTGACACAC soooossssssssssooss 39 77 619103 82 1218 CAGCAGGGACGGCTGACACA soooossssssssssooss 39 78 619104 83 1219 GCAGCAGGGACGGCTGACAC soooossssssssssooss 22 79 619105 84 1220 GGCAGCAGGGACGGCTGACA soooossssssssssooss 43 80 619059 9 1145 TTTCCTAGCGGGACACCGTA soooossssssssssooss 4 81 619106 95 1231 AGAAGCAACCGGGCAGCAGG soooossssssssssooss 54 82 619107 96 1232 GAGAAGCAACCGGGCAGCAG soooossssssssssooss 100 83 619108 97 1233 AGAGAAGCAACCGGGCAGCA soooossssssssssooss 32 84 619109 98 1234 AAGAGAAGCAACCGGGCAGC soooossssssssssooss 30 85 619110 99 1235 AAAGAGAAGCAACCGGGCAG soooossssssssssooss 44 86 619042 n/a 1111 GTTTTCTATGTGCGATGACG soooossssssssssooss 6 87 619043 n/a 1112 TGTTTTCTATGTGCGATGAC soooossssssssssooss 45 88 619044 n/a 1113 CTGTTTTCTATGTGCGATGA soooossssssssssooss 23 89 619045 n/a 1114 TCTGTTTTCTATGTGCGATG soooossssssssssooss 10 90 619046 n/a 1115 GTCTGTTTTCTATGTGCGAT soooossssssssssooss 11 91 619047 n/a 1116 TGTCTGTTTTCTATGTGCGA soooossssssssssooss 28 92 619048 n/a 1117 CTGTCTGTTTTCTATGTGCG soooossssssssssooss 34 93 619049 n/a 1118 TCTGTCTGTTTTCTATGTGC soooossssssssssooss 72 94 619050 n/a 1119 GTCTGTCTGTTTTCTATGTG soooossssssssssooss 37 95 619051 n/a 1120 CGTCTGTCTGTTTTCTATGT soooossssssssssooss 1 96 619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 100 97 619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 98 98
Example 2: Antisense Inhibition of a Human C9ORF72 mRNA Variant in HepG2 Cells by MOE Gapmers
(487) Additional antisense oligonucleotides targeting a C9ORF72 nucleic acid were designed and tested for their effects on C9ORF72 mRNA in vitro. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C9ORF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) targets the region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides. ‘n.d.’ indicates that there was no signal reading in the assay for that particular oligonucleotide.
(488) The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and on the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment comprises a 2′-MOE group. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage.
(489) “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. The gapmers of the Tables below also target either human C9ORF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1) or the human C9ORF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both. Some of the gapmers of Table 10 are targeted to GENBANK Accession No. NM_145005.5 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 5). ‘n/a’ indicates that the antisense oligonucleotide does not target that particular gene sequence.
(490) TABLE-US-00007 TABLE 7 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1 and 2 SEQ SEQ ID ID NO: 1 NO: 2 SEQ Start Start % ID ISIS NO Site Site Sequence Linkage inhibition NO 576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 70 20 619115 104 1240 CCCCAAAAGAGAAGCAACCG soooossssssssssooss 10 99 619116 105 1241 CCCCCAAAAGAGAAGCAACC soooossssssssssooss 19 100 619117 106 1242 GCCCCCAAAAGAGAAGCAAC soooossssssssssooss 0 101 619118* 107 1243 CGCCCCCAAAAGAGAAGCAA soooossssssssssooss 17 102 619119* 108 1244 CCGCCCCCAAAAGAGAAGCA soooossssssssssooss 14 103 619120* 109 1245 CCCGCCCCCAAAAGAGAAGC soooossssssssssooss 4 104 619121* 110 1246 CCCCGCCCCCAAAAGAGAAG soooossssssssssooss 19 105 619122* 111 1247 ACCCCGCCCCCAAAAGAGAA soooossssssssssooss 47 106 619123* 112 1248 GACCCCGCCCCCAAAAGAGA soooossssssssssooss 11 107 619124* 113 1249 AGACCCCGCCCCCAAAAGAG soooossssssssssooss 16 108 619125* 114 1250 TAGACCCCGCCCCCAAAAGA soooossssssssssooss 15 109 619126* 115 1251 CTAGACCCCGCCCCCAAAAG soooossssssssssooss 43 110 619127* 116 1252 GCTAGACCCCGCCCCCAAAA soooossssssssssooss 67 111 619128* 117 1253 TGCTAGACCCCGCCCCCAAA soooossssssssssooss 85 112 619129* 118 1254 TTGCTAGACCCCGCCCCCAA soooossssssssssooss 41 113 619130* 119 1255 CTTGCTAGACCCCGCCCCCA soooossssssssssooss 62 114 619131* 120 1256 TCTTGCTAGACCCCGCCCCC soooossssssssssooss 95 115 619132* 121 1257 CTCTTGCTAGACCCCGCCCC soooossssssssssooss 81 116 619133* 122 1258 GCTCTTGCTAGACCCCGCCC soooossssssssssooss 90 117 619134* 123 1259 TGCTCTTGCTAGACCCCGCC soooossssssssssooss 85 118 619135* 124 1260 CTGCTCTTGCTAGACCCCGC soooossssssssssooss 81 119 619136* 125 1261 CCTGCTCTTGCTAGACCCCG soooossssssssssooss 78 120 619137* 126 1262 ACCTGCTCTTGCTAGACCCC soooossssssssssooss 85 121 619138* 127 1263 CACCTGCTCTTGCTAGACCC soooossssssssssooss 81 122 619139* 128 1264 ACACCTGCTCTTGCTAGACC soooossssssssssooss 77 123 619140* 129 1265 CACACCTGCTCTTGCTAGAC soooossssssssssooss 86 124 619141* 130 1266 CCACACCTGCTCTTGCTAGA soooossssssssssooss 90 125 619142* 131 1267 CCCACACCTGCTCTTGCTAG soooossssssssssooss 98 126 619143* 132 1268 ACCCACACCTGCTCTTGCTA soooossssssssssooss 94 127 619144* 133 1269 AACCCACACCTGCTCTTGCT soooossssssssssooss 93 128 619145* 134 1270 AAACCCACACCTGCTCTTGC soooossssssssssooss 95 129 619146* 135 1271 TAAACCCACACCTGCTCTTG soooossssssssssooss 78 130 619147* 136 1272 CTAAACCCACACCTGCTCTT soooossssssssssooss 64 131 619148* 137 1273 CCTAAACCCACACCTGCTCT soooossssssssssooss 84 132 619149* 138 1274 TCCTAAACCCACACCTGCTC soooossssssssssooss 87 133 619150* 139 1275 CTCCTAAACCCACACCTGCT soooossssssssssooss 89 134 619413 340 8020 GTACCTGTTCTGTCTTTGGA soooossssssssssooss 70 135 619414 353 8033 CCATCACTGAGAAGTACCTG soooossssssssssooss 78 136 619415 940 16395 GGCATAATGTTCTGACTATC soooossssssssssooss 67 137 619151* n/a 1276 CCTCCTAAACCCACACCTGC soooossssssssssooss 64 138 619152* n/a 1277 ACCTCCTAAACCCACACCTG soooossssssssssooss 45 139 619153* n/a 1278 CACCTCCTAAACCCACACCT soooossssssssssooss 36 140 619154* n/a 1279 ACACCTCCTAAACCCACACC soooossssssssssooss 26 141 619155* n/a 1280 CACACCTCCTAAACCCACAC soooossssssssssooss 50 142 619156* n/a 1281 ACACACCTCCTAAACCCACA soooossssssssssooss 53 143 619157* n/a 1282 CACACACCTCCTAAACCCAC soooossssssssssooss 44 144 619158* n/a 1283 ACACACACCTCCTAAACCCA soooossssssssssooss 65 145 619159* n/a 1284 AACACACACCTCCTAAACCC soooossssssssssooss 9 146 619160* n/a 1285 AAACACACACCTCCTAAACC soooossssssssssooss 0 147 619161* n/a 1286 AAAACACACACCTCCTAAAC soooossssssssssooss 15 148 619162* n/a 1287 AAAAACACACACCTCCTAAA soooossssssssssooss 10 149 619163* n/a 1288 CAAAAACACACACCTCCTAA soooossssssssssooss 7 150 619164* n/a 1289 ACAAAAACACACACCTCCTA soooossssssssssooss 55 151 619165* n/a 1290 AACAAAAACACACACCTCCT soooossssssssssooss 24 152 619166* n/a 1291 AAACAAAAACACACACCTCC soooossssssssssooss 19 153 619167* n/a 1292 AAAACAAAAACACACACCTC soooossssssssssooss 8 154 619168* n/a 1294 GAAAAACAAAAACACACACC soooossssssssssooss 17 155 619169* n/a 1295 GGAAAAACAAAAACACACAC soooossssssssssooss 26 156 619170 n/a 1297 TGGGAAAAACAAAAACACAC soooossssssssssooss 30 157 619171 n/a 1298 GTGGGAAAAACAAAAACACA soooossssssssssooss 23 158 619172 n/a 1299 GGTGGGAAAAACAAAAACAC soooossssssssssooss 22 159 619173 n/a 1326 CTGTGAGAGCAAGTAGTGGG soooossssssssssooss 43 160 619174 n/a 1327 ACTGTGAGAGCAAGTAGTGG soooossssssssssooss 36 161 619175 n/a 1328 TACTGTGAGAGCAAGTAGTG soooossssssssssooss 24 162 619176 n/a 1329 GTACTGTGAGAGCAAGTAGT soooossssssssssooss 58 163 619177 n/a 1330 AGTACTGTGAGAGCAAGTAG soooossssssssssooss 22 164 619178 n/a 1331 GAGTACTGTGAGAGCAAGTA soooossssssssssooss 100 165 619179 n/a 1332 CGAGTACTGTGAGAGCAAGT soooossssssssssooss 62 166 619180 n/a 1333 GCGAGTACTGTGAGAGCAAG soooossssssssssooss 63 167 619181 n/a 1334 AGCGAGTACTGTGAGAGCAA soooossssssssssooss 36 168 619182 n/a 1335 CAGCGAGTACTGTGAGAGCA soooossssssssssooss 41 169 619183 n/a 1336 TCAGCGAGTACTGTGAGAGC soooossssssssssooss 66 170 619184 n/a 1337 CTCAGCGAGTACTGTGAGAG soooossssssssssooss 28 171 619185 n/a 1338 CCTCAGCGAGTACTGTGAGA soooossssssssssooss 37 172 619186 n/a 1339 CCCTCAGCGAGTACTGTGAG soooossssssssssooss 43 173 619187 n/a 1340 ACCCTCAGCGAGTACTGTGA soooossssssssssooss 84 174 619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 31 97 619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 63 98
(491) TABLE-US-00008 TABLE 8 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1 and 2 SEQ SEQ ID ID NO: 1 NO: 2 SEQ ISIS Start Start % ID NO Site Site Sequence Linkage inhibition NO 576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 82 20 619188 n/a 1341 CACCCTCAGCGAGTACTGTG soooossssssssssooss 56 175 619189 n/a 1342 TCACCCTCAGCGAGTACTGT soooossssssssssooss 66 176 619190 n/a 1343 TTCACCCTCAGCGAGTACTG soooossssssssssooss 57 177 619191 n/a 1344 GTTCACCCTCAGCGAGTACT soooossssssssssooss 83 178 619192 n/a 1345 TGTTCACCCTCAGCGAGTAC soooossssssssssooss 66 179 619193 n/a 1346 TTGTTCACCCTCAGCGAGTA soooossssssssssooss 57 180 619194 n/a 1347 CTTGTTCACCCTCAGCGAGT soooossssssssssooss 48 181 619195 n/a 1348 TCTTGTTCACCCTCAGCGAG soooossssssssssooss 46 182 619196 n/a 1349 TTCTTGTTCACCCTCAGCGA soooossssssssssooss 66 183 619197 n/a 1350 TTTCTTGTTCACCCTCAGCG soooossssssssssooss 31 184 619198 n/a 1351 TTTTCTTGTTCACCCTCAGC soooossssssssssooss 47 185 619199 n/a 1352 CTTTTCTTGTTCACCCTCAG soooossssssssssooss 53 186 619200 n/a 1353 TCTTTTCTTGTTCACCCTCA soooossssssssssooss 46 187 619201 n/a 1354 GTCTTTTCTTGTTCACCCTC soooossssssssssooss 71 188 619202 n/a 1355 GGTCTTTTCTTGTTCACCCT soooossssssssssooss 73 189 619203 n/a 1356 AGGTCTTTTCTTGTTCACCC soooossssssssssooss 79 190 619204 n/a 1357 CAGGTCTTTTCTTGTTCACC soooossssssssssooss 0 191 619205 n/a 1358 TCAGGTCTTTTCTTGTTCAC soooossssssssssooss 68 192 619206 n/a 1359 ATCAGGTCTTTTCTTGTTCA soooossssssssssooss 52 193 619207 n/a 1360 TATCAGGTCTTTTCTTGTTC soooossssssssssooss 47 194 619208 n/a 1361 TTATCAGGTCTTTTCTTGTT soooossssssssssooss 37 195 619209 n/a 1362 TTTATCAGGTCTTTTCTTGT soooossssssssssooss 31 196 619210 n/a 1363 CTTTATCAGGTCTTTTCTTG soooossssssssssooss 24 197 619211 n/a 1364 TCTTTATCAGGTCTTTTCTT soooossssssssssooss 37 198 619212 n/a 1365 ATCTTTATCAGGTCTTTTCT soooossssssssssooss 34 199 619213 n/a 1366 AATCTTTATCAGGTCTTTTC soooossssssssssooss 38 200 619214 n/a 1367 TAATCTTTATCAGGTCTTTT soooossssssssssooss 32 201 619215 n/a 1368 TTAATCTTTATCAGGTCTTT soooossssssssssooss 55 202 619216 n/a 1369 GTTAATCTTTATCAGGTCTT soooossssssssssooss 72 203 619217 n/a 1370 GGTTAATCTTTATCAGGTCT soooossssssssssooss 85 204 619218 n/a 1371 TGGTTAATCTTTATCAGGTC soooossssssssssooss 82 205 619219 n/a 1372 CTGGTTAATCTTTATCAGGT soooossssssssssooss 62 206 619220 n/a 1373 TCTGGTTAATCTTTATCAGG soooossssssssssooss 19 207 619221 n/a 1374 TTCTGGTTAATCTTTATCAG soooossssssssssooss 31 208 619222 n/a 1375 CTTCTGGTTAATCTTTATCA soooossssssssssooss 40 209 619223 n/a 1376 TCTTCTGGTTAATCTTTATC soooossssssssssooss 41 210 619224 n/a 1377 TTCTTCTGGTTAATCTTTAT soooossssssssssooss 11 211 619225 n/a 1378 TTTCTTCTGGTTAATCTTTA soooossssssssssooss 46 212 619226 n/a 1379 TTTTCTTCTGGTTAATCTTT soooossssssssssooss 14 213 619227 n/a 1380 GTTTTCTTCTGGTTAATCTT soooossssssssssooss 50 214 619228 n/a 1381 TGTTTTCTTCTGGTTAATCT soooossssssssssooss 49 215 619229 n/a 1382 TTGTTTTCTTCTGGTTAATC soooossssssssssooss 31 216 619230 n/a 1383 CTTGTTTTCTTCTGGTTAAT soooossssssssssooss 16 217 619231 n/a 1384 CCTTGTTTTCTTCTGGTTAA soooossssssssssooss 23 218 619232 n/a 1385 TCCTTGTTTTCTTCTGGTTA soooossssssssssooss 52 219 619233 n/a 1386 CTCCTTGTTTTCTTCTGGTT soooossssssssssooss 32 220 619234 n/a 1387 CCTCCTTGTTTTCTTCTGGT soooossssssssssooss 59 221 619235 n/a 1388 CCCTCCTTGTTTTCTTCTGG soooossssssssssooss 48 222 619236 n/a 1389 TCCCTCCTTGTTTTCTTCTG soooossssssssssooss 31 223 619237 n/a 1390 TTCCCTCCTTGTTTTCTTCT soooossssssssssooss 24 224 619238 n/a 1391 TTTCCCTCCTTGTTTTCTTC soooossssssssssooss 42 225 619239 n/a 1392 GTTTCCCTCCTTGTTTTCTT soooossssssssssooss 46 226 619240 n/a 1393 TGTTTCCCTCCTTGTTTTCT soooossssssssssooss 81 227 619241 n/a 1394 TTGTTTCCCTCCTTGTTTTC soooossssssssssooss 53 228 619242 n/a 1395 GTTGTTTCCCTCCTTGTTTT soooossssssssssooss 28 229 619243 n/a 1396 GGTTGTTTCCCTCCTTGTTT soooossssssssssooss 40 230 619244 n/a 1397 CGGTTGTTTCCCTCCTTGTT soooossssssssssooss 31 231 619245 n/a 1398 GCGGTTGTTTCCCTCCTTGT soooossssssssssooss 69 232 619246 n/a 1399 TGCGGTTGTTTCCCTCCTTG soooossssssssssooss 73 233 619247 n/a 1400 CTGCGGTTGTTTCCCTCCTT soooossssssssssooss 90 234 619248 n/a 1401 GCTGCGGTTGTTTCCCTCCT soooossssssssssooss 40 235 619249 n/a 1402 GGCTGCGGTTGTTTCCCTCC soooossssssssssooss 50 236 619250 n/a 1403 AGGCTGCGGTTGTTTCCCTC soooossssssssssooss 61 237 619251 n/a 1404 CAGGCTGCGGTTGTTTCCCT soooossssssssssooss 72 238 619252 n/a 1405 ACAGGCTGCGGTTGTTTCCC soooossssssssssooss 69 239 619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 67 97 619254 n/a 1407 CTACAGGCTGCGGTTGTTTC soooossssssssssooss 43 240 619255 n/a 1408 GCTACAGGCTGCGGTTGTTT soooossssssssssooss 54 241 619256 n/a 1409 TGCTACAGGCTGCGGTTGTT soooossssssssssooss 36 242 619257 n/a 1410 TTGCTACAGGCTGCGGTTGT soooossssssssssooss 29 243 619258 n/a 1411 CTTGCTACAGGCTGCGGTTG soooossssssssssooss 50 244 619259 n/a 1412 GCTTGCTACAGGCTGCGGTT soooossssssssssooss 76 245 619260 n/a 1413 AGCTTGCTACAGGCTGCGGT soooossssssssssooss 80 246 619261 n/a 1414 GAGCTTGCTACAGGCTGCGG soooossssssssssooss 54 247 619262 n/a 1415 AGAGCTTGCTACAGGCTGCG soooossssssssssooss 62 248 619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 64 98 619416 1937 24657 AAAAAACAGTAGTTGTGGTC soooossssssssssooss 78 249 27056 619417 1988 27107 GCCAACTCAGATTTCACCTT soooossssssssssooss 86 250
(492) TABLE-US-00009 TABLE 9 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1 and 2 SEQ SEQ ID ID NO: 1 NO: 2 SEQ ISIS Start Start % ID NO Site Site Sequence Linkage inhibition NO 576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 71 20 619264 n/a 1417 CCAGAGCTTGCTACAGGCTG soooossssssssssooss 54 251 619265 n/a 1418 TCCAGAGCTTGCTACAGGCT soooossssssssssooss 69 252 619266 n/a 1419 TTCCAGAGCTTGCTACAGGC soooossssssssssooss 70 253 619267 n/a 1420 GTTCCAGAGCTTGCTACAGG soooossssssssssooss 49 254 619268 n/a 1421 AGTTCCAGAGCTTGCTACAG soooossssssssssooss 95 255 619269 n/a 1422 GAGTTCCAGAGCTTGCTACA soooossssssssssooss 36 256 619270 n/a 1423 TGAGTTCCAGAGCTTGCTAC soooossssssssssooss 15 257 619271 n/a 1424 CTGAGTTCCAGAGCTTGCTA soooossssssssssooss 31 258 619272 n/a 1425 CCTGAGTTCCAGAGCTTGCT soooossssssssssooss 41 259 619273 n/a 1426 TCCTGAGTTCCAGAGCTTGC soooossssssssssooss 36 260 619274 n/a 1427 CTCCTGAGTTCCAGAGCTTG soooossssssssssooss 25 261 619275 n/a 1428 ACTCCTGAGTTCCAGAGCTT soooossssssssssooss 50 262 619276 n/a 1429 GACTCCTGAGTTCCAGAGCT soooossssssssssooss 74 263 619277 n/a 1430 CGACTCCTGAGTTCCAGAGC soooossssssssssooss 69 264 619278 n/a 1431 GCGACTCCTGAGTTCCAGAG soooossssssssssooss 98 265 619279 n/a 1432 CGCGACTCCTGAGTTCCAGA soooossssssssssooss 69 266 619280 n/a 1433 GCGCGACTCCTGAGTTCCAG soooossssssssssooss 75 267 619281 n/a 1434 CGCGCGACTCCTGAGTTCCA soooossssssssssooss 67 268 619282 n/a 1435 GCGCGCGACTCCTGAGTTCC soooossssssssssooss 55 269 619283 n/a 1436 AGCGCGCGACTCCTGAGTTC soooossssssssssooss 62 270 619284 n/a 1437 TAGCGCGCGACTCCTGAGTT soooossssssssssooss 100 271 619285 n/a 1438 CTAGCGCGCGACTCCTGAGT soooossssssssssooss 68 272 619286 n/a 1439 CCTAGCGCGCGACTCCTGAG soooossssssssssooss 41 273 619287 n/a 1440 CCCTAGCGCGCGACTCCTGA soooossssssssssooss 70 274 619288 n/a 1441 CCCCTAGCGCGCGACTCCTG soooossssssssssooss 68 275 619289 n/a 1442 GCCCCTAGCGCGCGACTCCT soooossssssssssooss 52 276 619290 n/a 1443 GGCCCCTAGCGCGCGACTCC soooossssssssssooss 49 277 619291 n/a 1444 CGGCCCCTAGCGCGCGACTC soooossssssssssooss 69 278 619292 n/a 1445 CCGGCCCCTAGCGCGCGACT soooossssssssssooss 76 279 619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 52 98 619294 n/a 1447 CCCCGGCCCCTAGCGCGCGA soooossssssssssooss 62 280 619295 n/a 1448 GCCCCGGCCCCTAGCGCGCG soooossssssssssooss 68 281 619296 n/a 1449 GGCCCCGGCCCCTAGCGCGC soooossssssssssooss 56 282 619297 n/a 1450 CGGCCCCGGCCCCTAGCGCG soooossssssssssooss 71 283 619298 n/a 1451 CCGGCCCCGGCCCCTAGCGC soooossssssssssooss 73 284 619299 n/a 1452 CCCGGCCCCGGCCCCTAGCG soooossssssssssooss 51 285 619300 n/a 1453 CCCCGGCCCCGGCCCCTAGC soooossssssssssooss 49 286 619301 n/a 1454 GCCCCGGCCCCGGCCCCTAG soooossssssssssooss 60 287 619302 n/a 1455 GGCCCCGGCCCCGGCCCCTA soooossssssssssooss 48 288 619303 n/a 1462 ACGCCCCGGCCCCGGCCCCG soooossssssssssooss 49 289 619304 n/a 1463 CACGCCCCGGCCCCGGCCCC soooossssssssssooss 25 290 619305 n/a 1464 CCACGCCCCGGCCCCGGCCC soooossssssssssooss 66 291 619306 n/a 1465 ACCACGCCCCGGCCCCGGCC soooossssssssssooss 70 292 619307 n/a 1466 GACCACGCCCCGGCCCCGGC soooossssssssssooss 73 293 619308 n/a 1467 CGACCACGCCCCGGCCCCGG soooossssssssssooss 55 294 619309 n/a 1468 CCGACCACGCCCCGGCCCCG soooossssssssssooss 70 295 619310 n/a 1469 CCCGACCACGCCCCGGCCCC soooossssssssssooss 50 296 619311 n/a 1470 CCCCGACCACGCCCCGGCCC soooossssssssssooss 45 297 619312 n/a 1471 GCCCCGACCACGCCCCGGCC soooossssssssssooss 36 298 619313 n/a 1472 CGCCCCGACCACGCCCCGGC soooossssssssssooss 58 299 619314 n/a 1473 CCGCCCCGACCACGCCCCGG soooossssssssssooss 100 300 619315 n/a 1474 CCCGCCCCGACCACGCCCCG soooossssssssssooss 44 301 619316 n/a 1475 GCCCGCCCCGACCACGCCCC soooossssssssssooss 97 302 619317 n/a 1476 GGCCCGCCCCGACCACGCCC soooossssssssssooss 76 303 619318 n/a 1477 GGGCCCGCCCCGACCACGCC soooossssssssssooss 44 304 619319 n/a 1478 CGGGCCCGCCCCGACCACGC soooossssssssssooss 40 305 619320 n/a 1479 CCGGGCCCGCCCCGACCACG soooossssssssssooss 50 306 619321 n/a 1480 CCCGGGCCCGCCCCGACCAC soooossssssssssooss 22 307 619322 n/a 1481 CCCCGGGCCCGCCCCGACCA soooossssssssssooss 56 308 619323 n/a 1482 CCCCCGGGCCCGCCCCGACC soooossssssssssooss 40 309 619324 n/a 1483 GCCCCCGGGCCCGCCCCGAC soooossssssssssooss 65 310 619325 n/a 1484 CGCCCCCGGGCCCGCCCCGA soooossssssssssooss 25 311 619326 n/a 1486 CCCGCCCCCGGGCCCGCCCC soooossssssssssooss 41 312 619327 n/a 1487 GCCCGCCCCCGGGCCCGCCC soooossssssssssooss 36 313 619328 n/a 1488 GGCCCGCCCCCGGGCCCGCC soooossssssssssooss 14 314 619329 n/a 1495 CGCCCCGGGCCCGCCCCCGG soooossssssssssooss 33 315 619330 n/a 1497 CCCGCCCCGGGCCCGCCCCC soooossssssssssooss 35 316 619331 n/a 1498 CCCCGCCCCGGGCCCGCCCC soooossssssssssooss 42 317 619332 n/a 1499 GCCCCGCCCCGGGCCCGCCC soooossssssssssooss 47 318 619333 n/a 1500 AGCCCCGCCCCGGGCCCGCC soooossssssssssooss 53 319 619334 n/a 1501 CAGCCCCGCCCCGGGCCCGC soooossssssssssooss 32 320 619335 n/a 1502 GCAGCCCCGCCCCGGGCCCG soooossssssssssooss 58 321 619336 n/a 1503 CGCAGCCCCGCCCCGGGCCC soooossssssssssooss 75 322 619418 n/a 27155 CTACACACCAAAGAATGCCA soooossssssssssooss 71 323 619419 n/a 15587 GGAATAAGGTCACTAGTTCG soooossssssssssooss 72 324 619420 n/a 7990 GCCTTACTCTAGGACCAAGA soooossssssssssooss 100 20 619263 n/a 1416 CAGAGCTTGCTACAGGCTGC soooossssssssssooss 63 325 619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 50 97
(493) TABLE-US-00010 TABLE 10 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1-5 SEQ SEQ SEQ SEQ SEQ ID ID ID ID ID NO: 1 NO: 2 NO: 3 NO: 4 NO: 5 Start Start Start Start Start % SEQ ID ISIS NO Site Site Site Site Site Sequence Linkage inhibition NO 576816 310 7990 232 188 188 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 69 20 619253 n/a 1406 n/a n/a n/a TACAGGCTGCGGTTGTTTCC soooossssssssssooss 19 97 619293 n/a 1446 n/a n/a n/a CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 56 98 619337 n/a 1504 n/a n/a n/a CCGCAGCCCCGCCCCGGGCC soooossssssssssooss 55 326 619338 n/a 1505 n/a n/a n/a ACCGCAGCCCCGCCCCGGGC soooossssssssssooss 62 327 619339 n/a 1506 n/a n/a n/a AACCGCAGCCCCGCCCCGGG soooossssssssssooss 68 328 619340 n/a 1507 n/a n/a n/a CAACCGCAGCCCCGCCCCGG soooossssssssssooss 14 329 619341 n/a 1508 n/a n/a n/a GCAACCGCAGCCCCGCCCCG soooossssssssssooss 95 330 619342 n/a 1509 n/a n/a n/a CGCAACCGCAGCCCCGCCCC soooossssssssssooss 56 331 619343 n/a 1510 n/a n/a n/a CCGCAACCGCAGCCCCGCCC soooossssssssssooss 58 332 619344 n/a 1511 n/a n/a n/a ACCGCAACCGCAGCCCCGCC soooossssssssssooss 51 333 619345 n/a 1512 n/a n/a n/a CACCGCAACCGCAGCCCCGC soooossssssssssooss 97 334 619346 n/a 1513 n/a n/a n/a GCACCGCAACCGCAGCCCCG soooossssssssssooss 49 335 619347 n/a 1514 n/a n/a n/a GGCACCGCAACCGCAGCCCC soooossssssssssooss 100 336 619348 n/a 1515 n/a n/a n/a AGGCACCGCAACCGCAGCCC soooossssssssssooss 46 337 619349 n/a 1516 n/a n/a n/a CAGGCACCGCAACCGCAGCC soooossssssssssooss 100 338 619350 n/a 1517 n/a n/a n/a GCAGGCACCGCAACCGCAGC soooossssssssssooss 55 339 619351 n/a 1518 n/a n/a n/a CGCAGGCACCGCAACCGCAG soooossssssssssooss 63 340 619352 n/a 1519 n/a n/a n/a GCGCAGGCACCGCAACCGCA soooossssssssssooss 42 341 619353 n/a 1520 n/a n/a n/a GGCGCAGGCACCGCAACCGC soooossssssssssooss 95 342 619354 n/a 1521 n/a n/a n/a GGGCGCAGGCACCGCAACCG soooossssssssssooss 23 343 619355* 140 n/a n/a n/a n/a TCTCCTAAACCCACACCTGC soooossssssssssooss 94 384 619356* 141 n/a n/a n/a n/a ATCTCCTAAACCCACACCTG soooossssssssssooss 69 385 619357 142 n/a n/a n/a n/a TATCTCCTAAACCCACACCT soooossssssssssooss n.d. 386 619358* 143 n/a n/a n/a n/a ATATCTCCTAAACCCACACC soooossssssssssooss 53 387 619359 144 n/a n/a n/a n/a GATATCTCCTAAACCCACAC soooossssssssssooss n.d. 388 619360* 145 n/a n/a n/a n/a AGATATCTCCTAAACCCACA soooossssssssssooss 30 389 619361* 146 n/a n/a n/a n/a GAGATATCTCCTAAACCCAC soooossssssssssooss 48 390 619362* 147 n/a n/a n/a n/a GGAGATATCTCCTAAACCCA soooossssssssssooss 60 391 619363* 148 n/a n/a n/a n/a CGGAGATATCTCCTAAACCC soooossssssssssooss 26 392 619364* 149 n/a n/a n/a n/a CCGGAGATATCTCCTAAACC soooossssssssssooss 97 393 619365* 150 n/a n/a n/a n/a TCCGGAGATATCTCCTAAAC soooossssssssssooss 60 394 619366* 151 n/a n/a n/a n/a CTCCGGAGATATCTCCTAAA soooossssssssssooss 34 395 619367 152 n/a n/a n/a n/a GCTCCGGAGATATCTCCTAA soooossssssssssooss n.d. 396 619368* 153 n/a n/a n/a n/a TGCTCCGGAGATATCTCCTA soooossssssssssooss 95 397 619369 154 n/a n/a n/a n/a ATGCTCCGGAGATATCTCCT soooossssssssssooss n.d. 398 619370* 155 n/a n/a n/a n/a AATGCTCCGGAGATATCTCC soooossssssssssooss 59 399 619371* n/a n/a n/a 17 n/a TCTCTCTTTCCTAGCGGGAC soooossssssssssooss 0 344 619372* n/a n/a n/a 18 n/a ATCTCTCTTTCCTAGCGGGA soooossssssssssooss 8 345 619373* n/a n/a n/a 19 n/a TATCTCTCTTTCCTAGCGGG soooossssssssssooss 6 346 619374* n/a n/a n/a 20 n/a ATATCTCTCTTTCCTAGCGG soooossssssssssooss 0 347 619375* n/a n/a n/a 21 n/a GATATCTCTCTTTCCTAGCG soooossssssssssooss 8 348 619376* n/a n/a n/a 22 n/a AGATATCTCTCTTTCCTAGC soooossssssssssooss 0 349 619377* n/a n/a n/a 23 n/a GAGATATCTCTCTTTCCTAG soooossssssssssooss 89 350 619378* n/a n/a n/a 24 n/a GGAGATATCTCTCTTTCCTA soooossssssssssooss 1 351 619379* n/a n/a n/a 25 n/a CGGAGATATCTCTCTTTCCT soooossssssssssooss 0 352 619380 n/a n/a n/a 26 n/a CCGGAGATATCTCTCTTTCC soooossssssssssooss n.d. 353 619381* n/a n/a n/a 27 n/a TCCGGAGATATCTCTCTTTC soooossssssssssooss 28 354 619382* n/a n/a n/a 28 n/a CTCCGGAGATATCTCTCTTT soooossssssssssooss 28 355 619383* n/a n/a n/a 29 n/a GCTCCGGAGATATCTCTCTT soooossssssssssooss 91 356 619384* n/a n/a n/a 30 n/a TGCTCCGGAGATATCTCTCT soooossssssssssooss 61 357 619385* n/a n/a n/a 31 n/a ATGCTCCGGAGATATCTCTC soooossssssssssooss 69 358 619386* n/a n/a n/a 32 n/a AATGCTCCGGAGATATCTCT soooossssssssssooss 75 359 619387 156 n/a n/a 33 n/a AAATGCTCCGGAGATATCTC soooossssssssssooss n.d. 400 619388* n/a n/a n/a n/a 18 TCTGCTCTTGCTAGACCCCG soooossssssssssooss 50 360 619389 n/a n/a n/a n/a 19 ATCTGCTCTTGCTAGACCCC soooossssssssssooss n.d. 361 619390* n/a n/a n/a n/a 20 TATCTGCTCTTGCTAGACCC soooossssssssssooss 5 362 619391* n/a n/a n/a n/a 21 ATATCTGCTCTTGCTAGACC soooossssssssssooss 0 363 619392* n/a n/a n/a n/a 22 GATATCTGCTCTTGCTAGAC soooossssssssssooss 0 364 619393* n/a n/a n/a n/a 23 AGATATCTGCTCTTGCTAGA soooossssssssssooss 6 365 619394* n/a n/a n/a n/a 24 GAGATATCTGCTCTTGCTAG soooossssssssssooss 57 366 619395* n/a n/a n/a n/a 25 GGAGATATCTGCTCTTGCTA soooossssssssssooss 6 367 619396* n/a n/a n/a n/a 26 CGGAGATATCTGCTCTTGCT soooossssssssssooss 0 368 619397* n/a n/a n/a n/a 27 CCGGAGATATCTGCTCTTGC soooossssssssssooss 0 369 619398* n/a n/a n/a n/a 28 TCCGGAGATATCTGCTCTTG soooossssssssssooss 22 370 619399* n/a n/a n/a n/a 29 CTCCGGAGATATCTGCTCTT soooossssssssssooss 14 371 619400* n/a n/a n/a n/a 30 GCTCCGGAGATATCTGCTCT soooossssssssssooss 46 372 619401* n/a n/a n/a n/a 31 TGCTCCGGAGATATCTGCTC soooossssssssssooss 40 373 619402* n/a n/a n/a n/a 32 ATGCTCCGGAGATATCTGCT soooossssssssssooss 79 374 619403* n/a n/a n/a n/a 33 AATGCTCCGGAGATATCTGC soooossssssssssooss 65 375 619404* n/a n/a n/a n/a 34 AAATGCTCCGGAGATATCTG soooossssssssssooss 22 376 619405* n/a n/a 75 n/a n/a TGCTCCGGAGATATCAAGCG soooossssssssssooss 18 377 619406* n/a n/a 76 n/a n/a ATGCTCCGGAGATATCAAGC soooossssssssssooss 21 378 619407* n/a n/a 77 n/a n/a AATGCTCCGGAGATATCAAG soooossssssssssooss 98 379 619408 n/a n/a 78 n/a n/a AAATGCTCCGGAGATATCAA soooossssssssssooss n.d. 380 619409* n/a n/a 79 n/a n/a CAAATGCTCCGGAGATATCA soooossssssssssooss 98. 381 619421 3132 28251 n/a n/a n/a GGGACACTACAAGGTAGTAT soooossssssssssooss 80 401 619422* n/a 3452 n/a n/a n/a GGTAACTTCAAACTCTTGGG soooossssssssssooss 85. 382 619423 n/a 13642 1013 n/a n/a GCCATGATTTCTTGTCTGGG soooossssssssssooss 67 383
Example 3: Dose-Dependent Antisense Inhibition of a Human C9ORF72 mRNA Variant in HepG2 Cells
(494) Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C9ORF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 576816 and ISIS 577061, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, were used as benchmark oligonucleotides. ISIS 576816 and ISIS 577061 are 5-10-5 MOE gapmers with phosphorothioate linkages throughout. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 78.1 nM, 312.5 nM, 1,250.0 nM, or 5,000.0 nM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human C9ORF72 primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant. The levels of the C9ORF72 pathogenic associated mRNA variant were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of variant C9ORF72 levels, relative to untreated control cells. ‘n.d.’ means no data.
(495) The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is also presented in the Tables below. As illustrated, the C9ORF72 pathogenic associated mRNA variant levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
(496) TABLE-US-00011 TABLE 11 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant 78.1 312.5 1250.0 5000.0 IC.sub.50 ISIS No nM nM nM nM (μM) 576816 13 47 92 95 0.4 577061 0 1 23 57 4.2 619049 11 46 34 18 >5.0 619055 14 13 0 0 >5.0 619061 0 2 0 0 >5.0 619080 7 4 0 0 >5.0 619088 0 7 16 16 >5.0 619089 2 0 0 17 >5.0 619095 10 0 0 27 >5.0 619096 16 0 10 27 >5.0 619097 23 55 41 38 >5.0 619099 10 36 46 23 >5.0 619107 15 0 4 33 >5.0 619114 0 0 8 31 >5.0 619253 26 33 66 86 0.5 619293 26 71 n.d. 95 0.2 619410 42 63 86 n.d. 0.1 619411 28 20 96 n.d. 0.3 619412 39 66 93 97 0.1
(497) TABLE-US-00012 TABLE 12 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant 78.1 312.5 1250.0 5000.0 IC.sub.50 ISIS No nM nM nM nM (μM) 576816 39 84 96 90 0.1 577061 29 0 25 71 3.7 619173 18 46 84 98 0.4 619174 21 36 77 n.d. 0.4 619176 16 29 57 95 0.7 619178 5 31 86 97 0.5 619179 0 16 65 96 0.8 619180 4 24 66 96 0.7 619181 10 34 72 95 0.6 619182 23 32 74 92 0.5 619183 0 26 44 96 1.0 619185 14 34 70 93 0.5 619186 8 32 71 98 0.6 619187 18 36 81 95 0.4 619253 17 22 61 97 0.7 619293 0 49 86 99 0.6 619413 8 48 84 95 0.4 619415 26 67 90 n.d. 0.2
(498) TABLE-US-00013 TABLE 13 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant 78.1 312.5 1250.0 5000.0 IC.sub.50 ISIS No nM nM nM nM (μM) 576816 0 71 97 n.d. 0.3 577061 0 12 46 82 1.4 619191 66 84 94 98 <0.07 619201 16 64 95 97 0.3 619202 35 78 95 95 0.1 619203 29 55 92 95 0.2 619216 61 55 92 96 <0.07 619217 44 86 83 n.d. 0.1 619218 35 87 93 n.d. 0.1 619240 0 43 52 78 1.0 619245 0 39 85 n.d. 0.5 619246 34 74 96 99 0.1 619247 0 46 92 93 0.6 619251 40 91 93 96 <0.07 619252 24 67 87 n.d. 0.2 619259 7 76 85 98 0.3 619260 16 80 92 99 0.2 619416 13 63 91 92 0.3 619417 45 88 91 97 <0.07
(499) TABLE-US-00014 TABLE 14 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant 78.1 312.5 1250.0 5000.0 IC.sub.50 ISIS No nM nM nM nM (μM) 576816 38 61 95 98 0.1 577061 0 8 13 77 2.5 619266 0 23 73 98 0.8 619268 5 29 77 97 0.6 619276 31 82 90 91 0.1 619278 35 83 97 99 0.1 619280 66 80 97 96 <0.07 619284 22 55 88 98 0.3 619292 37 79 85 94 0.1 619297 0 68 82 91 0.6 619298 47 89 93 91 <0.07 619307 37 71 96 98 0.1 619314 21 0 61 97 0.8 619316 13 37 71 91 0.5 619317 7 17 68 87 0.8 619336 17 51 64 90 0.5 619418 43 78 89 95 0.1 619419 43 68 94 95 0.1 619420 66 88 100 n.d. <0.07
(500) TABLE-US-00015 TABLE 15 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant 78.1 312.5 1250.0 5000.0 IC.sub.50 ISIS No nM nM nM nM (μM) 576816 8 48 91 91 0.4 577061 0 13 33 64 2.6 619293 32 77 85 95 0.1 619337 28 42 79 95 0.3 619338 11 55 83 91 0.4 619339 6 42 83 90 0.5 619341 17 14 66 83 0.8 619342 37 57 85 97 0.2 619343 25 51 87 96 0.3 619344 17 27 75 91 0.5 619345 0 18 50 88 1.2 619346 0 22 76 90 0.8 619347 1 8 41 76 1.7 619349 10 12 51 78 1.3 619350 16 46 84 91 0.4 619351 20 21 69 87 0.6 619353 0 13 52 76 1.4 619421 27 78 93 92 0.1 619423 0 53 87 93 0.5
(501) TABLE-US-00016 TABLE 16 Gapmers chosen for further analysis SEQ ID IC.sub.50 NO: 2 SEQ ID Isis No (μM) Sequence Start Site Location NO 619173 0.4 CTGTGAGAGCAAGTAGTGGG 1326 intron 160 619174 0.4 ACTGTGAGAGCAAGTAGTGG 1327 intron 161 619178 0.5 GAGTACTGTGAGAGCAAGTA 1331 intron 165 619179 0.8 CGAGTACTGTGAGAGCAAGT 1332 intron 166 619181 0.5 AGCGAGTACTGTGAGAGCAA 1334 intron 168 619182 0.5 CAGCGAGTACTGTGAGAGCA 1335 intron 169 619185 0.5 CCTCAGCGAGTACTGTGAGA 1338 intron 172 619186 0.6 CCCTCAGCGAGTACTGTGAG 1339 intron 173 619187 0.4 ACCCTCAGCGAGTACTGTGA 1340 intron 174 619191 <0.07 GTTCACCCTCAGCGAGTACT 1344 intron 178 619201 0.3 GTCTTTTCTTGTTCACCCTC 1354 intron 188 619202 0.1 GGTCTTTTCTTGTTCACCCT 1355 intron 189 619203 0.2 AGGTCTTTTCTTGTTCACCC 1356 intron 190 619216 <0.07 GTTAATCTTTATCAGGTCTT 1369 intron 203 619217 0.1 GGTTAATCTTTATCAGGTCT 1370 intron 204 619218 0.1 TGGTTAATCTTTATCAGGTC 1371 intron 205 619245 0.5 GCGGTTGTTTCCCTCCTTGT 1398 intron 232 619246 0.1 TGCGGTTGTTTCCCTCCTTG 1399 intron 233 619251 <0.07 CAGGCTGCGGTTGTTTCCCT 1404 intron 238 619252 0.2 ACAGGCTGCGGTTGTTTCCC 1405 intron 239 619253 0.5 TACAGGCTGCGGTTGTTTCC 1406 intron 97 619259 0.3 GCTTGCTACAGGCTGCGGTT 1412 intron 245 619260 0.2 AGCTTGCTACAGGCTGCGGT 1413 intron 246 619276 0.1 GACTCCTGAGTTCCAGAGCT 1429 intron 263 619278 0.1 GCGACTCCTGAGTTCCAGAG 1431 intron 265 619280 <0.07 GCGCGACTCCTGAGTTCCAG 1433 intron 267 619284 0.3 TAGCGCGCGACTCCTGAGTT 1437 Intron 271 619292 0.1 CCGGCCCCTAGCGCGCGACT 1445 intron 279 619293 0.2 CCCGGCCCCTAGCGCGCGAC 1446 intron 98 619298 <0.07 CCGGCCCCGGCCCCTAGCGC 1451 intron 284 619307 0.1 GACCACGCCCCGGCCCCGGC 1466 intron 293 619337 0.3 CCGCAGCCCCGCCCCGGGCC 1504 intron:exon1B 326 junction 619338 0.4 ACCGCAGCCCCGCCCCGGGC 1505 intron:exon1B 327 junction 619339 0.5 AACCGCAGCCCCGCCCCGGG 1506 intron:exon1B 328 junction 619342 0.2 CGCAACCGCAGCCCCGCCCC 1509 intron:exon1B 331 junction 619343 0.3 CCGCAACCGCAGCCCCGCCC 1510 intron:exon1B 332 junction 619344 0.5 ACCGCAACCGCAGCCCCGCC 1511 intron:exon1B 333 junction 619350 0.4 GCAGGCACCGCAACCGCAGC 1517 intron:exon1B 339 junction 619351 0.6 CGCAGGCACCGCAACCGCAG 1518 intron:exon1B 340 junction
Example 4: Antisense Inhibition of C9ORF72 by Human-Rhesus Cross-Reactive Antisense Oligonucleotides in LLC-MK2 Cells
(502) Antisense oligonucleotides targeting a human C9ORF72 nucleic acid and fully cross-reactive with a rhesus C9ORF72 nucleic acid were designed and were tested for their effects on rhesus C9ORF72 mRNA in vitro. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in the tables below. Cultured rhesus LLC-MK2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 (forward sequence TGTGACAGTITGGAATGCAGTGA, designated herein as SEQ ID NO: 16; reverse sequence GCCACITAAAGCAATCTCTGTCITG, designated herein as SEQ ID NO: 17; probe sequence TCGACTCTITGCCCACCGCCA, designated herein as SEQ ID NO: 18—a TAQ-man primer probe set) was used to measure total C9ORF72 mRNA levels. RTS3750 targets exon 2 of the mRNA transcripts and, therefore, measures total mRNA transcripts. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides. ‘n.d.’ indicates that there was no signal reading in the assay for that particular oligonucleotide. The antisense oligonucleotides were also tested in HepG2 cells in a series of experiments that had similar culture conditions. The results for each experiment are also presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C9ORF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells. ‘n.d.’ means no data.
(503) The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and on the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment comprises a 2′-MOE group. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage.
(504) “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each antisense oligonucleotide listed in the Tables below is targeted to either human C9ORF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1), the human C9ORF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 6), or all three. ‘n/a’ indicates that the antisense oligonucleotide does not target that particular gene sequence.
(505) TABLE-US-00017 TABLE 17 Percent inhibition of human C9ORF72 compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2, and 6 % inhibition % SEQ SEQ SEQ (LLC- inhibition ID ID ID MK2) (HepG2) NO: 1 NO: 2 NO: 6 Primer Primer SEQ Start Start Start Probe Probe ID ISIS NO Site Site Site Sequence Linkage RTS3750 RTS3905 NO 576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 51 91 20 619343 n/a 1510 1 CCGCAACCGCAGCCCCGCCC soooossssssssssooss 0 96 332 619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 59 100 20 625183 309 7989 214 CCTTACTCTAGGACCAAGAA soooossssssssssooss 27 92 484 625249 239 7919 144 AAAGCAATCTCTGTCTTGGC soooossssssssssooss 78 n.d. 465 625255 364 8044 269 AAGTTATTTCTCCATCACTG soooossssssssssooss 40 97 502 627833 321 8001 226 AGCCCAAATGTGCCTTACTC soooossssssssssooss 52 n.d. 487 627834 382 8062 287 GAGTGTGGTTGGCAAGAAAA soooossssssssssooss 0 61 506 655126 n/a 1548 39 CGCCACCGCCTGCGCCTCCG soooossssssssssooss 0 96 512 655127 n/a 1551 42 ACTCGCCACCGCCTGCGCCT soooossssssssssooss 11 93 513 655128 n/a n/a 45 TCCACTCGCCACCGCCTGCG soooossssssssssooss 0 60 514 655129 n/a n/a 48 ATATCCACTCGCCACCGCCT soooossssssssssooss 1 79 515 655130 n/a n/a 51 GAGATATCCACTCGCCACCG soooossssssssssooss 8 45 516 655131* 167 7847 72 TCACATTATCCAAATGCTCC soooossssssssssooss 36 88 441 655132* 170 7850 75 CTGTCACATTATCCAAATGC soooossssssssssooss 20 79 442 655133* 173 7853 78 CAACTGTCACATTATCCAAA soooossssssssssooss 31 82 443 655134* 176 7856 81 TTCCAACTGTCACATTATCC soooossssssssssooss 43 90 444 655135* 180 7860 85 TGCATTCCAACTGTCACATT soooossssssssssooss 69 94 445 655136* 183 7863 88 CACTGCATTCCAACTGTCAC soooossssssssssooss 75 98 446 655137* 186 7866 91 CATCACTGCATTCCAACTGT soooossssssssssooss 71 95 447 655138 189 7869 94 CGACATCACTGCATTCCAAC soooossssssssssooss 85 n.d. 448 655139 192 7872 97 AGTCGACATCACTGCATTCC soooossssssssssooss 89 n.d. 449 655140* 195 7875 100 AAGAGTCGACATCACTGCAT soooossssssssssooss 81 100 450 655141* 198 7878 103 GCAAAGAGTCGACATCACTG soooossssssssssooss 68 98 451 655142* 201 7881 106 TGGGCAAAGAGTCGACATCA soooossssssssssooss 60 98 452 655143* 204 7884 109 CGGTGGGCAAAGAGTCGACA soooossssssssssooss 69 99 453 655144* 207 7887 112 TGGCGGTGGGCAAAGAGTCG soooossssssssssooss 60 97 454 655145* 211 7891 116 GAGATGGCGGTGGGCAAAGA soooossssssssssooss 27 93 455 655146* 214 7894 119 CTGGAGATGGCGGTGGGCAA soooossssssssssooss 56 99 456 655147* 218 7898 123 ACAGCTGGAGATGGCGGTGG soooossssssssssooss 17 84 457 655148 221 7901 126 GCAACAGCTGGAGATGGCGG soooossssssssssooss 34 n.d. 458 655149 224 7904 129 TTGGCAACAGCTGGAGATGG soooossssssssssooss 27 n.d. 459 655150* 227 7907 132 GTCTTGGCAACAGCTGGAGA soooossssssssssooss 52 99 460 655151 230 7910 135 TCTGTCTTGGCAACAGCTGG soooossssssssssooss 60 n.d. 461 655152* 232 7912 137 TCTCTGTCTTGGCAACAGCT soooossssssssssooss 65 98 462 655153* 236 7916 141 GCAATCTCTGTCTTGGCAAC soooossssssssssooss 91 99 463 655154* 237 7917 142 AGCAATCTCTGTCTTGGCAA soooossssssssssooss 87 99 464 655155* 242 7922 147 CTTAAAGCAATCTCTGTCTT soooossssssssssooss 80 76 466 655156* 245 7925 150 CCACTTAAAGCAATCTCTGT soooossssssssssooss 74 86 467 655157 267 7947 172 AGCTGCTAATAAAGGTGATT soooossssssssssooss 27 90 468 655158 270 7950 175 AGTAGCTGCTAATAAAGGTG soooossssssssssooss 17 87 469 655159 273 7953 178 AAAAGTAGCTGCTAATAAAG soooossssssssssooss 6 48 470 655160 276 7956 181 AGCAAAAGTAGCTGCTAATA soooossssssssssooss 3 87 471 655161 279 7959 184 GTAAGCAAAAGTAGCTGCTA soooossssssssssooss 30 99 472 655162 282 7962 187 CCAGTAAGCAAAAGTAGCTG soooossssssssssooss 24 85 473 655163 285 7965 190 GTCCCAGTAAGCAAAAGTAG soooossssssssssooss 15 70 474 655164 286 7966 191 TGTCCCAGTAAGCAAAAGTA soooossssssssssooss 5 60 475 655165 288 7968 193 ATTGTCCCAGTAAGCAAAAG soooossssssssssooss 0 46 476 655166 290 7970 195 ATATTGTCCCAGTAAGCAAA soooossssssssssooss 0 54 477 655167 291 7971 196 AATATTGTCCCAGTAAGCAA soooossssssssssooss 16 60 478 655168 294 7974 199 AAGAATATTGTCCCAGTAAG soooossssssssssooss 0 52 479 655169 297 7977 202 ACCAAGAATATTGTCCCAGT soooossssssssssooss 20 82 480 655170 300 7980 205 AGGACCAAGAATATTGTCCC soooossssssssssooss 17 54 481 655171 303 7983 208 TCTAGGACCAAGAATATTGT soooossssssssssooss 0 36 482 655172 306 7986 211 TACTCTAGGACCAAGAATAT soooossssssssssooss 10 43 483 655173 312 7992 217 GTGCCTTACTCTAGGACCAA soooossssssssssooss 75 99 485 655174 315 7995 220 AATGTGCCTTACTCTAGGAC soooossssssssssooss 47 98 486 655175 327 8007 232 CTTTGGAGCCCAAATGTGCC soooossssssssssooss 21 86 488 655176 330 8010 235 TGTCTTTGGAGCCCAAATGT soooossssssssssooss 21 88 489 655177 333 8013 238 TTCTGTCTTTGGAGCCCAAA soooossssssssssooss 42 97 490 655178 334 8014 239 GTTCTGTCTTTGGAGCCCAA soooossssssssssooss 66 99 491 655179 336 8016 241 CTGTTCTGTCTTTGGAGCCC soooossssssssssooss 68 95 492 655180 339 8019 244 TACCTGTTCTGTCTTTGGAG soooossssssssssooss 29 92 493 655181 342 8022 247 AAGTACCTGTTCTGTCTTTG soooossssssssssooss 26 76 494 655182 345 8025 250 GAGAAGTACCTGTTCTGTCT soooossssssssssooss 38 94 495 655183 348 8028 253 ACTGAGAAGTACCTGTTCTG soooossssssssssooss 23 89 496 655184 350 8030 255 TCACTGAGAAGTACCTGTTC soooossssssssssooss 19 83 497 655185 351 8031 256 ATCACTGAGAAGTACCTGTT soooossssssssssooss 40 87 498 655186 354 8034 259 TCCATCACTGAGAAGTACCT soooossssssssssooss 46 97 499 655187 358 8038 263 TTTCTCCATCACTGAGAAGT soooossssssssssooss 36 94 500 655188 361 8041 266 TTATTTCTCCATCACTGAGA soooossssssssssooss 9 82 501 655189 367 8047 272 GAAAAGTTATTTCTCCATCA soooossssssssssooss 37 96 503 655190 376 8056 281 GGTTGGCAAGAAAAGTTATT soooossssssssssooss 15 74 504 655191 379 8059 284 TGTGGTTGGCAAGAAAAGTT soooossssssssssooss 15 62 505 655192 385 8065 290 TTAGAGTGTGGTTGGCAAGA soooossssssssssooss 12 63 507 655193 388 8068 293 CATTTAGAGTGTGGTTGGCA soooossssssssssooss 7 89 508 655194 389 8069 294 CCATTTAGAGTGTGGTTGGC soooossssssssssooss 31 93 509 655195 394 8074 299 TTTCTCCATTTAGAGTGTGG soooossssssssssooss 19 91 510 655196 397 8077 302 GGATTTCTCCATTTAGAGTG soooossssssssssooss 8 82 511
(506) TABLE-US-00018 TABLE 18 Percent inhibition of human C9ORF72 compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2, and 6 % inhibition % SEQ SEQ SEQ (LLC- inhibition ID ID ID MK2) (HepG2) NO: 1 NO: 2 NO: 6 Primer Primer SEQ ISIS Start Start Start Probe Probe ID NO Site Site Site Sequence Linkage RTS3750 RTS3905 NO 576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 55 97 20 619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 74 97 20 655197 403 8083 308 TTCGAAGGATTTCTCCATTT soooossssssssssooss 14 87 517 655198 406 8086 311 CATTTCGAAGGATTTCTCCA soooossssssssssooss 23 83 518 655199 409 8089 314 CTGCATTTCGAAGGATTTCT soooossssssssssooss 42 97 519 655200 412 8092 317 TCTCTGCATTTCGAAGGATT soooossssssssssooss 21 87 520 655201 415 8095 320 CACTCTCTGCATTTCGAAGG soooossssssssssooss 25 89 521 655202 418 8098 323 CACCACTCTCTGCATTTCGA soooossssssssssooss 54 96 522 655203 420 8100 325 AGCACCACTCTCTGCATTTC soooossssssssssooss 51 90 523 655204 421 8101 326 TAGCACCACTCTCTGCATTT soooossssssssssooss 28 94 524 655205 424 8104 329 CTATAGCACCACTCTCTGCA soooossssssssssooss 17 90 525 655206 427 8107 332 CATCTATAGCACCACTCTCT soooossssssssssooss 15 83 526 655207 433 8113 338 ACTTTACATCTATAGCACCA soooossssssssssooss 20 85 527 655208 436 8116 341 AAAACTTTACATCTATAGCA soooossssssssssooss 25 72 528 655209 443 8123 348 AAGACAAAAAACTTTACATC soooossssssssssooss 10 45 529 655210 444 8124 349 CAAGACAAAAAACTTTACAT soooossssssssssooss 0 56 530 655211 446 8126 351 GACAAGACAAAAAACTTTAC soooossssssssssooss 32 84 531 655212 449 8129 354 TCAGACAAGACAAAAAACTT soooossssssssssooss 10 74 532 655213 451 8131 356 TTTCAGACAAGACAAAAAAC soooossssssssssooss 7 54 533 655214 453 8133 358 CTTTTCAGACAAGACAAAAA soooossssssssssooss 7 57 534 655215 456 8136 361 TCCCTTTTCAGACAAGACAA soooossssssssssooss 32 91 535 655216 459 8139 364 CACTCCCTTTTCAGACAAGA soooossssssssssooss 39 91 536 655217 462 8142 367 AATCACTCCCTTTTCAGACA soooossssssssssooss 41 95 537 655218 465 8145 370 AATAATCACTCCCTTTTCAG soooossssssssssooss 13 63 538 655219 467 8147 372 ACAATAATCACTCCCTTTTC soooossssssssssooss 2 60 539 655220 468 8148 373 AACAATAATCACTCCCTTTT soooossssssssssooss 11 73 540 655221 471 8151 376 TGAAACAATAATCACTCCCT soooossssssssssooss 17 83 541 655222 474 8154 379 TAATGAAACAATAATCACTC soooossssssssssooss 1 79 542 655223 477 8157 382 GATTAATGAAACAATAATCA soooossssssssssooss 12 59 543 655224 482 8162 387 TCAAAGATTAATGAAACAAT soooossssssssssooss 0 9 544 655225 485 8165 390 CCATCAAAGATTAATGAAAC soooossssssssssooss 17 81 545 655226 488 8168 393 TTTCCATCAAAGATTAATGA soooossssssssssooss 14 87 546 655227 491 8171 396 CAGTTTCCATCAAAGATTAA soooossssssssssooss 7 69 547 655228 494 8174 399 TTCCAGTTTCCATCAAAGAT soooossssssssssooss 25 88 548 655229 497 8177 402 CCATTCCAGTTTCCATCAAA soooossssssssssooss 44 90 549 655230 500 8180 405 TCCCCATTCCAGTTTCCATC soooossssssssssooss 48 94 550 655231 503 8183 408 CGATCCCCATTCCAGTTTCC soooossssssssssooss 54 96 551 655232 506 8186 411 CTGCGATCCCCATTCCAGTT soooossssssssssooss 61 96 552 655233 509 8189 414 GTGCTGCGATCCCCATTCCA soooossssssssssooss 63 100 553 655234 512 8192 417 TATGTGCTGCGATCCCCATT soooossssssssssooss 34 94 554 655235 533 8213 438 GGAAGTATAATTGATAGTCC soooossssssssssooss 25 91 555 655236 536 8216 441 TGTGGAAGTATAATTGATAG soooossssssssssooss 13 66 556 655237 539 8219 444 GTCTGTGGAAGTATAATTGA soooossssssssssooss 24 83 557 655238 542 8222 447 TCTGTCTGTGGAAGTATAAT soooossssssssssooss 51 92 558 655239 545 8225 450 AGTTCTGTCTGTGGAAGTAT soooossssssssssooss 42 96 559 655240 548 8228 453 CTAAGTTCTGTCTGTGGAAG soooossssssssssooss 16 88 560 655241 551 8231 456 AAACTAAGTTCTGTCTGTGG soooossssssssssooss 25 93 561 655242 554 8234 459 TAGAAACTAAGTTCTGTCTG soooossssssssssooss 29 94 562 655243 557 8237 462 AGGTAGAAACTAAGTTCTGT soooossssssssssooss 43 85 563 655244 560 8240 465 GGGAGGTAGAAACTAAGTTC soooossssssssssooss 27 77 564 655245 563 8243 468 AGTGGGAGGTAGAAACTAAG soooossssssssssooss 22 77 565 655246 566 8246 471 TGAAGTGGGAGGTAGAAACT soooossssssssssooss 16 45 566 655247 569 8249 474 CTATGAAGTGGGAGGTAGAA soooossssssssssooss 14 60 567 655248 572 8252 477 ACTCTATGAAGTGGGAGGTA soooossssssssssooss 30 81 568 655249 574 8254 479 ACACTCTATGAAGTGGGAGG soooossssssssssooss 34 94 569 655250 575 8255 480 CACACTCTATGAAGTGGGAG soooossssssssssooss 46 98 570 655251 576 8256 481 ACACACTCTATGAAGTGGGA soooossssssssssooss 20 94 571 655252 578 8258 483 ACACACACTCTATGAAGTGG soooossssssssssooss 28 97 572 655253 581 8261 486 TCAACACACACTCTATGAAG soooossssssssssooss 12 62 573 655254 584 8264 489 CTATCAACACACACTCTATG soooossssssssssooss 6 68 574 655255 587 8267 492 AATCTATCAACACACACTCT soooossssssssssooss 16 87 575 655256 590 8270 495 GTTAATCTATCAACACACAC soooossssssssssooss 28 95 576 655257 592 8272 497 GTGTTAATCTATCAACACAC soooossssssssssooss 15 76 577 655258 593 8273 498 TGTGTTAATCTATCAACACA soooossssssssssooss 14 53 578 655259 595 8275 500 TATGTGTTAATCTATCAACA soooossssssssssooss 11 78 579 655260 596 8276 501 ATATGTGTTAATCTATCAAC soooossssssssssooss 25 79 580 655261 599 8279 504 ATTATATGTGTTAATCTATC soooossssssssssooss 11 71 581 655262 602 8282 507 CGGATTATATGTGTTAATCT soooossssssssssooss 21 91 582 655263 605 8285 510 TTCCGGATTATATGTGTTAA soooossssssssssooss 15 88 583 655264 608 8288 513 CCTTTCCGGATTATATGTGT soooossssssssssooss 12 83 584 655265 611 8291 516 CTTCCTTTCCGGATTATATG soooossssssssssooss 1 69 585 655266 614 8294 519 ATTCTTCCTTTCCGGATTAT soooossssssssssooss 15 76 586 655267 617 8297 522 CATATTCTTCCTTTCCGGAT soooossssssssssooss 17 69 587 655268 620 8300 525 ATCCATATTCTTCCTTTCCG soooossssssssssooss 21 67 588 655269 624 8304 529 ATGCATCCATATTCTTCCTT soooossssssssssooss 5 73 589 655270 626 8306 531 TTATGCATCCATATTCTTCC soooossssssssssooss 23 71 590 655271 629 n/a 534 TCCTTATGCATCCATATTCT soooossssssssssooss 15 64 591 655272 632 n/a 537 CTTTCCTTATGCATCCATAT soooossssssssssooss 24 66 592 655273 635 n/a 540 TGTCTTTCCTTATGCATCCA soooossssssssssooss 37 76 593
(507) TABLE-US-00019 TABLE 19 Percent inhibition of human C9ORF72 compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2, and 6 % inhibition % SEQ SEQ SEQ (LLC- inhibition ID ID ID MK2) (HepG2) NO: 1 NO: 2 NO: 6 Primer Primer SEQ ISIS Start Start Start Probe Probe ID NO Site Site Site Sequence Linkage RTS3750 RTS3905 NO 576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 53 95 20 619253 n/a 1406 n/a TACAGGCTGCGGTTGTTTCC soooossssssssssooss 0 72 97 619293 n/a 1446 n/a CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 0 95 98 619422 n/a 3452 n/a GGTAACTTCAAACTCTTGGG soooossssssssssooss 0 93 382 655329 n/a 2330 n/a AGGACCTCCCTCCTGTTTCT soooossssssssssooss 0 84 594 655330 n/a 2490 n/a AGAAGTAATGCCAGACAGAT soooossssssssssooss 0 75 595 655331 n/a 2901 n/a CTTTGTTTCTCTGAAAGCAA soooossssssssssooss 16 75 596 655332 n/a 3576 n/a GTGGTTGGTCCACTGCTATT soooossssssssssooss 28 94 597 655333 n/a 3801 n/a TTGAGGGAAGCCAAGATTCA soooossssssssssooss 10 77 598 655334 n/a 3975 n/a AGAGCTGTACAATTATTTTA soooossssssssssooss 13 90 599 655335 n/a 4725 n/a GGTAATGACACTACTGCTGT soooossssssssssooss 27 96 600 655336 n/a 5970 n/a GATCCTAATCCTGTCTATGC soooossssssssssooss 0 70 601 655337 n/a 7382 n/a ACTTGTGGGTTGAATTGTGT soooossssssssssooss 4 66 602 655338 n/a 8310 n/a TACCTTATGCATCCATATTC soooossssssssssooss 11 62 603 655339 n/a 8409 n/a GATGTTCACTGCATATAATT soooossssssssssooss 31 88 604 655340 n/a 8464 n/a CCAGATGTATTTGTATCTAA soooossssssssssooss 41 96 605 655341 n/a 8523 n/a TAATGTGGAGCTACCATTTC soooossssssssssooss 6 72 606 655342 n/a 8587 n/a GCTCCCAAGAAGAATCCAGG soooossssssssssooss 44 74 607 655343 n/a 8658 n/a ACTTACACATAGTAGTAAGC soooossssssssssooss 16 88 608 655344 n/a 8716 n/a AAAGAGACCAAAGGCTACAT soooossssssssssooss 4 82 609 655345 n/a 8785 n/a GGAATTCTCTTGGGAACCAT soooossssssssssooss 9 80 610 619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 51 98 20 655274 638 n/a 543 TCTTGTCTTTCCTTATGCAT soooossssssssssooss 0 73 611 655275 641 n/a 546 TTTTCTTGTCTTTCCTTATG soooossssssssssooss 10 61 612 625344 647 9413 552 TGGACATTTTCTTGTCTTTC soooossssssssssooss 32 94 613 655276 650 9416 555 TTCTGGACATTTTCTTGTCT soooossssssssssooss 8 79 614 655277 653 9419 558 ATCTTCTGGACATTTTCTTG soooossssssssssooss 0 60 615 655278 655 9421 560 TAATCTTCTGGACATTTTCT soooossssssssssooss 0 66 616 655279 659 9425 564 AAGATAATCTTCTGGACATT soooossssssssssooss 5 72 617 655280 662 9428 567 TCTAAGATAATCTTCTGGAC soooossssssssssooss 2 81 618 655281 665 9431 570 CCTTCTAAGATAATCTTCTG soooossssssssssooss 0 19 619 655282 668 9434 573 GTGCCTTCTAAGATAATCTT soooossssssssssooss 4 20 620 655283 671 9437 576 TCTGTGCCTTCTAAGATAAT soooossssssssssooss 9 27 621 655284 674 9440 579 CTCTCTGTGCCTTCTAAGAT soooossssssssssooss 0 35 622 655285 677 9443 582 ATTCTCTCTGTGCCTTCTAA soooossssssssssooss 7 40 623 655286 680 9446 585 TCCATTCTCTCTGTGCCTTC soooossssssssssooss 18 65 624 655287 683 9449 588 TCTTCCATTCTCTCTGTGCC soooossssssssssooss 14 67 625 655288 686 9452 591 TGATCTTCCATTCTCTCTGT soooossssssssssooss 7 65 626 655289 691 n/a 596 GACCCTGATCTTCCATTCTC soooossssssssssooss 12 89 627 655290 694 n/a 599 TCTGACCCTGATCTTCCATT soooossssssssssooss 13 81 628 655291 697 n/a 602 TACTCTGACCCTGATCTTCC soooossssssssssooss 0 82 629 655292 700 n/a 605 TAATACTCTGACCCTGATCT soooossssssssssooss 0 72 630 655293 703 n/a 608 GAATAATACTCTGACCCTGA soooossssssssssooss 0 77 631 655294 709 12529 614 GCATTGGAATAATACTCTGA soooossssssssssooss 0 79 632 655295 712 12532 617 TAAGCATTGGAATAATACTC soooossssssssssooss 8 79 633 655296 715 12535 620 CAGTAAGCATTGGAATAATA soooossssssssssooss 0 66 634 655297 718 12538 623 CTCCAGTAAGCATTGGAATA soooossssssssssooss 12 78 635 655298 721 12541 626 CTTCTCCAGTAAGCATTGGA soooossssssssssooss 0 81 636 655299 724 12544 629 TCACTTCTCCAGTAAGCATT soooossssssssssooss 0 70 637 655300 727 12547 632 GAATCACTTCTCCAGTAAGC soooossssssssssooss 0 75 638 655301 730 12550 635 CAGGAATCACTTCTCCAGTA soooossssssssssooss 20 85 639 655302 733 12553 638 TTACAGGAATCACTTCTCCA soooossssssssssooss 0 50 640 655303 736 12556 641 CCATTACAGGAATCACTTCT soooossssssssssooss 0 57 641 655304 744 12564 649 AAGCAGTTCCATTACAGGAA soooossssssssssooss 0 83 642 655305 747 12567 652 TGAAAGCAGTTCCATTACAG soooossssssssssooss 0 55 643 655306 750 12570 655 AGATGAAAGCAGTTCCATTA soooossssssssssooss 0 82 644 655307 753 12573 658 CATAGATGAAAGCAGTTCCA soooossssssssssooss 2 83 645 655308 756 12576 661 TTTCATAGATGAAAGCAGTT soooossssssssssooss 0 59 646 655309 762 12582 667 GTGTGATTTCATAGATGAAA soooossssssssssooss 0 39 647 655310 766 12586 671 CACTGTGTGATTTCATAGAT soooossssssssssooss 10 31 648 655311 769 12589 674 GAACACTGTGTGATTTCATA soooossssssssssooss 0 80 649 655312 772 12592 677 CAGGAACACTGTGTGATTTC soooossssssssssooss 0 53 650 655313 778 12598 683 TTTCTTCAGGAACACTGTGT soooossssssssssooss 0 45 651 655314 781 12601 686 CTATTTCTTCAGGAACACTG soooossssssssssooss 0 56 652 655315 784 n/a 689 TATCTATTTCTTCAGGAACA soooossssssssssooss 0 75 653 655316 787 n/a 692 CTATATCTATTTCTTCAGGA soooossssssssssooss 0 75 654 655317 790 n/a 695 CAGCTATATCTATTTCTTCA soooossssssssssooss 23 89 655 655318 793 n/a 698 TATCAGCTATATCTATTTCT soooossssssssssooss 7 80 656 655319 796 n/a 701 CTGTATCAGCTATATCTATT soooossssssssssooss 34 86 657 655320 799 n/a 704 GTACTGTATCAGCTATATCT soooossssssssssooss 42 88 658 655321 802 n/a 707 TGAGTACTGTATCAGCTATA soooossssssssssooss 31 87 659 655322 805 13356 710 CATTGAGTACTGTATCAGCT soooossssssssssooss 3 84 660 655323 808 13359 713 CATCATTGAGTACTGTATCA soooossssssssssooss 5 88 661 655324 811 13362 716 CATCATCATTGAGTACTGTA soooossssssssssooss 17 90 662 655325 814 13365 719 TATCATCATCATTGAGTACT soooossssssssssooss 2 84 663 655326 817 13368 722 CAATATCATCATCATTGAGT soooossssssssssooss 0 74 664 655327 822 13373 727 GTCACCAATATCATCATCAT soooossssssssssooss 6 78 665 655328 848 13399 753 TTGAGAAGAAAGCCTTCATG soooossssssssssooss 0 42 666 619421 3132 28251 3037 GGGACACTACAAGGTAGTAT soooossssssssssooss 0 94 401
(508) TABLE-US-00020 TABLE 20 Percent inhibition of human C9ORF72 compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2, and 6 % inhibition % SEQ SEQ SEQ (LLC- inhibition ID ID ID MK2) (HepG2) NO: 1 NO: 2 NO: 6 Primer Primer SEQ ISIS Start Start Start Probe Probe ID NO Site Site Site Sequence Linkage RTS3750 RTS3905 NO 576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 49 97 20 655346 n/a 8861 n/a ACTATACTGAAATGTAAATA soooossssssssssooss 4 7 667 655347 n/a 8915 n/a TATCAAACTGGAACACAGGA soooossssssssssooss 16 53 668 655348 n/a 8965 n/a TGGGCAAAAGCCTTTTAAAA soooossssssssssooss 13 63 669 655349 n/a 9017 n/a GCAAACATAGTAAAAAATTA soooossssssssssooss 6 7 670 655350 n/a 9067 n/a TTCTCCTGATTTTAAGAGTT soooossssssssssooss 39 90 671 655351 n/a 9117 n/a AAGAATGACTTGCACTTTTC soooossssssssssooss 25 100 672 655352 n/a 9173 n/a AAAGATAACTTCACAGAAAA soooossssssssssooss 13 10 673 655353 n/a 9286 n/a CTTTCTACTTTAGGGAAAAA soooossssssssssooss 16 64 674 655354 n/a 9336 n/a TTTTTCAATAGACATGTTCT soooossssssssssooss 19 81 675 655355 n/a 9403 n/a CTTGTCTTTCCTGAGCAAGA soooossssssssssooss 8 54 676 655356 n/a 9455 n/a ACCTGATCTTCCATTCTCTC soooossssssssssooss 22 81 677 655357 n/a 9576 n/a CTCCATAAAAGCTCCATTAA soooossssssssssooss 34 52 678 655358 n/a 9640 n/a TGTTTACTGATTTAACTCTT soooossssssssssooss 34 83 679 655359 n/a 9696 n/a AACAGAAAAAAAAAGGGAGC soooossssssssssooss 18 22 680 655360 n/a 9772 n/a GTACCTTAAAGAACATATCA soooossssssssssooss 34 100 681 655361 n/a 9920 n/a AAATGTAAATTGCATGAGTC soooossssssssssooss 7 100 682 655362 n/a 9970 n/a GGGTAAGAAATATCACTGAC soooossssssssssooss 43 63 683 655363 n/a 10055 n/a AACCATGCTTCTCAAACTCT soooossssssssssooss 29 75 684 655364 n/a 10122 n/a AAGAACTTCTCTGCTTTACA soooossssssssssooss 13 68 685 655365 n/a 10172 n/a AATGGAAGTAAAAGTGAAGA soooossssssssssooss 7 13 686 655366 n/a 10233 n/a AACAGCCATGTTTAAAATAT soooossssssssssooss 15 37 687 655367 n/a 10283 n/a TTAAAGTATCATCTGTCTCA soooossssssssssooss 34 74 688 655368 n/a 10364 n/a CAATTTGGTAAAGGAGATCA soooossssssssssooss 6 48 689 655369 n/a 10418 n/a ACACAGAATAACTGTCTCTG soooossssssssssooss 16 64 690 655370 n/a 10491 n/a GCTTATTGACCAGCAAATAA soooossssssssssooss 22 69 691 655371 n/a 10615 n/a CCCAGTAAAAGCAGAATTTT soooossssssssssooss 24 57 692 655372 n/a 10665 n/a ATTAATAGTAGTCAACTTAA soooossssssssssooss 20 10 693 655373 n/a 10730 n/a ACTTGAACTTCTCAGCAGTA soooossssssssssooss 25 62 694 655374 n/a 10786 n/a AGAAGAGGCTCTAAAAGAAA soooossssssssssooss 7 59 695 655375 n/a 10970 n/a AAAGGCAACTCCTCCTTTTC soooossssssssssooss 13 78 696 655376 n/a 11020 n/a ACAGTATTGTTCAAAATAAA soooossssssssssooss 18 100 697 655377 n/a 11070 n/a CAGATGACAGCTACAACTGA soooossssssssssooss 16 49 698 655378 n/a 11121 n/a GAATAATGACTAGATCCGTG soooossssssssssooss 26 88 699 655379 n/a 11171 n/a ATAATTATCATGCCTGTTTA soooossssssssssooss 22 80 700 655380 n/a 11221 n/a CTTTAGTAACCTCCACAACT soooossssssssssooss 19 26 701 655381 n/a 11313 n/a GAATTTAAATGTGATGCTAC soooossssssssssooss 15 49 702 655382 n/a 11385 n/a TGTCAGACCCAGGGCCATTT soooossssssssssooss 40 83 703 655383 n/a 11445 n/a ACTTATTTTATGAAATGATT soooossssssssssooss 7 3 704 655384 n/a 11513 n/a TTTTAGCTAAACATATTTTT soooossssssssssooss 2 1 705 655385 n/a 11591 n/a CAGTCTCATCAGTTTTGTGA soooossssssssssooss 33 83 706 655386 n/a 11641 n/a TGTAAAGTGTCTCAAATATG soooossssssssssooss 21 39 707 655387 n/a 11711 n/a CTTGAAATTGTAATTTTGAA soooossssssssssooss 14 42 708 655388 n/a 11798 n/a AATCAAAATCAGCACATATA soooossssssssssooss 8 46 709 655389 n/a 11871 n/a ACCAAATAGGTAAGGAAAAC soooossssssssssooss 9 32 710 655390 n/a 11978 n/a AAAGATCTCCTTTAAAATTT soooossssssssssooss 11 29 711 655391 n/a 12053 n/a CTTTAGAGAGTATGGAATCA soooossssssssssooss 22 71 712 655392 n/a 12334 n/a CAAAGCTCACTTTTATTCTT soooossssssssssooss 25 70 713 655393 n/a 12384 n/a ACACAGTATCAAACAAGTCT soooossssssssssooss 29 45 714 655394 n/a 12459 n/a AAGCTGGGCAATAAAAAATA soooossssssssssooss 0 24 715 655395 n/a 12513 n/a CTGACCCTGCACAATAAAGT soooossssssssssooss 17 0 716 655396 n/a 12604 n/a CATCTATTTCTTCAGGAACA soooossssssssssooss 21 74 717 655397 n/a 12681 n/a GAATATTAATAATATACATA soooossssssssssooss 0 16 718 655398 n/a 12765 n/a AGGATTTTGTGTGTGCTTAT soooossssssssssooss 30 65 719 655399 n/a 12855 n/a TTTTAGGAATTATAAAAGTA soooossssssssssooss 7 61 720 655400 n/a 12924 n/a ACACAGTTTTGTTTCAAAAG soooossssssssssooss 13 61 721 655401 n/a 12978 n/a GGAAACTAAATTTGTGACTA soooossssssssssooss 21 56 722 655402 n/a 13028 n/a CTCTTAACACTCATAGTGTG soooossssssssssooss 13 52 723 655403 n/a 13084 n/a GAGACTAACCTAAATGACAA soooossssssssssooss 20 35 724 655404 n/a 13159 n/a CAAATGTGAAAGCTGGTCAA soooossssssssssooss 8 100 725 655405 n/a 13237 n/a TAACACACTGCCTTCATTTC soooossssssssssooss 17 32 726 655406 n/a 13337 n/a TATCTAAAATGCATCAAAAA soooossssssssssooss 2 6 727 655407 n/a 13400 n/a CTTGAGAAGAAAGCCTTCAT soooossssssssssooss 23 42 728 655408 n/a 13471 n/a CCAAATCTTGTCATAGGTGA soooossssssssssooss 42 95 729 655409 n/a 13550 n/a TAACACAAATTTAAGCAACA soooossssssssssooss 21 55 730 655410 n/a 13603 n/a AAATAGCAAATGGAATAACA soooossssssssssooss 14 55 731 655411 n/a 13662 n/a AAACCAGAATCAAGCAAGGG soooossssssssssooss 27 73 732 655412 n/a 13722 n/a CATCTACAGTACAACTTAAT soooossssssssssooss 13 100 733 655413 n/a 13773 n/a AGATCAGTATAAATATGAAT soooossssssssssooss 1 43 734 655414 n/a 13823 n/a GTTTAAGGGCACAAACTCTT soooossssssssssooss 27 78 735 655415 n/a 13884 n/a AGGTGTATAGAGAATTCAGG soooossssssssssooss 43 89 736 655416 n/a 13955 n/a TACTCAATGCTTATAACAAC soooossssssssssooss 26 84 737 655417 n/a 14089 n/a GGAACTAACATGTAGGCACT soooossssssssssooss 66 100 738 655418 n/a 14213 n/a CATAAAAGTGAATACTTTAT soooossssssssssooss 13 0 739 655419 n/a 14281 n/a AGGCTCTTAGGTTAAACACA soooossssssssssooss 16 79 740 655420 n/a 14331 n/a GCTGACACTGAACAGATACA soooossssssssssooss 52 84 741 655421 n/a 14392 n/a CATGTAGAGAGATTAAGTGA soooossssssssssooss 27 42 742 655422 n/a 14452 n/a ATCATTTAATTAATGTATTT soooossssssssssooss 13 0 743 619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 76 98 20
Example 5: Dose-Dependent Antisense Inhibition of Human C9ORF72 mRNA in LLC-MK2
(509) Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C9ORF72 mRNA were selected and tested at various doses in LLC-MK2 cells. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.33 M, 1.00 μM, 3.00 μM, or 9.00 μM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human C9ORF72 primer probe set RTS3750 was used to measure total C9ORF72 mRNA levels. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72 levels, relative to untreated control cells.
(510) As shown in Table 21, total C9ORF72 mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
(511) TABLE-US-00021 TABLE 21 Dose-dependent inhibition of total C9ORF72 mRNA transcript levels in LLC-MK2 cells 0.33 1.00 3.00 9.00 ISIS No μM μM μM μM 576816 0 33 55 66 619411 15 43 67 87 619412 9 30 55 84 619413 17 27 58 79 619414 13 49 75 83 619415 15 41 62 57 619416 29 47 70 81 619420 17 49 70 85 619423 25 52 71 82 627833 4 31 63 82 655173 37 72 86 90 655178 9 35 71 86 655179 30 50 52 84 655202 1 12 41 72 655231 0 28 43 71 655232 17 45 64 76 655233 19 30 62 80 655420 24 28 49 78
(512) The antisense oligonucleotides were also selected and tested at various doses in HepG2 cells. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.11 M, 0.33 M, 1.00 μM, or 3.00 μM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human C9ORF72 primer probe set RTS3750 was used to measure total C9ORF72 mRNA levels. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72 levels, relative to untreated control cells.
(513) As shown in Table 22, total C9ORF72 mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
(514) TABLE-US-00022 TABLE 22 Dose-dependent inhibition of total C9ORF72 mRNA transcript levels in HepG2 cells 0.11 0.33 1.00 3.00 ISIS No μM μM μM μM 576816 16 32 71 90 619411 11 41 71 91 619412 24 44 79 92 619413 0 18 59 84 619414 16 51 76 92 619415 16 38 72 85 619416 16 36 47 80 619420 15 47 75 91 619423 24 50 81 89 627833 0 29 69 90 655173 24 56 88 96 655178 25 48 81 92 655179 16 43 79 87 655202 17 19 61 84 655231 14 45 68 84 655232 13 38 69 79 655233 17 30 65 86 655420 19 35 60 86
Example 6: Design of Mixed Backbone 5-8-5 MOE Gapmers and Deoxy, MOE, and cEt Oligonucleotides Targeting Human C9ORF72
(515) Additional antisense oligonucleotides were designed targeting a C9ORF72 nucleic acid. The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-8-5 MOE gapmers, 5-10-5 MOE gapmers, or deoxy, MOE, and cEt gapmers.
(516) The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of eight 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE modification. The linkages between the nucleosides are described in the Linkage column; ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.
(517) The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises often 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE modification. The linkages between the nucleosides are described in the Linkage column; ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.
(518) The deoxy, MOE, and cEt oligonucleotides are 17 nucleosides in length wherein the nucleoside has either a MOE sugar modification, a cEt sugar modification, or a deoxyribose sugar. The ‘Chemistry’ column describes the sugar modifications of each oligonucleotide; ‘k’ indicates a cEt nucleoside; d’ indicates deoxyribonucleosides, the number indicates the number of deoxyribonucleosides; and ‘e’ indicates a 2′-MOE nucleoside. The internucleoside linkages throughout each gapmer are either phosphorothioate linkages or phosphodiester linkages. The linkages between the nucleosides are described in the Linkage column; ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.
(519) “Start site” indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human gene sequence. Each antisense oligonucleotide listed in the Tables 23-29 below is targeted to the human C9ORF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000. Table 30 presents a 5-10-5 gapmer that is targeted to C9ORF72 mRNA sequence, SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1).
(520) TABLE-US-00023 TABLE 23 5-8-5 MOE gapmers targeting SEQ ID NO: 2 SEQ ID SEQ ID ISIS NO: 2 NO: 2 SEQ ID NO Sequence Linkage Start Site Stop Site NO 672581 GTGAGAGCAAGTAGTGGG sooosssssssssooss 1326 1343 744 672582 TGTGAGAGCAAGTAGTGG sooosssssssssooss 1327 1344 745 672583 CTGTGAGAGCAAGTAGTG sooosssssssssooss 1328 1345 746 672584 ACTGTGAGAGCAAGTAGT sooosssssssssooss 1329 1346 747 672585 TACTGTGAGAGCAAGTAG sooosssssssssooss 1330 1347 748 672586 GTACTGTGAGAGCAAGTA sooosssssssssooss 1331 1348 749 672587 AGTACTGTGAGAGCAAGT sooosssssssssooss 1332 1349 750 672588 GAGTACTGTGAGAGCAAG sooosssssssssooss 1333 1350 751 672589 CGAGTACTGTGAGAGCAA sooosssssssssooss 1334 1351 752 672590 GCGAGTACTGTGAGAGCA sooosssssssssooss 1335 1352 753 672591 AGCGAGTACTGTGAGAGC sooosssssssssooss 1336 1353 754 672592 CAGCGAGTACTGTGAGAG sooosssssssssooss 1337 1354 755 672593 TCAGCGAGTACTGTGAGA sooosssssssssooss 1338 1355 756 672594 CTCAGCGAGTACTGTGAG sooosssssssssooss 1339 1356 757 672595 CCTCAGCGAGTACTGTGA sooosssssssssooss 1340 1357 758 672596 CCCTCAGCGAGTACTGTG sooosssssssssooss 1341 1358 759 672597 ACCCTCAGCGAGTACTGT sooosssssssssooss 1342 1359 760 672598 CACCCTCAGCGAGTACTG sooosssssssssooss 1343 1360 761 672599 TCACCCTCAGCGAGTACT sooosssssssssooss 1344 1361 762 672600 TTCACCCTCAGCGAGTAC sooosssssssssooss 1345 1362 763 672601 GTTCACCCTCAGCGAGTA sooosssssssssooss 1346 1363 764 672602 TGTTCACCCTCAGCGAGT sooosssssssssooss 1347 1364 765 672603 TTGTTCACCCTCAGCGAG sooosssssssssooss 1348 1365 766 672604 CTTGTTCACCCTCAGCGA sooosssssssssooss 1349 1366 767 672605 TCTTGTTCACCCTCAGCG sooosssssssssooss 1350 1367 768 672606 TTCTTGTTCACCCTCAGC sooosssssssssooss 1351 1368 769 672607 TTTCTTGTTCACCCTCAG sooosssssssssooss 1352 1369 770 672608 TTTTCTTGTTCACCCTCA sooosssssssssooss 1353 1370 771 672609 CTTTTCTTGTTCACCCTC sooosssssssssooss 1354 1371 772 672610 TCTTTTCTTGTTCACCCT sooosssssssssooss 1355 1372 773 672611 GTCTTTTCTTGTTCACCC sooosssssssssooss 1356 1373 774 672612 GGTCTTTTCTTGTTCACC sooosssssssssooss 1357 1374 775 672613 AGGTCTTTTCTTGTTCAC sooosssssssssooss 1358 1375 776 672614 CAGGTCTTTTCTTGTTCA sooosssssssssooss 1359 1376 777 672615 TCAGGTCTTTTCTTGTTC sooosssssssssooss 1360 1377 778 672616 ATCAGGTCTTTTCTTGTT sooosssssssssooss 1361 1378 779 672617 TATCAGGTCTTTTCTTGT sooosssssssssooss 1362 1379 780 672618 TTATCAGGTCTTTTCTTG sooosssssssssooss 1363 1380 781 672619 TTTATCAGGTCTTTTCTT sooosssssssssooss 1364 1381 782 672620 AATCTTTATCAGGTCTTT sooosssssssssooss 1368 1385 783 672621 TAATCTTTATCAGGTCTT sooosssssssssooss 1369 1386 784 672622 TTAATCTTTATCAGGTCT sooosssssssssooss 1370 1387 785 672623 GTTAATCTTTATCAGGTC sooosssssssssooss 1371 1388 786 672624 GGTTAATCTTTATCAGGT sooosssssssssooss 1372 1389 787 672625 TGGTTAATCTTTATCAGG sooosssssssssooss 1373 1390 788 672626 CTGGTTAATCTTTATCAG sooosssssssssooss 1374 1391 789 672627 TCTGGTTAATCTTTATCA sooosssssssssooss 1375 1392 790 672628 TTCTGGTTAATCTTTATC sooosssssssssooss 1376 1393 791 672629 TCCCTCCTTGTTTTCTTC sooosssssssssooss 1391 1408 792 672630 TTTCCCTCCTTGTTTTCT sooosssssssssooss 1393 1410 793 672631 GTTTCCCTCCTTGTTTTC sooosssssssssooss 1394 1411 794 672632 TGTTTCCCTCCTTGTTTT sooosssssssssooss 1395 1412 795 672633 TTGTTTCCCTCCTTGTTT sooosssssssssooss 1396 1413 796 672634 GTTGTTTCCCTCCTTGTT sooosssssssssooss 1397 1414 797 672635 GGTTGTTTCCCTCCTTGT sooosssssssssooss 1398 1415 798 672636 CGGTTGTTTCCCTCCTTG sooosssssssssooss 1399 1416 799 672637 GCGGTTGTTTCCCTCCTT sooosssssssssooss 1400 1417 800 672638 TGCGGTTGTTTCCCTCCT sooosssssssssooss 1401 1418 801 672639 CTGCGGTTGTTTCCCTCC sooosssssssssooss 1402 1419 802 672640 GCTGCGGTTGTTTCCCTC sooosssssssssooss 1403 1420 803 672641 GGCTGCGGTTGTTTCCCT sooosssssssssooss 1404 1421 804 672642 AGGCTGCGGTTGTTTCCC sooosssssssssooss 1405 1422 805 672643 CAGGCTGCGGTTGTTTCC sooosssssssssooss 1406 1423 806 672644 ACAGGCTGCGGTTGTTTC sooosssssssssooss 1407 1424 807 672645 TACAGGCTGCGGTTGTTT sooosssssssssooss 1408 1425 808 672646 CTACAGGCTGCGGTTGTT sooosssssssssooss 1409 1426 809 672647 GCTACAGGCTGCGGTTGT sooosssssssssooss 1410 1427 810 672648 TGCTACAGGCTGCGGTTG sooosssssssssooss 1411 1428 811 672649 TTGCTACAGGCTGCGGTT sooosssssssssooss 1412 1429 812 672650 CTTGCTACAGGCTGCGGT sooosssssssssooss 1413 1430 813 672651 GCTTGCTACAGGCTGCGG sooosssssssssooss 1414 1431 814 672652 AGCTTGCTACAGGCTGCG sooosssssssssooss 1415 1432 815 672653 GAGCTTGCTACAGGCTGC sooosssssssssooss 1416 1433 816 672654 AGAGCTTGCTACAGGCTG sooosssssssssooss 1417 1434 817 672655 CAGAGCTTGCTACAGGCT sooosssssssssooss 1418 1435 818 672656 CCAGAGCTTGCTACAGGC sooosssssssssooss 1419 1436 819 672657 TCCAGAGCTTGCTACAGG sooosssssssssooss 1420 1437 820 672658 TTCCAGAGCTTGCTACAG sooosssssssssooss 1421 1438 821 672659 GTTCCAGAGCTTGCTACA sooosssssssssooss 1422 1439 822 672660 AGTTCCAGAGCTTGCTAC sooosssssssssooss 1423 1440 823 672661 GAGTTCCAGAGCTTGCTA sooosssssssssooss 1424 1441 824 672662 TGAGTTCCAGAGCTTGCT sooosssssssssooss 1425 1442 825 672663 CTGAGTTCCAGAGCTTGC sooosssssssssooss 1426 1443 826 672664 CCTGAGTTCCAGAGCTTG sooosssssssssooss 1427 1444 827 672665 TCCTGAGTTCCAGAGCTT sooosssssssssooss 1428 1445 828 672666 CTCCTGAGTTCCAGAGCT sooosssssssssooss 1429 1446 829 672667 ACTCCTGAGTTCCAGAGC sooosssssssssooss 1430 1447 830 672668 GACTCCTGAGTTCCAGAG sooosssssssssooss 1431 1448 831 672669 CGACTCCTGAGTTCCAGA sooosssssssssooss 1432 1449 832 672670 GCGACTCCTGAGTTCCAG sooosssssssssooss 1433 1450 833 672671 CGCGACTCCTGAGTTCCA sooosssssssssooss 1434 1451 834 672672 GCGCGACTCCTGAGTTCC sooosssssssssooss 1435 1452 835 672673 CGCGCGACTCCTGAGTTC sooosssssssssooss 1436 1453 836 672674 GCGCGCGACTCCTGAGTT sooosssssssssooss 1437 1454 837 672675 AGCGCGCGACTCCTGAGT sooosssssssssooss 1438 1455 838 672676 TAGCGCGCGACTCCTGAG sooosssssssssooss 1439 1456 839 672677 CTAGCGCGCGACTCCTGA sooosssssssssooss 1440 1457 840 672678 CCTAGCGCGCGACTCCTG sooosssssssssooss 1441 1458 841 672679 CCCTAGCGCGCGACTCCT sooosssssssssooss 1442 1459 842 672680 CCCCTAGCGCGCGACTCC sooosssssssssooss 1443 1460 843 672681 GCCCCTAGCGCGCGACTC sooosssssssssooss 1444 1461 844 672682 GGCCCCTAGCGCGCGACT sooosssssssssooss 1445 1462 845 672683 CGGCCCCTAGCGCGCGAC sooosssssssssooss 1446 1463 846 672684 CCGGCCCCTAGCGCGCGA sooosssssssssooss 1447 1464 847 672685 CCCGGCCCCTAGCGCGCG sooosssssssssooss 1448 1465 848 672686 CCCCGGCCCCTAGCGCGC sooosssssssssooss 1449 1466 849 672687 GCCCCGGCCCCTAGCGCG sooosssssssssooss 1450 1467 850 672688 GGCCCCGGCCCCTAGCGC sooosssssssssooss 1451 1468 851 672689 CGGCCCCGGCCCCTAGCG sooosssssssssooss 1452 1469 852 672690 CCGGCCCCGGCCCCTAGC sooosssssssssooss 1453 1470 853 672691 CCCGGCCCCGGCCCCTAG sooosssssssssooss 1454 1471 854 672692 CCCCGGCCCCGGCCCCTA sooosssssssssooss 1455 1472 855 672693 ACGCCCCGGCCCCGGCCC sooosssssssssooss 1464 1481 856 672694 CACGCCCCGGCCCCGGCC sooosssssssssooss 1465 1482 857 672695 CCACGCCCCGGCCCCGGC sooosssssssssooss 1466 1483 858 672696 ACCACGCCCCGGCCCCGG sooosssssssssooss 1467 1484 859 672697 GACCACGCCCCGGCCCCG sooosssssssssooss 1468 1485 860 672698 CGACCACGCCCCGGCCCC sooosssssssssooss 1469 1486 861 672699 CCGACCACGCCCCGGCCC sooosssssssssooss 1470 1487 862 672700 CCCGACCACGCCCCGGCC sooosssssssssooss 1471 1488 863 672701 CCCCGACCACGCCCCGGC sooosssssssssooss 1472 1489 864 672702 GCCCCGACCACGCCCCGG sooosssssssssooss 1473 1490 865 672703 CGCCCCGACCACGCCCCG sooosssssssssooss 1474 1491 866 672704 CCGCCCCGACCACGCCCC sooosssssssssooss 1475 1492 867 672705 CCCGCCCCGACCACGCCC sooosssssssssooss 1476 1493 868 672706 GCCCGCCCCGACCACGCC sooosssssssssooss 1477 1494 869 672707 GGCCCGCCCCGACCACGC sooosssssssssooss 1478 1495 870 672708 GGGCCCGCCCCGACCACG sooosssssssssooss 1479 1496 871 672709 CGGGCCCGCCCCGACCAC sooosssssssssooss 1480 1497 872 672710 CCGGGCCCGCCCCGACCA sooosssssssssooss 1481 1498 873 672711 CCCGGGCCCGCCCCGACC sooosssssssssooss 1482 1499 874 672712 CCCCGGGCCCGCCCCGAC sooosssssssssooss 1483 1500 875 672713 AGCCCCGCCCCGGGCCCG sooosssssssssooss 1502 1519 876 672714 CAGCCCCGCCCCGGGCCC sooosssssssssooss 1503 1520 877 672715 GCAGCCCCGCCCCGGGCC sooosssssssssooss 1504 1521 878 672716 CGCAGCCCCGCCCCGGGC sooosssssssssooss 1505 1522 879 672717 CCGCAGCCCCGCCCCGGG sooosssssssssooss 1506 1523 880 672718 ACCGCAGCCCCGCCCCGG sooosssssssssooss 1507 1524 881 672719 AACCGCAGCCCCGCCCCG sooosssssssssooss 1508 1525 882 672720 CAACCGCAGCCCCGCCCC sooosssssssssooss 1509 1526 883 672721 GCAACCGCAGCCCCGCCC sooosssssssssooss 1510 1527 884 672722 CGCAACCGCAGCCCCGCC sooosssssssssooss 1511 1528 885 672723 CCGCAACCGCAGCCCCGC sooosssssssssooss 1512 1529 886 672724 ACCGCAACCGCAGCCCCG sooosssssssssooss 1513 1530 887 672725 CACCGCAACCGCAGCCCC sooosssssssssooss 1514 1531 888 672726 GCACCGCAACCGCAGCCC sooosssssssssooss 1515 1532 889 672727 GGCACCGCAACCGCAGCC sooosssssssssooss 1516 1533 890 672728 AGGCACCGCAACCGCAGC sooosssssssssooss 1517 1534 891 672729 CAGGCACCGCAACCGCAG sooosssssssssooss 1518 1535 892 672730 GCAGGCACCGCAACCGCA sooosssssssssooss 1519 1536 893 672731 CGCAGGCACCGCAACCGC sooosssssssssooss 1520 1537 894 672732 GCGCAGGCACCGCAACCG sooosssssssssooss 1521 1538 895 672733 GGCGCAGGCACCGCAACC sooosssssssssooss 1522 1539 896 672734 GGGCGCAGGCACCGCAAC sooosssssssssooss 1523 1540 897
(521) TABLE-US-00024 TABLE 24 Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2 SEQ SEQ ID NO: ID NO: SEQ ISIS 2 Start 2 Stop ID NO Sequence Chemistry Linkage Site Site NO 672735 TGAGAGCAAGTAGTGGG eeekk-d7-kkeee soosssssssssooss 1326 1342 898 672736 GTGAGAGCAAGTAGTGG eeekk-d7-kkeee soosssssssssooss 1327 1343 899 672737 TGTGAGAGCAAGTAGTG eeekk-d7-kkeee soosssssssssooss 1328 1344 900 672738 CTGTGAGAGCAAGTAGT eeekk-d7-kkeee soosssssssssooss 1329 1345 901 672739 ACTGTGAGAGCAAGTAG eeekk-d7-kkeee soosssssssssooss 1330 1346 902 672740 TACTGTGAGAGCAAGTA eeekk-d7-kkeee soosssssssssooss 1331 1347 903 672741 GTACTGTGAGAGCAAGT eeekk-d7-kkeee soosssssssssooss 1332 1348 904 672742 AGTACTGTGAGAGCAAG eeekk-d7-kkeee soosssssssssooss 1333 1349 905 672743 GAGTACTGTGAGAGCAA eeekk-d7-kkeee soosssssssssooss 1334 1350 906 672744 CGAGTACTGTGAGAGCA eeekk-d7-kkeee soosssssssssooss 1335 1351 907 672745 GCGAGTACTGTGAGAGC eeekk-d7-kkeee soosssssssssooss 1336 1352 908 672746 AGCGAGTACTGTGAGAG eeekk-d7-kkeee soosssssssssooss 1337 1353 909 672747 CAGCGAGTACTGTGAGA eeekk-d7-kkeee soosssssssssooss 1338 1354 910 672748 TCAGCGAGTACTGTGAG eeekk-d7-kkeee soosssssssssooss 1339 1355 911 672749 CTCAGCGAGTACTGTGA eeekk-d7-kkeee soosssssssssooss 1340 1356 912 672750 CCTCAGCGAGTACTGTG eeekk-d7-kkeee soosssssssssooss 1341 1357 913 672751 CCCTCAGCGAGTACTGT eeekk-d7-kkeee soosssssssssooss 1342 1358 914 672752 ACCCTCAGCGAGTACTG eeekk-d7-kkeee soosssssssssooss 1343 1359 915 672753 CACCCTCAGCGAGTACT eeekk-d7-kkeee soosssssssssooss 1344 1360 916 672754 TCACCCTCAGCGAGTAC eeekk-d7-kkeee soosssssssssooss 1345 1361 917 672755 TTCACCCTCAGCGAGTA eeekk-d7-kkeee soosssssssssooss 1346 1362 918 672756 GTTCACCCTCAGCGAGT eeekk-d7-kkeee soosssssssssooss 1347 1363 919 672757 TGTTCACCCTCAGCGAG eeekk-d7-kkeee soosssssssssooss 1348 1364 920 672758 TTGTTCACCCTCAGCGA eeekk-d7-kkeee soosssssssssooss 1349 1365 921 672759 CTTGTTCACCCTCAGCG eeekk-d7-kkeee soosssssssssooss 1350 1366 922 672760 TCTTGTTCACCCTCAGC eeekk-d7-kkeee soosssssssssooss 1351 1367 923 672761 TTCTTGTTCACCCTCAG eeekk-d7-kkeee soosssssssssooss 1352 1368 924 672762 TTTCTTGTTCACCCTCA eeekk-d7-kkeee soosssssssssooss 1353 1369 925 672763 TTTTCTTGTTCACCCTC eeekk-d7-kkeee soosssssssssooss 1354 1370 926 672764 CTTTTCTTGTTCACCCT eeekk-d7-kkeee soosssssssssooss 1355 1371 927 672765 TCTTTTCTTGTTCACCC eeekk-d7-kkeee soosssssssssooss 1356 1372 928 672766 GTCTTTTCTTGTTCACC eeekk-d7-kkeee soosssssssssooss 1357 1373 929 672767 GGTCTTTTCTTGTTCAC eeekk-d7-kkeee soosssssssssooss 1358 1374 930 672768 AGGTCTTTTCTTGTTCA eeekk-d7-kkeee soosssssssssooss 1359 1375 931 672769 CAGGTCTTTTCTTGTTC eeekk-d7-kkeee soosssssssssooss 1360 1376 932 672770 TCAGGTCTTTTCTTGTT eeekk-d7-kkeee soosssssssssooss 1361 1377 933 672771 ATCAGGTCTTTTCTTGT eeekk-d7-kkeee soosssssssssooss 1362 1378 934 672772 TATCAGGTCTTTTCTTG eeekk-d7-kkeee soosssssssssooss 1363 1379 935 672773 TTATCAGGTCTTTTCTT eeekk-d7-kkeee soosssssssssooss 1364 1380 936 672774 ATCTTTATCAGGTCTTT eeekk-d7-kkeee soosssssssssooss 1368 1384 937 672775 AATCTTTATCAGGTCTT eeekk-d7-kkeee soosssssssssooss 1369 1385 938 672776 TAATCTTTATCAGGTCT eeekk-d7-kkeee soosssssssssooss 1370 1386 939 672777 TTAATCTTTATCAGGTC eeekk-d7-kkeee soosssssssssooss 1371 1387 940 672778 GTTAATCTTTATCAGGT eeekk-d7-kkeee soosssssssssooss 1372 1388 941 672779 GGTTAATCTTTATCAGG eeekk-d7-kkeee soosssssssssooss 1373 1389 942 672780 TGGTTAATCTTTATCAG eeekk-d7-kkeee soosssssssssooss 1374 1390 943 672781 CTGGTTAATCTTTATCA eeekk-d7-kkeee soosssssssssooss 1375 1391 944 672782 TCTGGTTAATCTTTATC eeekk-d7-kkeee soosssssssssooss 1376 1392 945 672783 CCCTCCTTGTTTTCTTC eeekk-d7-kkeee soosssssssssooss 1391 1407 946 672784 TCCCTCCTTGTTTTCTT eeekk-d7-kkeee soosssssssssooss 1392 1408 947 672785 TTCCCTCCTTGTTTTCT eeekk-d7-kkeee soosssssssssooss 1393 1409 948 672786 TTTCCCTCCTTGTTTTC eeekk-d7-kkeee soosssssssssooss 1394 1410 949 672787 GTTTCCCTCCTTGTTTT eeekk-d7-kkeee soosssssssssooss 1395 1411 950 672788 TGTTTCCCTCCTTGTTT eeekk-d7-kkeee soosssssssssooss 1396 1412 951 672789 TTGTTTCCCTCCTTGTT eeekk-d7-kkeee soosssssssssooss 1397 1413 952 672790 GGTTGTTTCCCTCCTTG eeekk-d7-kkeee soosssssssssooss 1399 1415 953 672791 CGGTTGTTTCCCTCCTT eeekk-d7-kkeee soosssssssssooss 1400 1416 954 672792 GCGGTTGTTTCCCTCCT eeekk-d7-kkeee soosssssssssooss 1401 1417 955 672793 TGCGGTTGTTTCCCTCC eeekk-d7-kkeee soosssssssssooss 1402 1418 956 672794 CTGCGGTTGTTTCCCTC eeekk-d7-kkeee soosssssssssooss 1403 1419 957 672795 GCTGCGGTTGTTTCCCT eeekk-d7-kkeee soosssssssssooss 1404 1420 958 672796 GGCTGCGGTTGTTTCCC eeekk-d7-kkeee soosssssssssooss 1405 1421 959 672797 AGGCTGCGGTTGTTTCC eeekk-d7-kkeee soosssssssssooss 1406 1422 960 672798 CAGGCTGCGGTTGTTTC eeekk-d7-kkeee soosssssssssooss 1407 1423 961 672799 ACAGGCTGCGGTTGTTT eeekk-d7-kkeee soosssssssssooss 1408 1424 962 672800 TACAGGCTGCGGTTGTT eeekk-d7-kkeee soosssssssssooss 1409 1425 963 672801 CTACAGGCTGCGGTTGT eeekk-d7-kkeee soosssssssssooss 1410 1426 964 672802 GCTACAGGCTGCGGTTG eeekk-d7-kkeee soosssssssssooss 1411 1427 965 672803 TGCTACAGGCTGCGGTT eeekk-d7-kkeee soosssssssssooss 1412 1428 966 672804 TTGCTACAGGCTGCGGT eeekk-d7-kkeee soosssssssssooss 1413 1429 967 672805 CTTGCTACAGGCTGCGG eeekk-d7-kkeee soosssssssssooss 1414 1430 968 672806 GCTTGCTACAGGCTGCG eeekk-d7-kkeee soosssssssssooss 1415 1431 969 672807 AGCTTGCTACAGGCTGC eeekk-d7-kkeee soosssssssssooss 1416 1432 970 672808 GAGCTTGCTACAGGCTG eeekk-d7-kkeee soosssssssssooss 1417 1433 971 672809 AGAGCTTGCTACAGGCT eeekk-d7-kkeee soosssssssssooss 1418 1434 972 672810 CAGAGCTTGCTACAGGC eeekk-d7-kkeee soosssssssssooss 1419 1435 973 672811 CCAGAGCTTGCTACAGG eeekk-d7-kkeee soosssssssssooss 1420 1436 974 672812 TCCAGAGCTTGCTACAG eeekk-d7-kkeee soosssssssssooss 1421 1437 975 672813 TTCCAGAGCTTGCTACA eeekk-d7-kkeee soosssssssssooss 1422 1438 976 672814 GTTCCAGAGCTTGCTAC eeekk-d7-kkeee soosssssssssooss 1423 1439 977 672815 AGTTCCAGAGCTTGCTA eeekk-d7-kkeee soosssssssssooss 1424 1440 978 672816 GAGTTCCAGAGCTTGCT eeekk-d7-kkeee soosssssssssooss 1425 1441 979 672817 TGAGTTCCAGAGCTTGC eeekk-d7-kkeee soosssssssssooss 1426 1442 980 672818 CTGAGTTCCAGAGCTTG eeekk-d7-kkeee soosssssssssooss 1427 1443 981 672819 CCTGAGTTCCAGAGCTT eeekk-d7-kkeee soosssssssssooss 1428 1444 982 672820 TCCTGAGTTCCAGAGCT eeekk-d7-kkeee soosssssssssooss 1429 1445 983 672821 CTCCTGAGTTCCAGAGC eeekk-d7-kkeee soosssssssssooss 1430 1446 984 672822 ACTCCTGAGTTCCAGAG eeekk-d7-kkeee soosssssssssooss 1431 1447 985 672823 GACTCCTGAGTTCCAGA eeekk-d7-kkeee soosssssssssooss 1432 1448 986 672824 CGACTCCTGAGTTCCAG eeekk-d7-kkeee soosssssssssooss 1433 1449 987 672825 GCGACTCCTGAGTTCCA eeekk-d7-kkeee soosssssssssooss 1434 1450 988 672826 CGCGACTCCTGAGTTCC eeekk-d7-kkeee soosssssssssooss 1435 1451 989 672827 GCGCGACTCCTGAGTTC eeekk-d7-kkeee soosssssssssooss 1436 1452 990 672828 CGCGCGACTCCTGAGTT eeekk-d7-kkeee soosssssssssooss 1437 1453 991 672829 GCGCGCGACTCCTGAGT eeekk-d7-kkeee soosssssssssooss 1438 1454 992 672830 AGCGCGCGACTCCTGAG eeekk-d7-kkeee soosssssssssooss 1439 1455 993 672831 TAGCGCGCGACTCCTGA eeekk-d7-kkeee soosssssssssooss 1440 1456 994 672832 CTAGCGCGCGACTCCTG eeekk-d7-kkeee soosssssssssooss 1441 1457 995 672833 CCTAGCGCGCGACTCCT eeekk-d7-kkeee soosssssssssooss 1442 1458 996 672834 CCCTAGCGCGCGACTCC eeekk-d7-kkeee soosssssssssooss 1443 1459 997 672835 CCCCTAGCGCGCGACTC eeekk-d7-kkeee soosssssssssooss 1444 1460 998 672836 GCCCCTAGCGCGCGACT eeekk-d7-kkeee soosssssssssooss 1445 1461 999 672837 GGCCCCTAGCGCGCGAC eeekk-d7-kkeee soosssssssssooss 1446 1462 1000 672838 CGGCCCCTAGCGCGCGA eeekk-d7-kkeee soosssssssssooss 1447 1463 1001 672839 CCGGCCCCTAGCGCGCG eeekk-d7-kkeee soosssssssssooss 1448 1464 1002 672840 CCCGGCCCCTAGCGCGC eeekk-d7-kkeee soosssssssssooss 1449 1465 1003 672841 CCCCGGCCCCTAGCGCG eeekk-d7-kkeee soosssssssssooss 1450 1466 1004 672842 GCCCCGGCCCCTAGCGC eeekk-d7-kkeee soosssssssssooss 1451 1467 1005 672843 GGCCCCGGCCCCTAGCG eeekk-d7-kkeee soosssssssssooss 1452 1468 1006 672844 CGGCCCCGGCCCCTAGC eeekk-d7-kkeee soosssssssssooss 1453 1469 1007 672845 CCGGCCCCGGCCCCTAG eeekk-d7-kkeee soosssssssssooss 1454 1470 1008 672846 CCCGGCCCCGGCCCCTA eeekk-d7-kkeee soosssssssssooss 1455 1471 1009 672847 ACGCCCCGGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1465 1481 1010 672848 CACGCCCCGGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1466 1482 1011 672849 CCACGCCCCGGCCCCGG eeekk-d7-kkeee soosssssssssooss 1467 1483 1012 672850 ACCACGCCCCGGCCCCG eeekk-d7-kkeee soosssssssssooss 1468 1484 1013 672851 GACCACGCCCCGGCCCC eeekk-d7-kkeee soosssssssssooss 1469 1485 1014 672852 CGACCACGCCCCGGCCC eeekk-d7-kkeee soosssssssssooss 1470 1486 1015 672853 CCGACCACGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1471 1487 1016 672854 CCCGACCACGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1472 1488 1017 672855 CCCCGACCACGCCCCGG eeekk-d7-kkeee soosssssssssooss 1473 1489 1018 672856 GCCCCGACCACGCCCCG eeekk-d7-kkeee soosssssssssooss 1474 1490 1019 672857 CGCCCCGACCACGCCCC eeekk-d7-kkeee soosssssssssooss 1475 1491 1020 672858 CCGCCCCGACCACGCCC eeekk-d7-kkeee soosssssssssooss 1476 1492 1021 672859 CCCGCCCCGACCACGCC eeekk-d7-kkeee soosssssssssooss 1477 1493 1022 672860 GCCCGCCCCGACCACGC eeekk-d7-kkeee soosssssssssooss 1478 1494 1023 672861 GGCCCGCCCCGACCACG eeekk-d7-kkeee soosssssssssooss 1479 1495 1024 672862 GGGCCCGCCCCGACCAC eeekk-d7-kkeee soosssssssssooss 1480 1496 1025 672863 CGGGCCCGCCCCGACCA eeekk-d7-kkeee soosssssssssooss 1481 1497 1026 672864 CCGGGCCCGCCCCGACC eeekk-d7-kkeee soosssssssssooss 1482 1498 1027 672865 CCCGGGCCCGCCCCGAC eeekk-d7-kkeee soosssssssssooss 1483 1499 1028 672866 GCAGCCCCGCCCCGGGC eeekk-d7-kkeee soosssssssssooss 1505 1521 1029 672867 CGCAGCCCCGCCCCGGG eeekk-d7-kkeee soosssssssssooss 1506 1522 1030 672868 CCGCAGCCCCGCCCCGG eeekk-d7-kkeee soosssssssssooss 1507 1523 1031 672869 ACCGCAGCCCCGCCCCG eeekk-d7-kkeee soosssssssssooss 1508 1524 1032 672870 AACCGCAGCCCCGCCCC eeekk-d7-kkeee soosssssssssooss 1509 1525 1033 672871 CAACCGCAGCCCCGCCC eeekk-d7-kkeee soosssssssssooss 1510 1526 1034 672872 GCAACCGCAGCCCCGCC eeekk-d7-kkeee soosssssssssooss 1511 1527 1035 672873 CGCAACCGCAGCCCCGC eeekk-d7-kkeee soosssssssssooss 1512 1528 1036 672874 CCGCAACCGCAGCCCCG eeekk-d7-kkeee soosssssssssooss 1513 1529 1037 672875 ACCGCAACCGCAGCCCC eeekk-d7-kkeee soosssssssssooss 1514 1530 1038 672876 CACCGCAACCGCAGCCC eeekk-d7-kkeee soosssssssssooss 1515 1531 1039 672877 GCACCGCAACCGCAGCC eeekk-d7-kkeee soosssssssssooss 1516 1532 1040 672878 GGCACCGCAACCGCAGC eeekk-d7-kkeee soosssssssssooss 1517 1533 1041 672879 AGGCACCGCAACCGCAG eeekk-d7-kkeee soosssssssssooss 1518 1534 1042 672880 CAGGCACCGCAACCGCA eeekk-d7-kkeee soosssssssssooss 1519 1535 1043 672881 GCAGGCACCGCAACCGC eeekk-d7-kkeee soosssssssssooss 1520 1536 1044 672882 CGCAGGCACCGCAACCG eeekk-d7-kkeee soosssssssssooss 1521 1537 1045 672883 GCGCAGGCACCGCAACC eeekk-d7-kkeee soosssssssssooss 1522 1538 1046 672884 GGCGCAGGCACCGCAAC eeekk-d7-kkeee soosssssssssooss 1523 1539 1047
(522) TABLE-US-00025 TABLE 25 Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: NO: 2 SEQ ISIS 2 Start Stop ID NO Sequence Chemistry Linkage Site Site NO 672885 TGAGAGCAAGTAGTGGG eekk-d8-kkeee soosssssssssooss 1326 1342 898 672886 GTGAGAGCAAGTAGTGG eekk-d8-kkeee soosssssssssooss 1327 1343 899 672887 TGTGAGAGCAAGTAGTG eekk-d8-kkeee soosssssssssooss 1328 1344 900 672888 CTGTGAGAGCAAGTAGT eekk-d8-kkeee soosssssssssooss 1329 1345 901 672889 ACTGTGAGAGCAAGTAG eekk-d8-kkeee soosssssssssooss 1330 1346 902 672890 TACTGTGAGAGCAAGTA eekk-d8-kkeee soosssssssssooss 1331 1347 903 672891 GTACTGTGAGAGCAAGT eekk-d8-kkeee soosssssssssooss 1332 1348 904 672892 AGTACTGTGAGAGCAAG eekk-d8-kkeee soosssssssssooss 1333 1349 905 672893 GAGTACTGTGAGAGCAA eekk-d8-kkeee soosssssssssooss 1334 1350 906 672894 CGAGTACTGTGAGAGCA eekk-d8-kkeee soosssssssssooss 1335 1351 907 672895 GCGAGTACTGTGAGAGC eekk-d8-kkeee soosssssssssooss 1336 1352 908 672896 AGCGAGTACTGTGAGAG eekk-d8-kkeee soosssssssssooss 1337 1353 909 672897 CAGCGAGTACTGTGAGA eekk-d8-kkeee soosssssssssooss 1338 1354 910 672898 TCAGCGAGTACTGTGAG eekk-d8-kkeee soosssssssssooss 1339 1355 911 672899 CTCAGCGAGTACTGTGA eekk-d8-kkeee soosssssssssooss 1340 1356 912 672900 CCTCAGCGAGTACTGTG eekk-d8-kkeee soosssssssssooss 1341 1357 913 672901 CCCTCAGCGAGTACTGT eekk-d8-kkeee soosssssssssooss 1342 1358 914 672902 ACCCTCAGCGAGTACTG eekk-d8-kkeee soosssssssssooss 1343 1359 915 672903 CACCCTCAGCGAGTACT eekk-d8-kkeee soosssssssssooss 1344 1360 916 672904 TCACCCTCAGCGAGTAC eekk-d8-kkeee soosssssssssooss 1345 1361 917 672905 TTCACCCTCAGCGAGTA eekk-d8-kkeee soosssssssssooss 1346 1362 918 672906 GTTCACCCTCAGCGAGT eekk-d8-kkeee soosssssssssooss 1347 1363 919 672907 TGTTCACCCTCAGCGAG eekk-d8-kkeee soosssssssssooss 1348 1364 920 672908 TTGTTCACCCTCAGCGA eekk-d8-kkeee soosssssssssooss 1349 1365 921 672909 CTTGTTCACCCTCAGCG eekk-d8-kkeee soosssssssssooss 1350 1366 922 672910 TCTTGTTCACCCTCAGC eekk-d8-kkeee soosssssssssooss 1351 1367 923 672911 TTCTTGTTCACCCTCAG eekk-d8-kkeee soosssssssssooss 1352 1368 924 672912 TTTCTTGTTCACCCTCA eekk-d8-kkeee soosssssssssooss 1353 1369 925 672913 TTTTCTTGTTCACCCTC eekk-d8-kkeee soosssssssssooss 1354 1370 926 672914 CTTTTCTTGTTCACCCT eekk-d8-kkeee soosssssssssooss 1355 1371 927 672915 TCTTTTCTTGTTCACCC eekk-d8-kkeee soosssssssssooss 1356 1372 928 672916 GTCTTTTCTTGTTCACC eekk-d8-kkeee soosssssssssooss 1357 1373 929 672917 GGTCTTTTCTTGTTCAC eekk-d8-kkeee soosssssssssooss 1358 1374 930 672918 AGGTCTTTTCTTGTTCA eekk-d8-kkeee soosssssssssooss 1359 1375 931 672919 CAGGTCTTTTCTTGTTC eekk-d8-kkeee soosssssssssooss 1360 1376 932 672920 TCAGGTCTTTTCTTGTT eekk-d8-kkeee soosssssssssooss 1361 1377 933 672921 ATCAGGTCTTTTCTTGT eekk-d8-kkeee soosssssssssooss 1362 1378 934 672922 TATCAGGTCTTTTCTTG eekk-d8-kkeee soosssssssssooss 1363 1379 935 672923 TTATCAGGTCTTTTCTT eekk-d8-kkeee soosssssssssooss 1364 1380 936 672924 ATCTTTATCAGGTCTTT eekk-d8-kkeee soosssssssssooss 1368 1384 937 672925 AATCTTTATCAGGTCTT eekk-d8-kkeee soosssssssssooss 1369 1385 938 672926 TAATCTTTATCAGGTCT eekk-d8-kkeee soosssssssssooss 1370 1386 939 672927 TTAATCTTTATCAGGTC eekk-d8-kkeee soosssssssssooss 1371 1387 940 672928 GTTAATCTTTATCAGGT eekk-d8-kkeee soosssssssssooss 1372 1388 941 672929 GGTTAATCTTTATCAGG eekk-d8-kkeee soosssssssssooss 1373 1389 942 672930 TGGTTAATCTTTATCAG eekk-d8-kkeee soosssssssssooss 1374 1390 943 672931 CTGGTTAATCTTTATCA eekk-d8-kkeee soosssssssssooss 1375 1391 944 672932 TCTGGTTAATCTTTATC eekk-d8-kkeee soosssssssssooss 1376 1392 945 672933 CCCTCCTTGTTTTCTTC eekk-d8-kkeee soosssssssssooss 1391 1407 946 672934 TCCCTCCTTGTTTTCTT eekk-d8-kkeee soosssssssssooss 1392 1408 947 672935 TTCCCTCCTTGTTTTCT eekk-d8-kkeee soosssssssssooss 1393 1409 948 672936 TTTCCCTCCTTGTTTTC eekk-d8-kkeee soosssssssssooss 1394 1410 949 672937 GTTTCCCTCCTTGTTTT eekk-d8-kkeee soosssssssssooss 1395 1411 950 672938 TGTTTCCCTCCTTGTTT eekk-d8-kkeee soosssssssssooss 1396 1412 951 672939 TTGTTTCCCTCCTTGTT eekk-d8-kkeee soosssssssssooss 1397 1413 952 672940 GGTTGTTTCCCTCCTTG eekk-d8-kkeee soosssssssssooss 1399 1415 953 672941 CGGTTGTTTCCCTCCTT eekk-d8-kkeee soosssssssssooss 1400 1416 954 672942 GCGGTTGTTTCCCTCCT eekk-d8-kkeee soosssssssssooss 1401 1417 955 672943 TGCGGTTGTTTCCCTCC eekk-d8-kkeee soosssssssssooss 1402 1418 956 672944 CTGCGGTTGTTTCCCTC eekk-d8-kkeee soosssssssssooss 1403 1419 957 672945 GCTGCGGTTGTTTCCCT eekk-d8-kkeee soosssssssssooss 1404 1420 958 672946 GGCTGCGGTTGTTTCCC eekk-d8-kkeee soosssssssssooss 1405 1421 959 672947 AGGCTGCGGTTGTTTCC eekk-d8-kkeee soosssssssssooss 1406 1422 960 672948 CAGGCTGCGGTTGTTTC eekk-d8-kkeee soosssssssssooss 1407 1423 961 672949 ACAGGCTGCGGTTGTTT eekk-d8-kkeee soosssssssssooss 1408 1424 962 672950 TACAGGCTGCGGTTGTT eekk-d8-kkeee soosssssssssooss 1409 1425 963 672951 CTACAGGCTGCGGTTGT eekk-d8-kkeee soosssssssssooss 1410 1426 964 672952 GCTACAGGCTGCGGTTG eekk-d8-kkeee soosssssssssooss 1411 1427 965 672953 TGCTACAGGCTGCGGTT eekk-d8-kkeee soosssssssssooss 1412 1428 966 672954 TTGCTACAGGCTGCGGT eekk-d8-kkeee soosssssssssooss 1413 1429 967 672955 CTTGCTACAGGCTGCGG eekk-d8-kkeee soosssssssssooss 1414 1430 968 672956 GCTTGCTACAGGCTGCG eekk-d8-kkeee soosssssssssooss 1415 1431 969 672957 AGCTTGCTACAGGCTGC eekk-d8-kkeee soosssssssssooss 1416 1432 970 672958 GAGCTTGCTACAGGCTG eekk-d8-kkeee soosssssssssooss 1417 1433 971 672959 AGAGCTTGCTACAGGCT eekk-d8-kkeee soosssssssssooss 1418 1434 972 672960 CAGAGCTTGCTACAGGC eekk-d8-kkeee soosssssssssooss 1419 1435 973 672961 CCAGAGCTTGCTACAGG eekk-d8-kkeee soosssssssssooss 1420 1436 974 672962 TCCAGAGCTTGCTACAG eekk-d8-kkeee soosssssssssooss 1421 1437 975 672963 TTCCAGAGCTTGCTACA eekk-d8-kkeee soosssssssssooss 1422 1438 976 672964 GTTCCAGAGCTTGCTAC eekk-d8-kkeee soosssssssssooss 1423 1439 977 672965 AGTTCCAGAGCTTGCTA eekk-d8-kkeee soosssssssssooss 1424 1440 978 672966 GAGTTCCAGAGCTTGCT eekk-d8-kkeee soosssssssssooss 1425 1441 979 672967 TGAGTTCCAGAGCTTGC eekk-d8-kkeee soosssssssssooss 1426 1442 980 672968 CTGAGTTCCAGAGCTTG eekk-d8-kkeee soosssssssssooss 1427 1443 981 672969 CCTGAGTTCCAGAGCTT eekk-d8-kkeee soosssssssssooss 1428 1444 982 672970 TCCTGAGTTCCAGAGCT eekk-d8-kkeee soosssssssssooss 1429 1445 983 672971 CTCCTGAGTTCCAGAGC eekk-d8-kkeee soosssssssssooss 1430 1446 984 672972 ACTCCTGAGTTCCAGAG eekk-d8-kkeee soosssssssssooss 1431 1447 985 672973 GACTCCTGAGTTCCAGA eekk-d8-kkeee soosssssssssooss 1432 1448 986 672974 CGACTCCTGAGTTCCAG eekk-d8-kkeee soosssssssssooss 1433 1449 987 672975 GCGACTCCTGAGTTCCA eekk-d8-kkeee soosssssssssooss 1434 1450 988 672976 CGCGACTCCTGAGTTCC eekk-d8-kkeee soosssssssssooss 1435 1451 989 672977 GCGCGACTCCTGAGTTC eekk-d8-kkeee soosssssssssooss 1436 1452 990 672978 CGCGCGACTCCTGAGTT eekk-d8-kkeee soosssssssssooss 1437 1453 991 672979 GCGCGCGACTCCTGAGT eekk-d8-kkeee soosssssssssooss 1438 1454 992 672980 AGCGCGCGACTCCTGAG eekk-d8-kkeee soosssssssssooss 1439 1455 993 672981 TAGCGCGCGACTCCTGA eekk-d8-kkeee soosssssssssooss 1440 1456 994 672982 CTAGCGCGCGACTCCTG eekk-d8-kkeee soosssssssssooss 1441 1457 995 672983 CCTAGCGCGCGACTCCT eekk-d8-kkeee soosssssssssooss 1442 1458 996 672984 CCCTAGCGCGCGACTCC eekk-d8-kkeee soosssssssssooss 1443 1459 997 672985 CCCCTAGCGCGCGACTC eekk-d8-kkeee soosssssssssooss 1444 1460 998 672986 GCCCCTAGCGCGCGACT eekk-d8-kkeee soosssssssssooss 1445 1461 999 672987 GGCCCCTAGCGCGCGAC eekk-d8-kkeee soosssssssssooss 1446 1462 1000 672988 CGGCCCCTAGCGCGCGA eekk-d8-kkeee soosssssssssooss 1447 1463 1001 672989 CCGGCCCCTAGCGCGCG eekk-d8-kkeee soosssssssssooss 1448 1464 1002 672990 CCCGGCCCCTAGCGCGC eekk-d8-kkeee soosssssssssooss 1449 1465 1003 672991 CCCCGGCCCCTAGCGCG eekk-d8-kkeee soosssssssssooss 1450 1466 1004 672992 GCCCCGGCCCCTAGCGC eekk-d8-kkeee soosssssssssooss 1451 1467 1005 672993 GGCCCCGGCCCCTAGCG eekk-d8-kkeee soosssssssssooss 1452 1468 1006 672994 CGGCCCCGGCCCCTAGC eekk-d8-kkeee soosssssssssooss 1453 1469 1007 672995 CCGGCCCCGGCCCCTAG eekk-d8-kkeee soosssssssssooss 1454 1470 1008 672996 CCCGGCCCCGGCCCCTA eekk-d8-kkeee soosssssssssooss 1455 1471 1009 672997 ACGCCCCGGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1465 1481 1010 672998 CACGCCCCGGCCCCGGC eekk-d8-kkeee soosssssssssooss 1466 1482 1011 672999 CCACGCCCCGGCCCCGG eekk-d8-kkeee soosssssssssooss 1467 1483 1012 673000 ACCACGCCCCGGCCCCG eekk-d8-kkeee soosssssssssooss 1468 1484 1013 673001 GACCACGCCCCGGCCCC eekk-d8-kkeee soosssssssssooss 1469 1485 1014 673002 CGACCACGCCCCGGCCC eekk-d8-kkeee soosssssssssooss 1470 1486 1015 673003 CCGACCACGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1471 1487 1016 673004 CCCGACCACGCCCCGGC eekk-d8-kkeee soosssssssssooss 1472 1488 1017 673005 CCCCGACCACGCCCCGG eekk-d8-kkeee soosssssssssooss 1473 1489 1018 673006 GCCCCGACCACGCCCCG eekk-d8-kkeee soosssssssssooss 1474 1490 1019 673007 CGCCCCGACCACGCCCC eekk-d8-kkeee soosssssssssooss 1475 1491 1020 673008 CCGCCCCGACCACGCCC eekk-d8-kkeee soosssssssssooss 1476 1492 1021 673009 CCCGCCCCGACCACGCC eekk-d8-kkeee soosssssssssooss 1477 1493 1022 673010 GCCCGCCCCGACCACGC eekk-d8-kkeee soosssssssssooss 1478 1494 1023 673011 GGCCCGCCCCGACCACG eekk-d8-kkeee soosssssssssooss 1479 1495 1024 673012 GGGCCCGCCCCGACCAC eekk-d8-kkeee soosssssssssooss 1480 1496 1025 673013 CGGGCCCGCCCCGACCA eekk-d8-kkeee soosssssssssooss 1481 1497 1026 673014 CCGGGCCCGCCCCGACC eekk-d8-kkeee soosssssssssooss 1482 1498 1027 673015 CCCGGGCCCGCCCCGAC eekk-d8-kkeee soosssssssssooss 1483 1499 1028 673016 GCAGCCCCGCCCCGGGC eekk-d8-kkeee soosssssssssooss 1505 1521 1029 673017 CGCAGCCCCGCCCCGGG eekk-d8-kkeee soosssssssssooss 1506 1522 1030 673018 CCGCAGCCCCGCCCCGG eekk-d8-kkeee soosssssssssooss 1507 1523 1031 673019 ACCGCAGCCCCGCCCCG eekk-d8-kkeee soosssssssssooss 1508 1524 1032 673020 AACCGCAGCCCCGCCCC eekk-d8-kkeee soosssssssssooss 1509 1525 1033 673021 CAACCGCAGCCCCGCCC eekk-d8-kkeee soosssssssssooss 1510 1526 1034 673022 GCAACCGCAGCCCCGCC eekk-d8-kkeee soosssssssssooss 1511 1527 1035 673023 CGCAACCGCAGCCCCGC eekk-d8-kkeee soosssssssssooss 1512 1528 1036 673024 CCGCAACCGCAGCCCCG eekk-d8-kkeee soosssssssssooss 1513 1529 1037 673025 ACCGCAACCGCAGCCCC eekk-d8-kkeee soosssssssssooss 1514 1530 1038 673026 CACCGCAACCGCAGCCC eekk-d8-kkeee soosssssssssooss 1515 1531 1039 673027 GCACCGCAACCGCAGCC eekk-d8-kkeee soosssssssssooss 1516 1532 1040 673028 GGCACCGCAACCGCAGC eekk-d8-kkeee soosssssssssooss 1517 1533 1041 673029 AGGCACCGCAACCGCAG eekk-d8-kkeee soosssssssssooss 1518 1534 1042 673030 CAGGCACCGCAACCGCA eekk-d8-kkeee soosssssssssooss 1519 1535 1043 673031 GCAGGCACCGCAACCGC eekk-d8-kkeee soosssssssssooss 1520 1536 1044 673032 CGCAGGCACCGCAACCG eekk-d8-kkeee soosssssssssooss 1521 1537 1045 673033 GCGCAGGCACCGCAACC eekk-d8-kkeee soosssssssssooss 1522 1538 1046 673034 GGCGCAGGCACCGCAAC eekk-d8-kkeee soosssssssssooss 1523 1539 1047
(523) TABLE-US-00026 TABLE 26 Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop ID NO Sequence Chemistry Linkage Site Site NO 673035 TGAGAGCAAGTAGTGGG ek-d8-ekekeee sosssssssssoooss 1326 1342 898 673036 GTGAGAGCAAGTAGTGG ek-d8-ekekeee sosssssssssoooss 1327 1343 899 673037 TGTGAGAGCAAGTAGTG ek-d8-ekekeee sosssssssssoooss 1328 1344 900 673038 CTGTGAGAGCAAGTAGT ek-d8-ekekeee sosssssssssoooss 1329 1345 901 673039 ACTGTGAGAGCAAGTAG ek-d8-ekekeee sosssssssssoooss 1330 1346 902 673040 TACTGTGAGAGCAAGTA ek-d8-ekekeee sosssssssssoooss 1331 1347 903 673041 GTACTGTGAGAGCAAGT ek-d8-ekekeee sosssssssssoooss 1332 1348 904 673042 AGTACTGTGAGAGCAAG ek-d8-ekekeee sosssssssssoooss 1333 1349 905 673043 GAGTACTGTGAGAGCAA ek-d8-ekekeee sosssssssssoooss 1334 1350 906 673044 CGAGTACTGTGAGAGCA ek-d8-ekekeee sosssssssssoooss 1335 1351 907 673045 GCGAGTACTGTGAGAGC ek-d8-ekekeee sosssssssssoooss 1336 1352 908 673046 AGCGAGTACTGTGAGAG ek-d8-ekekeee sosssssssssoooss 1337 1353 909 673047 CAGCGAGTACTGTGAGA ek-d8-ekekeee sosssssssssoooss 1338 1354 910 673048 TCAGCGAGTACTGTGAG ek-d8-ekekeee sosssssssssoooss 1339 1355 911 673049 CTCAGCGAGTACTGTGA ek-d8-ekekeee sosssssssssoooss 1340 1356 912 673050 CCTCAGCGAGTACTGTG ek-d8-ekekeee sosssssssssoooss 1341 1357 913 673051 CCCTCAGCGAGTACTGT ek-d8-ekekeee sosssssssssoooss 1342 1358 914 673052 ACCCTCAGCGAGTACTG ek-d8-ekekeee sosssssssssoooss 1343 1359 915 673053 CACCCTCAGCGAGTACT ek-d8-ekekeee sosssssssssoooss 1344 1360 916 673054 TCACCCTCAGCGAGTAC ek-d8-ekekeee sosssssssssoooss 1345 1361 917 673055 TTCACCCTCAGCGAGTA ek-d8-ekekeee sosssssssssoooss 1346 1362 918 673056 GTTCACCCTCAGCGAGT ek-d8-ekekeee sosssssssssoooss 1347 1363 919 673057 TGTTCACCCTCAGCGAG ek-d8-ekekeee sosssssssssoooss 1348 1364 920 673058 TTGTTCACCCTCAGCGA ek-d8-ekekeee sosssssssssoooss 1349 1365 921 673059 CTTGTTCACCCTCAGCG ek-d8-ekekeee sosssssssssoooss 1350 1366 922 673060 TCTTGTTCACCCTCAGC ek-d8-ekekeee sosssssssssoooss 1351 1367 923 673061 TTCTTGTTCACCCTCAG ek-d8-ekekeee sosssssssssoooss 1352 1368 924 673062 TTTCTTGTTCACCCTCA ek-d8-ekekeee sosssssssssoooss 1353 1369 925 673063 TTTTCTTGTTCACCCTC ek-d8-ekekeee sosssssssssoooss 1354 1370 926 673064 CTTTTCTTGTTCACCCT ek-d8-ekekeee sosssssssssoooss 1355 1371 927 673065 TCTTTTCTTGTTCACCC ek-d8-ekekeee sosssssssssoooss 1356 1372 928 673066 GTCTTTTCTTGTTCACC ek-d8-ekekeee sosssssssssoooss 1357 1373 929 673067 GGTCTTTTCTTGTTCAC ek-d8-ekekeee sosssssssssoooss 1358 1374 930 673068 AGGTCTTTTCTTGTTCA ek-d8-ekekeee sosssssssssoooss 1359 1375 931 673069 CAGGTCTTTTCTTGTTC ek-d8-ekekeee sosssssssssoooss 1360 1376 932 673070 TCAGGTCTTTTCTTGTT ek-d8-ekekeee sosssssssssoooss 1361 1377 933 673071 ATCAGGTCTTTTCTTGT ek-d8-ekekeee sosssssssssoooss 1362 1378 934 673072 TATCAGGTCTTTTCTTG ek-d8-ekekeee sosssssssssoooss 1363 1379 935 673073 TTATCAGGTCTTTTCTT ek-d8-ekekeee sosssssssssoooss 1364 1380 936 673074 ATCTTTATCAGGTCTTT ek-d8-ekekeee sosssssssssoooss 1368 1384 937 673075 AATCTTTATCAGGTCTT ek-d8-ekekeee sosssssssssoooss 1369 1385 938 673076 TAATCTTTATCAGGTCT ek-d8-ekekeee sosssssssssoooss 1370 1386 939 673077 TTAATCTTTATCAGGTC ek-d8-ekekeee sosssssssssoooss 1371 1387 940 673078 GTTAATCTTTATCAGGT ek-d8-ekekeee sosssssssssoooss 1372 1388 941 673079 GGTTAATCTTTATCAGG ek-d8-ekekeee sosssssssssoooss 1373 1389 942 673080 TGGTTAATCTTTATCAG ek-d8-ekekeee sosssssssssoooss 1374 1390 943 673081 CTGGTTAATCTTTATCA ek-d8-ekekeee sosssssssssoooss 1375 1391 944 673082 TCTGGTTAATCTTTATC ek-d8-ekekeee sosssssssssoooss 1376 1392 945 673083 CCCTCCTTGTTTTCTTC ek-d8-ekekeee sosssssssssoooss 1391 1407 946 673084 TCCCTCCTTGTTTTCTT ek-d8-ekekeee sosssssssssoooss 1392 1408 947 673085 TTCCCTCCTTGTTTTCT ek-d8-ekekeee sosssssssssoooss 1393 1409 948 673086 TTTCCCTCCTTGTTTTC ek-d8-ekekeee sosssssssssoooss 1394 1410 949 673087 GTTTCCCTCCTTGTTTT ek-d8-ekekeee sosssssssssoooss 1395 1411 950 673088 TGTTTCCCTCCTTGTTT ek-d8-ekekeee sosssssssssoooss 1396 1412 951 673089 TTGTTTCCCTCCTTGTT ek-d8-ekekeee sosssssssssoooss 1397 1413 952 673090 GGTTGTTTCCCTCCTTG ek-d8-ekekeee sosssssssssoooss 1399 1415 953 673091 CGGTTGTTTCCCTCCTT ek-d8-ekekeee sosssssssssoooss 1400 1416 954 673092 GCGGTTGTTTCCCTCCT ek-d8-ekekeee sosssssssssoooss 1401 1417 955 673093 TGCGGTTGTTTCCCTCC ek-d8-ekekeee sosssssssssoooss 1402 1418 956 673094 CTGCGGTTGTTTCCCTC ek-d8-ekekeee sosssssssssoooss 1403 1419 957 673095 GCTGCGGTTGTTTCCCT ek-d8-ekekeee sosssssssssoooss 1404 1420 958 673096 GGCTGCGGTTGTTTCCC ek-d8-ekekeee sosssssssssoooss 1405 1421 959 673097 AGGCTGCGGTTGTTTCC ek-d8-ekekeee sosssssssssoooss 1406 1422 960 673098 CAGGCTGCGGTTGTTTC ek-d8-ekekeee sosssssssssoooss 1407 1423 961 673099 ACAGGCTGCGGTTGTTT ek-d8-ekekeee sosssssssssoooss 1408 1424 962 673100 TACAGGCTGCGGTTGTT ek-d8-ekekeee sosssssssssoooss 1409 1425 963 673101 CTACAGGCTGCGGTTGT ek-d8-ekekeee sosssssssssoooss 1410 1426 964 673102 GCTACAGGCTGCGGTTG ek-d8-ekekeee sosssssssssoooss 1411 1427 965 673103 TGCTACAGGCTGCGGTT ek-d8-ekekeee sosssssssssoooss 1412 1428 966 673104 TTGCTACAGGCTGCGGT ek-d8-ekekeee sosssssssssoooss 1413 1429 967 673105 CTTGCTACAGGCTGCGG ek-d8-ekekeee sosssssssssoooss 1414 1430 968 673106 GCTTGCTACAGGCTGCG ek-d8-ekekeee sosssssssssoooss 1415 1431 969 673107 AGCTTGCTACAGGCTGC ek-d8-ekekeee sosssssssssoooss 1416 1432 970 673108 GAGCTTGCTACAGGCTG ek-d8-ekekeee sosssssssssoooss 1417 1433 971 673109 AGAGCTTGCTACAGGCT ek-d8-ekekeee sosssssssssoooss 1418 1434 972 673110 CAGAGCTTGCTACAGGC ek-d8-ekekeee sosssssssssoooss 1419 1435 973 673111 CCAGAGCTTGCTACAGG ek-d8-ekekeee sosssssssssoooss 1420 1436 974 673112 TCCAGAGCTTGCTACAG ek-d8-ekekeee sosssssssssoooss 1421 1437 975 673113 TTCCAGAGCTTGCTACA ek-d8-ekekeee sosssssssssoooss 1422 1438 976 673114 GTTCCAGAGCTTGCTAC ek-d8-ekekeee sosssssssssoooss 1423 1439 977 673115 AGTTCCAGAGCTTGCTA ek-d8-ekekeee sosssssssssoooss 1424 1440 978 673116 GAGTTCCAGAGCTTGCT ek-d8-ekekeee sosssssssssoooss 1425 1441 979 673117 TGAGTTCCAGAGCTTGC ek-d8-ekekeee sosssssssssoooss 1426 1442 980 673118 CTGAGTTCCAGAGCTTG ek-d8-ekekeee sosssssssssoooss 1427 1443 981 673119 CCTGAGTTCCAGAGCTT ek-d8-ekekeee sosssssssssoooss 1428 1444 982 673120 TCCTGAGTTCCAGAGCT ek-d8-ekekeee sosssssssssoooss 1429 1445 983 673121 CTCCTGAGTTCCAGAGC ek-d8-ekekeee sosssssssssoooss 1430 1446 984 673122 ACTCCTGAGTTCCAGAG ek-d8-ekekeee sosssssssssoooss 1431 1447 985 673123 GACTCCTGAGTTCCAGA ek-d8-ekekeee sosssssssssoooss 1432 1448 986 673124 CGACTCCTGAGTTCCAG ek-d8-ekekeee sosssssssssoooss 1433 1449 987 673125 GCGACTCCTGAGTTCCA ek-d8-ekekeee sosssssssssoooss 1434 1450 988 673126 CGCGACTCCTGAGTTCC ek-d8-ekekeee sosssssssssoooss 1435 1451 989 673127 GCGCGACTCCTGAGTTC ek-d8-ekekeee sosssssssssoooss 1436 1452 990 673128 CGCGCGACTCCTGAGTT ek-d8-ekekeee sosssssssssoooss 1437 1453 991 673129 GCGCGCGACTCCTGAGT ek-d8-ekekeee sosssssssssoooss 1438 1454 992 673130 AGCGCGCGACTCCTGAG ek-d8-ekekeee sosssssssssoooss 1439 1455 993 673131 TAGCGCGCGACTCCTGA ek-d8-ekekeee sosssssssssoooss 1440 1456 994 673132 CTAGCGCGCGACTCCTG ek-d8-ekekeee sosssssssssoooss 1441 1457 995 673133 CCTAGCGCGCGACTCCT ek-d8-ekekeee sosssssssssoooss 1442 1458 996 673134 CCCTAGCGCGCGACTCC ek-d8-ekekeee sosssssssssoooss 1443 1459 997 673135 CCCCTAGCGCGCGACTC ek-d8-ekekeee sosssssssssoooss 1444 1460 998 673136 GCCCCTAGCGCGCGACT ek-d8-ekekeee sosssssssssoooss 1445 1461 999 673137 GGCCCCTAGCGCGCGAC ek-d8-ekekeee sosssssssssoooss 1446 1462 1000 673138 CGGCCCCTAGCGCGCGA ek-d8-ekekeee sosssssssssoooss 1447 1463 1001 673139 CCGGCCCCTAGCGCGCG ek-d8-ekekeee sosssssssssoooss 1448 1464 1002 673140 CCCGGCCCCTAGCGCGC ek-d8-ekekeee sosssssssssoooss 1449 1465 1003 673141 CCCCGGCCCCTAGCGCG ek-d8-ekekeee sosssssssssoooss 1450 1466 1004 673142 GCCCCGGCCCCTAGCGC ek-d8-ekekeee sosssssssssoooss 1451 1467 1005 673143 GGCCCCGGCCCCTAGCG ek-d8-ekekeee sosssssssssoooss 1452 1468 1006 673144 CGGCCCCGGCCCCTAGC ek-d8-ekekeee sosssssssssoooss 1453 1469 1007 673145 CCGGCCCCGGCCCCTAG ek-d8-ekekeee sosssssssssoooss 1454 1470 1008 673146 CCCGGCCCCGGCCCCTA ek-d8-ekekeee sosssssssssoooss 1455 1471 1009 673147 ACGCCCCGGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1465 1481 1010 673148 CACGCCCCGGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1466 1482 1011 673149 CCACGCCCCGGCCCCGG ek-d8-ekekeee sosssssssssoooss 1467 1483 1012 673150 ACCACGCCCCGGCCCCG ek-d8-ekekeee sosssssssssoooss 1468 1484 1013 673151 GACCACGCCCCGGCCCC ek-d8-ekekeee sosssssssssoooss 1469 1485 1014 673152 CGACCACGCCCCGGCCC ek-d8-ekekeee sosssssssssoooss 1470 1486 1015 673153 CCGACCACGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1471 1487 1016 673154 CCCGACCACGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1472 1488 1017 673155 CCCCGACCACGCCCCGG ek-d8-ekekeee sosssssssssoooss 1473 1489 1018 673156 GCCCCGACCACGCCCCG ek-d8-ekekeee sosssssssssoooss 1474 1490 1019 673157 CGCCCCGACCACGCCCC ek-d8-ekekeee sosssssssssoooss 1475 1491 1020 673158 CCGCCCCGACCACGCCC ek-d8-ekekeee sosssssssssoooss 1476 1492 1021 673159 CCCGCCCCGACCACGCC ek-d8-ekekeee sosssssssssoooss 1477 1493 1022 673160 GCCCGCCCCGACCACGC ek-d8-ekekeee sosssssssssoooss 1478 1494 1023 673161 GGCCCGCCCCGACCACG ek-d8-ekekeee sosssssssssoooss 1479 1495 1024 673162 GGGCCCGCCCCGACCAC ek-d8-ekekeee sosssssssssoooss 1480 1496 1025 673163 CGGGCCCGCCCCGACCA ek-d8-ekekeee sosssssssssoooss 1481 1497 1026 673164 CCGGGCCCGCCCCGACC ek-d8-ekekeee sosssssssssoooss 1482 1498 1027 673165 CCCGGGCCCGCCCCGAC ek-d8-ekekeee sosssssssssoooss 1483 1499 1028 673166 GCAGCCCCGCCCCGGGC ek-d8-ekekeee sosssssssssoooss 1505 1521 1029 673167 CGCAGCCCCGCCCCGGG ek-d8-ekekeee sosssssssssoooss 1506 1522 1030 673168 CCGCAGCCCCGCCCCGG ek-d8-ekekeee sosssssssssoooss 1507 1523 1031 673169 ACCGCAGCCCCGCCCCG ek-d8-ekekeee sosssssssssoooss 1508 1524 1032 673170 AACCGCAGCCCCGCCCC ek-d8-ekekeee sosssssssssoooss 1509 1525 1033 673171 CAACCGCAGCCCCGCCC ek-d8-ekekeee sosssssssssoooss 1510 1526 1034 673172 GCAACCGCAGCCCCGCC ek-d8-ekekeee sosssssssssoooss 1511 1527 1035 673173 CGCAACCGCAGCCCCGC ek-d8-ekekeee sosssssssssoooss 1512 1528 1036 673174 CCGCAACCGCAGCCCCG ek-d8-ekekeee sosssssssssoooss 1513 1529 1037 673175 ACCGCAACCGCAGCCCC ek-d8-ekekeee sosssssssssoooss 1514 1530 1038 673176 CACCGCAACCGCAGCCC ek-d8-ekekeee sosssssssssoooss 1515 1531 1039 673177 GCACCGCAACCGCAGCC ek-d8-ekekeee sosssssssssoooss 1516 1532 1040 673178 GGCACCGCAACCGCAGC ek-d8-ekekeee sosssssssssoooss 1517 1533 1041 673179 AGGCACCGCAACCGCAG ek-d8-ekekeee sosssssssssoooss 1518 1534 1042 673180 CAGGCACCGCAACCGCA ek-d8-ekekeee sosssssssssoooss 1519 1535 1043 673181 GCAGGCACCGCAACCGC ek-d8-ekekeee sosssssssssoooss 1520 1536 1044 673182 CGCAGGCACCGCAACCG ek-d8-ekekeee sosssssssssoooss 1521 1537 1045 673183 GCGCAGGCACCGCAACC ek-d8-ekekeee sosssssssssoooss 1522 1538 1046 673184 GGCGCAGGCACCGCAAC ek-d8-ekekeee sosssssssssoooss 1523 1539 1047
(524) TABLE-US-00027 TABLE 27 Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop ID NO Sequence Chemistry Linkage Site Site NO 673185 TGAGAGCAAGTAGTGGG keke-d8-ekeke soosssssssssooss 1326 1342 898 673186 GTGAGAGCAAGTAGTGG keke-d8-ekeke soosssssssssooss 1327 1343 899 673187 TGTGAGAGCAAGTAGTG keke-d8-ekeke soosssssssssooss 1328 1344 900 673188 CTGTGAGAGCAAGTAGT keke-d8-ekeke soosssssssssooss 1329 1345 901 673189 ACTGTGAGAGCAAGTAG keke-d8-ekeke soosssssssssooss 1330 1346 902 673190 TACTGTGAGAGCAAGTA keke-d8-ekeke soosssssssssooss 1331 1347 903 673191 GTACTGTGAGAGCAAGT keke-d8-ekeke soosssssssssooss 1332 1348 904 673192 AGTACTGTGAGAGCAAG keke-d8-ekeke soosssssssssooss 1333 1349 905 673193 GAGTACTGTGAGAGCAA keke-d8-ekeke soosssssssssooss 1334 1350 906 673194 CGAGTACTGTGAGAGCA keke-d8-ekeke soosssssssssooss 1335 1351 907 673195 GCGAGTACTGTGAGAGC keke-d8-ekeke soosssssssssooss 1336 1352 908 673196 AGCGAGTACTGTGAGAG keke-d8-ekeke soosssssssssooss 1337 1353 909 673197 CAGCGAGTACTGTGAGA keke-d8-ekeke soosssssssssooss 1338 1354 910 673198 TCAGCGAGTACTGTGAG keke-d8-ekeke soosssssssssooss 1339 1355 911 673199 CTCAGCGAGTACTGTGA keke-d8-ekeke soosssssssssooss 1340 1356 912 673200 CCTCAGCGAGTACTGTG keke-d8-ekeke soosssssssssooss 1341 1357 913 673201 CCCTCAGCGAGTACTGT keke-d8-ekeke soosssssssssooss 1342 1358 914 673202 ACCCTCAGCGAGTACTG keke-d8-ekeke soosssssssssooss 1343 1359 915 673203 CACCCTCAGCGAGTACT keke-d8-ekeke soosssssssssooss 1344 1360 916 673204 TCACCCTCAGCGAGTAC keke-d8-ekeke soosssssssssooss 1345 1361 917 673205 TTCACCCTCAGCGAGTA keke-d8-ekeke soosssssssssooss 1346 1362 918 673206 GTTCACCCTCAGCGAGT keke-d8-ekeke soosssssssssooss 1347 1363 919 673207 TGTTCACCCTCAGCGAG keke-d8-ekeke soosssssssssooss 1348 1364 920 673208 TTGTTCACCCTCAGCGA keke-d8-ekeke soosssssssssooss 1349 1365 921 673209 CTTGTTCACCCTCAGCG keke-d8-ekeke soosssssssssooss 1350 1366 922 673210 TCTTGTTCACCCTCAGC keke-d8-ekeke soosssssssssooss 1351 1367 923 673211 TTCTTGTTCACCCTCAG keke-d8-ekeke soosssssssssooss 1352 1368 924 673212 TTTCTTGTTCACCCTCA keke-d8-ekeke soosssssssssooss 1353 1369 925 673213 TTTTCTTGTTCACCCTC keke-d8-ekeke soosssssssssooss 1354 1370 926 673214 CTTTTCTTGTTCACCCT keke-d8-ekeke soosssssssssooss 1355 1371 927 673215 TCTTTTCTTGTTCACCC keke-d8-ekeke soosssssssssooss 1356 1372 928 673216 GTCTTTTCTTGTTCACC keke-d8-ekeke soosssssssssooss 1357 1373 929 673217 GGTCTTTTCTTGTTCAC keke-d8-ekeke soosssssssssooss 1358 1374 930 673218 AGGTCTTTTCTTGTTCA keke-d8-ekeke soosssssssssooss 1359 1375 931 673219 CAGGTCTTTTCTTGTTC keke-d8-ekeke soosssssssssooss 1360 1376 932 673220 TCAGGTCTTTTCTTGTT keke-d8-ekeke soosssssssssooss 1361 1377 933 673221 ATCAGGTCTTTTCTTGT keke-d8-ekeke soosssssssssooss 1362 1378 934 673222 TATCAGGTCTTTTCTTG keke-d8-ekeke soosssssssssooss 1363 1379 935 673223 TTATCAGGTCTTTTCTT keke-d8-ekeke soosssssssssooss 1364 1380 936 673224 ATCTTTATCAGGTCTTT keke-d8-ekeke soosssssssssooss 1368 1384 937 673225 AATCTTTATCAGGTCTT keke-d8-ekeke soosssssssssooss 1369 1385 938 673226 TAATCTTTATCAGGTCT keke-d8-ekeke soosssssssssooss 1370 1386 939 673227 TTAATCTTTATCAGGTC keke-d8-ekeke soosssssssssooss 1371 1387 940 673228 GTTAATCTTTATCAGGT keke-d8-ekeke soosssssssssooss 1372 1388 941 673229 GGTTAATCTTTATCAGG keke-d8-ekeke soosssssssssooss 1373 1389 942 673230 TGGTTAATCTTTATCAG keke-d8-ekeke soosssssssssooss 1374 1390 943 673231 CTGGTTAATCTTTATCA keke-d8-ekeke soosssssssssooss 1375 1391 944 673232 TCTGGTTAATCTTTATC keke-d8-ekeke soosssssssssooss 1376 1392 945 673233 CCCTCCTTGTTTTCTTC keke-d8-ekeke soosssssssssooss 1391 1407 946 673234 TCCCTCCTTGTTTTCTT keke-d8-ekeke soosssssssssooss 1392 1408 947 673235 TTCCCTCCTTGTTTTCT keke-d8-ekeke soosssssssssooss 1393 1409 948 673236 TTTCCCTCCTTGTTTTC keke-d8-ekeke soosssssssssooss 1394 1410 949 673237 GTTTCCCTCCTTGTTTT keke-d8-ekeke soosssssssssooss 1395 1411 950 673238 TGTTTCCCTCCTTGTTT keke-d8-ekeke soosssssssssooss 1396 1412 951 673239 TTGTTTCCCTCCTTGTT keke-d8-ekeke soosssssssssooss 1397 1413 952 673240 GGTTGTTTCCCTCCTTG keke-d8-ekeke soosssssssssooss 1399 1415 953 673241 CGGTTGTTTCCCTCCTT keke-d8-ekeke soosssssssssooss 1400 1416 954 673242 GCGGTTGTTTCCCTCCT keke-d8-ekeke soosssssssssooss 1401 1417 955 673243 TGCGGTTGTTTCCCTCC keke-d8-ekeke soosssssssssooss 1402 1418 956 673244 CTGCGGTTGTTTCCCTC keke-d8-ekeke soosssssssssooss 1403 1419 957 673245 GCTGCGGTTGTTTCCCT keke-d8-ekeke soosssssssssooss 1404 1420 958 673246 GGCTGCGGTTGTTTCCC keke-d8-ekeke soosssssssssooss 1405 1421 959 673247 AGGCTGCGGTTGTTTCC keke-d8-ekeke soosssssssssooss 1406 1422 960 673248 CAGGCTGCGGTTGTTTC keke-d8-ekeke soosssssssssooss 1407 1423 961 673249 ACAGGCTGCGGTTGTTT keke-d8-ekeke soosssssssssooss 1408 1424 962 673250 TACAGGCTGCGGTTGTT keke-d8-ekeke soosssssssssooss 1409 1425 963 673251 CTACAGGCTGCGGTTGT keke-d8-ekeke soosssssssssooss 1410 1426 964 673252 GCTACAGGCTGCGGTTG keke-d8-ekeke soosssssssssooss 1411 1427 965 673253 TGCTACAGGCTGCGGTT keke-d8-ekeke soosssssssssooss 1412 1428 966 673254 TTGCTACAGGCTGCGGT keke-d8-ekeke soosssssssssooss 1413 1429 967 673255 CTTGCTACAGGCTGCGG keke-d8-ekeke soosssssssssooss 1414 1430 968 673256 GCTTGCTACAGGCTGCG keke-d8-ekeke soosssssssssooss 1415 1431 969 673257 AGCTTGCTACAGGCTGC keke-d8-ekeke soosssssssssooss 1416 1432 970 673258 GAGCTTGCTACAGGCTG keke-d8-ekeke soosssssssssooss 1417 1433 971 673259 AGAGCTTGCTACAGGCT keke-d8-ekeke soosssssssssooss 1418 1434 972 673260 CAGAGCTTGCTACAGGC keke-d8-ekeke soosssssssssooss 1419 1435 973 673261 CCAGAGCTTGCTACAGG keke-d8-ekeke soosssssssssooss 1420 1436 974 673262 TCCAGAGCTTGCTACAG keke-d8-ekeke soosssssssssooss 1421 1437 975 673263 TTCCAGAGCTTGCTACA keke-d8-ekeke soosssssssssooss 1422 1438 976 673264 GTTCCAGAGCTTGCTAC keke-d8-ekeke soosssssssssooss 1423 1439 977 673265 AGTTCCAGAGCTTGCTA keke-d8-ekeke soosssssssssooss 1424 1440 978 673266 GAGTTCCAGAGCTTGCT keke-d8-ekeke soosssssssssooss 1425 1441 979 673267 TGAGTTCCAGAGCTTGC keke-d8-ekeke soosssssssssooss 1426 1442 980 673268 CTGAGTTCCAGAGCTTG keke-d8-ekeke soosssssssssooss 1427 1443 981 673269 CCTGAGTTCCAGAGCTT keke-d8-ekeke soosssssssssooss 1428 1444 982 673270 TCCTGAGTTCCAGAGCT keke-d8-ekeke soosssssssssooss 1429 1445 983 673271 CTCCTGAGTTCCAGAGC keke-d8-ekeke soosssssssssooss 1430 1446 984 673272 ACTCCTGAGTTCCAGAG keke-d8-ekeke soosssssssssooss 1431 1447 985 673273 GACTCCTGAGTTCCAGA keke-d8-ekeke soosssssssssooss 1432 1448 986 673274 CGACTCCTGAGTTCCAG keke-d8-ekeke soosssssssssooss 1433 1449 987 673275 GCGACTCCTGAGTTCCA keke-d8-ekeke soosssssssssooss 1434 1450 988 673276 CGCGACTCCTGAGTTCC keke-d8-ekeke soosssssssssooss 1435 1451 989 673277 GCGCGACTCCTGAGTTC keke-d8-ekeke soosssssssssooss 1436 1452 990 673278 CGCGCGACTCCTGAGTT keke-d8-ekeke soosssssssssooss 1437 1453 991 673279 GCGCGCGACTCCTGAGT keke-d8-ekeke soosssssssssooss 1438 1454 992 673280 AGCGCGCGACTCCTGAG keke-d8-ekeke soosssssssssooss 1439 1455 993 673281 TAGCGCGCGACTCCTGA keke-d8-ekeke soosssssssssooss 1440 1456 994 673282 CTAGCGCGCGACTCCTG keke-d8-ekeke soosssssssssooss 1441 1457 995 673283 CCTAGCGCGCGACTCCT keke-d8-ekeke soosssssssssooss 1442 1458 996 673284 CCCTAGCGCGCGACTCC keke-d8-ekeke soosssssssssooss 1443 1459 997 673285 CCCCTAGCGCGCGACTC keke-d8-ekeke soosssssssssooss 1444 1460 998 673286 GCCCCTAGCGCGCGACT keke-d8-ekeke soosssssssssooss 1445 1461 999 673287 GGCCCCTAGCGCGCGAC keke-d8-ekeke soosssssssssooss 1446 1462 1000 673288 CGGCCCCTAGCGCGCGA keke-d8-ekeke soosssssssssooss 1447 1463 1001 673289 CCGGCCCCTAGCGCGCG keke-d8-ekeke soosssssssssooss 1448 1464 1002 673290 CCCGGCCCCTAGCGCGC keke-d8-ekeke soosssssssssooss 1449 1465 1003 673291 CCCCGGCCCCTAGCGCG keke-d8-ekeke soosssssssssooss 1450 1466 1004 673292 GCCCCGGCCCCTAGCGC keke-d8-ekeke soosssssssssooss 1451 1467 1005 673293 GGCCCCGGCCCCTAGCG keke-d8-ekeke soosssssssssooss 1452 1468 1006 673294 CGGCCCCGGCCCCTAGC keke-d8-ekeke soosssssssssooss 1453 1469 1007 673295 CCGGCCCCGGCCCCTAG keke-d8-ekeke soosssssssssooss 1454 1470 1008 673296 CCCGGCCCCGGCCCCTA keke-d8-ekeke soosssssssssooss 1455 1471 1009 673297 ACGCCCCGGCCCCGGCC keke-d8-ekeke soosssssssssooss 1465 1481 1010 673298 CACGCCCCGGCCCCGGC keke-d8-ekeke soosssssssssooss 1466 1482 1011 673299 CCACGCCCCGGCCCCGG keke-d8-ekeke soosssssssssooss 1467 1483 1012 673300 ACCACGCCCCGGCCCCG keke-d8-ekeke soosssssssssooss 1468 1484 1013 673301 GACCACGCCCCGGCCCC keke-d8-ekeke soosssssssssooss 1469 1485 1014 673302 CGACCACGCCCCGGCCC keke-d8-ekeke soosssssssssooss 1470 1486 1015 673303 CCGACCACGCCCCGGCC keke-d8-ekeke soosssssssssooss 1471 1487 1016 673304 CCCGACCACGCCCCGGC keke-d8-ekeke soosssssssssooss 1472 1488 1017 673305 CCCCGACCACGCCCCGG keke-d8-ekeke soosssssssssooss 1473 1489 1018 673306 GCCCCGACCACGCCCCG keke-d8-ekeke soosssssssssooss 1474 1490 1019 673307 CGCCCCGACCACGCCCC keke-d8-ekeke soosssssssssooss 1475 1491 1020 673308 CCGCCCCGACCACGCCC keke-d8-ekeke soosssssssssooss 1476 1492 1021 673309 CCCGCCCCGACCACGCC keke-d8-ekeke soosssssssssooss 1477 1493 1022 673310 GCCCGCCCCGACCACGC keke-d8-ekeke soosssssssssooss 1478 1494 1023 673311 GGCCCGCCCCGACCACG keke-d8-ekeke soosssssssssooss 1479 1495 1024 673312 GGGCCCGCCCCGACCAC keke-d8-ekeke soosssssssssooss 1480 1496 1025 673313 CGGGCCCGCCCCGACCA keke-d8-ekeke soosssssssssooss 1481 1497 1026 673314 CCGGGCCCGCCCCGACC keke-d8-ekeke soosssssssssooss 1482 1498 1027 673315 CCCGGGCCCGCCCCGAC keke-d8-ekeke soosssssssssooss 1483 1499 1028 673316 GCAGCCCCGCCCCGGGC keke-d8-ekeke soosssssssssooss 1505 1521 1029 673317 CGCAGCCCCGCCCCGGG keke-d8-ekeke soosssssssssooss 1506 1522 1030 673318 CCGCAGCCCCGCCCCGG keke-d8-ekeke soosssssssssooss 1507 1523 1031 673319 ACCGCAGCCCCGCCCCG keke-d8-ekeke soosssssssssooss 1508 1524 1032 673320 AACCGCAGCCCCGCCCC keke-d8-ekeke soosssssssssooss 1509 1525 1033 673321 CAACCGCAGCCCCGCCC keke-d8-ekeke soosssssssssooss 1510 1526 1034 673322 GCAACCGCAGCCCCGCC keke-d8-ekeke soosssssssssooss 1511 1527 1035 673323 CGCAACCGCAGCCCCGC keke-d8-ekeke soosssssssssooss 1512 1528 1036 673324 CCGCAACCGCAGCCCCG keke-d8-ekeke soosssssssssooss 1513 1529 1037 673325 ACCGCAACCGCAGCCCC keke-d8-ekeke soosssssssssooss 1514 1530 1038 673326 CACCGCAACCGCAGCCC keke-d8-ekeke soosssssssssooss 1515 1531 1039 673327 GCACCGCAACCGCAGCC keke-d8-ekeke soosssssssssooss 1516 1532 1040 673328 GGCACCGCAACCGCAGC keke-d8-ekeke soosssssssssooss 1517 1533 1041 673329 AGGCACCGCAACCGCAG keke-d8-ekeke soosssssssssooss 1518 1534 1042 673330 CAGGCACCGCAACCGCA keke-d8-ekeke soosssssssssooss 1519 1535 1043 673331 GCAGGCACCGCAACCGC keke-d8-ekeke soosssssssssooss 1520 1536 1044 673332 CGCAGGCACCGCAACCG keke-d8-ekeke soosssssssssooss 1521 1537 1045 673333 GCGCAGGCACCGCAACC keke-d8-ekeke soosssssssssooss 1522 1538 1046 673334 GGCGCAGGCACCGCAAC keke-d8-ekeke soosssssssssooss 1523 1539 1047
(525) TABLE-US-00028 TABLE 28 Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop ID NO Sequence Chemistry Linkage Site Site NO 673335 TGAGAGCAAGTAGTGGG ekek-d8-kekee soosssssssssooss 1326 1342 898 673336 GTGAGAGCAAGTAGTGG ekek-d8-kekee soosssssssssooss 1327 1343 899 673337 TGTGAGAGCAAGTAGTG ekek-d8-kekee soosssssssssooss 1328 1344 900 673338 CTGTGAGAGCAAGTAGT ekek-d8-kekee soosssssssssooss 1329 1345 901 673339 ACTGTGAGAGCAAGTAG ekek-d8-kekee soosssssssssooss 1330 1346 902 673340 TACTGTGAGAGCAAGTA ekek-d8-kekee soosssssssssooss 1331 1347 903 673341 GTACTGTGAGAGCAAGT ekek-d8-kekee soosssssssssooss 1332 1348 904 673342 AGTACTGTGAGAGCAAG ekek-d8-kekee soosssssssssooss 1333 1349 905 673343 GAGTACTGTGAGAGCAA ekek-d8-kekee soosssssssssooss 1334 1350 906 673344 CGAGTACTGTGAGAGCA ekek-d8-kekee soosssssssssooss 1335 1351 907 673345 GCGAGTACTGTGAGAGC ekek-d8-kekee soosssssssssooss 1336 1352 908 673346 AGCGAGTACTGTGAGAG ekek-d8-kekee soosssssssssooss 1337 1353 909 673347 CAGCGAGTACTGTGAGA ekek-d8-kekee soosssssssssooss 1338 1354 910 673348 TCAGCGAGTACTGTGAG ekek-d8-kekee soosssssssssooss 1339 1355 911 673349 CTCAGCGAGTACTGTGA ekek-d8-kekee soosssssssssooss 1340 1356 912 673350 CCTCAGCGAGTACTGTG ekek-d8-kekee soosssssssssooss 1341 1357 913 673351 CCCTCAGCGAGTACTGT ekek-d8-kekee soosssssssssooss 1342 1358 914 673352 ACCCTCAGCGAGTACTG ekek-d8-kekee soosssssssssooss 1343 1359 915 673353 CACCCTCAGCGAGTACT ekek-d8-kekee soosssssssssooss 1344 1360 916 673354 TCACCCTCAGCGAGTAC ekek-d8-kekee soosssssssssooss 1345 1361 917 673355 TTCACCCTCAGCGAGTA ekek-d8-kekee soosssssssssooss 1346 1362 918 673356 GTTCACCCTCAGCGAGT ekek-d8-kekee soosssssssssooss 1347 1363 919 673357 TGTTCACCCTCAGCGAG ekek-d8-kekee soosssssssssooss 1348 1364 920 673358 TTGTTCACCCTCAGCGA ekek-d8-kekee soosssssssssooss 1349 1365 921 673359 CTTGTTCACCCTCAGCG ekek-d8-kekee soosssssssssooss 1350 1366 922 673360 TCTTGTTCACCCTCAGC ekek-d8-kekee soosssssssssooss 1351 1367 923 673361 TTCTTGTTCACCCTCAG ekek-d8-kekee soosssssssssooss 1352 1368 924 673362 TTTCTTGTTCACCCTCA ekek-d8-kekee soosssssssssooss 1353 1369 925 673363 TTTTCTTGTTCACCCTC ekek-d8-kekee soosssssssssooss 1354 1370 926 673364 CTTTTCTTGTTCACCCT ekek-d8-kekee soosssssssssooss 1355 1371 927 673365 TCTTTTCTTGTTCACCC ekek-d8-kekee soosssssssssooss 1356 1372 928 673366 GTCTTTTCTTGTTCACC ekek-d8-kekee soosssssssssooss 1357 1373 929 673367 GGTCTTTTCTTGTTCAC ekek-d8-kekee soosssssssssooss 1358 1374 930 673368 AGGTCTTTTCTTGTTCA ekek-d8-kekee soosssssssssooss 1359 1375 931 673369 CAGGTCTTTTCTTGTTC ekek-d8-kekee soosssssssssooss 1360 1376 932 673370 TCAGGTCTTTTCTTGTT ekek-d8-kekee soosssssssssooss 1361 1377 933 673371 ATCAGGTCTTTTCTTGT ekek-d8-kekee soosssssssssooss 1362 1378 934 673372 TATCAGGTCTTTTCTTG ekek-d8-kekee soosssssssssooss 1363 1379 935 673373 TTATCAGGTCTTTTCTT ekek-d8-kekee soosssssssssooss 1364 1380 936 673374 ATCTTTATCAGGTCTTT ekek-d8-kekee soosssssssssooss 1368 1384 937 673375 AATCTTTATCAGGTCTT ekek-d8-kekee soosssssssssooss 1369 1385 938 673376 TAATCTTTATCAGGTCT ekek-d8-kekee soosssssssssooss 1370 1386 939 673377 TTAATCTTTATCAGGTC ekek-d8-kekee soosssssssssooss 1371 1387 940 673378 GTTAATCTTTATCAGGT ekek-d8-kekee soosssssssssooss 1372 1388 941 673379 GGTTAATCTTTATCAGG ekek-d8-kekee soosssssssssooss 1373 1389 942 673380 TGGTTAATCTTTATCAG ekek-d8-kekee soosssssssssooss 1374 1390 943 673381 CTGGTTAATCTTTATCA ekek-d8-kekee soosssssssssooss 1375 1391 944 673382 TCTGGTTAATCTTTATC ekek-d8-kekee soosssssssssooss 1376 1392 945 673383 CCCTCCTTGTTTTCTTC ekek-d8-kekee soosssssssssooss 1391 1407 946 673384 TCCCTCCTTGTTTTCTT ekek-d8-kekee soosssssssssooss 1392 1408 947 673385 TTCCCTCCTTGTTTTCT ekek-d8-kekee soosssssssssooss 1393 1409 948 673386 TTTCCCTCCTTGTTTTC ekek-d8-kekee soosssssssssooss 1394 1410 949 673387 GTTTCCCTCCTTGTTTT ekek-d8-kekee soosssssssssooss 1395 1411 950 673388 TGTTTCCCTCCTTGTTT ekek-d8-kekee soosssssssssooss 1396 1412 951 673389 TTGTTTCCCTCCTTGTT ekek-d8-kekee soosssssssssooss 1397 1413 952 673390 GGTTGTTTCCCTCCTTG ekek-d8-kekee soosssssssssooss 1399 1415 953 673391 CGGTTGTTTCCCTCCTT ekek-d8-kekee soosssssssssooss 1400 1416 954 673392 GCGGTTGTTTCCCTCCT ekek-d8-kekee soosssssssssooss 1401 1417 955 673393 TGCGGTTGTTTCCCTCC ekek-d8-kekee soosssssssssooss 1402 1418 956 673394 CTGCGGTTGTTTCCCTC ekek-d8-kekee soosssssssssooss 1403 1419 957 673395 GCTGCGGTTGTTTCCCT ekek-d8-kekee soosssssssssooss 1404 1420 958 673396 GGCTGCGGTTGTTTCCC ekek-d8-kekee soosssssssssooss 1405 1421 959 673397 AGGCTGCGGTTGTTTCC ekek-d8-kekee soosssssssssooss 1406 1422 960 673398 CAGGCTGCGGTTGTTTC ekek-d8-kekee soosssssssssooss 1407 1423 961 673399 ACAGGCTGCGGTTGTTT ekek-d8-kekee soosssssssssooss 1408 1424 962 673400 TACAGGCTGCGGTTGTT ekek-d8-kekee soosssssssssooss 1409 1425 963 673401 CTACAGGCTGCGGTTGT ekek-d8-kekee soosssssssssooss 1410 1426 964 673402 GCTACAGGCTGCGGTTG ekek-d8-kekee soosssssssssooss 1411 1427 965 673403 TGCTACAGGCTGCGGTT ekek-d8-kekee soosssssssssooss 1412 1428 966 673404 TTGCTACAGGCTGCGGT ekek-d8-kekee soosssssssssooss 1413 1429 967 673405 CTTGCTACAGGCTGCGG ekek-d8-kekee soosssssssssooss 1414 1430 968 673406 GCTTGCTACAGGCTGCG ekek-d8-kekee soosssssssssooss 1415 1431 969 673407 AGCTTGCTACAGGCTGC ekek-d8-kekee soosssssssssooss 1416 1432 970 673408 GAGCTTGCTACAGGCTG ekek-d8-kekee soosssssssssooss 1417 1433 971 673409 AGAGCTTGCTACAGGCT ekek-d8-kekee soosssssssssooss 1418 1434 972 673410 CAGAGCTTGCTACAGGC ekek-d8-kekee soosssssssssooss 1419 1435 973 673411 CCAGAGCTTGCTACAGG ekek-d8-kekee soosssssssssooss 1420 1436 974 673412 TCCAGAGCTTGCTACAG ekek-d8-kekee soosssssssssooss 1421 1437 975 673413 TTCCAGAGCTTGCTACA ekek-d8-kekee soosssssssssooss 1422 1438 976 673414 GTTCCAGAGCTTGCTAC ekek-d8-kekee soosssssssssooss 1423 1439 977 673415 AGTTCCAGAGCTTGCTA ekek-d8-kekee soosssssssssooss 1424 1440 978 673416 GAGTTCCAGAGCTTGCT ekek-d8-kekee soosssssssssooss 1425 1441 979 673417 TGAGTTCCAGAGCTTGC ekek-d8-kekee soosssssssssooss 1426 1442 980 673418 CTGAGTTCCAGAGCTTG ekek-d8-kekee soosssssssssooss 1427 1443 981 673419 CCTGAGTTCCAGAGCTT ekek-d8-kekee soosssssssssooss 1428 1444 982 673420 TCCTGAGTTCCAGAGCT ekek-d8-kekee soosssssssssooss 1429 1445 983 673421 CTCCTGAGTTCCAGAGC ekek-d8-kekee soosssssssssooss 1430 1446 984 673422 ACTCCTGAGTTCCAGAG ekek-d8-kekee soosssssssssooss 1431 1447 985 673423 GACTCCTGAGTTCCAGA ekek-d8-kekee soosssssssssooss 1432 1448 986 673424 CGACTCCTGAGTTCCAG ekek-d8-kekee soosssssssssooss 1433 1449 987 673425 GCGACTCCTGAGTTCCA ekek-d8-kekee soosssssssssooss 1434 1450 988 673426 CGCGACTCCTGAGTTCC ekek-d8-kekee soosssssssssooss 1435 1451 989 673427 GCGCGACTCCTGAGTTC ekek-d8-kekee soosssssssssooss 1436 1452 990 673428 CGCGCGACTCCTGAGTT ekek-d8-kekee soosssssssssooss 1437 1453 991 673429 GCGCGCGACTCCTGAGT ekek-d8-kekee soosssssssssooss 1438 1454 992 673430 AGCGCGCGACTCCTGAG ekek-d8-kekee soosssssssssooss 1439 1455 993 673431 TAGCGCGCGACTCCTGA ekek-d8-kekee soosssssssssooss 1440 1456 994 673432 CTAGCGCGCGACTCCTG ekek-d8-kekee soosssssssssooss 1441 1457 995 673433 CCTAGCGCGCGACTCCT ekek-d8-kekee soosssssssssooss 1442 1458 996 673434 CCCTAGCGCGCGACTCC ekek-d8-kekee soosssssssssooss 1443 1459 997 673435 CCCCTAGCGCGCGACTC ekek-d8-kekee soosssssssssooss 1444 1460 998 673436 GCCCCTAGCGCGCGACT ekek-d8-kekee soosssssssssooss 1445 1461 999 673437 GGCCCCTAGCGCGCGAC ekek-d8-kekee soosssssssssooss 1446 1462 1000 673438 CGGCCCCTAGCGCGCGA ekek-d8-kekee soosssssssssooss 1447 1463 1001 673439 CCGGCCCCTAGCGCGCG ekek-d8-kekee soosssssssssooss 1448 1464 1002 673440 CCCGGCCCCTAGCGCGC ekek-d8-kekee soosssssssssooss 1449 1465 1003 673441 CCCCGGCCCCTAGCGCG ekek-d8-kekee soosssssssssooss 1450 1466 1004 673442 GCCCCGGCCCCTAGCGC ekek-d8-kekee soosssssssssooss 1451 1467 1005 673443 GGCCCCGGCCCCTAGCG ekek-d8-kekee soosssssssssooss 1452 1468 1006 673444 CGGCCCCGGCCCCTAGC ekek-d8-kekee soosssssssssooss 1453 1469 1007 673445 CCGGCCCCGGCCCCTAG ekek-d8-kekee soosssssssssooss 1454 1470 1008 673446 CCCGGCCCCGGCCCCTA ekek-d8-kekee soosssssssssooss 1455 1471 1009 673447 ACGCCCCGGCCCCGGCC ekek-d8-kekee soosssssssssooss 1465 1481 1010 673448 CACGCCCCGGCCCCGGC ekek-d8-kekee soosssssssssooss 1466 1482 1011 673449 CCACGCCCCGGCCCCGG ekek-d8-kekee soosssssssssooss 1467 1483 1012 673450 ACCACGCCCCGGCCCCG ekek-d8-kekee soosssssssssooss 1468 1484 1013 673451 GACCACGCCCCGGCCCC ekek-d8-kekee soosssssssssooss 1469 1485 1014 673452 CGACCACGCCCCGGCCC ekek-d8-kekee soosssssssssooss 1470 1486 1015 673453 CCGACCACGCCCCGGCC ekek-d8-kekee soosssssssssooss 1471 1487 1016 673454 CCCGACCACGCCCCGGC ekek-d8-kekee soosssssssssooss 1472 1488 1017 673455 CCCCGACCACGCCCCGG ekek-d8-kekee soosssssssssooss 1473 1489 1018 673456 GCCCCGACCACGCCCCG ekek-d8-kekee soosssssssssooss 1474 1490 1019 673457 CGCCCCGACCACGCCCC ekek-d8-kekee soosssssssssooss 1475 1491 1020 673458 CCGCCCCGACCACGCCC ekek-d8-kekee soosssssssssooss 1476 1492 1021 673459 CCCGCCCCGACCACGCC ekek-d8-kekee soosssssssssooss 1477 1493 1022 673460 GCCCGCCCCGACCACGC ekek-d8-kekee soosssssssssooss 1478 1494 1023 673461 GGCCCGCCCCGACCACG ekek-d8-kekee soosssssssssooss 1479 1495 1024 673462 GGGCCCGCCCCGACCAC ekek-d8-kekee soosssssssssooss 1480 1496 1025 673463 CGGGCCCGCCCCGACCA ekek-d8-kekee soosssssssssooss 1481 1497 1026 673464 CCGGGCCCGCCCCGACC ekek-d8-kekee soosssssssssooss 1482 1498 1027 673465 CCCGGGCCCGCCCCGAC ekek-d8-kekee soosssssssssooss 1483 1499 1028 673466 GCAGCCCCGCCCCGGGC ekek-d8-kekee soosssssssssooss 1505 1521 1029 673467 CGCAGCCCCGCCCCGGG ekek-d8-kekee soosssssssssooss 1506 1522 1030 673468 CCGCAGCCCCGCCCCGG ekek-d8-kekee soosssssssssooss 1507 1523 1031 673469 ACCGCAGCCCCGCCCCG ekek-d8-kekee soosssssssssooss 1508 1524 1032 673470 AACCGCAGCCCCGCCCC ekek-d8-kekee soosssssssssooss 1509 1525 1033 673471 CAACCGCAGCCCCGCCC ekek-d8-kekee soosssssssssooss 1510 1526 1034 673472 GCAACCGCAGCCCCGCC ekek-d8-kekee soosssssssssooss 1511 1527 1035 673473 CGCAACCGCAGCCCCGC ekek-d8-kekee soosssssssssooss 1512 1528 1036 673474 CCGCAACCGCAGCCCCG ekek-d8-kekee soosssssssssooss 1513 1529 1037 673475 ACCGCAACCGCAGCCCC ekek-d8-kekee soosssssssssooss 1514 1530 1038 673476 CACCGCAACCGCAGCCC ekek-d8-kekee soosssssssssooss 1515 1531 1039 673477 GCACCGCAACCGCAGCC ekek-d8-kekee soosssssssssooss 1516 1532 1040 673478 GGCACCGCAACCGCAGC ekek-d8-kekee soosssssssssooss 1517 1533 1041 673479 AGGCACCGCAACCGCAG ekek-d8-kekee soosssssssssooss 1518 1534 1042 673480 CAGGCACCGCAACCGCA ekek-d8-kekee soosssssssssooss 1519 1535 1043 673481 GCAGGCACCGCAACCGC ekek-d8-kekee soosssssssssooss 1520 1536 1044 673482 CGCAGGCACCGCAACCG ekek-d8-kekee soosssssssssooss 1521 1537 1045 673483 GCGCAGGCACCGCAACC ekek-d8-kekee soosssssssssooss 1522 1538 1046 673484 GGCGCAGGCACCGCAAC ekek-d8-kekee soosssssssssooss 1523 1539 1047
(526) TABLE-US-00029 TABLE 29 5-10-5 MOE gapmers targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop ID NO Sequence Linkage Site Site NO 653222 CCACTCGCCACCGCCTGCGC soooossssssssssooss 1553 1572 1048 653223 TGCATTCCTAAGCAATGTGT soooossssssssssooss 5325 5344 1049 655016 CCCGGCCCCGGCCCCGGCCC soooossssssssssooss 1458 1477 1050 655017 CCCCGGCCCCGGCCCCGGCC soooossssssssssooss 1459 1478 1051 671081 TTACATCTATAGCACCACTC soooossssssssssooss 8110 8129 1052 671082 TCACTCCCTTTTCAGACAAG soooossssssssssooss 8140 8159 1053 671083 AACTAAGTTCTGTCTGTGGA soooossssssssssooss 8230 8249 1054 671084 ATACAGGACTAAAGTGCTTC soooossssssssssooss 14316 14335 1055
(527) TABLE-US-00030 TABLE 30 5-10-5 MOE gapmers targeting SEQ ID NO: 1 SEQ SEQ ID ID NO: 1 NO: 1 SEQ ISIS Start Stop ID NO Sequence Linkage Site Site NO 672561 CTCTGACCCTG soooosssssssss 695 714 1056 ATCTTCCAT sooss
Example 7: In Vivo Rodent Inhibition and Tolerability with Treatment of C9ORF72 Antisense Oligonucleotides
(528) In order to assess the tolerability of inhibition of C9ORF72 expression in vivo, antisense oligonucleotides targeting a murine C9ORF72 nucleic acid were designed and assessed in mouse and rat models.
(529) ISIS 571883 was designed as a 5-10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and on the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a MOE modification. The internucleoside linkages are phosphorothioate linkages. All cytosine residues throughout the gapmer are 5-methylcytosines. ISIS 571883 has a target start site of nucleoside 33704 on the murine C9ORF72 genomic sequence, designated herein as SEQ ID NO: 11 (the complement of GENBANK Accession No. NT_166289.1 truncated from nucleosides 3587000 to 3625000).
(530) ISIS 603538 was designed as a 5-10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and on the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a MOE modification. The internucleoside linkages are either phosphorothioate linkages or phosphate ester linkages (Gs Ao Co Co Gs Cs Ts Ts Gs As Gs Ts Ts Ts Gs Co Co Ao Cs A; wherein ‘s’ denotes a phosphorothioate internucleoside linkage, ‘o’ denotes a phosphate ester linkage; and A, G, C, T denote the relevant nucleosides). All cytosine residues throughout the gapmer are 5-methylcytosines. ISIS 603538 has a target start site of nucleoside 2872 on the rat C9ORF72 mRNA sequence, designated herein as SEQ ID NO: 12 (GENBANK Accession No. NM_001007702.1).
(531) Mouse Experiment 1
(532) Groups of 4 C57BL/6 mice each were injected with 50 μg, 100 μg, 300 μg, 500 μg, or 700 μg of ISIS 571883 administered via an intracerebroventricular bolus injection. A control group of four C57/BL6 mice were similarly treated with PBS. Animals were anesthetized with 3% isofluorane and placed in a stereotactic frame. After sterilizing the surgical site, each mouse was injected −0.2 mm anterior-posterior from the bregma na d 3 mm dorsoventral to the bregma with the above-mentioned doses of ISIS 571883 using a Hamilton syringe. The incision was closed with sutures. The mice were allowed to recover for 14 days, after which animals were euthanized according to a humane protocol approved by the Institutional Animal Care and Use Committee. Brain and spinal cord tissue were harvested and snap frozen in liquid nitrogen. Prior to freezing, brain tissue was cut transversely five sections using a mouse brain matrix.
(533) RNA Analysis
(534) RNA was extracted from a 2-3 mm brain section posterior to the injection site, from brain frontal cortex and from the lumbar section of the spinal cord tissue for analysis of C9ORF72 mRNA expression. C9ORF72 mRNA expression was measured by RT-PCR. The data is presented in Table 31. The results indicate that treatment with increasing doses of ISIS 571883 resulted in dose-dependent inhibition of C9ORF72 mRNA expression.
(535) The induction of the microglial marker AIF-1 as a measure of CNS toxicity was also assessed. The data is presented in Table 32. The results indicate that treatment with increasing doses of ISIS 571883 did not result in significant increases in AIF-1 mRNA expression. Hence, the injection of ISIS 571883 was deemed tolerable in this model.
(536) TABLE-US-00031 TABLE 31 Percentage inhibition of C9ORF72 mRNA expression compared to the PBS control Posterior Spinal Dose (μg) brain Cortex cord 50 22 8 46 100 22 12 47 300 55 47 67 500 61 56 78 700 65 65 79
(537) TABLE-US-00032 TABLE 32 Percentage expression of AIF-1 mRNA expression compared to the PBS control Posterior Spinal Dose (μg) brain cord 50 102 89 100 105 111 300 107 98 500 131 124 700 122 116
Mouse Experiment 2
(538) Groups of 4 C57BL/6 mice each were injected with 500 μg of ISIS 571883 administered via an intracerebroventricular bolus injection in a procedure similar to that described above. A control group of four C57/BL6 mice were similarly treated with PBS. The mice were tested at regular time points after ICV administration.
(539) Behavior Analysis
(540) Two standard assays to assess motor behavior were employed; the rotarod assay and grip strength assay. In case of the rotarod assays, the time of latency to fall was measured. The data for the assays is presented in Tables 33 and 34. The results indicate that there were no significant changes in the motor behavior of the mice as a result of antisense inhibition of ISIS 571883 or due to the ICV injection. Hence, antisense inhibition of C9ORF72 was deemed tolerable in this model.
(541) TABLE-US-00033 TABLE 33 Latency to fall (sec) in the rotarod assay Weeks after ISIS injection PBS 571883 0 66 66 4 91 70 8 94 84
(542) TABLE-US-00034 TABLE 34 Mean hindlimb grip strength (g) in the grip strength assay Weeks after ISIS injection PBS 571883 0 57 63 1 65 51 2 51 52 3 51 51 4 59 72 5 60 64 6 61 72 7 67 68 8 66 70 9 63 61 10 48 46
Rat Experiment
(543) Groups of 4 Sprague-Dawley rats each were injected with 700 μg, 1,000 μg, or 3,000 μg of ISIS 603538 administered via an intrathecal bolus injection. A control group of four Sprague-Dawley rats were similarly treated with PBS. Animals were anesthetized with 3% isofluorane and placed in a stereotactic frame. After sterilizing the surgical site, each rat was injected with 30 μL of ASO solution administered via 8 cm intrathecal catheter 2 cm into the spinal canal with a 50 μL flush. The rats were allowed to recover for 4 weeks, after which animals were euthanized according to a humane protocol approved by the Institutional Animal Care and Use Committee.
(544) RNA Analysis
(545) RNA was extracted from a 2-3 mm brain section posterior to the injection site, from brain frontal cortex, and from the cervical and lumbar sections of the spinal cord tissue for analysis of C9ORF72 mRNA expression. C9ORF72 mRNA expression was measured by RT-PCR. The data is presented in Table 35. The results indicate that treatment with increasing doses of ISIS 603538 resulted in dose-dependent inhibition of C9ORF72 mRNA expression.
(546) The induction of the microglial marker AIF-1 as a measure of CNS toxicity was also assessed. The data is presented in Table 36. The results indicate that treatment with increasing doses of ISIS 603538 did not result in significant increases in AIF-1 mRNA expression. Hence, the injection of ISIS 603538 was deemed tolerable in this model.
(547) TABLE-US-00035 TABLE 35 Percentage inhibition of C9ORF72 mRNA expression compared to the PBS control Dose Brain (1 mm Spinal cord Spinal cord (μg) section) Cortex (lumbar) (cervical) 700 21 4 86 74 1000 53 49 88 82 3000 64 62 88 80
(548) TABLE-US-00036 TABLE 36 Percentage expression of AIF-1 mRNA expression compared to the PBS control Dose Brain (1 mm Spinal cord Spinal cord (μg) section) Cortex (lumbar) (cervical) 700 97 119 98 89 1000 105 113 122 96 3000 109 141 156 115
Body Weight Analysis
(549) Body weights of the rats were measured at regular time point intervals. The data is presented in Table 37. The results indicate that treatment with increasing doses of ISIS 603538 did not have any significant changes in the body weights of the rats.
(550) TABLE-US-00037 TABLE 37 Body weights of the rats (% initial body weight) Dose Week Week Week Week Week (μg) 1 2 3 4 5 PBS 100 94 103 105 109 ISIS 700 100 94 98 103 107 603538 1000 100 95 97 101 103 3000 100 92 98 102 105
Example 8: Antisense Inhibition of C9ORF72 by 5-8-5 MOE Gapmers with Mixed Backbones and Deoxy, MOE and cEt Antisense Oligonucleotides with Mixed Backbones
(551) Antisense oligonucleotides described in Example 6 hereinabove (see Table 23 and Table 24 hereinabove) were tested in HepG2 cells in a series of experiments that had similar culture conditions. ISIS 576816, previously tested in PCT/US2013/065073 (claiming priority to U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide for study with deoxy, MOE, and cEt antisense oligonucleotides. The results for each experiment are presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C9ORF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells.
(552) TABLE-US-00038 TABLE 38 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by 5-8-5 MOE gapmers with mixed backbones targeting SEQ ID NO: 2 SEQ ID SEQ ID NO: 2 NO: 2 ISIS Start Stop % SEQ ID NO Sequence Linkage Site Site inhibition NO 672581 GTGAGAGCAAGTAGTGGG sooosssssssssooss 1326 1343 11 744 672582 TGTGAGAGCAAGTAGTGG sooosssssssssooss 1327 1344 32 745 672583 CTGTGAGAGCAAGTAGTG sooosssssssssooss 1328 1345 14 746 672584 ACTGTGAGAGCAAGTAGT sooosssssssssooss 1329 1346 1 747 672585 TACTGTGAGAGCAAGTAG sooosssssssssooss 1330 1347 14 748 672586 GTACTGTGAGAGCAAGTA sooosssssssssooss 1331 1348 22 749 672587 AGTACTGTGAGAGCAAGT sooosssssssssooss 1332 1349 0 750 672588 GAGTACTGTGAGAGCAAG sooosssssssssooss 1333 1350 8 751 672589 CGAGTACTGTGAGAGCAA sooosssssssssooss 1334 1351 15 752 672590 GCGAGTACTGTGAGAGCA sooosssssssssooss 1335 1352 13 753 672591 AGCGAGTACTGTGAGAGC sooosssssssssooss 1336 1353 32 754 672592 CAGCGAGTACTGTGAGAG sooosssssssssooss 1337 1354 39 755 672593 TCAGCGAGTACTGTGAGA sooosssssssssooss 1338 1355 15 756 672594 CTCAGCGAGTACTGTGAG sooosssssssssooss 1339 1356 14 757 672595 CCTCAGCGAGTACTGTGA sooosssssssssooss 1340 1357 40 758 672596 CCCTCAGCGAGTACTGTG sooosssssssssooss 1341 1358 28 759 672597 ACCCTCAGCGAGTACTGT sooosssssssssooss 1342 1359 30 760 672598 CACCCTCAGCGAGTACTG sooosssssssssooss 1343 1360 46 761 672599 TCACCCTCAGCGAGTACT sooosssssssssooss 1344 1361 40 762 672600 TTCACCCTCAGCGAGTAC sooosssssssssooss 1345 1362 25 763 672601 GTTCACCCTCAGCGAGTA sooosssssssssooss 1346 1363 15 764 672602 TGTTCACCCTCAGCGAGT sooosssssssssooss 1347 1364 35 765 672603 TTGTTCACCCTCAGCGAG sooosssssssssooss 1348 1365 22 766 672604 CTTGTTCACCCTCAGCGA sooosssssssssooss 1349 1366 6 767 672605 TCTTGTTCACCCTCAGCG sooosssssssssooss 1350 1367 26 768 672606 TTCTTGTTCACCCTCAGC sooosssssssssooss 1351 1368 11 769 672607 TTTCTTGTTCACCCTCAG sooosssssssssooss 1352 1369 9 770 672608 TTTTCTTGTTCACCCTCA sooosssssssssooss 1353 1370 36 771 672609 CTTTTCTTGTTCACCCTC sooosssssssssooss 1354 1371 25 772 672610 TCTTTTCTTGTTCACCCT sooosssssssssooss 1355 1372 16 773 672611 GTCTTTTCTTGTTCACCC sooosssssssssooss 1356 1373 45 774 672612 GGTCTTTTCTTGTTCACC sooosssssssssooss 1357 1374 15 775 672613 AGGTCTTTTCTTGTTCAC sooosssssssssooss 1358 1375 10 776 672614 CAGGTCTTTTCTTGTTCA sooosssssssssooss 1359 1376 25 777 672615 TCAGGTCTTTTCTTGTTC sooosssssssssooss 1360 1377 21 778 672616 ATCAGGTCTTTTCTTGTT sooosssssssssooss 1361 1378 15 779 672617 TATCAGGTCTTTTCTTGT sooosssssssssooss 1362 1379 27 780 672618 TTATCAGGTCTTTTCTTG sooosssssssssooss 1363 1380 14 781 672619 TTTATCAGGTCTTTTCTT sooosssssssssooss 1364 1381 46 782 672620 AATCTTTATCAGGTCTTT sooosssssssssooss 1368 1385 31 783 672621 TAATCTTTATCAGGTCTT sooosssssssssooss 1369 1386 12 784 672622 TTAATCTTTATCAGGTCT sooosssssssssooss 1370 1387 27 785 672623 GTTAATCTTTATCAGGTC sooosssssssssooss 1371 1388 9 786 672624 GGTTAATCTTTATCAGGT sooosssssssssooss 1372 1389 53 787 672625 TGGTTAATCTTTATCAGG sooosssssssssooss 1373 1390 17 788 672626 CTGGTTAATCTTTATCAG sooosssssssssooss 1374 1391 11 789 672627 TCTGGTTAATCTTTATCA sooosssssssssooss 1375 1392 16 790 672628 TTCTGGTTAATCTTTATC sooosssssssssooss 1376 1393 22 791 672629 TCCCTCCTTGTTTTCTTC sooosssssssssooss 1391 1408 0 792 672630 TTTCCCTCCTTGTTTTCT sooosssssssssooss 1393 1410 8 793 672631 GTTTCCCTCCTTGTTTTC sooosssssssssooss 1394 1411 0 794 672632 TGTTTCCCTCCTTGTTTT sooosssssssssooss 1395 1412 25 795 672633 TTGTTTCCCTCCTTGTTT sooosssssssssooss 1396 1413 0 796 672634 GTTGTTTCCCTCCTTGTT sooosssssssssooss 1397 1414 10 797 672635 GGTTGTTTCCCTCCTTGT sooosssssssssooss 1398 1415 15 798 672636 CGGTTGTTTCCCTCCTTG sooosssssssssooss 1399 1416 49 799 672637 GCGGTTGTTTCCCTCCTT sooosssssssssooss 1400 1417 49 800 672638 TGCGGTTGTTTCCCTCCT sooosssssssssooss 1401 1418 23 801 672639 CTGCGGTTGTTTCCCTCC sooosssssssssooss 1402 1419 21 802 672640 GCTGCGGTTGTTTCCCTC sooosssssssssooss 1403 1420 52 803 672641 GGCTGCGGTTGTTTCCCT sooosssssssssooss 1404 1421 23 804 672642 AGGCTGCGGTTGTTTCCC sooosssssssssooss 1405 1422 35 805 672643 CAGGCTGCGGTTGTTTCC sooosssssssssooss 1406 1423 22 806 672644 ACAGGCTGCGGTTGTTTC sooosssssssssooss 1407 1424 27 807 672645 TACAGGCTGCGGTTGTTT sooosssssssssooss 1408 1425 21 808 672646 CTACAGGCTGCGGTTGTT sooosssssssssooss 1409 1426 18 809 672647 GCTACAGGCTGCGGTTGT sooosssssssssooss 1410 1427 16 810 672648 TGCTACAGGCTGCGGTTG sooosssssssssooss 1411 1428 10 811 672649 TTGCTACAGGCTGCGGTT sooosssssssssooss 1412 1429 0 812 672650 CTTGCTACAGGCTGCGGT sooosssssssssooss 1413 1430 27 813 672651 GCTTGCTACAGGCTGCGG sooosssssssssooss 1414 1431 53 814 672652 AGCTTGCTACAGGCTGCG sooosssssssssooss 1415 1432 38 815 672653 GAGCTTGCTACAGGCTGC sooosssssssssooss 1416 1433 7 816 672654 AGAGCTTGCTACAGGCTG sooosssssssssooss 1417 1434 7 817 672655 CAGAGCTTGCTACAGGCT sooosssssssssooss 1418 1435 15 818 672656 CCAGAGCTTGCTACAGGC sooosssssssssooss 1419 1436 22 819 672657 TCCAGAGCTTGCTACAGG sooosssssssssooss 1420 1437 43 820 672658 TTCCAGAGCTTGCTACAG sooosssssssssooss 1421 1438 20 821 672659 GTTCCAGAGCTTGCTACA sooosssssssssooss 1422 1439 12 822 672660 AGTTCCAGAGCTTGCTAC sooosssssssssooss 1423 1440 11 823 672661 GAGTTCCAGAGCTTGCTA sooosssssssssooss 1424 1441 39 824 672662 TGAGTTCCAGAGCTTGCT sooosssssssssooss 1425 1442 18 825 672663 CTGAGTTCCAGAGCTTGC sooosssssssssooss 1426 1443 26 826 672664 CCTGAGTTCCAGAGCTTG sooosssssssssooss 1427 1444 69 827 672665 TCCTGAGTTCCAGAGCTT sooosssssssssooss 1428 1445 56 828 672666 CTCCTGAGTTCCAGAGCT sooosssssssssooss 1429 1446 28 829 672667 ACTCCTGAGTTCCAGAGC sooosssssssssooss 1430 1447 51 830 672668 GACTCCTGAGTTCCAGAG sooosssssssssooss 1431 1448 39 831 672669 CGACTCCTGAGTTCCAGA sooosssssssssooss 1432 1449 32 832 672670 GCGACTCCTGAGTTCCAG sooosssssssssooss 1433 1450 66 833 672671 CGCGACTCCTGAGTTCCA sooosssssssssooss 1434 1451 67 834 672672 GCGCGACTCCTGAGTTCC sooosssssssssooss 1435 1452 48 835 672673 CGCGCGACTCCTGAGTTC sooosssssssssooss 1436 1453 38 836 672674 GCGCGCGACTCCTGAGTT sooosssssssssooss 1437 1454 53 837 672675 AGCGCGCGACTCCTGAGT sooosssssssssooss 1438 1455 58 838 672676 TAGCGCGCGACTCCTGAG sooosssssssssooss 1439 1456 55 839 672677 CTAGCGCGCGACTCCTGA sooosssssssssooss 1440 1457 47 840 672678 CCTAGCGCGCGACTCCTG sooosssssssssooss 1441 1458 56 841 672679 CCCTAGCGCGCGACTCCT sooosssssssssooss 1442 1459 74 842 672680 CCCCTAGCGCGCGACTCC sooosssssssssooss 1443 1460 43 843 672681 GCCCCTAGCGCGCGACTC sooosssssssssooss 1444 1461 53 844 672682 GGCCCCTAGCGCGCGACT sooosssssssssooss 1445 1462 42 845 672683 CGGCCCCTAGCGCGCGAC sooosssssssssooss 1446 1463 69 846 672684 CCGGCCCCTAGCGCGCGA sooosssssssssooss 1447 1464 29 847 672685 CCCGGCCCCTAGCGCGCG sooosssssssssooss 1448 1465 21 848 672686 CCCCGGCCCCTAGCGCGC sooosssssssssooss 1449 1466 35 849 672687 GCCCCGGCCCCTAGCGCG sooosssssssssooss 1450 1467 41 850 672688 GGCCCCGGCCCCTAGCGC sooosssssssssooss 1451 1468 46 851 672689 CGGCCCCGGCCCCTAGCG sooosssssssssooss 1452 1469 28 852 672690 CCGGCCCCGGCCCCTAGC sooosssssssssooss 1453 1470 33 853 672691 CCCGGCCCCGGCCCCTAG sooosssssssssooss 1454 1471 10 854 672692 CCCCGGCCCCGGCCCCTA sooosssssssssooss 1455 1472 35 855 672693 ACGCCCCGGCCCCGGCCC sooosssssssssooss 1464 1481 57 856 672694 CACGCCCCGGCCCCGGCC sooosssssssssooss 1465 1482 39 857 672695 CCACGCCCCGGCCCCGGC sooosssssssssooss 1466 1483 48 858 672696 ACCACGCCCCGGCCCCGG sooosssssssssooss 1467 1484 39 859 672697 GACCACGCCCCGGCCCCG sooosssssssssooss 1468 1485 54 860 672698 CGACCACGCCCCGGCCCC sooosssssssssooss 1469 1486 48 861 672699 CCGACCACGCCCCGGCCC sooosssssssssooss 1470 1487 52 862 672700 CCCGACCACGCCCCGGCC sooosssssssssooss 1471 1488 67 863 672701 CCCCGACCACGCCCCGGC sooosssssssssooss 1472 1489 42 864 672702 GCCCCGACCACGCCCCGG sooosssssssssooss 1473 1490 11 865 672703 CGCCCCGACCACGCCCCG sooosssssssssooss 1474 1491 23 866 672704 CCGCCCCGACCACGCCCC sooosssssssssooss 1475 1492 50 867 672705 CCCGCCCCGACCACGCCC sooosssssssssooss 1476 1493 23 868 672706 GCCCGCCCCGACCACGCC sooosssssssssooss 1477 1494 24 869 672707 GGCCCGCCCCGACCACGC sooosssssssssooss 1478 1495 44 870 672708 GGGCCCGCCCCGACCACG sooosssssssssooss 1479 1496 29 871 672709 CGGGCCCGCCCCGACCAC sooosssssssssooss 1480 1497 7 872 672710 CCGGGCCCGCCCCGACCA sooosssssssssooss 1481 1498 30 873 672711 CCCGGGCCCGCCCCGACC sooosssssssssooss 1482 1499 16 874 672712 CCCCGGGCCCGCCCCGAC sooosssssssssooss 1483 1500 14 875 672713 AGCCCCGCCCCGGGCCCG sooosssssssssooss 1502 1519 32 876 672714 CAGCCCCGCCCCGGGCCC sooosssssssssooss 1503 1520 22 877 672715 GCAGCCCCGCCCCGGGCC sooosssssssssooss 1504 1521 1 878 672716 CGCAGCCCCGCCCCGGGC sooosssssssssooss 1505 1522 29 879 672717 CCGCAGCCCCGCCCCGGG sooosssssssssooss 1506 1523 51 880 672718 ACCGCAGCCCCGCCCCGG sooosssssssssooss 1507 1524 45 881 672719 AACCGCAGCCCCGCCCCG sooosssssssssooss 1508 1525 12 882 672720 CAACCGCAGCCCCGCCCC sooosssssssssooss 1509 1526 7 883 672721 GCAACCGCAGCCCCGCCC sooosssssssssooss 1510 1527 38 884 672722 CGCAACCGCAGCCCCGCC sooosssssssssooss 1511 1528 34 885 672723 CCGCAACCGCAGCCCCGC sooosssssssssooss 1512 1529 58 886 672724 ACCGCAACCGCAGCCCCG sooosssssssssooss 1513 1530 39 887 672725 CACCGCAACCGCAGCCCC sooosssssssssooss 1514 1531 43 888 672726 GCACCGCAACCGCAGCCC sooosssssssssooss 1515 1532 41 889 672727 GGCACCGCAACCGCAGCC sooosssssssssooss 1516 1533 18 890 672728 AGGCACCGCAACCGCAGC sooosssssssssooss 1517 1534 53 891 672729 CAGGCACCGCAACCGCAG sooosssssssssooss 1518 1535 26 892 672730 GCAGGCACCGCAACCGCA sooosssssssssooss 1519 1536 54 893 672731 CGCAGGCACCGCAACCGC sooosssssssssooss 1520 1537 41 894 672732 GCGCAGGCACCGCAACCG sooosssssssssooss 1521 1538 46 895 672733 GGCGCAGGCACCGCAACC sooosssssssssooss 1522 1539 7 896 672734 GGGCGCAGGCACCGCAAC sooosssssssssooss 1523 1540 26 897
(553) TABLE-US-00039 TABLE 39 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2 SEQ ID SEQ ID NO: 2 NO: 2 SEQ ISIS Start Stop % ID NO Sequence Chemistry Linkage Site Site inhibition NO 576816 GCCTTACTCTAGGACCAAGA eeeee-d10-eeeee sssssssssssssssssss 7990 8009 71 20 672735 TGAGAGCAAGTAGTGGG eeekk-d7-kkeee soosssssssssooss 1326 1342 5 898 672736 GTGAGAGCAAGTAGTGG eeekk-d7-kkeee soosssssssssooss 1327 1343 35 899 672737 TGTGAGAGCAAGTAGTG eeekk-d7-kkeee soosssssssssooss 1328 1344 0 900 672738 CTGTGAGAGCAAGTAGT eeekk-d7-kkeee soosssssssssooss 1329 1345 63 901 672739 ACTGTGAGAGCAAGTAG eeekk-d7-kkeee soosssssssssooss 1330 1346 0 902 672740 TACTGTGAGAGCAAGTA eeekk-d7-kkeee soosssssssssooss 1331 1347 65 903 672741 GTACTGTGAGAGCAAGT eeekk-d7-kkeee soosssssssssooss 1332 1348 13 904 672742 AGTACTGTGAGAGCAAG eeekk-d7-kkeee soosssssssssooss 1333 1349 46 905 672743 GAGTACTGTGAGAGCAA eeekk-d7-kkeee soosssssssssooss 1334 1350 55 906 672744 CGAGTACTGTGAGAGCA eeekk-d7-kkeee soosssssssssooss 1335 1351 76 907 672745 GCGAGTACTGTGAGAGC eeekk-d7-kkeee soosssssssssooss 1336 1352 11 908 672746 AGCGAGTACTGTGAGAG eeekk-d7-kkeee soosssssssssooss 1337 1353 11 909 672747 CAGCGAGTACTGTGAGA eeekk-d7-kkeee soosssssssssooss 1338 1354 51 910 672748 TCAGCGAGTACTGTGAG eeekk-d7-kkeee soosssssssssooss 1339 1355 20 911 672749 CTCAGCGAGTACTGTGA eeekk-d7-kkeee soosssssssssooss 1340 1356 12 912 672750 CCTCAGCGAGTACTGTG eeekk-d7-kkeee soosssssssssooss 1341 1357 2 913 672751 CCCTCAGCGAGTACTGT eeekk-d7-kkeee soosssssssssooss 1342 1358 39 914 672752 ACCCTCAGCGAGTACTG eeekk-d7-kkeee soosssssssssooss 1343 1359 27 915 672753 CACCCTCAGCGAGTACT eeekk-d7-kkeee soosssssssssooss 1344 1360 33 916 672754 TCACCCTCAGCGAGTAC eeekk-d7-kkeee soosssssssssooss 1345 1361 0 917 672755 TTCACCCTCAGCGAGTA eeekk-d7-kkeee soosssssssssooss 1346 1362 13 918 672756 GTTCACCCTCAGCGAGT eeekk-d7-kkeee soosssssssssooss 1347 1363 45 919 672757 TGTTCACCCTCAGCGAG eeekk-d7-kkeee soosssssssssooss 1348 1364 11 920 672758 TTGTTCACCCTCAGCGA eeekk-d7-kkeee soosssssssssooss 1349 1365 0 921 672759 CTTGTTCACCCTCAGCG eeekk-d7-kkeee soosssssssssooss 1350 1366 12 922 672760 TCTTGTTCACCCTCAGC eeekk-d7-kkeee soosssssssssooss 1351 1367 21 923 672761 TTCTTGTTCACCCTCAG eeekk-d7-kkeee soosssssssssooss 1352 1368 0 924 672762 TTTCTTGTTCACCCTCA eeekk-d7-kkeee soosssssssssooss 1353 1369 34 925 672763 TTTTCTTGTTCACCCTC eeekk-d7-kkeee soosssssssssooss 1354 1370 16 926 672764 CTTTTCTTGTTCACCCT eeekk-d7-kkeee soosssssssssooss 1355 1371 2 927 672765 TCTTTTCTTGTTCACCC eeekk-d7-kkeee soosssssssssooss 1356 1372 24 928 672766 GTCTTTTCTTGTTCACC eeekk-d7-kkeee soosssssssssooss 1357 1373 28 929 672767 GGTCTTTTCTTGTTCAC eeekk-d7-kkeee soosssssssssooss 1358 1374 30 930 672768 AGGTCTTTTCTTGTTCA eeekk-d7-kkeee soosssssssssooss 1359 1375 14 931 672769 CAGGTCTTTTCTTGTTC eeekk-d7-kkeee soosssssssssooss 1360 1376 20 932 672770 TCAGGTCTTTTCTTGTT eeekk-d7-kkeee soosssssssssooss 1361 1377 2 933 672771 ATCAGGTCTTTTCTTGT eeekk-d7-kkeee soosssssssssooss 1362 1378 0 934 672772 TATCAGGTCTTTTCTTG eeekk-d7-kkeee soosssssssssooss 1363 1379 23 935 672773 TTATCAGGTCTTTTCTT eeekk-d7-kkeee soosssssssssooss 1364 1380 39 936 672774 ATCTTTATCAGGTCTTT eeekk-d7-kkeee soosssssssssooss 1368 1384 92 937 672775 AATCTTTATCAGGTCTT eeekk-d7-kkeee soosssssssssooss 1369 1385 61 938 672776 TAATCTTTATCAGGTCT eeekk-d7-kkeee soosssssssssooss 1370 1386 2 939 672777 TTAATCTTTATCAGGTC eeekk-d7-kkeee soosssssssssooss 1371 1387 33 940 672778 GTTAATCTTTATCAGGT eeekk-d7-kkeee soosssssssssooss 1372 1388 53 941 672779 GGTTAATCTTTATCAGG eeekk-d7-kkeee soosssssssssooss 1373 1389 40 942 672780 TGGTTAATCTTTATCAG eeekk-d7-kkeee soosssssssssooss 1374 1390 26 943 672781 CTGGTTAATCTTTATCA eeekk-d7-kkeee soosssssssssooss 1375 1391 25 944 672782 TCTGGTTAATCTTTATC eeekk-d7-kkeee soosssssssssooss 1376 1392 44 945 672783 CCCTCCTTGTTTTCTTC eeekk-d7-kkeee soosssssssssooss 1391 1407 37 946 672784 TCCCTCCTTGTTTTCTT eeekk-d7-kkeee soosssssssssooss 1392 1408 10 947 672785 TTCCCTCCTTGTTTTCT eeekk-d7-kkeee soosssssssssooss 1393 1409 0 948 672786 TTTCCCTCCTTGTTTTC eeekk-d7-kkeee soosssssssssooss 1394 1410 0 949 672787 GTTTCCCTCCTTGTTTT eeekk-d7-kkeee soosssssssssooss 1395 1411 0 950 672788 TGTTTCCCTCCTTGTTT eeekk-d7-kkeee soosssssssssooss 1396 1412 0 951 672789 TTGTTTCCCTCCTTGTT eeekk-d7-kkeee soosssssssssooss 1397 1413 0 952 672790 GGTTGTTTCCCTCCTTG eeekk-d7-kkeee soosssssssssooss 1399 1415 33 953 672791 CGGTTGTTTCCCTCCTT eeekk-d7-kkeee soosssssssssooss 1400 1416 0 954 672792 GCGGTTGTTTCCCTCCT eeekk-d7-kkeee soosssssssssooss 1401 1417 23 955 672793 TGCGGTTGTTTCCCTCC eeekk-d7-kkeee soosssssssssooss 1402 1418 0 956 672794 CTGCGGTTGTTTCCCTC eeekk-d7-kkeee soosssssssssooss 1403 1419 25 957 672795 GCTGCGGTTGTTTCCCT eeekk-d7-kkeee soosssssssssooss 1404 1420 5 958 672796 GGCTGCGGTTGTTTCCC eeekk-d7-kkeee soosssssssssooss 1405 1421 16 959 672797 AGGCTGCGGTTGTTTCC eeekk-d7-kkeee soosssssssssooss 1406 1422 7 960 672798 CAGGCTGCGGTTGTTTC eeekk-d7-kkeee soosssssssssooss 1407 1423 0 961 672799 ACAGGCTGCGGTTGTTT eeekk-d7-kkeee soosssssssssooss 1408 1424 28 962 672800 TACAGGCTGCGGTTGTT eeekk-d7-kkeee soosssssssssooss 1409 1425 33 963 672801 CTACAGGCTGCGGTTGT eeekk-d7-kkeee soosssssssssooss 1410 1426 53 964 672802 GCTACAGGCTGCGGTTG eeekk-d7-kkeee soosssssssssooss 1411 1427 0 965 672803 TGCTACAGGCTGCGGTT eeekk-d7-kkeee soosssssssssooss 1412 1428 0 966 672804 TTGCTACAGGCTGCGGT eeekk-d7-kkeee soosssssssssooss 1413 1429 0 967 672805 CTTGCTACAGGCTGCGG eeekk-d7-kkeee soosssssssssooss 1414 1430 1 968 672806 GCTTGCTACAGGCTGCG eeekk-d7-kkeee soosssssssssooss 1415 1431 58 969 672807 AGCTTGCTACAGGCTGC eeekk-d7-kkeee soosssssssssooss 1416 1432 0 970 672808 GAGCTTGCTACAGGCTG eeekk-d7-kkeee soosssssssssooss 1417 1433 0 971 672809 AGAGCTTGCTACAGGCT eeekk-d7-kkeee soosssssssssooss 1418 1434 71 972 672810 CAGAGCTTGCTACAGGC eeekk-d7-kkeee soosssssssssooss 1419 1435 18 973 672811 CCAGAGCTTGCTACAGG eeekk-d7-kkeee soosssssssssooss 1420 1436 0 974 672812 TCCAGAGCTTGCTACAG eeekk-d7-kkeee soosssssssssooss 1421 1437 19 975 672813 TTCCAGAGCTTGCTACA eeekk-d7-kkeee soosssssssssooss 1422 1438 19 976 672814 GTTCCAGAGCTTGCTAC eeekk-d7-kkeee soosssssssssooss 1423 1439 0 977 672815 AGTTCCAGAGCTTGCTA eeekk-d7-kkeee soosssssssssooss 1424 1440 0 978 672816 GAGTTCCAGAGCTTGCT eeekk-d7-kkeee soosssssssssooss 1425 1441 14 979 672817 TGAGTTCCAGAGCTTGC eeekk-d7-kkeee soosssssssssooss 1426 1442 31 980 672818 CTGAGTTCCAGAGCTTG eeekk-d7-kkeee soosssssssssooss 1427 1443 21 981 672819 CCTGAGTTCCAGAGCTT eeekk-d7-kkeee soosssssssssooss 1428 1444 19 982 672820 TCCTGAGTTCCAGAGCT eeekk-d7-kkeee soosssssssssooss 1429 1445 46 983 672821 CTCCTGAGTTCCAGAGC eeekk-d7-kkeee soosssssssssooss 1430 1446 7 984 672822 ACTCCTGAGTTCCAGAG eeekk-d7-kkeee soosssssssssooss 1431 1447 13 985 672823 GACTCCTGAGTTCCAGA eeekk-d7-kkeee soosssssssssooss 1432 1448 19 986 672824 CGACTCCTGAGTTCCAG eeekk-d7-kkeee soosssssssssooss 1433 1449 23 987 672825 GCGACTCCTGAGTTCCA eeekk-d7-kkeee soosssssssssooss 1434 1450 0 988 672826 CGCGACTCCTGAGTTCC eeekk-d7-kkeee soosssssssssooss 1435 1451 19 989 672827 GCGCGACTCCTGAGTTC eeekk-d7-kkeee soosssssssssooss 1436 1452 31 990 672828 CGCGCGACTCCTGAGTT eeekk-d7-kkeee soosssssssssooss 1437 1453 63 991 672829 GCGCGCGACTCCTGAGT eeekk-d7-kkeee soosssssssssooss 1438 1454 28 992 672830 AGCGCGCGACTCCTGAG eeekk-d7-kkeee soosssssssssooss 1439 1455 58 993 672831 TAGCGCGCGACTCCTGA eeekk-d7-kkeee soosssssssssooss 1440 1456 42 994 672832 CTAGCGCGCGACTCCTG eeekk-d7-kkeee soosssssssssooss 1441 1457 42 995 672833 CCTAGCGCGCGACTCCT eeekk-d7-kkeee soosssssssssooss 1442 1458 24 996 672834 CCCTAGCGCGCGACTCC eeekk-d7-kkeee soosssssssssooss 1443 1459 58 997 672835 CCCCTAGCGCGCGACTC eeekk-d7-kkeee soosssssssssooss 1444 1460 40 998 672836 GCCCCTAGCGCGCGACT eeekk-d7-kkeee soosssssssssooss 1445 1461 0 999 672837 GGCCCCTAGCGCGCGAC eeekk-d7-kkeee soosssssssssooss 1446 1462 2 1000 672838 CGGCCCCTAGCGCGCGA eeekk-d7-kkeee soosssssssssooss 1447 1463 72 1001 672839 CCGGCCCCTAGCGCGCG eeekk-d7-kkeee soosssssssssooss 1448 1464 0 1002 672840 CCCGGCCCCTAGCGCGC eeekk-d7-kkeee soosssssssssooss 1449 1465 28 1003 672841 CCCCGGCCCCTAGCGCG eeekk-d7-kkeee soosssssssssooss 1450 1466 28 1004 672842 GCCCCGGCCCCTAGCGC eeekk-d7-kkeee soosssssssssooss 1451 1467 0 1005 672843 GGCCCCGGCCCCTAGCG eeekk-d7-kkeee soosssssssssooss 1452 1468 23 1006 672844 CGGCCCCGGCCCCTAGC eeekk-d7-kkeee soosssssssssooss 1453 1469 26 1007 672845 CCGGCCCCGGCCCCTAG eeekk-d7-kkeee soosssssssssooss 1454 1470 24 1008 672846 CCCGGCCCCGGCCCCTA eeekk-d7-kkeee soosssssssssooss 1455 1471 9 1009 672847 ACGCCCCGGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1465 1481 3 1010 672848 CACGCCCCGGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1466 1482 19 1011 672849 CCACGCCCCGGCCCCGG eeekk-d7-kkeee soosssssssssooss 1467 1483 50 1012 672850 ACCACGCCCCGGCCCCG eeekk-d7-kkeee soosssssssssooss 1468 1484 0 1013 672851 GACCACGCCCCGGCCCC eeekk-d7-kkeee soosssssssssooss 1469 1485 3 1014 672852 CGACCACGCCCCGGCCC eeekk-d7-kkeee soosssssssssooss 1470 1486 9 1015 672853 CCGACCACGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1471 1487 24 1016 672854 CCCGACCACGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1472 1488 9 1017 672855 CCCCGACCACGCCCCGG eeekk-d7-kkeee soosssssssssooss 1473 1489 18 1018 672856 GCCCCGACCACGCCCCG eeekk-d7-kkeee soosssssssssooss 1474 1490 8 1019 672857 CGCCCCGACCACGCCCC eeekk-d7-kkeee soosssssssssooss 1475 1491 0 1020 672858 CCGCCCCGACCACGCCC eeekk-d7-kkeee soosssssssssooss 1476 1492 48 1021 672859 CCCGCCCCGACCACGCC eeekk-d7-kkeee soosssssssssooss 1477 1493 28 1022 672860 GCCCGCCCCGACCACGC eeekk-d7-kkeee soosssssssssooss 1478 1494 0 1023 672861 GGCCCGCCCCGACCACG eeekk-d7-kkeee soosssssssssooss 1479 1495 33 1024 672862 GGGCCCGCCCCGACCAC eeekk-d7-kkeee soosssssssssooss 1480 1496 32 1025 672863 CGGGCCCGCCCCGACCA eeekk-d7-kkeee soosssssssssooss 1481 1497 0 1026 672864 CCGGGCCCGCCCCGACC eeekk-d7-kkeee soosssssssssooss 1482 1498 0 1027 672865 CCCGGGCCCGCCCCGAC eeekk-d7-kkeee soosssssssssooss 1483 1499 11 1028 672866 GCAGCCCCGCCCCGGGC eeekk-d7-kkeee soosssssssssooss 1505 1521 23 1029 672867 CGCAGCCCCGCCCCGGG eeekk-d7-kkeee soosssssssssooss 1506 1522 26 1030 672868 CCGCAGCCCCGCCCCGG eeekk-d7-kkeee soosssssssssooss 1507 1523 2 1031 672869 ACCGCAGCCCCGCCCCG eeekk-d7-kkeee soosssssssssooss 1508 1524 8 1032 672870 AACCGCAGCCCCGCCCC eeekk-d7-kkeee soosssssssssooss 1509 1525 7 1033 672871 CAACCGCAGCCCCGCCC eeekk-d7-kkeee soosssssssssooss 1510 1526 1 1034 672872 GCAACCGCAGCCCCGCC eeekk-d7-kkeee soosssssssssooss 1511 1527 37 1035 672873 CGCAACCGCAGCCCCGC eeekk-d7-kkeee soosssssssssooss 1512 1528 20 1036 672874 CCGCAACCGCAGCCCCG eeekk-d7-kkeee soosssssssssooss 1513 1529 23 1037 672875 ACCGCAACCGCAGCCCC eeekk-d7-kkeee soosssssssssooss 1514 1530 8 1038 672876 CACCGCAACCGCAGCCC eeekk-d7-kkeee soosssssssssooss 1515 1531 22 1039 672877 GCACCGCAACCGCAGCC eeekk-d7-kkeee soosssssssssooss 1516 1532 19 1040 672878 GGCACCGCAACCGCAGC eeekk-d7-kkeee soosssssssssooss 1517 1533 25 1041 672879 AGGCACCGCAACCGCAG eeekk-d7-kkeee soosssssssssooss 1518 1534 21 1042 672880 CAGGCACCGCAACCGCA eeekk-d7-kkeee soosssssssssooss 1519 1535 12 1043 672881 GCAGGCACCGCAACCGC eeekk-d7-kkeee soosssssssssooss 1520 1536 18 1044 672882 CGCAGGCACCGCAACCG eeekk-d7-kkeee soosssssssssooss 1521 1537 15 1045 672883 GCGCAGGCACCGCAACC eeekk-d7-kkeee soosssssssssooss 1522 1538 0 1046 672884 GGCGCAGGCACCGCAAC eeekk-d7-kkeee soosssssssssooss 1523 1539 0 1047
Example 9: Dose-Dependent Antisense Inhibition of Human C9ORF72 mRNA in HepG2 Cells
(554) Antisense oligonucleotides from the study described in Example 8 hereinabove exhibiting significant in vitro inhibition of C9ORF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 576816, previously tested in PCT/US2013/065073 (claiming priority to U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.11 μM, 0.33 μM, 1.00 M, or 3.00 μM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72 levels, relative to untreated control cells.
(555) As shown in Tables 39 and 40, total C9ORF72 mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
(556) TABLE-US-00040 TABLE 39 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.11 0.33 1.00 3.00 ISIS No μM μM μM μM 672651 12 39 63 88 672611 13 50 59 79 672602 16 36 62 79 672624 25 54 80 95 672657 19 30 53 75 672582 0 0 20 57 672683 33 57 73 84 672595 39 39 66 88 576816 23 53 78 87 672640 17 26 56 84 672599 28 59 69 87 672637 36 50 66 88 672592 16 38 37 65 672636 24 39 69 88 672652 26 48 63 94 672619 8 12 6 0 672608 12 45 37 59 672598 21 9 55 69 672642 28 35 59 72
(557) TABLE-US-00041 TABLE 40 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.11 0.33 1.00 3.00 ISIS No μM μM μM μM 672679 2 52 81 95 672693 14 41 53 83 672681 27 42 63 87 672683 10 35 64 82 672678 24 56 77 91 672699 17 31 46 83 672664 7 28 58 87 672665 35 46 62 75 576816 15 55 71 84 672671 36 66 79 87 672676 33 53 71 77 672700 25 45 68 81 672730 24 41 59 80 672670 25 40 60 75 672697 11 41 64 80 672723 30 48 68 88 672728 11 44 49 68 672675 41 48 74 88 672674 19 34 55 61
Example 10: Antisense Inhibition of C9ORF72 by Deoxy, MOE and cEt Antisense Oligonucleotides with Mixed Backbones
(558) Antisense oligonucleotides described in Example 6 hereinabove (see Tables 25-28 hereinabove) were tested in HepG2 cells in a series of experiments that had similar culture conditions. ISIS 576816, which was previously tested in PCT/US2013/065073 (claiming priority to U.S. Application No. 61/714,132, filed Oct. 15, 2012) was used as a benchmark oligonucleotide for study with deoxy, MOE, and cEt antisense oligonucleotides. The results for each experiment are presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 700 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C9ORF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72, relative to untreated control cells.
(559) TABLE-US-00042 TABLE 41 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop % ID NO Sequence Chemistry Linkage Site Site inhibition NO 576816 GCCTTACTCTAGGACCAAGA eeeee-d10-eeeee sssssssssssssssssss 7990 8009 52 20 672885 TGAGAGCAAGTAGTGGG eekk-d8-kkeee soosssssssssooss 1326 1342 10 898 672886 GTGAGAGCAAGTAGTGG eekk-d8-kkeee soosssssssssooss 1327 1343 24 899 672887 TGTGAGAGCAAGTAGTG eekk-d8-kkeee soosssssssssooss 1328 1344 38 900 672888 CTGTGAGAGCAAGTAGT eekk-d8-kkeee soosssssssssooss 1329 1345 37 901 672889 ACTGTGAGAGCAAGTAG eekk-d8-kkeee soosssssssssooss 1330 1346 16 902 672890 TACTGTGAGAGCAAGTA eekk-d8-kkeee soosssssssssooss 1331 1347 26 903 672891 GTACTGTGAGAGCAAGT eekk-d8-kkeee soosssssssssooss 1332 1348 38 904 672892 AGTACTGTGAGAGCAAG eekk-d8-kkeee soosssssssssooss 1333 1349 44 905 672893 GAGTACTGTGAGAGCAA eekk-d8-kkeee soosssssssssooss 1334 1350 57 906 672894 CGAGTACTGTGAGAGCA eekk-d8-kkeee soosssssssssooss 1335 1351 62 907 672895 GCGAGTACTGTGAGAGC eekk-d8-kkeee soosssssssssooss 1336 1352 39 908 672896 AGCGAGTACTGTGAGAG eekk-d8-kkeee soosssssssssooss 1337 1353 54 909 672897 CAGCGAGTACTGTGAGA eekk-d8-kkeee soosssssssssooss 1338 1354 57 910 672898 TCAGCGAGTACTGTGAG eekk-d8-kkeee soosssssssssooss 1339 1355 23 911 672899 CTCAGCGAGTACTGTGA eekk-d8-kkeee soosssssssssooss 1340 1356 34 912 672900 CCTCAGCGAGTACTGTG eekk-d8-kkeee soosssssssssooss 1341 1357 33 913 672901 CCCTCAGCGAGTACTGT eekk-d8-kkeee soosssssssssooss 1342 1358 32 914 672902 ACCCTCAGCGAGTACTG eekk-d8-kkeee soosssssssssooss 1343 1359 62 915 672903 CACCCTCAGCGAGTACT eekk-d8-kkeee soosssssssssooss 1344 1360 59 916 672904 TCACCCTCAGCGAGTAC eekk-d8-kkeee soosssssssssooss 1345 1361 52 917 672905 TTCACCCTCAGCGAGTA eekk-d8-kkeee soosssssssssooss 1346 1362 50 918 672906 GTTCACCCTCAGCGAGT eekk-d8-kkeee soosssssssssooss 1347 1363 38 919 672907 TGTTCACCCTCAGCGAG eekk-d8-kkeee soosssssssssooss 1348 1364 20 920 672908 TTGTTCACCCTCAGCGA eekk-d8-kkeee soosssssssssooss 1349 1365 57 921 672909 CTTGTTCACCCTCAGCG eekk-d8-kkeee soosssssssssooss 1350 1366 66 922 672910 TCTTGTTCACCCTCAGC eekk-d8-kkeee soosssssssssooss 1351 1367 47 923 672911 TTCTTGTTCACCCTCAG eekk-d8-kkeee soosssssssssooss 1352 1368 37 924 672912 TTTCTTGTTCACCCTCA eekk-d8-kkeee soosssssssssooss 1353 1369 36 925 672913 TTTTCTTGTTCACCCTC eekk-d8-kkeee soosssssssssooss 1354 1370 34 926 672914 CTTTTCTTGTTCACCCT eekk-d8-kkeee soosssssssssooss 1355 1371 35 927 672915 TCTTTTCTTGTTCACCC eekk-d8-kkeee soosssssssssooss 1356 1372 41 928 672916 GTCTTTTCTTGTTCACC eekk-d8-kkeee soosssssssssooss 1357 1373 34 929 672917 GGTCTTTTCTTGTTCAC eekk-d8-kkeee soosssssssssooss 1358 1374 23 930 672918 AGGTCTTTTCTTGTTCA eekk-d8-kkeee soosssssssssooss 1359 1375 31 931 672919 CAGGTCTTTTCTTGTTC eekk-d8-kkeee soosssssssssooss 1360 1376 51 932 672920 TCAGGTCTTTTCTTGTT eekk-d8-kkeee soosssssssssooss 1361 1377 15 933 672921 ATCAGGTCTTTTCTTGT eekk-d8-kkeee soosssssssssooss 1362 1378 0 934 672922 TATCAGGTCTTTTCTTG eekk-d8-kkeee soosssssssssooss 1363 1379 31 935 672923 TTATCAGGTCTTTTCTT eekk-d8-kkeee soosssssssssooss 1364 1380 14 936 672924 ATCTTTATCAGGTCTTT eekk-d8-kkeee soosssssssssooss 1368 1384 71 937 672925 AATCTTTATCAGGTCTT eekk-d8-kkeee soosssssssssooss 1369 1385 72 938 672926 TAATCTTTATCAGGTCT eekk-d8-kkeee soosssssssssooss 1370 1386 40 939 672927 TTAATCTTTATCAGGTC eekk-d8-kkeee soosssssssssooss 1371 1387 66 940 672928 GTTAATCTTTATCAGGT eekk-d8-kkeee soosssssssssooss 1372 1388 56 941 672929 GGTTAATCTTTATCAGG eekk-d8-kkeee soosssssssssooss 1373 1389 80 942 672930 TGGTTAATCTTTATCAG eekk-d8-kkeee soosssssssssooss 1374 1390 48 943 672931 CTGGTTAATCTTTATCA eekk-d8-kkeee soosssssssssooss 1375 1391 48 944 672932 TCTGGTTAATCTTTATC eekk-d8-kkeee soosssssssssooss 1376 1392 54 945 672933 CCCTCCTTGTTTTCTTC eekk-d8-kkeee soosssssssssooss 1391 1407 18 946 672934 TCCCTCCTTGTTTTCTT eekk-d8-kkeee soosssssssssooss 1392 1408 7 947 672935 TTCCCTCCTTGTTTTCT eekk-d8-kkeee soosssssssssooss 1393 1409 10 948 672936 TTTCCCTCCTTGTTTTC eekk-d8-kkeee soosssssssssooss 1394 1410 0 949 672937 GTTTCCCTCCTTGTTTT eekk-d8-kkeee soosssssssssooss 1395 1411 0 950 672938 TGTTTCCCTCCTTGTTT eekk-d8-kkeee soosssssssssooss 1396 1412 9 951 672939 TTGTTTCCCTCCTTGTT eekk-d8-kkeee soosssssssssooss 1397 1413 27 952 672940 GGTTGTTTCCCTCCTTG eekk-d8-kkeee soosssssssssooss 1399 1415 49 953 672941 CGGTTGTTTCCCTCCTT eekk-d8-kkeee soosssssssssooss 1400 1416 17 954 672942 GCGGTTGTTTCCCTCCT eekk-d8-kkeee soosssssssssooss 1401 1417 10 955 672943 TGCGGTTGTTTCCCTCC eekk-d8-kkeee soosssssssssooss 1402 1418 33 956 672944 CTGCGGTTGTTTCCCTC eekk-d8-kkeee soosssssssssooss 1403 1419 29 957 672945 GCTGCGGTTGTTTCCCT eekk-d8-kkeee soosssssssssooss 1404 1420 23 958 672946 GGCTGCGGTTGTTTCCC eekk-d8-kkeee soosssssssssooss 1405 1421 15 959 672947 AGGCTGCGGTTGTTTCC eekk-d8-kkeee soosssssssssooss 1406 1422 24 960 672948 CAGGCTGCGGTTGTTTC eekk-d8-kkeee soosssssssssooss 1407 1423 49 961 672949 ACAGGCTGCGGTTGTTT eekk-d8-kkeee soosssssssssooss 1408 1424 35 962 672950 TACAGGCTGCGGTTGTT eekk-d8-kkeee soosssssssssooss 1409 1425 37 963 672951 CTACAGGCTGCGGTTGT eekk-d8-kkeee soosssssssssooss 1410 1426 4 964 672952 GCTACAGGCTGCGGTTG eekk-d8-kkeee soosssssssssooss 1411 1427 4 965 672953 TGCTACAGGCTGCGGTT eekk-d8-kkeee soosssssssssooss 1412 1428 24 966 672954 TTGCTACAGGCTGCGGT eekk-d8-kkeee soosssssssssooss 1413 1429 8 967 672955 CTTGCTACAGGCTGCGG eekk-d8-kkeee soosssssssssooss 1414 1430 28 968 672956 GCTTGCTACAGGCTGCG eekk-d8-kkeee soosssssssssooss 1415 1431 8 969 672957 AGCTTGCTACAGGCTGC eekk-d8-kkeee soosssssssssooss 1416 1432 5 970 672958 GAGCTTGCTACAGGCTG eekk-d8-kkeee soosssssssssooss 1417 1433 4 971 672959 AGAGCTTGCTACAGGCT eekk-d8-kkeee soosssssssssooss 1418 1434 0 972 672960 CAGAGCTTGCTACAGGC eekk-d8-kkeee soosssssssssooss 1419 1435 12 973 672961 CCAGAGCTTGCTACAGG eekk-d8-kkeee soosssssssssooss 1420 1436 36 974 672962 TCCAGAGCTTGCTACAG eekk-d8-kkeee soosssssssssooss 1421 1437 0 975 672963 TTCCAGAGCTTGCTACA eekk-d8-kkeee soosssssssssooss 1422 1438 11 976 672964 GTTCCAGAGCTTGCTAC eekk-d8-kkeee soosssssssssooss 1423 1439 8 977 672965 AGTTCCAGAGCTTGCTA eekk-d8-kkeee soosssssssssooss 1424 1440 19 978 672966 GAGTTCCAGAGCTTGCT eekk-d8-kkeee soosssssssssooss 1425 1441 48 979 672967 TGAGTTCCAGAGCTTGC eekk-d8-kkeee soosssssssssooss 1426 1442 41 980 672968 CTGAGTTCCAGAGCTTG eekk-d8-kkeee soosssssssssooss 1427 1443 54 981 672969 CCTGAGTTCCAGAGCTT eekk-d8-kkeee soosssssssssooss 1428 1444 58 982 672970 TCCTGAGTTCCAGAGCT eekk-d8-kkeee soosssssssssooss 1429 1445 12 983 672971 CTCCTGAGTTCCAGAGC eekk-d8-kkeee soosssssssssooss 1430 1446 23 984 672972 ACTCCTGAGTTCCAGAG eekk-d8-kkeee soosssssssssooss 1431 1447 30 985 672973 GACTCCTGAGTTCCAGA eekk-d8-kkeee soosssssssssooss 1432 1448 39 986 672974 CGACTCCTGAGTTCCAG eekk-d8-kkeee soosssssssssooss 1433 1449 41 987 672975 GCGACTCCTGAGTTCCA eekk-d8-kkeee soosssssssssooss 1434 1450 31 988 672976 CGCGACTCCTGAGTTCC eekk-d8-kkeee soosssssssssooss 1435 1451 56 989 672977 GCGCGACTCCTGAGTTC eekk-d8-kkeee soosssssssssooss 1436 1452 31 990 672978 CGCGCGACTCCTGAGTT eekk-d8-kkeee soosssssssssooss 1437 1453 45 991 672979 GCGCGCGACTCCTGAGT eekk-d8-kkeee soosssssssssooss 1438 1454 29 992 672980 AGCGCGCGACTCCTGAG eekk-d8-kkeee soosssssssssooss 1439 1455 48 993 672981 TAGCGCGCGACTCCTGA eekk-d8-kkeee soosssssssssooss 1440 1456 68 994 672982 CTAGCGCGCGACTCCTG eekk-d8-kkeee soosssssssssooss 1441 1457 59 995 672983 CCTAGCGCGCGACTCCT eekk-d8-kkeee soosssssssssooss 1442 1458 62 996 672984 CCCTAGCGCGCGACTCC eekk-d8-kkeee soosssssssssooss 1443 1459 69 997 672985 CCCCTAGCGCGCGACTC eekk-d8-kkeee soosssssssssooss 1444 1460 65 998 672986 GCCCCTAGCGCGCGACT eekk-d8-kkeee soosssssssssooss 1445 1461 34 999 672987 GGCCCCTAGCGCGCGAC eekk-d8-kkeee soosssssssssooss 1446 1462 22 1000 672988 CGGCCCCTAGCGCGCGA eekk-d8-kkeee soosssssssssooss 1447 1463 16 1001 672989 CCGGCCCCTAGCGCGCG eekk-d8-kkeee soosssssssssooss 1448 1464 24 1002 672990 CCCGGCCCCTAGCGCGC eekk-d8-kkeee soosssssssssooss 1449 1465 10 1003 672991 CCCCGGCCCCTAGCGCG eekk-d8-kkeee soosssssssssooss 1450 1466 24 1004 672992 GCCCCGGCCCCTAGCGC eekk-d8-kkeee soosssssssssooss 1451 1467 29 1005 672993 GGCCCCGGCCCCTAGCG eekk-d8-kkeee soosssssssssooss 1452 1468 24 1006 672994 CGGCCCCGGCCCCTAGC eekk-d8-kkeee soosssssssssooss 1453 1469 25 1007 672995 CCGGCCCCGGCCCCTAG eekk-d8-kkeee soosssssssssooss 1454 1470 28 1008 672996 CCCGGCCCCGGCCCCTA eekk-d8-kkeee soosssssssssooss 1455 1471 25 1009 672997 ACGCCCCGGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1465 1481 21 1010 672998 CACGCCCCGGCCCCGGC eekk-d8-kkeee soosssssssssooss 1466 1482 17 1011 672999 CCACGCCCCGGCCCCGG eekk-d8-kkeee soosssssssssooss 1467 1483 30 1012 673000 ACCACGCCCCGGCCCCG eekk-d8-kkeee soosssssssssooss 1468 1484 29 1013 673001 GACCACGCCCCGGCCCC eekk-d8-kkeee soosssssssssooss 1469 1485 25 1014 673002 CGACCACGCCCCGGCCC eekk-d8-kkeee soosssssssssooss 1470 1486 37 1015 673003 CCGACCACGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1471 1487 23 1016 673004 CCCGACCACGCCCCGGC eekk-d8-kkeee soosssssssssooss 1472 1488 21 1017 673005 CCCCGACCACGCCCCGG eekk-d8-kkeee soosssssssssooss 1473 1489 9 1018 673006 GCCCCGACCACGCCCCG eekk-d8-kkeee soosssssssssooss 1474 1490 13 1019 673007 CGCCCCGACCACGCCCC eekk-d8-kkeee soosssssssssooss 1475 1491 17 1020 673008 CCGCCCCGACCACGCCC eekk-d8-kkeee soosssssssssooss 1476 1492 20 1021 673009 CCCGCCCCGACCACGCC eekk-d8-kkeee soosssssssssooss 1477 1493 36 1022 673010 GCCCGCCCCGACCACGC eekk-d8-kkeee soosssssssssooss 1478 1494 16 1023 673011 GGCCCGCCCCGACCACG eekk-d8-kkeee soosssssssssooss 1479 1495 3 1024 673012 GGGCCCGCCCCGACCAC eekk-d8-kkeee soosssssssssooss 1480 1496 21 1025 673013 CGGGCCCGCCCCGACCA eekk-d8-kkeee soosssssssssooss 1481 1497 4 1026 673014 CCGGGCCCGCCCCGACC eekk-d8-kkeee soosssssssssooss 1482 1498 21 1027 673015 CCCGGGCCCGCCCCGAC eekk-d8-kkeee soosssssssssooss 1483 1499 15 1028 673016 GCAGCCCCGCCCCGGGC eekk-d8-kkeee soosssssssssooss 1505 1521 3 1029 673017 CGCAGCCCCGCCCCGGG eekk-d8-kkeee soosssssssssooss 1506 1522 7 1030 673018 CCGCAGCCCCGCCCCGG eekk-d8-kkeee soosssssssssooss 1507 1523 7 1031 673019 ACCGCAGCCCCGCCCCG eekk-d8-kkeee soosssssssssooss 1508 1524 8 1032 673020 AACCGCAGCCCCGCCCC eekk-d8-kkeee soosssssssssooss 1509 1525 42 1033 673021 CAACCGCAGCCCCGCCC eekk-d8-kkeee soosssssssssooss 1510 1526 58 1034 673022 GCAACCGCAGCCCCGCC eekk-d8-kkeee soosssssssssooss 1511 1527 44 1035 673023 CGCAACCGCAGCCCCGC eekk-d8-kkeee soosssssssssooss 1512 1528 46 1036 673024 CCGCAACCGCAGCCCCG eekk-d8-kkeee soosssssssssooss 1513 1529 26 1037 673025 ACCGCAACCGCAGCCCC eekk-d8-kkeee soosssssssssooss 1514 1530 20 1038 673026 CACCGCAACCGCAGCCC eekk-d8-kkeee soosssssssssooss 1515 1531 52 1039 673027 GCACCGCAACCGCAGCC eekk-d8-kkeee soosssssssssooss 1516 1532 22 1040 673028 GGCACCGCAACCGCAGC eekk-d8-kkeee soosssssssssooss 1517 1533 32 1041 673029 AGGCACCGCAACCGCAG eekk-d8-kkeee soosssssssssooss 1518 1534 27 1042 673030 CAGGCACCGCAACCGCA eekk-d8-kkeee soosssssssssooss 1519 1535 32 1043 673031 GCAGGCACCGCAACCGC eekk-d8-kkeee soosssssssssooss 1520 1536 38 1044 673032 CGCAGGCACCGCAACCG eekk-d8-kkeee soosssssssssooss 1521 1537 54 1045 673033 GCGCAGGCACCGCAACC eekk-d8-kkeee soosssssssssooss 1522 1538 24 1046 673034 GGCGCAGGCACCGCAAC eekk-d8-kkeee soosssssssssooss 1523 1539 17 1047
(560) TABLE-US-00043 TABLE 42 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop % ID NO Sequence Chemistry Linkage Site Site inhibition NO 576816 GCCTTACTCTAGGACCAAGA eeeee-d10-eeeee sssssssssssssssssss 7990 8009 75 20 673035 TGAGAGCAAGTAGTGGG ek-d8-ekekeee sosssssssssoooss 1326 1342 47 898 673036 GTGAGAGCAAGTAGTGG ek-d8-ekekeee sosssssssssoooss 1327 1343 57 899 673037 TGTGAGAGCAAGTAGTG ek-d8-ekekeee sosssssssssoooss 1328 1344 39 900 673038 CTGTGAGAGCAAGTAGT ek-d8-ekekeee sosssssssssoooss 1329 1345 48 901 673039 ACTGTGAGAGCAAGTAG ek-d8-ekekeee sosssssssssoooss 1330 1346 35 902 673040 TACTGTGAGAGCAAGTA ek-d8-ekekeee sosssssssssoooss 1331 1347 40 903 673041 GTACTGTGAGAGCAAGT ek-d8-ekekeee sosssssssssoooss 1332 1348 35 904 673042 AGTACTGTGAGAGCAAG ek-d8-ekekeee sosssssssssoooss 1333 1349 26 905 673043 GAGTACTGTGAGAGCAA ek-d8-ekekeee sosssssssssoooss 1334 1350 44 906 673044 CGAGTACTGTGAGAGCA ek-d8-ekekeee sosssssssssoooss 1335 1351 44 907 673045 GCGAGTACTGTGAGAGC ek-d8-ekekeee sosssssssssoooss 1336 1352 36 908 673046 AGCGAGTACTGTGAGAG ek-d8-ekekeee sosssssssssoooss 1337 1353 37 909 673047 CAGCGAGTACTGTGAGA ek-d8-ekekeee sosssssssssoooss 1338 1354 66 910 673048 TCAGCGAGTACTGTGAG ek-d8-ekekeee sosssssssssoooss 1339 1355 22 911 673049 CTCAGCGAGTACTGTGA ek-d8-ekekeee sosssssssssoooss 1340 1356 49 912 673050 CCTCAGCGAGTACTGTG ek-d8-ekekeee sosssssssssoooss 1341 1357 53 913 673051 CCCTCAGCGAGTACTGT ek-d8-ekekeee sosssssssssoooss 1342 1358 52 914 673052 ACCCTCAGCGAGTACTG ek-d8-ekekeee sosssssssssoooss 1343 1359 20 915 673053 CACCCTCAGCGAGTACT ek-d8-ekekeee sosssssssssoooss 1344 1360 66 916 673054 TCACCCTCAGCGAGTAC ek-d8-ekekeee sosssssssssoooss 1345 1361 50 917 673055 TTCACCCTCAGCGAGTA ek-d8-ekekeee sosssssssssoooss 1346 1362 35 918 673056 GTTCACCCTCAGCGAGT ek-d8-ekekeee sosssssssssoooss 1347 1363 46 919 673057 TGTTCACCCTCAGCGAG ek-d8-ekekeee sosssssssssoooss 1348 1364 51 920 673058 TTGTTCACCCTCAGCGA ek-d8-ekekeee sosssssssssoooss 1349 1365 57 921 673059 CTTGTTCACCCTCAGCG ek-d8-ekekeee sosssssssssoooss 1350 1366 50 922 673060 TCTTGTTCACCCTCAGC ek-d8-ekekeee sosssssssssoooss 1351 1367 41 923 673061 TTCTTGTTCACCCTCAG ek-d8-ekekeee sosssssssssoooss 1352 1368 14 924 673062 TTTCTTGTTCACCCTCA ek-d8-ekekeee sosssssssssoooss 1353 1369 28 925 673063 TTTTCTTGTTCACCCTC ek-d8-ekekeee sosssssssssoooss 1354 1370 38 926 673064 CTTTTCTTGTTCACCCT ek-d8-ekekeee sosssssssssoooss 1355 1371 38 927 673065 TCTTTTCTTGTTCACCC ek-d8-ekekeee sosssssssssoooss 1356 1372 30 928 673066 GTCTTTTCTTGTTCACC ek-d8-ekekeee sosssssssssoooss 1357 1373 47 929 673067 GGTCTTTTCTTGTTCAC ek-d8-ekekeee sosssssssssoooss 1358 1374 63 930 673068 AGGTCTTTTCTTGTTCA ek-d8-ekekeee sosssssssssoooss 1359 1375 71 931 673069 CAGGTCTTTTCTTGTTC ek-d8-ekekeee sosssssssssoooss 1360 1376 41 932 673070 TCAGGTCTTTTCTTGTT ek-d8-ekekeee sosssssssssoooss 1361 1377 24 933 673071 ATCAGGTCTTTTCTTGT ek-d8-ekekeee sosssssssssoooss 1362 1378 53 934 673072 TATCAGGTCTTTTCTTG ek-d8-ekekeee sosssssssssoooss 1363 1379 44 935 673073 TTATCAGGTCTTTTCTT ek-d8-ekekeee sosssssssssoooss 1364 1380 28 936 673074 ATCTTTATCAGGTCTTT ek-d8-ekekeee sosssssssssoooss 1368 1384 57 937 673075 AATCTTTATCAGGTCTT ek-d8-ekekeee sosssssssssoooss 1369 1385 49 938 673076 TAATCTTTATCAGGTCT ek-d8-ekekeee sosssssssssoooss 1370 1386 40 939 673077 TTAATCTTTATCAGGTC ek-d8-ekekeee sosssssssssoooss 1371 1387 33 940 673078 GTTAATCTTTATCAGGT ek-d8-ekekeee sosssssssssoooss 1372 1388 46 941 673079 GGTTAATCTTTATCAGG ek-d8-ekekeee sosssssssssoooss 1373 1389 87 942 673080 TGGTTAATCTTTATCAG ek-d8-ekekeee sosssssssssoooss 1374 1390 35 943 673081 CTGGTTAATCTTTATCA ek-d8-ekekeee sosssssssssoooss 1375 1391 56 944 673082 TCTGGTTAATCTTTATC ek-d8-ekekeee sosssssssssoooss 1376 1392 59 945 673083 CCCTCCTTGTTTTCTTC ek-d8-ekekeee sosssssssssoooss 1391 1407 11 946 673084 TCCCTCCTTGTTTTCTT ek-d8-ekekeee sosssssssssoooss 1392 1408 10 947 673085 TTCCCTCCTTGTTTTCT ek-d8-ekekeee sosssssssssoooss 1393 1409 8 948 673086 TTTCCCTCCTTGTTTTC ek-d8-ekekeee sosssssssssoooss 1394 1410 26 949 673087 GTTTCCCTCCTTGTTTT ek-d8-ekekeee sosssssssssoooss 1395 1411 25 950 673088 TGTTTCCCTCCTTGTTT ek-d8-ekekeee sosssssssssoooss 1396 1412 62 951 673089 TTGTTTCCCTCCTTGTT ek-d8-ekekeee sosssssssssoooss 1397 1413 51 952 673090 GGTTGTTTCCCTCCTTG ek-d8-ekekeee sosssssssssoooss 1399 1415 34 953 673091 CGGTTGTTTCCCTCCTT ek-d8-ekekeee sosssssssssoooss 1400 1416 13 954 673092 GCGGTTGTTTCCCTCCT ek-d8-ekekeee sosssssssssoooss 1401 1417 37 955 673093 TGCGGTTGTTTCCCTCC ek-d8-ekekeee sosssssssssoooss 1402 1418 49 956 673094 CTGCGGTTGTTTCCCTC ek-d8-ekekeee sosssssssssoooss 1403 1419 15 957 673095 GCTGCGGTTGTTTCCCT ek-d8-ekekeee sosssssssssoooss 1404 1420 17 958 673096 GGCTGCGGTTGTTTCCC ek-d8-ekekeee sosssssssssoooss 1405 1421 33 959 673097 AGGCTGCGGTTGTTTCC ek-d8-ekekeee sosssssssssoooss 1406 1422 43 960 673098 CAGGCTGCGGTTGTTTC ek-d8-ekekeee sosssssssssoooss 1407 1423 53 961 673099 ACAGGCTGCGGTTGTTT ek-d8-ekekeee sosssssssssoooss 1408 1424 21 962 673100 TACAGGCTGCGGTTGTT ek-d8-ekekeee sosssssssssoooss 1409 1425 23 963 673101 CTACAGGCTGCGGTTGT ek-d8-ekekeee sosssssssssoooss 1410 1426 16 964 673102 GCTACAGGCTGCGGTTG ek-d8-ekekeee sosssssssssoooss 1411 1427 24 965 673103 TGCTACAGGCTGCGGTT ek-d8-ekekeee sosssssssssoooss 1412 1428 41 966 673104 TTGCTACAGGCTGCGGT ek-d8-ekekeee sosssssssssoooss 1413 1429 30 967 673105 CTTGCTACAGGCTGCGG ek-d8-ekekeee sosssssssssoooss 1414 1430 13 968 673106 GCTTGCTACAGGCTGCG ek-d8-ekekeee sosssssssssoooss 1415 1431 7 969 673107 AGCTTGCTACAGGCTGC ek-d8-ekekeee sosssssssssoooss 1416 1432 7 970 673108 GAGCTTGCTACAGGCTG ek-d8-ekekeee sosssssssssoooss 1417 1433 23 971 673109 AGAGCTTGCTACAGGCT ek-d8-ekekeee sosssssssssoooss 1418 1434 38 972 673110 CAGAGCTTGCTACAGGC ek-d8-ekekeee sosssssssssoooss 1419 1435 22 973 673111 CCAGAGCTTGCTACAGG ek-d8-ekekeee sosssssssssoooss 1420 1436 14 974 673112 TCCAGAGCTTGCTACAG ek-d8-ekekeee sosssssssssoooss 1421 1437 11 975 673113 TTCCAGAGCTTGCTACA ek-d8-ekekeee sosssssssssoooss 1422 1438 24 976 673114 GTTCCAGAGCTTGCTAC ek-d8-ekekeee sosssssssssoooss 1423 1439 37 977 673115 AGTTCCAGAGCTTGCTA ek-d8-ekekeee sosssssssssoooss 1424 1440 34 978 673116 GAGTTCCAGAGCTTGCT ek-d8-ekekeee sosssssssssoooss 1425 1441 21 979 673117 TGAGTTCCAGAGCTTGC ek-d8-ekekeee sosssssssssoooss 1426 1442 47 980 673118 CTGAGTTCCAGAGCTTG ek-d8-ekekeee sosssssssssoooss 1427 1443 27 981 673119 CCTGAGTTCCAGAGCTT ek-d8-ekekeee sosssssssssoooss 1428 1444 44 982 673120 TCCTGAGTTCCAGAGCT ek-d8-ekekeee sosssssssssoooss 1429 1445 39 983 673121 CTCCTGAGTTCCAGAGC ek-d8-ekekeee sosssssssssoooss 1430 1446 37 984 673122 ACTCCTGAGTTCCAGAG ek-d8-ekekeee sosssssssssoooss 1431 1447 40 985 673123 GACTCCTGAGTTCCAGA ek-d8-ekekeee sosssssssssoooss 1432 1448 26 986 673124 CGACTCCTGAGTTCCAG ek-d8-ekekeee sosssssssssoooss 1433 1449 36 987 673125 GCGACTCCTGAGTTCCA ek-d8-ekekeee sosssssssssoooss 1434 1450 55 988 673126 CGCGACTCCTGAGTTCC ek-d8-ekekeee sosssssssssoooss 1435 1451 55 989 673127 GCGCGACTCCTGAGTTC ek-d8-ekekeee sosssssssssoooss 1436 1452 64 990 673128 CGCGCGACTCCTGAGTT ek-d8-ekekeee sosssssssssoooss 1437 1453 59 991 673129 GCGCGCGACTCCTGAGT ek-d8-ekekeee sosssssssssoooss 1438 1454 42 992 673130 AGCGCGCGACTCCTGAG ek-d8-ekekeee sosssssssssoooss 1439 1455 60 993 673131 TAGCGCGCGACTCCTGA ek-d8-ekekeee sosssssssssoooss 1440 1456 59 994 673132 CTAGCGCGCGACTCCTG ek-d8-ekekeee sosssssssssoooss 1441 1457 49 995 673133 CCTAGCGCGCGACTCCT ek-d8-ekekeee sosssssssssoooss 1442 1458 62 996 673134 CCCTAGCGCGCGACTCC ek-d8-ekekeee sosssssssssoooss 1443 1459 62 997 673135 CCCCTAGCGCGCGACTC ek-d8-ekekeee sosssssssssoooss 1444 1460 65 998 673136 GCCCCTAGCGCGCGACT ek-d8-ekekeee sosssssssssoooss 1445 1461 27 999 673137 GGCCCCTAGCGCGCGAC ek-d8-ekekeee sosssssssssoooss 1446 1462 6 1000 673138 CGGCCCCTAGCGCGCGA ek-d8-ekekeee sosssssssssoooss 1447 1463 26 1001 673139 CCGGCCCCTAGCGCGCG ek-d8-ekekeee sosssssssssoooss 1448 1464 15 1002 673140 CCCGGCCCCTAGCGCGC ek-d8-ekekeee sosssssssssoooss 1449 1465 24 1003 673141 CCCCGGCCCCTAGCGCG ek-d8-ekekeee sosssssssssoooss 1450 1466 27 1004 673142 GCCCCGGCCCCTAGCGC ek-d8-ekekeee sosssssssssoooss 1451 1467 28 1005 673143 GGCCCCGGCCCCTAGCG ek-d8-ekekeee sosssssssssoooss 1452 1468 28 1006 673144 CGGCCCCGGCCCCTAGC ek-d8-ekekeee sosssssssssoooss 1453 1469 49 1007 673145 CCGGCCCCGGCCCCTAG ek-d8-ekekeee sosssssssssoooss 1454 1470 24 1008 673146 CCCGGCCCCGGCCCCTA ek-d8-ekekeee sosssssssssoooss 1455 1471 32 1009 673147 ACGCCCCGGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1465 1481 12 1010 673148 CACGCCCCGGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1466 1482 4 1011 673149 CCACGCCCCGGCCCCGG ek-d8-ekekeee sosssssssssoooss 1467 1483 18 1012 673150 ACCACGCCCCGGCCCCG ek-d8-ekekeee sosssssssssoooss 1468 1484 5 1013 673151 GACCACGCCCCGGCCCC ek-d8-ekekeee sosssssssssoooss 1469 1485 20 1014 673152 CGACCACGCCCCGGCCC ek-d8-ekekeee sosssssssssoooss 1470 1486 52 1015 673153 CCGACCACGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1471 1487 4 1016 673154 CCCGACCACGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1472 1488 9 1017 673155 CCCCGACCACGCCCCGG ek-d8-ekekeee sosssssssssoooss 1473 1489 23 1018 673156 GCCCCGACCACGCCCCG ek-d8-ekekeee sosssssssssoooss 1474 1490 9 1019 673157 CGCCCCGACCACGCCCC ek-d8-ekekeee sosssssssssoooss 1475 1491 22 1020 673158 CCGCCCCGACCACGCCC ek-d8-ekekeee sosssssssssoooss 1476 1492 27 1021 673159 CCCGCCCCGACCACGCC ek-d8-ekekeee sosssssssssoooss 1477 1493 49 1022 673160 GCCCGCCCCGACCACGC ek-d8-ekekeee sosssssssssoooss 1478 1494 33 1023 673161 GGCCCGCCCCGACCACG ek-d8-ekekeee sosssssssssoooss 1479 1495 7 1024 673162 GGGCCCGCCCCGACCAC ek-d8-ekekeee sosssssssssoooss 1480 1496 8 1025 673163 CGGGCCCGCCCCGACCA ek-d8-ekekeee sosssssssssoooss 1481 1497 12 1026 673164 CCGGGCCCGCCCCGACC ek-d8-ekekeee sosssssssssoooss 1482 1498 2 1027 673165 CCCGGGCCCGCCCCGAC ek-d8-ekekeee sosssssssssoooss 1483 1499 13 1028 673166 GCAGCCCCGCCCCGGGC ek-d8-ekekeee sosssssssssoooss 1505 1521 7 1029 673167 CGCAGCCCCGCCCCGGG ek-d8-ekekeee sosssssssssoooss 1506 1522 14 1030 673168 CCGCAGCCCCGCCCCGG ek-d8-ekekeee sosssssssssoooss 1507 1523 17 1031 673169 ACCGCAGCCCCGCCCCG ek-d8-ekekeee sosssssssssoooss 1508 1524 44 1032 673170 AACCGCAGCCCCGCCCC ek-d8-ekekeee sosssssssssoooss 1509 1525 40 1033 673171 CAACCGCAGCCCCGCCC ek-d8-ekekeee sosssssssssoooss 1510 1526 45 1034 673172 GCAACCGCAGCCCCGCC ek-d8-ekekeee sosssssssssoooss 1511 1527 28 1035 673173 CGCAACCGCAGCCCCGC ek-d8-ekekeee sosssssssssoooss 1512 1528 31 1036 673174 CCGCAACCGCAGCCCCG ek-d8-ekekeee sosssssssssoooss 1513 1529 38 1037 673175 ACCGCAACCGCAGCCCC ek-d8-ekekeee sosssssssssoooss 1514 1530 47 1038 673176 CACCGCAACCGCAGCCC ek-d8-ekekeee sosssssssssoooss 1515 1531 37 1039 673177 GCACCGCAACCGCAGCC ek-d8-ekekeee sosssssssssoooss 1516 1532 41 1040 673178 GGCACCGCAACCGCAGC ek-d8-ekekeee sosssssssssoooss 1517 1533 34 1041 673179 AGGCACCGCAACCGCAG ek-d8-ekekeee sosssssssssoooss 1518 1534 19 1042 673180 CAGGCACCGCAACCGCA ek-d8-ekekeee sosssssssssoooss 1519 1535 36 1043 673181 GCAGGCACCGCAACCGC ek-d8-ekekeee sosssssssssoooss 1520 1536 33 1044 673182 CGCAGGCACCGCAACCG ek-d8-ekekeee sosssssssssoooss 1521 1537 37 1045 673183 GCGCAGGCACCGCAACC ek-d8-ekekeee sosssssssssoooss 1522 1538 6 1046 673184 GGCGCAGGCACCGCAAC ek-d8-ekekeee sosssssssssoooss 1523 1539 11 1047
(561) TABLE-US-00044 TABLE 43 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop % ID NO Sequence Chemistry Linkage Site Site inhibition NO 576816 GCCTTACTCTAGGACCAAGA eeeee-d10-eeeee sssssssssssssssssss 7990 8009 79 20 673185 TGAGAGCAAGTAGTGGG keke-d8-ekeke soosssssssssooss 1326 1342 37 898 673186 GTGAGAGCAAGTAGTGG keke-d8-ekeke soosssssssssooss 1327 1343 39 899 673187 TGTGAGAGCAAGTAGTG keke-d8-ekeke soosssssssssooss 1328 1344 33 900 673188 CTGTGAGAGCAAGTAGT keke-d8-ekeke soosssssssssooss 1329 1345 40 901 673189 ACTGTGAGAGCAAGTAG keke-d8-ekeke soosssssssssooss 1330 1346 26 902 673190 TACTGTGAGAGCAAGTA keke-d8-ekeke soosssssssssooss 1331 1347 23 903 673191 GTACTGTGAGAGCAAGT keke-d8-ekeke soosssssssssooss 1332 1348 50 904 673192 AGTACTGTGAGAGCAAG keke-d8-ekeke soosssssssssooss 1333 1349 39 905 673193 GAGTACTGTGAGAGCAA keke-d8-ekeke soosssssssssooss 1334 1350 69 906 673194 CGAGTACTGTGAGAGCA keke-d8-ekeke soosssssssssooss 1335 1351 72 907 673195 GCGAGTACTGTGAGAGC keke-d8-ekeke soosssssssssooss 1336 1352 51 908 673196 AGCGAGTACTGTGAGAG keke-d8-ekeke soosssssssssooss 1337 1353 51 909 673197 CAGCGAGTACTGTGAGA keke-d8-ekeke soosssssssssooss 1338 1354 59 910 673198 TCAGCGAGTACTGTGAG keke-d8-ekeke soosssssssssooss 1339 1355 33 911 673199 CTCAGCGAGTACTGTGA keke-d8-ekeke soosssssssssooss 1340 1356 32 912 673200 CCTCAGCGAGTACTGTG keke-d8-ekeke soosssssssssooss 1341 1357 46 913 673201 CCCTCAGCGAGTACTGT keke-d8-ekeke soosssssssssooss 1342 1358 53 914 673202 ACCCTCAGCGAGTACTG keke-d8-ekeke soosssssssssooss 1343 1359 58 915 673203 CACCCTCAGCGAGTACT keke-d8-ekeke soosssssssssooss 1344 1360 68 916 673204 TCACCCTCAGCGAGTAC keke-d8-ekeke soosssssssssooss 1345 1361 70 917 673205 TTCACCCTCAGCGAGTA keke-d8-ekeke soosssssssssooss 1346 1362 47 918 673206 GTTCACCCTCAGCGAGT keke-d8-ekeke soosssssssssooss 1347 1363 65 919 673207 TGTTCACCCTCAGCGAG keke-d8-ekeke soosssssssssooss 1348 1364 31 920 673208 TTGTTCACCCTCAGCGA keke-d8-ekeke soosssssssssooss 1349 1365 51 921 673209 CTTGTTCACCCTCAGCG keke-d8-ekeke soosssssssssooss 1350 1366 49 922 673210 TCTTGTTCACCCTCAGC keke-d8-ekeke soosssssssssooss 1351 1367 61 923 673211 TTCTTGTTCACCCTCAG keke-d8-ekeke soosssssssssooss 1352 1368 49 924 673212 TTTCTTGTTCACCCTCA keke-d8-ekeke soosssssssssooss 1353 1369 42 925 673213 TTTTCTTGTTCACCCTC keke-d8-ekeke soosssssssssooss 1354 1370 36 926 673214 CTTTTCTTGTTCACCCT keke-d8-ekeke soosssssssssooss 1355 1371 41 927 673215 TCTTTTCTTGTTCACCC keke-d8-ekeke soosssssssssooss 1356 1372 41 928 673216 GTCTTTTCTTGTTCACC keke-d8-ekeke soosssssssssooss 1357 1373 36 929 673217 GGTCTTTTCTTGTTCAC keke-d8-ekeke soosssssssssooss 1358 1374 29 930 673218 AGGTCTTTTCTTGTTCA keke-d8-ekeke soosssssssssooss 1359 1375 50 931 673219 CAGGTCTTTTCTTGTTC keke-d8-ekeke soosssssssssooss 1360 1376 60 932 673220 TCAGGTCTTTTCTTGTT keke-d8-ekeke soosssssssssooss 1361 1377 34 933 673221 ATCAGGTCTTTTCTTGT keke-d8-ekeke soosssssssssooss 1362 1378 33 934 673222 TATCAGGTCTTTTCTTG keke-d8-ekeke soosssssssssooss 1363 1379 31 935 673223 TTATCAGGTCTTTTCTT keke-d8-ekeke soosssssssssooss 1364 1380 10 936 673224 ATCTTTATCAGGTCTTT keke-d8-ekeke soosssssssssooss 1368 1384 61 937 673225 AATCTTTATCAGGTCTT keke-d8-ekeke soosssssssssooss 1369 1385 74 938 673226 TAATCTTTATCAGGTCT keke-d8-ekeke soosssssssssooss 1370 1386 62 939 673227 TTAATCTTTATCAGGTC keke-d8-ekeke soosssssssssooss 1371 1387 51 940 673228 GTTAATCTTTATCAGGT keke-d8-ekeke soosssssssssooss 1372 1388 73 941 673229 GGTTAATCTTTATCAGG keke-d8-ekeke soosssssssssooss 1373 1389 66 942 673230 TGGTTAATCTTTATCAG keke-d8-ekeke soosssssssssooss 1374 1390 38 943 673231 CTGGTTAATCTTTATCA keke-d8-ekeke soosssssssssooss 1375 1391 41 944 673232 TCTGGTTAATCTTTATC keke-d8-ekeke soosssssssssooss 1376 1392 37 945 673233 CCCTCCTTGTTTTCTTC keke-d8-ekeke soosssssssssooss 1391 1407 26 946 673234 TCCCTCCTTGTTTTCTT keke-d8-ekeke soosssssssssooss 1392 1408 10 947 673235 TTCCCTCCTTGTTTTCT keke-d8-ekeke soosssssssssooss 1393 1409 20 948 673236 TTTCCCTCCTTGTTTTC keke-d8-ekeke soosssssssssooss 1394 1410 1 949 673237 GTTTCCCTCCTTGTTTT keke-d8-ekeke soosssssssssooss 1395 1411 7 950 673238 TGTTTCCCTCCTTGTTT keke-d8-ekeke soosssssssssooss 1396 1412 26 951 673239 TTGTTTCCCTCCTTGTT keke-d8-ekeke soosssssssssooss 1397 1413 28 952 673240 GGTTGTTTCCCTCCTTG keke-d8-ekeke soosssssssssooss 1399 1415 70 953 673241 CGGTTGTTTCCCTCCTT keke-d8-ekeke soosssssssssooss 1400 1416 36 954 673242 GCGGTTGTTTCCCTCCT keke-d8-ekeke soosssssssssooss 1401 1417 21 955 673243 TGCGGTTGTTTCCCTCC keke-d8-ekeke soosssssssssooss 1402 1418 24 956 673244 CTGCGGTTGTTTCCCTC keke-d8-ekeke soosssssssssooss 1403 1419 41 957 673245 GCTGCGGTTGTTTCCCT keke-d8-ekeke soosssssssssooss 1404 1420 23 958 673246 GGCTGCGGTTGTTTCCC keke-d8-ekeke soosssssssssooss 1405 1421 39 959 673247 AGGCTGCGGTTGTTTCC keke-d8-ekeke soosssssssssooss 1406 1422 50 960 673248 CAGGCTGCGGTTGTTTC keke-d8-ekeke soosssssssssooss 1407 1423 32 961 673249 ACAGGCTGCGGTTGTTT keke-d8-ekeke soosssssssssooss 1408 1424 28 962 673250 TACAGGCTGCGGTTGTT keke-d8-ekeke soosssssssssooss 1409 1425 41 963 673251 CTACAGGCTGCGGTTGT keke-d8-ekeke soosssssssssooss 1410 1426 18 964 673252 GCTACAGGCTGCGGTTG keke-d8-ekeke soosssssssssooss 1411 1427 28 965 673253 TGCTACAGGCTGCGGTT keke-d8-ekeke soosssssssssooss 1412 1428 28 966 673254 TTGCTACAGGCTGCGGT keke-d8-ekeke soosssssssssooss 1413 1429 9 967 673255 CTTGCTACAGGCTGCGG keke-d8-ekeke soosssssssssooss 1414 1430 34 968 673256 GCTTGCTACAGGCTGCG keke-d8-ekeke soosssssssssooss 1415 1431 28 969 673257 AGCTTGCTACAGGCTGC keke-d8-ekeke soosssssssssooss 1416 1432 25 970 673258 GAGCTTGCTACAGGCTG keke-d8-ekeke soosssssssssooss 1417 1433 23 971 673259 AGAGCTTGCTACAGGCT keke-d8-ekeke soosssssssssooss 1418 1434 0 972 673260 CAGAGCTTGCTACAGGC keke-d8-ekeke soosssssssssooss 1419 1435 4 973 673261 CCAGAGCTTGCTACAGG keke-d8-ekeke soosssssssssooss 1420 1436 40 974 673262 TCCAGAGCTTGCTACAG keke-d8-ekeke soosssssssssooss 1421 1437 35 975 673263 TTCCAGAGCTTGCTACA keke-d8-ekeke soosssssssssooss 1422 1438 23 976 673264 GTTCCAGAGCTTGCTAC keke-d8-ekeke soosssssssssooss 1423 1439 36 977 673265 AGTTCCAGAGCTTGCTA keke-d8-ekeke soosssssssssooss 1424 1440 54 978 673266 GAGTTCCAGAGCTTGCT keke-d8-ekeke soosssssssssooss 1425 1441 32 979 673267 TGAGTTCCAGAGCTTGC keke-d8-ekeke soosssssssssooss 1426 1442 32 980 673268 CTGAGTTCCAGAGCTTG keke-d8-ekeke soosssssssssooss 1427 1443 44 981 673269 CCTGAGTTCCAGAGCTT keke-d8-ekeke soosssssssssooss 1428 1444 70 982 673270 TCCTGAGTTCCAGAGCT keke-d8-ekeke soosssssssssooss 1429 1445 43 983 673271 CTCCTGAGTTCCAGAGC keke-d8-ekeke soosssssssssooss 1430 1446 41 984 673272 ACTCCTGAGTTCCAGAG keke-d8-ekeke soosssssssssooss 1431 1447 23 985 673273 GACTCCTGAGTTCCAGA keke-d8-ekeke soosssssssssooss 1432 1448 48 986 673274 CGACTCCTGAGTTCCAG keke-d8-ekeke soosssssssssooss 1433 1449 34 987 673275 GCGACTCCTGAGTTCCA keke-d8-ekeke soosssssssssooss 1434 1450 64 988 673276 CGCGACTCCTGAGTTCC keke-d8-ekeke soosssssssssooss 1435 1451 65 989 673277 GCGCGACTCCTGAGTTC keke-d8-ekeke soosssssssssooss 1436 1452 62 990 673278 CGCGCGACTCCTGAGTT keke-d8-ekeke soosssssssssooss 1437 1453 45 991 673279 GCGCGCGACTCCTGAGT keke-d8-ekeke soosssssssssooss 1438 1454 52 992 673280 AGCGCGCGACTCCTGAG keke-d8-ekeke soosssssssssooss 1439 1455 65 993 673281 TAGCGCGCGACTCCTGA keke-d8-ekeke soosssssssssooss 1440 1456 89 994 673282 CTAGCGCGCGACTCCTG keke-d8-ekeke soosssssssssooss 1441 1457 69 995 673283 CCTAGCGCGCGACTCCT keke-d8-ekeke soosssssssssooss 1442 1458 68 996 673284 CCCTAGCGCGCGACTCC keke-d8-ekeke soosssssssssooss 1443 1459 73 997 673285 CCCCTAGCGCGCGACTC keke-d8-ekeke soosssssssssooss 1444 1460 70 998 673286 GCCCCTAGCGCGCGACT keke-d8-ekeke soosssssssssooss 1445 1461 45 999 673287 GGCCCCTAGCGCGCGAC keke-d8-ekeke soosssssssssooss 1446 1462 33 1000 673288 CGGCCCCTAGCGCGCGA keke-d8-ekeke soosssssssssooss 1447 1463 29 1001 673289 CCGGCCCCTAGCGCGCG keke-d8-ekeke soosssssssssooss 1448 1464 0 1002 673290 CCCGGCCCCTAGCGCGC keke-d8-ekeke soosssssssssooss 1449 1465 31 1003 673291 CCCCGGCCCCTAGCGCG keke-d8-ekeke soosssssssssooss 1450 1466 28 1004 673292 GCCCCGGCCCCTAGCGC keke-d8-ekeke soosssssssssooss 1451 1467 12 1005 673293 GGCCCCGGCCCCTAGCG keke-d8-ekeke soosssssssssooss 1452 1468 29 1006 673294 CGGCCCCGGCCCCTAGC keke-d8-ekeke soosssssssssooss 1453 1469 39 1007 673295 CCGGCCCCGGCCCCTAG keke-d8-ekeke soosssssssssooss 1454 1470 28 1008 673296 CCCGGCCCCGGCCCCTA keke-d8-ekeke soosssssssssooss 1455 1471 4 1009 673297 ACGCCCCGGCCCCGGCC keke-d8-ekeke soosssssssssooss 1465 1481 17 1010 673298 CACGCCCCGGCCCCGGC keke-d8-ekeke soosssssssssooss 1466 1482 35 1011 673299 CCACGCCCCGGCCCCGG keke-d8-ekeke soosssssssssooss 1467 1483 28 1012 673300 ACCACGCCCCGGCCCCG keke-d8-ekeke soosssssssssooss 1468 1484 21 1013 673301 GACCACGCCCCGGCCCC keke-d8-ekeke soosssssssssooss 1469 1485 28 1014 673302 CGACCACGCCCCGGCCC keke-d8-ekeke soosssssssssooss 1470 1486 46 1015 673303 CCGACCACGCCCCGGCC keke-d8-ekeke soosssssssssooss 1471 1487 40 1016 673304 CCCGACCACGCCCCGGC keke-d8-ekeke soosssssssssooss 1472 1488 16 1017 673305 CCCCGACCACGCCCCGG keke-d8-ekeke soosssssssssooss 1473 1489 11 1018 673306 GCCCCGACCACGCCCCG keke-d8-ekeke soosssssssssooss 1474 1490 13 1019 673307 CGCCCCGACCACGCCCC keke-d8-ekeke soosssssssssooss 1475 1491 43 1020 673308 CCGCCCCGACCACGCCC keke-d8-ekeke soosssssssssooss 1476 1492 20 1021 673309 CCCGCCCCGACCACGCC keke-d8-ekeke soosssssssssooss 1477 1493 16 1022 673310 GCCCGCCCCGACCACGC keke-d8-ekeke soosssssssssooss 1478 1494 44 1023 673311 GGCCCGCCCCGACCACG keke-d8-ekeke soosssssssssooss 1479 1495 33 1024 673312 GGGCCCGCCCCGACCAC keke-d8-ekeke soosssssssssooss 1480 1496 1 1025 673313 CGGGCCCGCCCCGACCA keke-d8-ekeke soosssssssssooss 1481 1497 0 1026 673314 CCGGGCCCGCCCCGACC keke-d8-ekeke soosssssssssooss 1482 1498 0 1027 673315 CCCGGGCCCGCCCCGAC keke-d8-ekeke soosssssssssooss 1483 1499 8 1028 673316 GCAGCCCCGCCCCGGGC keke-d8-ekeke soosssssssssooss 1505 1521 31 1029 673317 CGCAGCCCCGCCCCGGG keke-d8-ekeke soosssssssssooss 1506 1522 4 1030 673318 CCGCAGCCCCGCCCCGG keke-d8-ekeke soosssssssssooss 1507 1523 18 1031 673319 ACCGCAGCCCCGCCCCG keke-d8-ekeke soosssssssssooss 1508 1524 16 1032 673320 AACCGCAGCCCCGCCCC keke-d8-ekeke soosssssssssooss 1509 1525 39 1033 673321 CAACCGCAGCCCCGCCC keke-d8-ekeke soosssssssssooss 1510 1526 50 1034 673322 GCAACCGCAGCCCCGCC keke-d8-ekeke soosssssssssooss 1511 1527 45 1035 673323 CGCAACCGCAGCCCCGC keke-d8-ekeke soosssssssssooss 1512 1528 56 1036 673324 CCGCAACCGCAGCCCCG keke-d8-ekeke soosssssssssooss 1513 1529 10 1037 673325 ACCGCAACCGCAGCCCC keke-d8-ekeke soosssssssssooss 1514 1530 43 1038 673326 CACCGCAACCGCAGCCC keke-d8-ekeke soosssssssssooss 1515 1531 49 1039 673327 GCACCGCAACCGCAGCC keke-d8-ekeke soosssssssssooss 1516 1532 35 1040 673328 GGCACCGCAACCGCAGC keke-d8-ekeke soosssssssssooss 1517 1533 24 1041 673329 AGGCACCGCAACCGCAG keke-d8-ekeke soosssssssssooss 1518 1534 52 1042 673330 CAGGCACCGCAACCGCA keke-d8-ekeke soosssssssssooss 1519 1535 38 1043 673331 GCAGGCACCGCAACCGC keke-d8-ekeke soosssssssssooss 1520 1536 51 1044 673332 CGCAGGCACCGCAACCG keke-d8-ekeke soosssssssssooss 1521 1537 59 1045 673333 GCGCAGGCACCGCAACC keke-d8-ekeke soosssssssssooss 1522 1538 24 1046 673334 GGCGCAGGCACCGCAAC keke-d8-ekeke soosssssssssooss 1523 1539 18 1047
(562) TABLE-US-00045 TABLE 44 Percent inhibition of the C9ORF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2 SEQ SEQ ID ID NO: 2 NO: 2 SEQ ISIS Start Stop % ID NO Sequence Chemistry Linkage Site Site inhibition NO 576816 GCCTTACTCTAGGACCAAGA eeeee-d10-eeeee sssssssssssssssssss 7990 8009 60 20 673335 TGAGAGCAAGTAGTGGG ekek-d8-kekee soosssssssssooss 1326 1342 28 898 673336 GTGAGAGCAAGTAGTGG ekek-d8-kekee soosssssssssooss 1327 1343 27 899 673337 TGTGAGAGCAAGTAGTG ekek-d8-kekee soosssssssssooss 1328 1344 32 900 673338 CTGTGAGAGCAAGTAGT ekek-d8-kekee soosssssssssooss 1329 1345 43 901 673339 ACTGTGAGAGCAAGTAG ekek-d8-kekee soosssssssssooss 1330 1346 22 902 673340 TACTGTGAGAGCAAGTA ekek-d8-kekee soosssssssssooss 1331 1347 20 903 673341 GTACTGTGAGAGCAAGT ekek-d8-kekee soosssssssssooss 1332 1348 53 904 673342 AGTACTGTGAGAGCAAG ekek-d8-kekee soosssssssssooss 1333 1349 20 905 673343 GAGTACTGTGAGAGCAA ekek-d8-kekee soosssssssssooss 1334 1350 50 906 673344 CGAGTACTGTGAGAGCA ekek-d8-kekee soosssssssssooss 1335 1351 45 907 673345 GCGAGTACTGTGAGAGC ekek-d8-kekee soosssssssssooss 1336 1352 45 908 673346 AGCGAGTACTGTGAGAG ekek-d8-kekee soosssssssssooss 1337 1353 53 909 673347 CAGCGAGTACTGTGAGA ekek-d8-kekee soosssssssssooss 1338 1354 35 910 673348 TCAGCGAGTACTGTGAG ekek-d8-kekee soosssssssssooss 1339 1355 36 911 673349 CTCAGCGAGTACTGTGA ekek-d8-kekee soosssssssssooss 1340 1356 19 912 673350 CCTCAGCGAGTACTGTG ekek-d8-kekee soosssssssssooss 1341 1357 21 913 673351 CCCTCAGCGAGTACTGT ekek-d8-kekee soosssssssssooss 1342 1358 46 914 673352 ACCCTCAGCGAGTACTG ekek-d8-kekee soosssssssssooss 1343 1359 43 915 673353 CACCCTCAGCGAGTACT ekek-d8-kekee soosssssssssooss 1344 1360 46 916 673354 TCACCCTCAGCGAGTAC ekek-d8-kekee soosssssssssooss 1345 1361 40 917 673355 TTCACCCTCAGCGAGTA ekek-d8-kekee soosssssssssooss 1346 1362 33 918 673356 GTTCACCCTCAGCGAGT ekek-d8-kekee soosssssssssooss 1347 1363 11 919 673357 TGTTCACCCTCAGCGAG ekek-d8-kekee soosssssssssooss 1348 1364 34 920 673358 TTGTTCACCCTCAGCGA ekek-d8-kekee soosssssssssooss 1349 1365 47 921 673359 CTTGTTCACCCTCAGCG ekek-d8-kekee soosssssssssooss 1350 1366 54 922 673360 TCTTGTTCACCCTCAGC ekek-d8-kekee soosssssssssooss 1351 1367 26 923 673361 TTCTTGTTCACCCTCAG ekek-d8-kekee soosssssssssooss 1352 1368 36 924 673362 TTTCTTGTTCACCCTCA ekek-d8-kekee soosssssssssooss 1353 1369 29 925 673363 TTTTCTTGTTCACCCTC ekek-d8-kekee soosssssssssooss 1354 1370 29 926 673364 CTTTTCTTGTTCACCCT ekek-d8-kekee soosssssssssooss 1355 1371 23 927 673365 TCTTTTCTTGTTCACCC ekek-d8-kekee soosssssssssooss 1356 1372 36 928 673366 GTCTTTTCTTGTTCACC ekek-d8-kekee soosssssssssooss 1357 1373 27 929 673367 GGTCTTTTCTTGTTCAC ekek-d8-kekee soosssssssssooss 1358 1374 21 930 673368 AGGTCTTTTCTTGTTCA ekek-d8-kekee soosssssssssooss 1359 1375 29 931 673369 CAGGTCTTTTCTTGTTC ekek-d8-kekee soosssssssssooss 1360 1376 65 932 673370 TCAGGTCTTTTCTTGTT ekek-d8-kekee soosssssssssooss 1361 1377 2 933 673371 ATCAGGTCTTTTCTTGT ekek-d8-kekee soosssssssssooss 1362 1378 23 934 673372 TATCAGGTCTTTTCTTG ekek-d8-kekee soosssssssssooss 1363 1379 40 935 673373 TTATCAGGTCTTTTCTT ekek-d8-kekee soosssssssssooss 1364 1380 13 936 673374 ATCTTTATCAGGTCTTT ekek-d8-kekee soosssssssssooss 1368 1384 76 937 673375 AATCTTTATCAGGTCTT ekek-d8-kekee soosssssssssooss 1369 1385 62 938 673376 TAATCTTTATCAGGTCT ekek-d8-kekee soosssssssssooss 1370 1386 39 939 673377 TTAATCTTTATCAGGTC ekek-d8-kekee soosssssssssooss 1371 1387 71 940 673378 GTTAATCTTTATCAGGT ekek-d8-kekee soosssssssssooss 1372 1388 61 941 673379 GGTTAATCTTTATCAGG ekek-d8-kekee soosssssssssooss 1373 1389 74 942 673380 TGGTTAATCTTTATCAG ekek-d8-kekee soosssssssssooss 1374 1390 24 943 673381 CTGGTTAATCTTTATCA ekek-d8-kekee soosssssssssooss 1375 1391 32 944 673382 TCTGGTTAATCTTTATC ekek-d8-kekee soosssssssssooss 1376 1392 38 945 673383 CCCTCCTTGTTTTCTTC ekek-d8-kekee soosssssssssooss 1391 1407 21 946 673384 TCCCTCCTTGTTTTCTT ekek-d8-kekee soosssssssssooss 1392 1408 0 947 673385 TTCCCTCCTTGTTTTCT ekek-d8-kekee soosssssssssooss 1393 1409 0 948 673386 TTTCCCTCCTTGTTTTC ekek-d8-kekee soosssssssssooss 1394 1410 5 949 673387 GTTTCCCTCCTTGTTTT ekek-d8-kekee soosssssssssooss 1395 1411 0 950 673388 TGTTTCCCTCCTTGTTT ekek-d8-kekee soosssssssssooss 1396 1412 0 951 673389 TTGTTTCCCTCCTTGTT ekek-d8-kekee soosssssssssooss 1397 1413 22 952 673390 GGTTGTTTCCCTCCTTG ekek-d8-kekee soosssssssssooss 1399 1415 55 953 673391 CGGTTGTTTCCCTCCTT ekek-d8-kekee soosssssssssooss 1400 1416 25 954 673392 GCGGTTGTTTCCCTCCT ekek-d8-kekee soosssssssssooss 1401 1417 19 955 673393 TGCGGTTGTTTCCCTCC ekek-d8-kekee soosssssssssooss 1402 1418 0 956 673394 CTGCGGTTGTTTCCCTC ekek-d8-kekee soosssssssssooss 1403 1419 13 957 673395 GCTGCGGTTGTTTCCCT ekek-d8-kekee soosssssssssooss 1404 1420 19 958 673396 GGCTGCGGTTGTTTCCC ekek-d8-kekee soosssssssssooss 1405 1421 27 959 673397 AGGCTGCGGTTGTTTCC ekek-d8-kekee soosssssssssooss 1406 1422 13 960 673398 CAGGCTGCGGTTGTTTC ekek-d8-kekee soosssssssssooss 1407 1423 22 961 673399 ACAGGCTGCGGTTGTTT ekek-d8-kekee soosssssssssooss 1408 1424 5 962 673400 TACAGGCTGCGGTTGTT ekek-d8-kekee soosssssssssooss 1409 1425 0 963 673401 CTACAGGCTGCGGTTGT ekek-d8-kekee soosssssssssooss 1410 1426 0 964 673402 GCTACAGGCTGCGGTTG ekek-d8-kekee soosssssssssooss 1411 1427 39 965 673403 TGCTACAGGCTGCGGTT ekek-d8-kekee soosssssssssooss 1412 1428 20 966 673404 TTGCTACAGGCTGCGGT ekek-d8-kekee soosssssssssooss 1413 1429 24 967 673405 CTTGCTACAGGCTGCGG ekek-d8-kekee soosssssssssooss 1414 1430 0 968 673406 GCTTGCTACAGGCTGCG ekek-d8-kekee soosssssssssooss 1415 1431 18 969 673407 AGCTTGCTACAGGCTGC ekek-d8-kekee soosssssssssooss 1416 1432 3 970 673408 GAGCTTGCTACAGGCTG ekek-d8-kekee soosssssssssooss 1417 1433 13 971 673409 AGAGCTTGCTACAGGCT ekek-d8-kekee soosssssssssooss 1418 1434 29 972 673410 CAGAGCTTGCTACAGGC ekek-d8-kekee soosssssssssooss 1419 1435 22 973 673411 CCAGAGCTTGCTACAGG ekek-d8-kekee soosssssssssooss 1420 1436 24 974 673412 TCCAGAGCTTGCTACAG ekek-d8-kekee soosssssssssooss 1421 1437 4 975 673413 TTCCAGAGCTTGCTACA ekek-d8-kekee soosssssssssooss 1422 1438 0 976 673414 GTTCCAGAGCTTGCTAC ekek-d8-kekee soosssssssssooss 1423 1439 19 977 673415 AGTTCCAGAGCTTGCTA ekek-d8-kekee soosssssssssooss 1424 1440 0 978 673416 GAGTTCCAGAGCTTGCT ekek-d8-kekee soosssssssssooss 1425 1441 48 979 673417 TGAGTTCCAGAGCTTGC ekek-d8-kekee soosssssssssooss 1426 1442 14 980 673418 CTGAGTTCCAGAGCTTG ekek-d8-kekee soosssssssssooss 1427 1443 37 981 673419 CCTGAGTTCCAGAGCTT ekek-d8-kekee soosssssssssooss 1428 1444 80 982 673420 TCCTGAGTTCCAGAGCT ekek-d8-kekee soosssssssssooss 1429 1445 26 983 673421 CTCCTGAGTTCCAGAGC ekek-d8-kekee soosssssssssooss 1430 1446 5 984 673422 ACTCCTGAGTTCCAGAG ekek-d8-kekee soosssssssssooss 1431 1447 23 985 673423 GACTCCTGAGTTCCAGA ekek-d8-kekee soosssssssssooss 1432 1448 37 986 673424 CGACTCCTGAGTTCCAG ekek-d8-kekee soosssssssssooss 1433 1449 5 987 673425 GCGACTCCTGAGTTCCA ekek-d8-kekee soosssssssssooss 1434 1450 39 988 673426 CGCGACTCCTGAGTTCC ekek-d8-kekee soosssssssssooss 1435 1451 46 989 673427 GCGCGACTCCTGAGTTC ekek-d8-kekee soosssssssssooss 1436 1452 50 990 673428 CGCGCGACTCCTGAGTT ekek-d8-kekee soosssssssssooss 1437 1453 19 991 673429 GCGCGCGACTCCTGAGT ekek-d8-kekee soosssssssssooss 1438 1454 13 992 673430 AGCGCGCGACTCCTGAG ekek-d8-kekee soosssssssssooss 1439 1455 51 993 673431 TAGCGCGCGACTCCTGA ekek-d8-kekee soosssssssssooss 1440 1456 83 994 673432 CTAGCGCGCGACTCCTG ekek-d8-kekee soosssssssssooss 1441 1457 60 995 673433 CCTAGCGCGCGACTCCT ekek-d8-kekee soosssssssssooss 1442 1458 37 996 673434 CCCTAGCGCGCGACTCC ekek-d8-kekee soosssssssssooss 1443 1459 60 997 673435 CCCCTAGCGCGCGACTC ekek-d8-kekee soosssssssssooss 1444 1460 62 998 673436 GCCCCTAGCGCGCGACT ekek-d8-kekee soosssssssssooss 1445 1461 41 999 673437 GGCCCCTAGCGCGCGAC ekek-d8-kekee soosssssssssooss 1446 1462 8 1000 673438 CGGCCCCTAGCGCGCGA ekek-d8-kekee soosssssssssooss 1447 1463 31 1001 673439 CCGGCCCCTAGCGCGCG ekek-d8-kekee soosssssssssooss 1448 1464 18 1002 673440 CCCGGCCCCTAGCGCGC ekek-d8-kekee soosssssssssooss 1449 1465 6 1003 673441 CCCCGGCCCCTAGCGCG ekek-d8-kekee soosssssssssooss 1450 1466 23 1004 673442 GCCCCGGCCCCTAGCGC ekek-d8-kekee soosssssssssooss 1451 1467 8 1005 673443 GGCCCCGGCCCCTAGCG ekek-d8-kekee soosssssssssooss 1452 1468 18 1006 673444 CGGCCCCGGCCCCTAGC ekek-d8-kekee soosssssssssooss 1453 1469 28 1007 673445 CCGGCCCCGGCCCCTAG ekek-d8-kekee soosssssssssooss 1454 1470 9 1008 673446 CCCGGCCCCGGCCCCTA ekek-d8-kekee soosssssssssooss 1455 1471 5 1009 673447 ACGCCCCGGCCCCGGCC ekek-d8-kekee soosssssssssooss 1465 1481 23 1010 673448 CACGCCCCGGCCCCGGC ekek-d8-kekee soosssssssssooss 1466 1482 14 1011 673449 CCACGCCCCGGCCCCGG ekek-d8-kekee soosssssssssooss 1467 1483 35 1012 673450 ACCACGCCCCGGCCCCG ekek-d8-kekee soosssssssssooss 1468 1484 30 1013 673451 GACCACGCCCCGGCCCC ekek-d8-kekee soosssssssssooss 1469 1485 0 1014 673452 CGACCACGCCCCGGCCC ekek-d8-kekee soosssssssssooss 1470 1486 15 1015 673453 CCGACCACGCCCCGGCC ekek-d8-kekee soosssssssssooss 1471 1487 42 1016 673454 CCCGACCACGCCCCGGC ekek-d8-kekee soosssssssssooss 1472 1488 19 1017 673455 CCCCGACCACGCCCCGG ekek-d8-kekee soosssssssssooss 1473 1489 21 1018 673456 GCCCCGACCACGCCCCG ekek-d8-kekee soosssssssssooss 1474 1490 9 1019 673457 CGCCCCGACCACGCCCC ekek-d8-kekee soosssssssssooss 1475 1491 45 1020 673458 CCGCCCCGACCACGCCC ekek-d8-kekee soosssssssssooss 1476 1492 14 1021 673459 CCCGCCCCGACCACGCC ekek-d8-kekee soosssssssssooss 1477 1493 2 1022 673460 GCCCGCCCCGACCACGC ekek-d8-kekee soosssssssssooss 1478 1494 28 1023 673461 GGCCCGCCCCGACCACG ekek-d8-kekee soosssssssssooss 1479 1495 19 1024 673462 GGGCCCGCCCCGACCAC ekek-d8-kekee soosssssssssooss 1480 1496 26 1025 673463 CGGGCCCGCCCCGACCA ekek-d8-kekee soosssssssssooss 1481 1497 12 1026 673464 CCGGGCCCGCCCCGACC ekek-d8-kekee soosssssssssooss 1482 1498 18 1027 673465 CCCGGGCCCGCCCCGAC ekek-d8-kekee soosssssssssooss 1483 1499 19 1028 673466 GCAGCCCCGCCCCGGGC ekek-d8-kekee soosssssssssooss 1505 1521 11 1029 673467 CGCAGCCCCGCCCCGGG ekek-d8-kekee soosssssssssooss 1506 1522 40 1030 673468 CCGCAGCCCCGCCCCGG ekek-d8-kekee soosssssssssooss 1507 1523 12 1031 673469 ACCGCAGCCCCGCCCCG ekek-d8-kekee soosssssssssooss 1508 1524 26 1032 673470 AACCGCAGCCCCGCCCC ekek-d8-kekee soosssssssssooss 1509 1525 36 1033 673471 CAACCGCAGCCCCGCCC ekek-d8-kekee soosssssssssooss 1510 1526 63 1034 673472 GCAACCGCAGCCCCGCC ekek-d8-kekee soosssssssssooss 1511 1527 35 1035 673473 CGCAACCGCAGCCCCGC ekek-d8-kekee soosssssssssooss 1512 1528 51 1036 673474 CCGCAACCGCAGCCCCG ekek-d8-kekee soosssssssssooss 1513 1529 27 1037 673475 ACCGCAACCGCAGCCCC ekek-d8-kekee soosssssssssooss 1514 1530 49 1038 673476 CACCGCAACCGCAGCCC ekek-d8-kekee soosssssssssooss 1515 1531 34 1039 673477 GCACCGCAACCGCAGCC ekek-d8-kekee soosssssssssooss 1516 1532 36 1040 673478 GGCACCGCAACCGCAGC ekek-d8-kekee soosssssssssooss 1517 1533 22 1041 673479 AGGCACCGCAACCGCAG ekek-d8-kekee soosssssssssooss 1518 1534 23 1042 673480 CAGGCACCGCAACCGCA ekek-d8-kekee soosssssssssooss 1519 1535 27 1043 673481 GCAGGCACCGCAACCGC ekek-d8-kekee soosssssssssooss 1520 1536 41 1044 673482 CGCAGGCACCGCAACCG ekek-d8-kekee soosssssssssooss 1521 1537 60 1045 673483 GCGCAGGCACCGCAACC ekek-d8-kekee soosssssssssooss 1522 1538 22 1046 673484 GGCGCAGGCACCGCAAC ekek-d8-kekee soosssssssssooss 1523 1539 11 1047
Example 11: Dose-Dependent Antisense Inhibition of Human C9ORF72 mRNA in HepG2 Cells
(563) Antisense oligonucleotides from the study described in Example 10 hereinabove exhibiting significant in vitro inhibition of C9ORF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 576816, which was previously tested in PCT/US2013/065073 (claiming priority to U.S. Application No. 61/714,132, filed Oct. 15, 2012) was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.185 M, 0.56 M, 1.67 M, or 5.00 μM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C9ORF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72 levels, relative to untreated control cells.
(564) As shown in Tables 45-52, total C9ORF72 mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
(565) TABLE-US-00046 TABLE 45 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 21 66 82 91 0.5 672893 4 50 83 82 0.8 672894 13 55 70 88 0.7 672896 13 57 81 89 0.6 672897 2 38 72 79 1.1 672902 20 40 83 88 0.7 672903 19 44 73 80 0.8 672904 16 35 49 85 1.2 672905 15 30 67 82 1.0 672908 41 49 79 83 0.4 672909 20 54 72 90 0.6 672919 31 58 69 92 0.5 672924 34 60 89 97 0.4 672925 41 58 88 94 0.3 672927 31 78 81 92 0.3 672928 30 62 79 92 0.4 672929 51 71 89 94 0.1 672932 10 54 83 88 0.7 672940 14 36 58 87 1.0
(566) TABLE-US-00047 TABLE 46 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 24 51 78 88 0.6 672948 17 27 52 65 1.8 672966 1 36 77 73 1.1 672967 24 36 44 75 1.4 672968 15 46 69 83 0.8 672969 1 39 66 93 1.0 672976 47 65 74 80 0.2 672978 36 32 52 76 1.0 672980 24 45 77 86 0.6 672981 48 74 86 93 0.1 672982 42 63 91 90 0.2 672983 38 56 83 92 0.4 672984 33 53 72 88 0.5 672985 38 46 66 78 0.6 673021 43 48 76 79 0.4 673022 2 52 58 89 1.0 673023 44 36 76 78 0.5 673026 22 77 70 76 0.4 673032 19 37 55 80 1.1
(567) TABLE-US-00048 TABLE 47 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 48 49 80 95 0.3 673036 38 54 73 88 0.4 673047 27 75 93 87 0.3 673050 6 66 83 82 0.6 673051 31 57 69 85 0.5 673053 17 59 76 92 0.6 673054 15 45 76 90 0.7 673057 37 67 64 81 0.3 673058 35 62 79 87 0.4 673067 59 74 98 97 <0.2 673068 37 71 85 95 0.3 673071 43 5 59 64 1.9 673074 37 44 89 89 0.4 673079 41 71 89 95 0.2 673081 21 37 80 76 0.8 673082 27 58 87 92 0.4 673088 63 79 96 97 <0.2 673089 11 41 71 83 0.9 673098 15 61 68 93 0.6
(568) TABLE-US-00049 TABLE 48 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 43 71 80 93 0.2 673098 18 53 81 88 0.6 673117 22 45 76 80 0.7 673119 17 47 65 90 0.8 673125 33 64 79 79 0.4 673126 41 56 70 82 0.4 673127 46 85 92 96 <0.2 673128 32 71 88 99 0.3 673130 42 69 91 91 0.2 673131 34 62 74 99 0.4 673132 47 44 75 89 0.4 673133 54 61 78 84 <0.2 673134 41 62 77 77 0.3 673135 28 60 77 82 0.5 673144 24 58 64 92 0.6 673152 18 59 70 72 0.7 673159 4 50 75 80 0.9 673171 17 43 58 86 0.9 673175 30 45 76 78 0.6
(569) TABLE-US-00050 TABLE 49 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 22 69 78 93 0.4 673193 60 74 90 89 <0.2 673194 15 54 75 77 0.7 673196 36 38 71 73 0.7 673197 28 39 68 78 0.8 673201 0 40 69 91 1.0 673202 9 50 77 89 0.7 673203 40 52 84 98 0.4 673204 44 67 91 92 0.2 673206 27 40 70 90 0.7 673210 22 43 79 94 0.6 673211 0 45 53 85 1.2 673219 27 36 67 88 0.8 673224 41 65 86 95 0.3 673225 34 73 78 97 0.3 673226 19 59 83 94 0.5 673228 8 67 79 94 0.6 673229 46 76 89 86 <0.2 673240 18 58 75 93 0.6
(570) TABLE-US-00051 TABLE 50 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 31 65 81 89 0.4 673265 24 43 73 83 0.7 673269 12 58 81 89 0.6 673275 31 57 63 94 0.5 673276 33 56 69 91 0.5 673277 37 51 65 66 0.6 673279 11 57 68 86 0.8 673280 38 60 80 95 0.3 673281 51 83 92 86 <0.2 673282 60 73 93 95 <0.2 673283 59 66 94 96 <0.2 673284 45 59 78 91 0.3 673285 30 59 78 86 0.4 673321 10 44 72 79 0.9 673323 43 54 76 86 0.3 673326 0 46 72 81 0.8 673329 15 30 64 76 1.2 673331 47 40 66 79 0.5 673332 58 49 71 78 <0.2
(571) TABLE-US-00052 TABLE 51 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 38 61 75 92 0.3 673338 0 13 48 61 2.6 673341 29 39 66 82 0.8 673343 38 33 58 81 0.8 673344 29 40 69 72 0.8 673345 24 11 51 66 2.2 673346 19 27 52 74 1.4 673351 17 40 61 82 1.0 673352 18 36 62 71 1.2 673353 29 38 47 74 1.2 673358 11 39 63 71 1.2 673359 15 46 51 65 1.4 673369 17 33 55 70 1.4 673374 42 62 77 87 0.3 673375 28 66 79 94 0.4 673377 32 51 77 87 0.5 673378 32 47 76 89 0.5 673379 33 58 76 83 0.4 673390 21 40 57 74 1.1
(572) TABLE-US-00053 TABLE 52 Dose-dependent inhibition of the C9ORF72 pathogenic associated mRNA variant transcript levels in HepG2 cells 0.185 0.56 1.67 5.00 IC.sub.50 ISIS No μM μM μM μM (μM) 576816 6 54 75 88 0.7 673416 31 51 61 67 0.7 673419 16 34 41 67 2.0 673426 31 62 53 68 0.7 673427 41 52 52 59 0.8 673430 27 46 76 83 0.6 673431 49 68 83 96 0.2 673432 43 72 72 86 0.2 673434 41 70 80 90 0.2 673435 8 48 71 69 1.0 673436 15 20 65 66 1.6 673453 18 49 57 72 1.0 673457 0 19 43 63 2.5 673467 12 25 35 42 >5.0 673471 13 45 57 79 1.0 673473 13 48 62 92 0.8 673475 23 30 65 61 1.4 673481 26 33 52 41 >5.0 673482 14 45 56 75 1.1
Example 12: Antisense Inhibition of C9ORF72 by Human-Rhesus Cross-Reactive Antisense Oligonucleotides in LLC-MK2 Cells by Mixed Backbone 5-8-5 MOE and 5-10-5 MOE Gapmers
(573) Antisense oligonucleotides targeting a human C9ORF72 nucleic acid and cross-reactive with a rhesus C9ORF72 nucleic acid were designed and tested for their effects on rhesus C9ORF72 mRNA expression in vitro. ISIS 576816, previously tested in U.S. Application No. 61/714,132, filed Oct. 15, 2012, was used as a benchmark oligonucleotide. ISIS 619420, which is the mixed backbone version of ISIS 576816, described in Example 2 hereinabove was also tested. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured LLC-MK2 cells at a density of 20,000 cells per well were transfected using electroporation with 3,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 (a TAQ-man primer probe set) was used to measure total C9ORF72 mRNA levels. RTS3750 targets exon 2 of the mRNA transcripts and, therefore, measures total mRNA transcripts. In cases where the oligonucleotide overlapped the amplicon of the primer probe set RTS3750 (see, e.g., Table 53), an alternative primer probe set, RTS3760_MGB (forward sequence TCCAATGCITACTGGAGAAGTGA, designated herein as SEQ ID NO: 1546; reverse sequence GGAACACTGTGTGATITCATAGATGA, designated herein as SEQ ID NO: 1547; probe sequence TCCTGTAATGGAACTGC, designated herein as SEQ ID NO: 1548—a TAQ-man primer probe set) was used to measure total mRNA transcripts. The levels of the C9ORF72 mRNA were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of rhesus C9ORF72 mRNA expression, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides. ‘n.d.’ indicates that there was no signal reading in the assay for that particular oligonucleotide.
(574) The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-8-5 MOE gapmers and 5-10-5 MOE gapmers.
(575) The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises eight 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE group. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage.
(576) The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end and the 3′ end comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE group. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where ‘o’ indicates a phosphodiester linkage and ‘s’ indicates a phosphorothioate linkage.
(577) “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted in the gene sequence. Each gapmer listed in the Tables below is targeted to one or more of human C9ORF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1), human C9ORF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), and rhesus C9ORF72 genomic sequence designated herein as SEQ ID NO: 19 (GENBANK Accession No. NW_001101662.1 truncated from nucleosides 8522000 to 8552000). The ‘Mismatches’ column indicates the number of mismatches the human antisense oligonucleotide has with the rhesus genomic sequence. ‘n/a’ in the rhesus sequence columns indicates that the human oligonucleotide has more than 3 mismatches with the rhesus genomic sequence. Where the ‘Mismtaches’ column is not provided in a Table, it is understood that the human oligonucleotides of the Table are fully cross-reactive with the rhesus genomic sequence.
(578) TABLE-US-00054 TABLE 53 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % inhi- SEQ Start Start Start bition % inhibition ID ISIS NO Site Site Site Sequence Linkage Motif (RTS3750) (RTS3760_MGB) NO 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 60 54 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 69 68 20 688005* 221 7901 7954 AACAGCTGGAGATGGCGG sooosssssssssooss 5-8-5 12 36 1057 688006* 222 7902 7955 CAACAGCTGGAGATGGCG sooosssssssssooss 5-8-5 29 20 1058 688007* 223 7903 7956 GCAACAGCTGGAGATGGC sooosssssssssooss 5-8-5 46 33 1059 688008* 224 7904 7957 GGCAACAGCTGGAGATGG sooosssssssssooss 5-8-5 59 41 1060 688009* 225 7905 7958 TGGCAACAGCTGGAGATG sooosssssssssooss 5-8-5 43 24 1061 688010* 226 7906 7959 TTGGCAACAGCTGGAGAT sooosssssssssooss 5-8-5 31 0 1062 688011* 227 7907 7960 CTTGGCAACAGCTGGAGA sooosssssssssooss 5-8-5 45 18 1063 688012* 228 7908 7961 TCTTGGCAACAGCTGGAG sooosssssssssooss 5-8-5 67 0 1064 688013* 229 7909 7962 GTCTTGGCAACAGCTGGA sooosssssssssooss 5-8-5 48 13 1065 688014* 230 7910 7963 TGTCTTGGCAACAGCTGG sooosssssssssooss 5-8-5 16 16 1066 688015* 231 7911 7964 CTGTCTTGGCAACAGCTG sooosssssssssooss 5-8-5 75 33 1067 688016* 232 7912 7965 TCTGTCTTGGCAACAGCT sooosssssssssooss 5-8-5 37 36 1068 688017* 233 7913 7966 CTCTGTCTTGGCAACAGC sooosssssssssooss 5-8-5 59 28 1069 688018* 234 7914 7967 TCTCTGTCTTGGCAACAG sooosssssssssooss 5-8-5 40 36 1070 688019* 235 7915 7968 ATCTCTGTCTTGGCAACA sooosssssssssooss 5-8-5 34 31 1071 688020* 236 7916 7969 AATCTCTGTCTTGGCAAC sooosssssssssooss 5-8-5 30 26 1072 688021* 237 7917 7970 CAATCTCTGTCTTGGCAA sooosssssssssooss 5-8-5 58 0 1073 688022* 238 7918 7971 GCAATCTCTGTCTTGGCA sooosssssssssooss 5-8-5 90 52 1074 688023* 239 7919 7972 AGCAATCTCTGTCTTGGC sooosssssssssooss 5-8-5 92 73 1075 688024* 240 7920 7973 AAGCAATCTCTGTCTTGG sooosssssssssooss 5-8-5 74 24 1076 688025* 241 7921 7974 AAAGCAATCTCTGTCTTG sooosssssssssooss 5-8-5 76 0 1077 688026* 242 7922 7975 TAAAGCAATCTCTGTCTT sooosssssssssooss 5-8-5 28 6 1078 688027* 243 7923 7976 TTAAAGCAATCTCTGTCT sooosssssssssooss 5-8-5 32 18 1079 688028* 244 7924 7977 CTTAAAGCAATCTCTGTC sooosssssssssooss 5-8-5 41 4 1080 688029* 245 7925 7978 ACTTAAAGCAATCTCTGT sooosssssssssooss 5-8-5 63 0 1081 688030* 246 7926 7979 CACTTAAAGCAATCTCTG sooosssssssssooss 5-8-5 26 31 1082 688031* 247 7927 7980 CCACTTAAAGCAATCTCT sooosssssssssooss 5-8-5 73 33 1083 688032 267 7947 8000 CTGCTAATAAAGGTGATT sooosssssssssooss 5-8-5 24 34 1084 688033 268 7948 8001 GCTGCTAATAAAGGTGAT sooosssssssssooss 5-8-5 11 18 1085 688034 269 7949 8002 AGCTGCTAATAAAGGTGA sooosssssssssooss 5-8-5 40 34 1086 688035 270 7950 8003 TAGCTGCTAATAAAGGTG sooosssssssssooss 5-8-5 46 1 1087 688036 271 7951 8004 GTAGCTGCTAATAAAGGT sooosssssssssooss 5-8-5 13 17 1088 688037 272 7952 8005 AGTAGCTGCTAATAAAGG sooosssssssssooss 5-8-5 0 0 1089 688038 273 7953 8006 AAGTAGCTGCTAATAAAG sooosssssssssooss 5-8-5 0 0 1090 688039 274 7954 8007 AAAGTAGCTGCTAATAAA sooosssssssssooss 5-8-5 0 3 1091 688040 275 7955 8008 AAAAGTAGCTGCTAATAA sooosssssssssooss 5-8-5 0 0 1092 688041 276 7956 8009 CAAAAGTAGCTGCTAATA sooosssssssssooss 5-8-5 0 0 1093 688042 277 7957 8010 GCAAAAGTAGCTGCTAAT sooosssssssssooss 5-8-5 32 31 1094 688043 278 7958 8011 AGCAAAAGTAGCTGCTAA sooosssssssssooss 5-8-5 18 14 1095 688044 279 7959 8012 AAGCAAAAGTAGCTGCTA sooosssssssssooss 5-8-5 17 24 1096 688045 280 7960 8013 TAAGCAAAAGTAGCTGCT sooosssssssssooss 5-8-5 38 7 1097 688046 281 7961 8014 GTAAGCAAAAGTAGCTGC sooosssssssssooss 5-8-5 37 38 1098 688047 282 7962 8015 AGTAAGCAAAAGTAGCTG sooosssssssssooss 5-8-5 12 33 1099 688048 283 7963 8016 CAGTAAGCAAAAGTAGCT sooosssssssssooss 5-8-5 17 29 1100 688049 284 7964 8017 CCAGTAAGCAAAAGTAGC sooosssssssssooss 5-8-5 17 0 1101 688050 285 7965 8018 CCCAGTAAGCAAAAGTAG sooosssssssssooss 5-8-5 7 27 1102 688051 286 7966 8019 TCCCAGTAAGCAAAAGTA sooosssssssssooss 5-8-5 0 0 1103 688052 287 7967 8020 GTCCCAGTAAGCAAAAGT sooosssssssssooss 5-8-5 16 24 1104 688053 288 7968 8021 TGTCCCAGTAAGCAAAAG sooosssssssssooss 5-8-5 0 0 1105 688054 289 7969 8022 TTGTCCCAGTAAGCAAAA sooosssssssssooss 5-8-5 9 10 1106 688055 290 7970 8023 ATTGTCCCAGTAAGCAAA sooosssssssssooss 5-8-5 6 15 1107 688056 291 7971 8024 TATTGTCCCAGTAAGCAA sooosssssssssooss 5-8-5 21 0 1108 688057 292 7972 8025 ATATTGTCCCAGTAAGCA sooosssssssssooss 5-8-5 11 4 1109 688058 293 7973 8026 AATATTGTCCCAGTAAGC sooosssssssssooss 5-8-5 23 29 1110 688059 294 7974 8027 GAATATTGTCCCAGTAAG sooosssssssssooss 5-8-5 5 13 1111 688060 295 7975 8028 AGAATATTGTCCCAGTAA sooosssssssssooss 5-8-5 0 31 1112 688061 296 7976 8029 AAGAATATTGTCCCAGTA sooosssssssssooss 5-8-5 0 16 1113 688062 297 7977 8030 CAAGAATATTGTCCCAGT sooosssssssssooss 5-8-5 29 0 1114 688063 298 7978 8031 CCAAGAATATTGTCCCAG sooosssssssssooss 5-8-5 26 42 1115 688064 299 7979 8032 ACCAAGAATATTGTCCCA sooosssssssssooss 5-8-5 19 11 1116 688065 300 7980 8033 GACCAAGAATATTGTCCC sooosssssssssooss 5-8-5 31 26 1117 688066 301 7981 8034 GGACCAAGAATATTGTCC sooosssssssssooss 5-8-5 0 0 1118 688067 302 7982 8035 AGGACCAAGAATATTGTC sooosssssssssooss 5-8-5 5 10 1119 688068 303 7983 8036 TAGGACCAAGAATATTGT sooosssssssssooss 5-8-5 20 13 1120 688069 304 7984 8037 CTAGGACCAAGAATATTG sooosssssssssooss 5-8-5 0 22 1121 688070 305 7985 8038 TCTAGGACCAAGAATATT sooosssssssssooss 5-8-5 0 0 1122 688071 306 7986 8039 CTCTAGGACCAAGAATAT sooosssssssssooss 5-8-5 5 18 1123 688072 307 7987 8040 ACTCTAGGACCAAGAATA sooosssssssssooss 5-8-5 17 27 1124 688073 308 7988 8041 TACTCTAGGACCAAGAAT sooosssssssssooss 5-8-5 13 8 1125 688074 309 7989 8042 TTACTCTAGGACCAAGAA sooosssssssssooss 5-8-5 0 0 1126 688075 310 7990 8043 CTTACTCTAGGACCAAGA sooosssssssssooss 5-8-5 0 0 1127 688076 311 7991 8044 CCTTACTCTAGGACCAAG sooosssssssssooss 5-8-5 45 71 1128 688077 312 7992 8045 GCCTTACTCTAGGACCAA sooosssssssssooss 5-8-5 62 67 1129 688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 33 30 1130 688079 314 7994 8047 GTGCCTTACTCTAGGACC sooosssssssssooss 5-8-5 59 49 1131 688080 315 7995 8048 TGTGCCTTACTCTAGGAC sooosssssssssooss 5-8-5 47 41 1132 688081 316 7996 8049 ATGTGCCTTACTCTAGGA sooosssssssssooss 5-8-5 44 13 1133 688082 317 7997 8050 AATGTGCCTTACTCTAGG sooosssssssssooss 5-8-5 6 0 1134
(579) TABLE-US-00055 TABLE 54 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % SEQ ISIS Start Start Start inhibition ID NO Site Site Site Sequence Linkage Motif (RTS3750) NO 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 58 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 70 20 688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 50 1130 688083 318 7998 8051 AAATGTGCCTTACTCTAG sooosssssssssooss 5-8-5 7 1135 688084 319 7999 8052 CAAATGTGCCTTACTCTA sooosssssssssooss 5-8-5 11 1136 688085 320 8000 8053 CCAAATGTGCCTTACTCT sooosssssssssooss 5-8-5 29 1137 688086 321 8001 8054 CCCAAATGTGCCTTACTC sooosssssssssooss 5-8-5 43 1138 688087 322 8002 8055 GCCCAAATGTGCCTTACT sooosssssssssooss 5-8-5 58 1139 688088 323 8003 8056 AGCCCAAATGTGCCTTAC sooosssssssssooss 5-8-5 66 1140 688089 324 8004 8057 GAGCCCAAATGTGCCTTA sooosssssssssooss 5-8-5 61 1141 688090 325 8005 8058 GGAGCCCAAATGTGCCTT sooosssssssssooss 5-8-5 52 1142 688091 326 8006 8059 TGGAGCCCAAATGTGCCT sooosssssssssooss 5-8-5 34 1143 688092 327 8007 8060 TTGGAGCCCAAATGTGCC sooosssssssssooss 5-8-5 15 1144 688093 328 8008 8061 TTTGGAGCCCAAATGTGC sooosssssssssooss 5-8-5 31 1145 688094 329 8009 8062 CTTTGGAGCCCAAATGTG sooosssssssssooss 5-8-5 23 1146 688095 330 8010 8063 TCTTTGGAGCCCAAATGT sooosssssssssooss 5-8-5 13 1147 688096 331 8011 8064 GTCTTTGGAGCCCAAATG sooosssssssssooss 5-8-5 30 1148 688097 332 8012 8065 TGTCTTTGGAGCCCAAAT sooosssssssssooss 5-8-5 32 1149 688098 333 8013 8066 CTGTCTTTGGAGCCCAAA sooosssssssssooss 5-8-5 48 1150 688099 334 8014 8067 TCTGTCTTTGGAGCCCAA sooosssssssssooss 5-8-5 62 1151 688100 335 8015 8068 TTCTGTCTTTGGAGCCCA sooosssssssssooss 5-8-5 61 1152 688101 336 8016 8069 GTTCTGTCTTTGGAGCCC sooosssssssssooss 5-8-5 77 1153 688102 337 8017 8070 TGTTCTGTCTTTGGAGCC sooosssssssssooss 5-8-5 58 1154 688103 338 8018 8071 CTGTTCTGTCTTTGGAGC sooosssssssssooss 5-8-5 57 1155 688104 339 8019 8072 CCTGTTCTGTCTTTGGAG sooosssssssssooss 5-8-5 55 1156 688105 340 8020 8073 ACCTGTTCTGTCTTTGGA sooosssssssssooss 5-8-5 51 1157 688106 341 8021 8074 TACCTGTTCTGTCTTTGG sooosssssssssooss 5-8-5 42 1158 688107 342 8022 8075 GTACCTGTTCTGTCTTTG sooosssssssssooss 5-8-5 49 1159 688108 343 8023 8076 AGTACCTGTTCTGTCTTT sooosssssssssooss 5-8-5 25 1160 688109 344 8024 8077 AAGTACCTGTTCTGTCTT sooosssssssssooss 5-8-5 22 1161 688110 345 8025 8078 GAAGTACCTGTTCTGTCT sooosssssssssooss 5-8-5 42 1162 688111 346 8026 8079 AGAAGTACCTGTTCTGTC sooosssssssssooss 5-8-5 21 1163 688112 347 8027 8080 GAGAAGTACCTGTTCTGT sooosssssssssooss 5-8-5 22 1164 688113 348 8028 8081 TGAGAAGTACCTGTTCTG sooosssssssssooss 5-8-5 13 1165 688114 349 8029 8082 CTGAGAAGTACCTGTTCT sooosssssssssooss 5-8-5 25 1166 688115 350 8030 8083 ACTGAGAAGTACCTGTTC sooosssssssssooss 5-8-5 14 1167 688116 351 8031 8084 CACTGAGAAGTACCTGTT sooosssssssssooss 5-8-5 36 1168 688117 352 8032 8085 TCACTGAGAAGTACCTGT sooosssssssssooss 5-8-5 28 1169 688118 353 8033 8086 ATCACTGAGAAGTACCTG sooosssssssssooss 5-8-5 36 1170 688119 354 8034 8087 CATCACTGAGAAGTACCT sooosssssssssooss 5-8-5 32 1171 688120 355 8035 8088 CCATCACTGAGAAGTACC sooosssssssssooss 5-8-5 44 1172 688121 356 8036 8089 TCCATCACTGAGAAGTAC sooosssssssssooss 5-8-5 31 1173 688122 357 8037 8090 CTCCATCACTGAGAAGTA sooosssssssssooss 5-8-5 56 1174 688123 358 8038 8091 TCTCCATCACTGAGAAGT sooosssssssssooss 5-8-5 53 1175 688124 359 8039 8092 TTCTCCATCACTGAGAAG sooosssssssssooss 5-8-5 14 1176 688125 360 8040 8093 TTTCTCCATCACTGAGAA sooosssssssssooss 5-8-5 12 1177 688126 361 8041 8094 ATTTCTCCATCACTGAGA sooosssssssssooss 5-8-5 18 1178 688127 362 8042 8095 TATTTCTCCATCACTGAG sooosssssssssooss 5-8-5 11 1179 688128 364 8044 8097 GTTATTTCTCCATCACTG sooosssssssssooss 5-8-5 40 1180 688129 365 8045 8098 AGTTATTTCTCCATCACT sooosssssssssooss 5-8-5 37 1181 688130 366 8046 8099 AAGTTATTTCTCCATCAC sooosssssssssooss 5-8-5 20 1182 688131 367 8047 8100 AAAGTTATTTCTCCATCA sooosssssssssooss 5-8-5 22 1183 688132 368 8048 8101 AAAAGTTATTTCTCCATC sooosssssssssooss 5-8-5 31 1184 688133 369 8049 8102 GAAAAGTTATTTCTCCAT sooosssssssssooss 5-8-5 19 1185 688134 371 8051 8104 AAGAAAAGTTATTTCTCC sooosssssssssooss 5-8-5 34 1186 688135 372 8052 8105 CAAGAAAAGTTATTTCTC sooosssssssssooss 5-8-5 0 1187 688136 373 8053 8106 GCAAGAAAAGTTATTTCT sooosssssssssooss 5-8-5 21 1188 688137 374 8054 8107 GGCAAGAAAAGTTATTTC sooosssssssssooss 5-8-5 51 1189 688138 375 8055 8108 TGGCAAGAAAAGTTATTT sooosssssssssooss 5-8-5 42 1190 688139 376 8056 8109 TTGGCAAGAAAAGTTATT sooosssssssssooss 5-8-5 13 1191 688140 377 8057 8110 GTTGGCAAGAAAAGTTAT sooosssssssssooss 5-8-5 16 1192 688141 378 8058 8111 GGTTGGCAAGAAAAGTTA sooosssssssssooss 5-8-5 23 1193 688142 379 8059 8112 TGGTTGGCAAGAAAAGTT sooosssssssssooss 5-8-5 7 1194 688143 380 8060 8113 GTGGTTGGCAAGAAAAGT sooosssssssssooss 5-8-5 30 1195 688144 381 8061 8114 TGTGGTTGGCAAGAAAAG sooosssssssssooss 5-8-5 12 1196 688145 382 8062 8115 GTGTGGTTGGCAAGAAAA sooosssssssssooss 5-8-5 7 1197 688146 383 8063 8116 AGTGTGGTTGGCAAGAAA sooosssssssssooss 5-8-5 0 1198 688147 384 8064 8117 GAGTGTGGTTGGCAAGAA sooosssssssssooss 5-8-5 27 1199 688148 385 8065 8118 AGAGTGTGGTTGGCAAGA sooosssssssssooss 5-8-5 17 1200 688149 386 8066 8119 TAGAGTGTGGTTGGCAAG sooosssssssssooss 5-8-5 17 1201 688150 387 8067 8120 TTAGAGTGTGGTTGGCAA sooosssssssssooss 5-8-5 20 1202 688151 388 8068 8121 TTTAGAGTGTGGTTGGCA sooosssssssssooss 5-8-5 22 1203 688152 389 8069 8122 ATTTAGAGTGTGGTTGGC sooosssssssssooss 5-8-5 47 1204 688153 390 8070 8123 CATTTAGAGTGTGGTTGG sooosssssssssooss 5-8-5 21 1205 688154 391 8071 8124 CCATTTAGAGTGTGGTTG sooosssssssssooss 5-8-5 23 1206 688155 392 8072 8125 TCCATTTAGAGTGTGGTT sooosssssssssooss 5-8-5 9 1207 688156 393 8073 8126 CTCCATTTAGAGTGTGGT sooosssssssssooss 5-8-5 25 1208 688157 394 8074 8127 TCTCCATTTAGAGTGTGG sooosssssssssooss 5-8-5 41 1209 688158 395 8075 8128 TTCTCCATTTAGAGTGTG sooosssssssssooss 5-8-5 19 1210 688159 396 8076 8129 TTTCTCCATTTAGAGTGT sooosssssssssooss 5-8-5 0 1211
(580) TABLE-US-00056 TABLE 55 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % SEQ ISIS Start Start Start inhibition ID NO Site Site Site Sequence Linkage Motif (RTS3750) NO 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 57 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 64 20 688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 37 1130 688160 397 8077 8130 ATTTCTCCATTTAGAGTG sooosssssssssooss 5-8-5 0 1212 688161 398 8078 8131 GATTTCTCCATTTAGAGT sooosssssssssooss 5-8-5 9 1213 688162 399 8079 8132 GGATTTCTCCATTTAGAG sooosssssssssooss 5-8-5 2 1214 688163 400 8080 8133 AGGATTTCTCCATTTAGA sooosssssssssooss 5-8-5 0 1215 688164 401 8081 8134 AAGGATTTCTCCATTTAG sooosssssssssooss 5-8-5 12 1216 688165 402 8082 8135 GAAGGATTTCTCCATTTA sooosssssssssooss 5-8-5 0 1217 688166 403 8083 8136 CGAAGGATTTCTCCATTT sooosssssssssooss 5-8-5 18 1218 688167 404 8084 8137 TCGAAGGATTTCTCCATT sooosssssssssooss 5-8-5 12 1219 688168 405 8085 8138 TTCGAAGGATTTCTCCAT sooosssssssssooss 5-8-5 6 1220 688169 406 8086 8139 TTTCGAAGGATTTCTCCA sooosssssssssooss 5-8-5 0 1221 688170 407 8087 8140 ATTTCGAAGGATTTCTCC sooosssssssssooss 5-8-5 8 1222 688171 408 8088 8141 CATTTCGAAGGATTTCTC sooosssssssssooss 5-8-5 16 1223 688172 409 8089 8142 GCATTTCGAAGGATTTCT sooosssssssssooss 5-8-5 55 1224 688173 410 8090 8143 TGCATTTCGAAGGATTTC sooosssssssssooss 5-8-5 0 1225 688174 411 8091 8144 CTGCATTTCGAAGGATTT sooosssssssssooss 5-8-5 25 1226 688175 412 8092 8145 TCTGCATTTCGAAGGATT sooosssssssssooss 5-8-5 33 1227 688176 413 8093 8146 CTCTGCATTTCGAAGGAT sooosssssssssooss 5-8-5 12 1228 688177 414 8094 8147 TCTCTGCATTTCGAAGGA sooosssssssssooss 5-8-5 14 1229 688178 415 8095 8148 CTCTCTGCATTTCGAAGG sooosssssssssooss 5-8-5 5 1230 688179 416 8096 8149 ACTCTCTGCATTTCGAAG sooosssssssssooss 5-8-5 0 1231 688180 417 8097 8150 CACTCTCTGCATTTCGAA sooosssssssssooss 5-8-5 12 1232 688181 418 8098 8151 CCACTCTCTGCATTTCGA sooosssssssssooss 5-8-5 40 1233 688182 419 8099 8152 ACCACTCTCTGCATTTCG sooosssssssssooss 5-8-5 40 1234 688183 420 8100 8153 CACCACTCTCTGCATTTC sooosssssssssooss 5-8-5 45 1235 688184 421 8101 8154 GCACCACTCTCTGCATTT sooosssssssssooss 5-8-5 24 1236 688185 422 8102 8155 AGCACCACTCTCTGCATT sooosssssssssooss 5-8-5 12 1237 688186 423 8103 8156 TAGCACCACTCTCTGCAT sooosssssssssooss 5-8-5 21 1238 688187 424 8104 8157 ATAGCACCACTCTCTGCA sooosssssssssooss 5-8-5 25 1239 688188 425 8105 8158 TATAGCACCACTCTCTGC sooosssssssssooss 5-8-5 12 1240 688189 426 8106 8159 CTATAGCACCACTCTCTG sooosssssssssooss 5-8-5 0 1241 688190 427 8107 8160 TCTATAGCACCACTCTCT sooosssssssssooss 5-8-5 0 1242 688191 428 8108 8161 ATCTATAGCACCACTCTC sooosssssssssooss 5-8-5 20 1243 688192 429 8109 8162 CATCTATAGCACCACTCT sooosssssssssooss 5-8-5 0 1244 688193 430 8110 8163 ACATCTATAGCACCACTC sooosssssssssooss 5-8-5 31 1245 688194 431 8111 8164 TACATCTATAGCACCACT sooosssssssssooss 5-8-5 4 1246 688195 432 8112 8165 TTACATCTATAGCACCAC sooosssssssssooss 5-8-5 32 1247 688196 433 8113 8166 TTTACATCTATAGCACCA sooosssssssssooss 5-8-5 37 1248 688197 434 8114 8167 CTTTACATCTATAGCACC sooosssssssssooss 5-8-5 25 1249 688198 435 8115 8168 ACTTTACATCTATAGCAC sooosssssssssooss 5-8-5 0 1250 688199 436 8116 8169 AACTTTACATCTATAGCA sooosssssssssooss 5-8-5 9 1251 688200 437 8117 8170 AAACTTTACATCTATAGC sooosssssssssooss 5-8-5 8 1252 688201 438 8118 8171 AAAACTTTACATCTATAG sooosssssssssooss 5-8-5 4 1253 688202 440 8120 8173 AAAAAACTTTACATCTAT sooosssssssssooss 5-8-5 8 1254 688203 441 8121 8174 CAAAAAACTTTACATCTA sooosssssssssooss 5-8-5 4 1255 688204 442 8122 8175 ACAAAAAACTTTACATCT sooosssssssssooss 5-8-5 0 1256 688205 443 8123 8176 GACAAAAAACTTTACATC sooosssssssssooss 5-8-5 0 1257 688206 446 8126 8179 CAAGACAAAAAACTTTAC sooosssssssssooss 5-8-5 5 1258 688207 448 8128 8181 GACAAGACAAAAAACTTT sooosssssssssooss 5-8-5 27 1259 688208 449 8129 8182 AGACAAGACAAAAAACTT sooosssssssssooss 5-8-5 9 1260 688209 450 8130 8183 CAGACAAGACAAAAAACT sooosssssssssooss 5-8-5 0 1261 688210 451 8131 8184 TCAGACAAGACAAAAAAC sooosssssssssooss 5-8-5 11 1262 688211 452 8132 8185 TTCAGACAAGACAAAAAA sooosssssssssooss 5-8-5 0 1263 688212 454 8134 8187 TTTTCAGACAAGACAAAA sooosssssssssooss 5-8-5 0 1264 688213 455 8135 8188 CTTTTCAGACAAGACAAA sooosssssssssooss 5-8-5 0 1265 688214 456 8136 8189 CCTTTTCAGACAAGACAA sooosssssssssooss 5-8-5 30 1266 688215 457 8137 8190 CCCTTTTCAGACAAGACA sooosssssssssooss 5-8-5 31 1267 688216 458 8138 8191 TCCCTTTTCAGACAAGAC sooosssssssssooss 5-8-5 24 1268 688217 459 8139 8192 CTCCCTTTTCAGACAAGA sooosssssssssooss 5-8-5 47 1269 688218 460 8140 8193 ACTCCCTTTTCAGACAAG sooosssssssssooss 5-8-5 34 1270 688219 461 8141 8194 CACTCCCTTTTCAGACAA sooosssssssssooss 5-8-5 5 1271 688220 462 8142 8195 TCACTCCCTTTTCAGACA sooosssssssssooss 5-8-5 15 1272 688221 463 8143 8196 ATCACTCCCTTTTCAGAC sooosssssssssooss 5-8-5 14 1273 688222 464 8144 8197 AATCACTCCCTTTTCAGA sooosssssssssooss 5-8-5 18 1274 688223 465 8145 8198 TAATCACTCCCTTTTCAG sooosssssssssooss 5-8-5 14 1275 688224 466 8146 8199 ATAATCACTCCCTTTTCA sooosssssssssooss 5-8-5 15 1276 688225 467 8147 8200 AATAATCACTCCCTTTTC sooosssssssssooss 5-8-5 8 1277 688226 468 8148 8201 CAATAATCACTCCCTTTT sooosssssssssooss 5-8-5 9 1278 688227 469 8149 8202 ACAATAATCACTCCCTTT sooosssssssssooss 5-8-5 24 1279 688228 470 8150 8203 AACAATAATCACTCCCTT sooosssssssssooss 5-8-5 21 1280 688229 471 8151 8204 AAACAATAATCACTCCCT sooosssssssssooss 5-8-5 21 1281 688230 472 8152 8205 GAAACAATAATCACTCCC sooosssssssssooss 5-8-5 36 1282 688231 473 8153 8206 TGAAACAATAATCACTCC sooosssssssssooss 5-8-5 7 1283 688232 474 8154 8207 ATGAAACAATAATCACTC sooosssssssssooss 5-8-5 20 1284 688233 475 8155 8208 AATGAAACAATAATCACT sooosssssssssooss 5-8-5 0 1285 688234 476 8156 8209 TAATGAAACAATAATCAC sooosssssssssooss 5-8-5 16 1286 688235 477 8157 8210 TTAATGAAACAATAATCA sooosssssssssooss 5-8-5 0 1287 688236 478 8158 8211 ATTAATGAAACAATAATC sooosssssssssooss 5-8-5 0 1288
(581) TABLE-US-00057 TABLE 56 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % SEQ ISIS Start Start Start inhibition ID NO Site Site Site Sequence Linkage Motif (RTS3750) NO 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 61 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 75 20 688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 67 1130 688237 485 8165 8218 ATCAAAGATTAATGAAAC sooosssssssssooss 5-8-5 43 1289 688238 486 8166 8219 CATCAAAGATTAATGAAA sooosssssssssooss 5-8-5 0 1290 688239 487 8167 8220 CCATCAAAGATTAATGAA sooosssssssssooss 5-8-5 42 1291 688240 488 8168 8221 TCCATCAAAGATTAATGA sooosssssssssooss 5-8-5 46 1292 688241 489 8169 8222 TTCCATCAAAGATTAATG sooosssssssssooss 5-8-5 0 1293 688242 490 8170 8223 TTTCCATCAAAGATTAAT sooosssssssssooss 5-8-5 55 1294 688243 491 8171 8224 GTTTCCATCAAAGATTAA sooosssssssssooss 5-8-5 49 1295 688244 492 8172 8225 AGTTTCCATCAAAGATTA sooosssssssssooss 5-8-5 44 1296 688245 493 8173 8226 CAGTTTCCATCAAAGATT sooosssssssssooss 5-8-5 0 1297 688246 494 8174 8227 CCAGTTTCCATCAAAGAT sooosssssssssooss 5-8-5 46 1298 688247 495 8175 8228 TCCAGTTTCCATCAAAGA sooosssssssssooss 5-8-5 46 1299 688248 496 8176 8229 TTCCAGTTTCCATCAAAG sooosssssssssooss 5-8-5 59 1300 688249 497 8177 8230 ATTCCAGTTTCCATCAAA sooosssssssssooss 5-8-5 48 1301 688250 498 8178 8231 CATTCCAGTTTCCATCAA sooosssssssssooss 5-8-5 54 1302 688251 499 8179 8232 CCATTCCAGTTTCCATCA sooosssssssssooss 5-8-5 59 1303 688252 500 8180 8233 CCCATTCCAGTTTCCATC sooosssssssssooss 5-8-5 67 1304 688253 501 8181 8234 CCCCATTCCAGTTTCCAT sooosssssssssooss 5-8-5 58 1305 688254 502 8182 8235 TCCCCATTCCAGTTTCCA sooosssssssssooss 5-8-5 55 1306 688255 503 8183 8236 ATCCCCATTCCAGTTTCC sooosssssssssooss 5-8-5 61 1307 688256 504 8184 8237 GATCCCCATTCCAGTTTC sooosssssssssooss 5-8-5 51 1308 688257 505 8185 8238 CGATCCCCATTCCAGTTT sooosssssssssooss 5-8-5 49 1309 688258 506 8186 8239 GCGATCCCCATTCCAGTT sooosssssssssooss 5-8-5 43 1310 688259 507 8187 8240 TGCGATCCCCATTCCAGT sooosssssssssooss 5-8-5 51 1311 688260 508 8188 8241 CTGCGATCCCCATTCCAG sooosssssssssooss 5-8-5 70 1312 688261 509 8189 8242 GCTGCGATCCCCATTCCA sooosssssssssooss 5-8-5 72 1313 688262 510 8190 8243 TGCTGCGATCCCCATTCC sooosssssssssooss 5-8-5 49 1314 688263 511 8191 8244 GTGCTGCGATCCCCATTC sooosssssssssooss 5-8-5 0 1315 688264 512 8192 8245 TGTGCTGCGATCCCCATT sooosssssssssooss 5-8-5 58 1316 688265 513 8193 8246 ATGTGCTGCGATCCCCAT sooosssssssssooss 5-8-5 66 1317 688266 514 8194 8247 TATGTGCTGCGATCCCCA sooosssssssssooss 5-8-5 63 1318 688267 533 8213 8266 AAGTATAATTGATAGTCC sooosssssssssooss 5-8-5 49 1319 688268 534 8214 8267 GAAGTATAATTGATAGTC sooosssssssssooss 5-8-5 50 1320 688269 535 8215 8268 GGAAGTATAATTGATAGT sooosssssssssooss 5-8-5 39 1321 688270 536 8216 8269 TGGAAGTATAATTGATAG sooosssssssssooss 5-8-5 43 1322 688271 537 8217 8270 GTGGAAGTATAATTGATA sooosssssssssooss 5-8-5 49 1323 688272 538 8218 8271 TGTGGAAGTATAATTGAT sooosssssssssooss 5-8-5 40 1324 688273 539 8219 8272 CTGTGGAAGTATAATTGA sooosssssssssooss 5-8-5 34 1325 688274 540 8220 8273 TCTGTGGAAGTATAATTG sooosssssssssooss 5-8-5 0 1326 688275 541 8221 8274 GTCTGTGGAAGTATAATT sooosssssssssooss 5-8-5 0 1327 688276 542 8222 8275 TGTCTGTGGAAGTATAAT sooosssssssssooss 5-8-5 66 1328 688277 543 8223 8276 CTGTCTGTGGAAGTATAA sooosssssssssooss 5-8-5 0 1329 688278 544 8224 8277 TCTGTCTGTGGAAGTATA sooosssssssssooss 5-8-5 63 1330 688279 545 8225 8278 TTCTGTCTGTGGAAGTAT sooosssssssssooss 5-8-5 55 1331 688280 546 8226 8279 GTTCTGTCTGTGGAAGTA sooosssssssssooss 5-8-5 78 1332 688281 547 8227 8280 AGTTCTGTCTGTGGAAGT sooosssssssssooss 5-8-5 63 1333 688282 548 8228 8281 AAGTTCTGTCTGTGGAAG sooosssssssssooss 5-8-5 50 1334 688283 549 8229 8282 TAAGTTCTGTCTGTGGAA sooosssssssssooss 5-8-5 0 1335 688284 550 8230 8283 CTAAGTTCTGTCTGTGGA sooosssssssssooss 5-8-5 55 1336 688285 551 8231 8284 ACTAAGTTCTGTCTGTGG sooosssssssssooss 5-8-5 69 1337 688286 552 8232 8285 AACTAAGTTCTGTCTGTG sooosssssssssooss 5-8-5 66 1338 688287 553 8233 8286 AAACTAAGTTCTGTCTGT sooosssssssssooss 5-8-5 43 1339 688288 554 8234 8287 GAAACTAAGTTCTGTCTG sooosssssssssooss 5-8-5 37 1340 688289 555 8235 8288 AGAAACTAAGTTCTGTCT sooosssssssssooss 5-8-5 47 1341 688290 556 8236 8289 TAGAAACTAAGTTCTGTC sooosssssssssooss 5-8-5 50 1342 688291 557 8237 8290 GTAGAAACTAAGTTCTGT sooosssssssssooss 5-8-5 47 1343 688292 558 8238 8291 GGTAGAAACTAAGTTCTG sooosssssssssooss 5-8-5 46 1344 688293 559 8239 8292 AGGTAGAAACTAAGTTCT sooosssssssssooss 5-8-5 59 1345 688294 560 8240 8293 GAGGTAGAAACTAAGTTC sooosssssssssooss 5-8-5 48 1346 688295 561 8241 8294 GGAGGTAGAAACTAAGTT sooosssssssssooss 5-8-5 47 1347 688296 562 8242 8295 GGGAGGTAGAAACTAAGT sooosssssssssooss 5-8-5 43 1348 688297 563 8243 8296 TGGGAGGTAGAAACTAAG sooosssssssssooss 5-8-5 49 1349 688298 564 8244 8297 GTGGGAGGTAGAAACTAA sooosssssssssooss 5-8-5 51 1350 688299 565 8245 8298 AGTGGGAGGTAGAAACTA sooosssssssssooss 5-8-5 45 1351 688300 566 8246 8299 AAGTGGGAGGTAGAAACT sooosssssssssooss 5-8-5 40 1352 688301 567 8247 8300 GAAGTGGGAGGTAGAAAC sooosssssssssooss 5-8-5 39 1353 688302 568 8248 8301 TGAAGTGGGAGGTAGAAA sooosssssssssooss 5-8-5 0 1354 688303 569 8249 8302 ATGAAGTGGGAGGTAGAA sooosssssssssooss 5-8-5 42 1355 688304 570 8250 8303 TATGAAGTGGGAGGTAGA sooosssssssssooss 5-8-5 32 1356 688305 571 8251 8304 CTATGAAGTGGGAGGTAG sooosssssssssooss 5-8-5 47 1357 688306 572 8252 8305 TCTATGAAGTGGGAGGTA sooosssssssssooss 5-8-5 33 1358 688307 573 8253 8306 CTCTATGAAGTGGGAGGT sooosssssssssooss 5-8-5 55 1359 688308 574 8254 8307 ACTCTATGAAGTGGGAGG sooosssssssssooss 5-8-5 51 1360 688309 575 8255 8308 CACTCTATGAAGTGGGAG sooosssssssssooss 5-8-5 59 1361 688310 576 8256 8309 ACACTCTATGAAGTGGGA sooosssssssssooss 5-8-5 58 1362 688311 577 8257 8310 CACACTCTATGAAGTGGG sooosssssssssooss 5-8-5 59 1363 688312 578 8258 8311 ACACACTCTATGAAGTGG sooosssssssssooss 5-8-5 42 1364 688313 579 8259 8312 CACACACTCTATGAAGTG sooosssssssssooss 5-8-5 40 1365
(582) TABLE-US-00058 TABLE 57 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: Mis- NO: 1 NO: 2 19 matches % Start Start Start with SEQ inhibition SEQ ISIS NO Site Site Site ID NO: 19 Sequence Linkage Motif (RTS3750) ID NO 576816 310 7990 8043 0 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 47 20 619420 310 7990 8043 0 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 51 20 688078 313 7993 8046 0 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 32 1130 688314 580 8260 8313 0 ACACACACTCTATGAAGT sooosssssssssooss 5-8-5 9 1366 688315 691 n/a 9505 1 CCCTGATCTTCCATTCTC sooosssssssssooss 5-8-5 21 1367 688316 692 n/a 9506 2 ACCCTGATCTTCCATTCT sooosssssssssooss 5-8-5 2 1368 688317 693 n/a 9507 3 GACCCTGATCTTCCATTC sooosssssssssooss 5-8-5 16 1369 688318 694 n/a 9508 3 TGACCCTGATCTTCCATT sooosssssssssooss 5-8-5 18 1370 688319 695 n/a n/a n/a CTGACCCTGATCTTCCAT sooosssssssssooss 5-8-5 5 1371 688320 696 n/a n/a n/a TCTGACCCTGATCTTCCA sooosssssssssooss 5-8-5 11 1372 688321 697 n/a n/a n/a CTCTGACCCTGATCTTCC sooosssssssssooss 5-8-5 21 1373 688322 698 n/a n/a n/a ACTCTGACCCTGATCTTC sooosssssssssooss 5-8-5 26 1374 688323 699 n/a n/a n/a TACTCTGACCCTGATCTT sooosssssssssooss 5-8-5 6 1375 688324 700 n/a 12554 3 ATACTCTGACCCTGATCT sooosssssssssooss 5-8-5 7 1376 688325 701 n/a 12555 2 AATACTCTGACCCTGATC sooosssssssssooss 5-8-5 0 1377 687955 n/a 13641 13680 0 ATGATTTCTTGTCTGGGA sooosssssssssooss 5-8-5 31 1378 687956 n/a 13642 13681 0 CATGATTTCTTGTCTGGG sooosssssssssooss 5-8-5 38 1379 687957 n/a 13643 13682 0 CCATGATTTCTTGTCTGG sooosssssssssooss 5-8-5 12 1380 687958 n/a 13644 13683 0 GCCATGATTTCTTGTCTG sooosssssssssooss 5-8-5 27 1381 687959 n/a 13645 13684 0 GGCCATGATTTCTTGTCT sooosssssssssooss 5-8-5 26 1382 687960 n/a 13646 13685 0 GGGCCATGATTTCTTGTC sooosssssssssooss 5-8-5 18 1383 687961 n/a 14089 14136 0 AACTAACATGTAGGCACT sooosssssssssooss 5-8-5 38 1384 687962 n/a 14090 14137 0 GAACTAACATGTAGGCAC sooosssssssssooss 5-8-5 57 1385 687963 n/a 14091 14138 0 GGAACTAACATGTAGGCA sooosssssssssooss 5-8-5 63 1386 687964 n/a 14092 14139 0 AGGAACTAACATGTAGGC sooosssssssssooss 5-8-5 29 1387 687965 n/a 14302 14349 0 CTTCTGATTCAAGCCATT sooosssssssssooss 5-8-5 25 1388 687966 n/a 14303 14350 0 GCTTCTGATTCAAGCCAT sooosssssssssooss 5-8-5 51 1389 687967 n/a 14304 14351 0 TGCTTCTGATTCAAGCCA sooosssssssssooss 5-8-5 46 1390 687968 n/a 14305 14352 0 GTGCTTCTGATTCAAGCC sooosssssssssooss 5-8-5 21 1391 687969 n/a 14306 14353 0 AGTGCTTCTGATTCAAGC sooosssssssssooss 5-8-5 36 1392 687970 n/a 14307 14354 0 AAGTGCTTCTGATTCAAG sooosssssssssooss 5-8-5 25 1393 687971 n/a 14308 14355 0 AAAGTGCTTCTGATTCAA sooosssssssssooss 5-8-5 28 1394 687972 n/a 14309 14356 0 TAAAGTGCTTCTGATTCA sooosssssssssooss 5-8-5 0 1395 687973 n/a 14310 14357 0 CTAAAGTGCTTCTGATTC sooosssssssssooss 5-8-5 25 1396 687974 n/a 14311 14358 0 ACTAAAGTGCTTCTGATT sooosssssssssooss 5-8-5 17 1397 687975 n/a 14312 14359 0 GACTAAAGTGCTTCTGAT sooosssssssssooss 5-8-5 33 1398 687976 n/a 14313 14360 0 GGACTAAAGTGCTTCTGA sooosssssssssooss 5-8-5 47 1399 687977 n/a 14314 14361 0 AGGACTAAAGTGCTTCTG sooosssssssssooss 5-8-5 44 1400 687978 n/a 14315 14362 0 CAGGACTAAAGTGCTTCT sooosssssssssooss 5-8-5 57 1401 687979 n/a 14316 14363 0 ACAGGACTAAAGTGCTTC sooosssssssssooss 5-8-5 31 1402 687980 n/a 14317 14364 0 TACAGGACTAAAGTGCTT sooosssssssssooss 5-8-5 24 1403 687981 n/a 14318 14365 0 ATACAGGACTAAAGTGCT sooosssssssssooss 5-8-5 21 1404 687982 n/a 14319 14366 0 GATACAGGACTAAAGTGC sooosssssssssooss 5-8-5 15 1405 687983 n/a 14320 14367 0 AGATACAGGACTAAAGTG sooosssssssssooss 5-8-5 8 1406 687984 n/a 14321 14368 0 CAGATACAGGACTAAAGT sooosssssssssooss 5-8-5 1 1407 687985 n/a 14322 14369 0 ACAGATACAGGACTAAAG sooosssssssssooss 5-8-5 10 1408 687986 n/a 14323 14370 0 AACAGATACAGGACTAAA sooosssssssssooss 5-8-5 11 1409 687987 n/a 14324 14371 0 GAACAGATACAGGACTAA sooosssssssssooss 5-8-5 20 1410 687988 n/a 14325 14372 0 TGAACAGATACAGGACTA sooosssssssssooss 5-8-5 25 1411 687989 n/a 14326 14373 0 CTGAACAGATACAGGACT sooosssssssssooss 5-8-5 12 1412 687990 n/a 14327 14374 0 ACTGAACAGATACAGGAC sooosssssssssooss 5-8-5 25 1413 687991 n/a 14328 14375 0 CACTGAACAGATACAGGA sooosssssssssooss 5-8-5 8 1414 687992 n/a 14329 14376 0 ACACTGAACAGATACAGG sooosssssssssooss 5-8-5 10 1415 687993 n/a 14330 14377 0 GACACTGAACAGATACAG sooosssssssssooss 5-8-5 13 1416 687994 n/a 14331 14378 0 TGACACTGAACAGATACA sooosssssssssooss 5-8-5 25 1417 687995 n/a 14332 14379 0 CTGACACTGAACAGATAC sooosssssssssooss 5-8-5 35 1418 687996 n/a 14333 14380 0 GCTGACACTGAACAGATA sooosssssssssooss 5-8-5 24 1419 687997 n/a 14334 14381 0 GGCTGACACTGAACAGAT sooosssssssssooss 5-8-5 40 1420 687998 n/a 14335 14382 0 AGGCTGACACTGAACAGA sooosssssssssooss 5-8-5 10 1421 687999 n/a 14336 14383 0 AAGGCTGACACTGAACAG sooosssssssssooss 5-8-5 3 1422 688000 n/a 14337 14384 0 AAAGGCTGACACTGAACA sooosssssssssooss 5-8-5 18 1423 688001 n/a 14338 14385 0 GAAAGGCTGACACTGAAC sooosssssssssooss 5-8-5 17 1424 688002 n/a 14339 14386 0 TGAAAGGCTGACACTGAA sooosssssssssooss 5-8-5 12 1425 688003 n/a 14358 14405 0 TGGGATTTAAAATGATGT sooosssssssssooss 5-8-5 17 1426 688004 n/a 14359 14406 0 ATGGGATTTAAAATGATG sooosssssssssooss 5-8-5 11 1427 688326 n/a 13402 13443 0 CTTGAGAAGAAAGCCTTC sooosssssssssooss 5-8-5 6 1428 688327 n/a 14287 14334 0 ATTAAGGCTCTTAGGTTA sooosssssssssooss 5-8-5 0 1429 688328 n/a 13499 13530 0 GTAGACAGTCTGTTATTT sooosssssssssooss 5-8-5 27 1430 688329 n/a 14397 14444 0 TGACATGTAGAGAGATTA sooosssssssssooss 5-8-5 43 1431 688330 n/a 13827 13866 0 TGGTTTAAGGGCACAAAC sooosssssssssooss 5-8-5 0 1432 688331 n/a 13403 13444 0 ACTTGAGAAGAAAGCCTT sooosssssssssooss 5-8-5 27 1433 688332 n/a 14257 14304 0 CCTCTGATACTCCATCAT sooosssssssssooss 5-8-5 28 1434 688333 n/a 13471 13502 0 AAATCTTGTCATAGGTGA sooosssssssssooss 5-8-5 21 1435 688334 n/a 13410 13451 0 AATTCTTACTTGAGAAGA sooosssssssssooss 5-8-5 7 1436 688335 n/a 13885 13924 0 GGTGTATAGAGAATTCAG sooosssssssssooss 5-8-5 41 1437 688336 n/a 14250 14297 0 TACTCCATCATGAGCCTA sooosssssssssooss 5-8-5 35 1438 688337 n/a 13788 13827 0 GCTGGATGGAAAAAGATC sooosssssssssooss 5-8-5 12 1439 688338 n/a 13517 13548 0 GTCCCTAGAACAATCTAA sooosssssssssooss 5-8-5 28 1440 688339 n/a 14405 14452 0 GAAGAAATTGACATGTAG sooosssssssssooss 5-8-5 12 1441 688340 n/a 13724 13763 0 CATCTACAGTACAACTTA sooosssssssssooss 5-8-5 4 1442
(583) TABLE-US-00059 TABLE 58 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % SEQ ISIS Start Start Start inhibition ID NO Site Site Site Sequence Linkage Motif (RTS3750) NO 688341 233 7913 7966 ATCTCTGTCTTGGCAACAGC soooossssssssssooss 5-10-5 57 1443 688342 234 7914 7967 AATCTCTGTCTTGGCAACAG soooossssssssssooss 5-10-5 35 1444 688343 235 7915 7968 CAATCTCTGTCTTGGCAACA soooossssssssssooss 5-10-5 36 1445 655153 236 7916 7969 GCAATCTCTGTCTTGGCAAC soooossssssssssooss 5-10-5 89 463 655154 237 7917 7970 AGCAATCTCTGTCTTGGCAA soooossssssssssooss 5-10-5 81 464 688344 238 7918 7971 AAGCAATCTCTGTCTTGGCA soooossssssssssooss 5-10-5 83 1446 655172 306 7986 8039 TACTCTAGGACCAAGAATAT soooossssssssssooss 5-10-5 10 483 688345 307 7987 8040 TTACTCTAGGACCAAGAATA soooossssssssssooss 5-10-5 1 1447 688346 308 7988 8041 CTTACTCTAGGACCAAGAAT soooossssssssssooss 5-10-5 10 1448 625183 309 7989 8042 CCTTACTCTAGGACCAAGAA soooossssssssssooss 5-10-5 44 484 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 56 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 73 20 688347 311 7991 8044 TGCCTTACTCTAGGACCAAG soooossssssssssooss 5-10-5 62 1449 655173 312 7992 8045 GTGCCTTACTCTAGGACCAA soooossssssssssooss 5-10-5 59 485 688348 313 7993 8046 TGTGCCTTACTCTAGGACCA soooossssssssssooss 5-10-5 62 1450 688349 314 7994 8047 ATGTGCCTTACTCTAGGACC soooossssssssssooss 5-10-5 62 1451 655174 315 7995 8048 AATGTGCCTTACTCTAGGAC soooossssssssssooss 5-10-5 60 486 688350 319 7999 8052 CCCAAATGTGCCTTACTCTA soooossssssssssooss 5-10-5 41 1452 688351 320 8000 8053 GCCCAAATGTGCCTTACTCT soooossssssssssooss 5-10-5 62 1453 627833 321 8001 8054 AGCCCAAATGTGCCTTACTC soooossssssssssooss 5-10-5 51 487 688352 322 8002 8055 GAGCCCAAATGTGCCTTACT soooossssssssssooss 5-10-5 66 1454 688353 323 8003 8056 GGAGCCCAAATGTGCCTTAC soooossssssssssooss 5-10-5 48 1455 619411 324 8004 8057 TGGAGCCCAAATGTGCCTTA soooossssssssssooss 5-10-5 67 51 688354 325 8005 8058 TTGGAGCCCAAATGTGCCTT soooossssssssssooss 5-10-5 53 1456 627608 326 8006 8059 TTTGGAGCCCAAATGTGCCT soooossssssssssooss 5-10-5 42 1457 655175 327 8007 8060 CTTTGGAGCCCAAATGTGCC soooossssssssssooss 5-10-5 26 488 655176 330 8010 8063 TGTCTTTGGAGCCCAAATGT soooossssssssssooss 5-10-5 33 489 688355 331 8011 8064 CTGTCTTTGGAGCCCAAATG soooossssssssssooss 5-10-5 56 1458 619412 332 8012 8065 TCTGTCTTTGGAGCCCAAAT soooossssssssssooss 5-10-5 60 53 655177 333 8013 8066 TTCTGTCTTTGGAGCCCAAA soooossssssssssooss 5-10-5 47 490 655178 334 8014 8067 GTTCTGTCTTTGGAGCCCAA soooossssssssssooss 5-10-5 67 491 688356 335 8015 8068 TGTTCTGTCTTTGGAGCCCA soooossssssssssooss 5-10-5 60 1459 655179 336 8016 8069 CTGTTCTGTCTTTGGAGCCC soooossssssssssooss 5-10-5 59 492 688357 337 8017 8070 CCTGTTCTGTCTTTGGAGCC soooossssssssssooss 5-10-5 50 1460 688358 338 8018 8071 ACCTGTTCTGTCTTTGGAGC soooossssssssssooss 5-10-5 44 1461 655180 339 8019 8072 TACCTGTTCTGTCTTTGGAG soooossssssssssooss 5-10-5 42 493 619413 340 8020 8073 GTACCTGTTCTGTCTTTGGA soooossssssssssooss 5-10-5 56 135 688359 341 8021 8074 AGTACCTGTTCTGTCTTTGG soooossssssssssooss 5-10-5 38 1462 655181 342 8022 8075 AAGTACCTGTTCTGTCTTTG soooossssssssssooss 5-10-5 31 494 655185 351 8031 8084 ATCACTGAGAAGTACCTGTT soooossssssssssooss 5-10-5 32 498 688360 352 8032 8085 CATCACTGAGAAGTACCTGT soooossssssssssooss 5-10-5 53 1463 619414 353 8033 8086 CCATCACTGAGAAGTACCTG soooossssssssssooss 5-10-5 48 136 655186 354 8034 8087 TCCATCACTGAGAAGTACCT soooossssssssssooss 5-10-5 56 499 688361 355 8035 8088 CTCCATCACTGAGAAGTACC soooossssssssssooss 5-10-5 54 1464 655201 415 8095 8148 CACTCTCTGCATTTCGAAGG soooossssssssssooss 5-10-5 32 521 688362 416 8096 8149 CCACTCTCTGCATTTCGAAG soooossssssssssooss 5-10-5 39 1465 688363 417 8097 8150 ACCACTCTCTGCATTTCGAA soooossssssssssooss 5-10-5 37 1466 655202 418 8098 8151 CACCACTCTCTGCATTTCGA soooossssssssssooss 5-10-5 50 522 688364 419 8099 8152 GCACCACTCTCTGCATTTCG soooossssssssssooss 5-10-5 56 1467 655203 420 8100 8153 AGCACCACTCTCTGCATTTC soooossssssssssooss 5-10-5 56 523 655204 421 8101 8154 TAGCACCACTCTCTGCATTT soooossssssssssooss 5-10-5 25 524 688365 422 8102 8155 ATAGCACCACTCTCTGCATT soooossssssssssooss 5-10-5 29 1468 688366 423 8103 8156 TATAGCACCACTCTCTGCAT soooossssssssssooss 5-10-5 31 1469 655206 427 8107 8160 CATCTATAGCACCACTCTCT soooossssssssssooss 5-10-5 20 526 688367 428 8108 8161 ACATCTATAGCACCACTCTC soooossssssssssooss 5-10-5 28 1470 688368 429 8109 8162 TACATCTATAGCACCACTCT soooossssssssssooss 5-10-5 24 1471 671081 430 8110 8163 TTACATCTATAGCACCACTC soooossssssssssooss 5-10-5 26 1052 688369 431 8111 8164 TTTACATCTATAGCACCACT soooossssssssssooss 5-10-5 40 1472 688370 432 8112 8165 CTTTACATCTATAGCACCAC soooossssssssssooss 5-10-5 43 1473 655207 433 8113 8166 ACTTTACATCTATAGCACCA soooossssssssssooss 5-10-5 33 527 688371 434 8114 8167 AACTTTACATCTATAGCACC soooossssssssssooss 5-10-5 15 1474 688372 435 8115 8168 AAACTTTACATCTATAGCAC soooossssssssssooss 5-10-5 24 1475 655208 436 8116 8169 AAAACTTTACATCTATAGCA soooossssssssssooss 5-10-5 28 528 655215 456 8136 8189 TCCCTTTTCAGACAAGACAA soooossssssssssooss 5-10-5 35 535 688373 457 8137 8190 CTCCCTTTTCAGACAAGACA soooossssssssssooss 5-10-5 42 1476 688374 458 8138 8191 ACTCCCTTTTCAGACAAGAC soooossssssssssooss 5-10-5 57 1477 655216 459 8139 8192 CACTCCCTTTTCAGACAAGA soooossssssssssooss 5-10-5 51 536 671082 460 8140 8193 TCACTCCCTTTTCAGACAAG soooossssssssssooss 5-10-5 45 1053 688375 461 8141 8194 ATCACTCCCTTTTCAGACAA soooossssssssssooss 5-10-5 39 1478 655217 462 8142 8195 AATCACTCCCTTTTCAGACA soooossssssssssooss 5-10-5 45 537 688376 463 8143 8196 TAATCACTCCCTTTTCAGAC soooossssssssssooss 5-10-5 7 1479 688377 464 8144 8197 ATAATCACTCCCTTTTCAGA soooossssssssssooss 5-10-5 1 1480 655218 465 8145 8198 AATAATCACTCCCTTTTCAG soooossssssssssooss 5-10-5 23 538 655230 500 8180 8233 TCCCCATTCCAGTTTCCATC soooossssssssssooss 5-10-5 57 550 688378 501 8181 8234 ATCCCCATTCCAGTTTCCAT soooossssssssssooss 5-10-5 60 1481 688379 502 8182 8235 GATCCCCATTCCAGTTTCCA soooossssssssssooss 5-10-5 55 1482 655231 503 8183 8236 CGATCCCCATTCCAGTTTCC soooossssssssssooss 5-10-5 58 551 688380 504 8184 8237 GCGATCCCCATTCCAGTTTC soooossssssssssooss 5-10-5 56 1483 688381 505 8185 8238 TGCGATCCCCATTCCAGTTT soooossssssssssooss 5-10-5 46 1484
(584) TABLE-US-00060 TABLE 59 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: 1 NO: 2 NO: 19 Mismatches % ISIS Start Start Start with SEQ inhibition SEQ NO Site Site Site ID NO: 19 Sequence Linkage Motif (RTS3750) ID NO 576816 310 7990 8043 0 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 53 20 619420 310 7990 8043 0 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 54 20 655173 312 7992 8045 0 GTGCCTTACTCTAGGACCAA soooossssssssssooss 5-10-5 77 485 655232 506 8186 8239 0 CTGCGATCCCCATTCCAGTT soooossssssssssooss 5-10-5 46 552 688382 507 8187 8240 0 GCTGCGATCCCCATTCCAGT soooossssssssssooss 5-10-5 65 1485 688383 508 8188 8241 0 TGCTGCGATCCCCATTCCAG soooossssssssssooss 5-10-5 60 1486 655233 509 8189 8242 0 GTGCTGCGATCCCCATTCCA soooossssssssssooss 5-10-5 57 553 688384 510 8190 8243 0 TGTGCTGCGATCCCCATTCC soooossssssssssooss 5-10-5 45 1487 688385 511 8191 8244 0 ATGTGCTGCGATCCCCATTC soooossssssssssooss 5-10-5 68 1488 655234 512 8192 8245 0 TATGTGCTGCGATCCCCATT soooossssssssssooss 5-10-5 32 554 655240 548 8228 8281 0 CTAAGTTCTGTCTGTGGAAG soooossssssssssooss 5-10-5 23 560 688386 549 8229 8282 0 ACTAAGTTCTGTCTGTGGAA soooossssssssssooss 5-10-5 45 1489 671083 550 8230 8283 0 AACTAAGTTCTGTCTGTGGA soooossssssssssooss 5-10-5 41 1054 655241 551 8231 8284 0 AAACTAAGTTCTGTCTGTGG soooossssssssssooss 5-10-5 28 561 688387 552 8232 8285 0 GAAACTAAGTTCTGTCTGTG soooossssssssssooss 5-10-5 49 1490 688388 553 8233 8286 0 AGAAACTAAGTTCTGTCTGT soooossssssssssooss 5-10-5 46 1491 655242 554 8234 8287 0 TAGAAACTAAGTTCTGTCTG soooossssssssssooss 5-10-5 25 562 655289 691 n/a 9505 3 GACCCTGATCTTCCATTCTC soooossssssssssooss 5-10-5 34 627 688389 692 n/a 9506 3 TGACCCTGATCTTCCATTCT soooossssssssssooss 5-10-5 19 1492 688390 693 n/a n/a n/a CTGACCCTGATCTTCCATTC soooossssssssssooss 5-10-5 21 1493 655290 694 n/a n/a n/a TCTGACCCTGATCTTCCATT soooossssssssssooss 5-10-5 67 628 672561 695 n/a n/a n/a CTCTGACCCTGATCTTCCAT soooossssssssssooss 5-10-5 25 1056 625345 696 n/a n/a n/a ACTCTGACCCTGATCTTCCA soooossssssssssooss 5-10-5 15 1494 655291 697 n/a n/a n/a TACTCTGACCCTGATCTTCC soooossssssssssooss 5-10-5 18 629 688391 698 n/a n/a n/a ATACTCTGACCCTGATCTTC soooossssssssssooss 5-10-5 40 1495 688392 699 n/a n/a n/a AATACTCTGACCCTGATCTT soooossssssssssooss 5-10-5 8 1496 619423 n/a 13642 13681 0 GCCATGATTTCTTGTCTGGG soooossssssssssooss 5-10-5 77 383 655417 n/a 14089 14136 0 GGAACTAACATGTAGGCACT soooossssssssssooss 5-10-5 83 738 655420 n/a 14331 14378 0 GCTGACACTGAACAGATACA soooossssssssssooss 5-10-5 51 741 655422 n/a 14452 14499 0 ATCATTTAATTAATGTATTT soooossssssssssooss 5-10-5 33 743 671084 n/a 14316 14363 0 ATACAGGACTAAAGTGCTTC soooossssssssssooss 5-10-5 74 1055 688393 n/a 13641 13680 0 CCATGATTTCTTGTCTGGGA soooossssssssssooss 5-10-5 54 1497 688394 n/a 13643 13682 0 GGCCATGATTTCTTGTCTGG soooossssssssssooss 5-10-5 52 1498 688395 n/a 13644 13683 0 GGGCCATGATTTCTTGTCTG soooossssssssssooss 5-10-5 46 1499 688396 n/a 13731 13770 0 ACTTAAGTTCATCTACAGTA soooossssssssssooss 5-10-5 18 1500 688397 n/a 13792 13831 0 TCCACTGCTGGATGGAAAAA soooossssssssssooss 5-10-5 20 1501 688398 n/a 13968 14007 0 ATATTATTTATCTTACTCAA soooossssssssssooss 5-10-5 32 1502 688399 n/a 13982 14021 0 GTTCTAAGTGCTTTATATTA soooossssssssssooss 5-10-5 30 1503 688400 n/a 14090 14137 0 AGGAACTAACATGTAGGCAC soooossssssssssooss 5-10-5 87 1504 688401 n/a 14122 14169 0 ATATAAGATAATACATGTAA soooossssssssssooss 5-10-5 6 1505 688402 n/a 14243 14290 0 CATCATGAGCCTAAAGGAAA soooossssssssssooss 5-10-5 22 1506 688403 n/a 14244 14291 0 CCATCATGAGCCTAAAGGAA soooossssssssssooss 5-10-5 37 1507 688404 n/a 14300 14347 0 CTTCTGATTCAAGCCATTAA soooossssssssssooss 5-10-5 76 1508 688405 n/a 14302 14349 0 TGCTTCTGATTCAAGCCATT soooossssssssssooss 5-10-5 55 1509 688406 n/a 14303 14350 0 GTGCTTCTGATTCAAGCCAT soooossssssssssooss 5-10-5 50 1510 688407 n/a 14304 14351 0 AGTGCTTCTGATTCAAGCCA soooossssssssssooss 5-10-5 68 1511 688408 n/a 14305 14352 0 AAGTGCTTCTGATTCAAGCC soooossssssssssooss 5-10-5 41 1512 688409 n/a 14306 14353 0 AAAGTGCTTCTGATTCAAGC soooossssssssssooss 5-10-5 18 1513 688410 n/a 14307 14354 0 TAAAGTGCTTCTGATTCAAG soooossssssssssooss 5-10-5 29 1514 688411 n/a 14308 14355 0 CTAAAGTGCTTCTGATTCAA soooossssssssssooss 5-10-5 43 1515 688412 n/a 14309 14356 0 ACTAAAGTGCTTCTGATTCA soooossssssssssooss 5-10-5 33 1516 688413 n/a 14310 14357 0 GACTAAAGTGCTTCTGATTC soooossssssssssooss 5-10-5 49 1517 688414 n/a 14311 14358 0 GGACTAAAGTGCTTCTGATT soooossssssssssooss 5-10-5 49 1518 688415 n/a 14312 14359 0 AGGACTAAAGTGCTTCTGAT soooossssssssssooss 5-10-5 55 1519 688416 n/a 14313 14360 0 CAGGACTAAAGTGCTTCTGA soooossssssssssooss 5-10-5 71 1520 688417 n/a 14314 14361 0 ACAGGACTAAAGTGCTTCTG soooossssssssssooss 5-10-5 66 1521 688418 n/a 14315 14362 0 TACAGGACTAAAGTGCTTCT soooossssssssssooss 5-10-5 61 1522 688419 n/a 14317 14364 0 GATACAGGACTAAAGTGCTT soooossssssssssooss 5-10-5 76 1523 688420 n/a 14318 14365 0 AGATACAGGACTAAAGTGCT soooossssssssssooss 5-10-5 46 1524 688421 n/a 14319 14366 0 CAGATACAGGACTAAAGTGC soooossssssssssooss 5-10-5 53 1525 688422 n/a 14320 14367 0 ACAGATACAGGACTAAAGTG soooossssssssssooss 5-10-5 23 1526 688423 n/a 14321 14368 0 AACAGATACAGGACTAAAGT soooossssssssssooss 5-10-5 28 1527 688424 n/a 14322 14369 0 GAACAGATACAGGACTAAAG soooossssssssssooss 5-10-5 26 1528 688425 n/a 14323 14370 0 TGAACAGATACAGGACTAAA soooossssssssssooss 5-10-5 13 1529 688426 n/a 14324 14371 0 CTGAACAGATACAGGACTAA soooossssssssssooss 5-10-5 27 1530 688427 n/a 14325 14372 0 ACTGAACAGATACAGGACTA soooossssssssssooss 5-10-5 37 1531 688428 n/a 14326 14373 0 CACTGAACAGATACAGGACT soooossssssssssooss 5-10-5 35 1532 688429 n/a 14327 14374 0 ACACTGAACAGATACAGGAC soooossssssssssooss 5-10-5 28 1533 688430 n/a 14328 14375 0 GACACTGAACAGATACAGGA soooossssssssssooss 5-10-5 39 1534 688431 n/a 14329 14376 0 TGACACTGAACAGATACAGG soooossssssssssooss 5-10-5 38 1535 688432 n/a 14330 14377 0 CTGACACTGAACAGATACAG soooossssssssssooss 5-10-5 64 1536 688433 n/a 14332 14379 0 GGCTGACACTGAACAGATAC soooossssssssssooss 5-10-5 50 1537 688434 n/a 14333 14380 0 AGGCTGACACTGAACAGATA soooossssssssssooss 5-10-5 18 1538 688435 n/a 14334 14381 0 AAGGCTGACACTGAACAGAT soooossssssssssooss 5-10-5 45 1539 688436 n/a 14335 14382 0 AAAGGCTGACACTGAACAGA soooossssssssssooss 5-10-5 28 1540 688437 n/a 14336 14383 0 GAAAGGCTGACACTGAACAG soooossssssssssooss 5-10-5 18 1541 688438 n/a 14337 14384 0 TGAAAGGCTGACACTGAACA soooossssssssssooss 5-10-5 23 1542 688439 n/a 14358 14405 0 AATGGGATTTAAAATGATGT soooossssssssssooss 5-10-5 26 1543 688440 n/a 14359 14406 0 AAATGGGATTTAAAATGATG soooossssssssssooss 5-10-5 30 1544 688441 n/a 14360 14407 0 CAAATGGGATTTAAAATGAT soooossssssssssooss 5-10-5 16 1545
(585) TABLE-US-00061 TABLE 60 Percent inhibition of the C9ORF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19 SEQ SEQ SEQ ID ID ID NO: NO: 1 NO: 2 19 % SEQ ISIS Start Start Start inhibition ID NO Site Site Site Sequence Linkage Motif (RTS3750) NO 576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 62 20 619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 75 20 688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 67 1130 688237 485 8165 8218 ATCAAAGATTAATGAAAC sooosssssssssooss 5-8-5 42 1289 688238 486 8166 8219 CATCAAAGATTAATGAAA sooosssssssssooss 5-8-5 0 1290 688239 487 8167 8220 CCATCAAAGATTAATGAA sooosssssssssooss 5-8-5 39 1291 688240 488 8168 8221 TCCATCAAAGATTAATGA sooosssssssssooss 5-8-5 45 1292 688241 489 8169 8222 TTCCATCAAAGATTAATG sooosssssssssooss 5-8-5 0 1293 688242 490 8170 8223 TTTCCATCAAAGATTAAT sooosssssssssooss 5-8-5 53 1294 688243 491 8171 8224 GTTTCCATCAAAGATTAA sooosssssssssooss 5-8-5 46 1295 688244 492 8172 8225 AGTTTCCATCAAAGATTA sooosssssssssooss 5-8-5 43 1296 688245 493 8173 8226 CAGTTTCCATCAAAGATT sooosssssssssooss 5-8-5 0 1297 688246 494 8174 8227 CCAGTTTCCATCAAAGAT sooosssssssssooss 5-8-5 44 1298 688247 495 8175 8228 TCCAGTTTCCATCAAAGA sooosssssssssooss 5-8-5 46 1299 688248 496 8176 8229 TTCCAGTTTCCATCAAAG sooosssssssssooss 5-8-5 58 1300 688249 497 8177 8230 ATTCCAGTTTCCATCAAA sooosssssssssooss 5-8-5 46 1301 688250 498 8178 8231 CATTCCAGTTTCCATCAA sooosssssssssooss 5-8-5 50 1302 688251 499 8179 8232 CCATTCCAGTTTCCATCA sooosssssssssooss 5-8-5 58 1303 688252 500 8180 8233 CCCATTCCAGTTTCCATC sooosssssssssooss 5-8-5 66 1304 688253 501 8181 8234 CCCCATTCCAGTTTCCAT sooosssssssssooss 5-8-5 59 1305 688254 502 8182 8235 TCCCCATTCCAGTTTCCA sooosssssssssooss 5-8-5 52 1306 688255 503 8183 8236 ATCCCCATTCCAGTTTCC sooosssssssssooss 5-8-5 61 1307 688256 504 8184 8237 GATCCCCATTCCAGTTTC sooosssssssssooss 5-8-5 50 1308 688257 505 8185 8238 CGATCCCCATTCCAGTTT sooosssssssssooss 5-8-5 48 1309 688258 506 8186 8239 GCGATCCCCATTCCAGTT sooosssssssssooss 5-8-5 44 1310 688259 507 8187 8240 TGCGATCCCCATTCCAGT sooosssssssssooss 5-8-5 49 1311 688260 508 8188 8241 CTGCGATCCCCATTCCAG sooosssssssssooss 5-8-5 70 1312 688261 509 8189 8242 GCTGCGATCCCCATTCCA sooosssssssssooss 5-8-5 72 1313 688262 510 8190 8243 TGCTGCGATCCCCATTCC sooosssssssssooss 5-8-5 47 1314 688263 511 8191 8244 GTGCTGCGATCCCCATTC sooosssssssssooss 5-8-5 0 1315 688264 512 8192 8245 TGTGCTGCGATCCCCATT sooosssssssssooss 5-8-5 56 1316 688265 513 8193 8246 ATGTGCTGCGATCCCCAT sooosssssssssooss 5-8-5 65 1317 688266 514 8194 8247 TATGTGCTGCGATCCCCA sooosssssssssooss 5-8-5 61 1318 688267 533 8213 8266 AAGTATAATTGATAGTCC sooosssssssssooss 5-8-5 47 1319 688268 534 8214 8267 GAAGTATAATTGATAGTC sooosssssssssooss 5-8-5 48 1320 688269 535 8215 8268 GGAAGTATAATTGATAGT sooosssssssssooss 5-8-5 35 1321 688270 536 8216 8269 TGGAAGTATAATTGATAG sooosssssssssooss 5-8-5 41 1322 688271 537 8217 8270 GTGGAAGTATAATTGATA sooosssssssssooss 5-8-5 48 1323 688272 538 8218 8271 TGTGGAAGTATAATTGAT sooosssssssssooss 5-8-5 42 1324 688273 539 8219 8272 CTGTGGAAGTATAATTGA sooosssssssssooss 5-8-5 32 1325 688274 540 8220 8273 TCTGTGGAAGTATAATTG sooosssssssssooss 5-8-5 0 1326 688275 541 8221 8274 GTCTGTGGAAGTATAATT sooosssssssssooss 5-8-5 0 1327 688276 542 8222 8275 TGTCTGTGGAAGTATAAT sooosssssssssooss 5-8-5 65 1328 688277 543 8223 8276 CTGTCTGTGGAAGTATAA sooosssssssssooss 5-8-5 0 1329 688278 544 8224 8277 TCTGTCTGTGGAAGTATA sooosssssssssooss 5-8-5 62 1330 688279 545 8225 8278 TTCTGTCTGTGGAAGTAT sooosssssssssooss 5-8-5 55 1331 688280 546 8226 8279 GTTCTGTCTGTGGAAGTA sooosssssssssooss 5-8-5 77 1332 688281 547 8227 8280 AGTTCTGTCTGTGGAAGT sooosssssssssooss 5-8-5 63 1333 688282 548 8228 8281 AAGTTCTGTCTGTGGAAG sooosssssssssooss 5-8-5 49 1334 688283 549 8229 8282 TAAGTTCTGTCTGTGGAA sooosssssssssooss 5-8-5 0 1335 688284 550 8230 8283 CTAAGTTCTGTCTGTGGA sooosssssssssooss 5-8-5 54 1336 688285 551 8231 8284 ACTAAGTTCTGTCTGTGG sooosssssssssooss 5-8-5 69 1337 688286 552 8232 8285 AACTAAGTTCTGTCTGTG sooosssssssssooss 5-8-5 65 1338 688287 553 8233 8286 AAACTAAGTTCTGTCTGT sooosssssssssooss 5-8-5 40 1339 688288 554 8234 8287 GAAACTAAGTTCTGTCTG sooosssssssssooss 5-8-5 36 1340 688289 555 8235 8288 AGAAACTAAGTTCTGTCT sooosssssssssooss 5-8-5 47 1341 688290 556 8236 8289 TAGAAACTAAGTTCTGTC sooosssssssssooss 5-8-5 48 1342 688291 557 8237 8290 GTAGAAACTAAGTTCTGT sooosssssssssooss 5-8-5 45 1343 688292 558 8238 8291 GGTAGAAACTAAGTTCTG sooosssssssssooss 5-8-5 44 1344 688293 559 8239 8292 AGGTAGAAACTAAGTTCT sooosssssssssooss 5-8-5 58 1345 688294 560 8240 8293 GAGGTAGAAACTAAGTTC sooosssssssssooss 5-8-5 45 1346 688295 561 8241 8294 GGAGGTAGAAACTAAGTT sooosssssssssooss 5-8-5 47 1347 688296 562 8242 8295 GGGAGGTAGAAACTAAGT sooosssssssssooss 5-8-5 44 1348 688297 563 8243 8296 TGGGAGGTAGAAACTAAG sooosssssssssooss 5-8-5 47 1349 688298 564 8244 8297 GTGGGAGGTAGAAACTAA sooosssssssssooss 5-8-5 53 1350 688299 565 8245 8298 AGTGGGAGGTAGAAACTA sooosssssssssooss 5-8-5 43 1351 688300 566 8246 8299 AAGTGGGAGGTAGAAACT sooosssssssssooss 5-8-5 36 1352 688301 567 8247 8300 GAAGTGGGAGGTAGAAAC sooosssssssssooss 5-8-5 41 1353 688302 568 8248 8301 TGAAGTGGGAGGTAGAAA sooosssssssssooss 5-8-5 0 1354 688303 569 8249 8302 ATGAAGTGGGAGGTAGAA sooosssssssssooss 5-8-5 41 1355 688304 570 8250 8303 TATGAAGTGGGAGGTAGA sooosssssssssooss 5-8-5 31 1356 688305 571 8251 8304 CTATGAAGTGGGAGGTAG sooosssssssssooss 5-8-5 46 1357 688306 572 8252 8305 TCTATGAAGTGGGAGGTA sooosssssssssooss 5-8-5 30 1358 688307 573 8253 8306 CTCTATGAAGTGGGAGGT sooosssssssssooss 5-8-5 54 1359 688308 574 8254 8307 ACTCTATGAAGTGGGAGG sooosssssssssooss 5-8-5 50 1360 688309 575 8255 8308 CACTCTATGAAGTGGGAG sooosssssssssooss 5-8-5 60 1361 688310 576 8256 8309 ACACTCTATGAAGTGGGA sooosssssssssooss 5-8-5 56 1362 688311 577 8257 8310 CACACTCTATGAAGTGGG sooosssssssssooss 5-8-5 57 1363 688312 578 8258 8311 ACACACTCTATGAAGTGG sooosssssssssooss 5-8-5 41 1364 688313 579 8259 8312 CACACACTCTATGAAGTG sooosssssssssooss 5-8-5 38 1365
Example 13: Dose-Dependent Antisense Inhibition of Human C9ORF72 mRNA in HepG2 Cells
(586) Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C9ORF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 619420 described in Example 2 hereinabove was also tested. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.33 μM, 1.00 μM, 3.00 μM, or 9.00 μM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C9ORF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 was used to measure the total C9ORF72 mRNA levels. C9ORF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C9ORF72 levels, relative to untreated control cells.
(587) The half maximal inhibitory concentration (IC.sup.50) of each oligonucleotide is also presented in the Tables below. As shown in the Tables below, total C9ORF72 mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
(588) TABLE-US-00062 TABLE 61 Dose-dependent inhibition of total C9ORF72 mRNA levels in HepG2 cells 0.33 1.00 3.00 9.00 IC.sub.50 ISIS No μM μM μM μM (μM) 619411 55 68 89 90 <0.3 619420 41 74 87 95 0.4 655178 45 63 84 92 0.4 687962 48 61 83 86 0.4 687963 34 53 77 76 0.8 687978 50 60 70 65 <0.3 688077 49 63 70 86 0.3 688088 51 72 86 92 <0.3 688089 51 66 76 85 <0.3 688099 41 66 73 85 0.5 688100 44 64 79 86 0.4 688101 53 64 77 74 <0.3 688102 29 43 52 62 2.4 688172 31 47 77 88 1.0 688261 35 41 50 49 6.7 688347 41 60 79 89 0.5 688348 57 61 85 92 <0.3 688352 51 64 71 75 <0.3
(589) TABLE-US-00063 TABLE 62 Dose-dependent inhibition of total C9ORF72 mRNA levels in HepG2 cells 0.33 1.00 3.00 9.00 IC.sub.50 ISIS No μM μM μM μM (μM) 619412 48 69 83 87 0.3 619413 34 33 47 85 1.8 619420 53 72 80 84 <0.3 655173 48 62 76 89 0.4 655174 38 59 82 79 0.6 655179 47 68 83 80 0.3 655186 40 53 82 85 0.6 655203 28 61 87 79 0.7 655230 36 59 77 89 0.7 655231 49 69 78 81 <0.3 688349 40 63 84 79 0.5 688351 47 74 81 88 0.3 688355 50 56 79 83 0.4 688356 47 64 78 85 0.3 688364 29 44 57 78 1.5 688374 38 50 79 70 0.8 688378 41 67 85 87 0.4 688379 39 42 83 83 0.8 688380 50 62 68 82 0.3
(590) TABLE-US-00064 TABLE 63 Dose-dependent inhibition of total C9ORF72 mRNA levels in HepG2 cells 0.33 1.00 3.00 9.00 IC.sub.50 ISIS No μM μM μM μM (μM) 619420 37 39 87 92 0.3 619423 55 73 84 82 <0.3 655173 53 83 82 94 <0.3 655233 34 28 41 79 2.4 655290 16 27 68 78 2.0 655417 73 42 87 84 <0.3 688022 51 71 80 76 <0.3 688360 32 63 85 72 0.6 688361 46 70 34 85 0.5 688382 42 58 79 81 0.5 688383 43 63 80 87 0.5 688385 41 60 82 84 0.5 688400 61 81 85 85 <0.3 688404 38 62 78 81 0.6 688407 37 53 71 85 0.8 688415 43 18 79 73 1.3 688416 48 74 73 81 <0.3 688417 33 61 67 74 0.8 688418 34 55 77 82 0.8
Example 14: Tolerability of Antisense Oligonucleotides Targeting Human C9ORF72 in Mice
(591) Antisense oligonucleotides from the Examples above were tested in a standard mouse model to assess tolerability of the oligonucleotides. The rodents were assessed by standard FOB assays and measurement of GFAP and/or AIF expression levels.
(592) Groups of mice were administered a single ICV dose of 700 μg of ISIS oligonucleotides.
(593) Mouse FOB Assay
(594) At 3 hours, one week, 2 weeks, 4 weeks, 6 weeks, and 8 weeks post injection, each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the 700 μg ICV dose, and met all other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the 700 μg ICV dose but met all other criteria, it would receive a score of 1.
(595) The results are presented as individual scores for each mouse in each group. The expression levels of GFAP and AIF1 in the thoracic spinal cord of the mice were assessed by qRT-PCR after 8 weeks.
(596) Study 1 with cEt Oligonucleotides
(597) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(598) TABLE-US-00065 TABLE 64 Antisense oligonucleotides targeted to SEQ ID NO: 2 ISIS No Start Site 672744 1335 672747 1338 672774 1368 672775 1369 672778 1372 672779 1373 672831 1440 672908 1349 672909 1350 672919 1360 672924 1368 672925 1369 672927 1371 672928 1372 672929 1373 672976 1435 672980 1439 672981 1440
(599) TABLE-US-00066 TABLE 65 FOB scores in C57/B16 mice 3 hr PBS 0, 0, 0, 0 672744 7, 7, 7, 7 672747 7, 7, 7, 7 672774 5, 5, 5, 5 672775 5, 7, 5, 7 672778 1, 7, 1, 1 672779 7, 2, 5, 7 672831 7, 7, 7, 7 672908 6, 1, 1, 1 672909 6, 6, 6, 4 672919 5, 5, 5, 5 672924 4, 6, 7, 6 672925 4, 4, 4, 4 672927 0, 0, 0, 0 672928 0, 0, 0, 0 672929 7, 7, 7, 7 672976 5, 7, 7, 7 672980 2, 2, 2, 2 672981 6, 6, 6, 6
Study 2 with cEt Oligonucleotides
(600) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(601) TABLE-US-00067 TABLE 66 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 672982 1441 672983 1442 672984 1443 672985 1444 673021 1510 673023 1512 673026 1515 673036 1327 673047 1338 673057 1348 673058 1349 673067 1358 673068 1359 673074 1368 673079 1373 673082 1376 673088 1396 673125 1434 673126 1435 673127 1436 672832 1441
(602) TABLE-US-00068 TABLE 67 FOB scores in C57/B16 mice 3 hr PBS 0, 0, 0, 0 672982 7, 7, 7, 7 672983 5, 7, 5, 7 672984 4, 6, 6, 6 672985 5, 4, 4, 4 673021 5, 5, 5, 5 673023 7, 7, 7, 7 673026 0, 0, 0, 0 673036 7, 7, 7, 7 673047 5, 5, 5, 6 673057 5, 0, 5, 7 673058 3, 3, 3, 3 673067 7, 0, 0, 6 673068 6, 6, 6, 6 673074 1, 1, 1, 1 673079 6, 6, 7, 6 673082 1, 3, 0, 3 673088 6, 6, 6, 6 673125 0, 0, 0, 0 673126 0, 0, 0, 0 673127 7, 7, 7, 7 672832 6, 6, 6, 7
Study 3 with cEt Oligonucleotides
(603) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(604) TABLE-US-00069 TABLE 68 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 673131 1440 673132 1441 673133 1442 673134 1443 673135 1444 673193 1334 673203 1344 673204 1345 673224 1368 673225 1369 673226 1370 673228 1372 673229 1373 673275 1434 673276 1435 673280 1439
(605) TABLE-US-00070 TABLE 69 FOB scores in C57/B16 mice 3 hr PBS 0, 0, 0, 0 673131 4, 4, 4, 5 673132 4, 4, 4, 4 673133 4, 3, 4, 3 673134 5, 6, 3, 6 673135 5, 3, 4, 5 673193 6, 6, 6, 6 673203 4, 3, 4, 4 673204 2, 3, 2, 2 673224 5, 5, 5, 5 673225 1, 2, 2, 2 673226 1, 1, 1, 1 673228 2, 2, 2, 2 673229 6, 6, 6, 6 673275 1, 1, 1, 1 673276 3, 3, 3, 3 673280 1, 1, 1, 1
Study 4 with cEt Oligonucleotides
(606) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(607) TABLE-US-00071 TABLE 70 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 673128 1437 673130 1439 673281 1440 673282 1441 673283 1442 673284 1443 673285 1444 673323 1512 673331 1520 673332 1521 673374 1368 673375 1369 673377 1371 673378 1372 673379 1373 673430 1439 673431 1440 673432 1441 673434 1443
(608) TABLE-US-00072 TABLE 71 FOB scores in C57/B16 mice 3 hr PBS 0, 0, 0, 0 673128 0, 0, 0, 0 673130 0, 0, 0, 0 673281 7, 7, 7, 7 673282 7, 7, 7, 7 673283 5, 6, 6, 7 673284 5, 0, 0, 0 673285 3, 3, 3, 3 673323 7, 7, 7, 7 673331 7, 7, 7, 7 673332 7, 7, 7, 7 673374 7, 7, 7, 7 673375 2, 3, 2, 3 673377 0, 0, 0, 0 673378 1, 1, 1, 1 673379 4, 6, 6, 7 673430 7, 7, 7, 7 673431 7, 7, 7, 7 673432 7, 6, 6, 7 673434 7, 7, 7, 7
Study 1 with MOE Oligonucleotides
(609) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(610) TABLE-US-00073 TABLE 72 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS No SEQ ID NO: 2 619253 1406 619293 1446 619322 1481 619352 1519 619353 1520 619410 7840 619414 8033 619420 7990 619421 28251 619422 3452 619423 13642 653222 1553 653223 5325 655016 1458 655017 1459
(611) TABLE-US-00074 TABLE 73 FOB scores in C57/B16 mice 3 hrs PBS 0,0,0,0 619253 3,3,7,7 619293 6,4,2,4 619322 2,2,2,4 619352 0,0,7,0 619353 6,4,7,6 619410 7,3,3,3 619414 6,6,6,6 619420 7,7,7,7 619421 1,1,1,1 619422 5,5,5,5 619423 6,6,6,6 653222 3,3,3,3 653223 1,1,7,1 655016 5,5,3,3 655017 0,0,0,0
Study 2 with MOE Oligonucleotides
(612) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(613) TABLE-US-00075 TABLE 74 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS No SEQ ID NO: 2 619173 1326 619174 1327 619178 1331 619179 1332 619180 1333 619181 1334 619182 1335 619185 1338 619186 1339 619187 1340 619191 1344 619201 1354 619202 1355 619203 1356 619216 1369 619217 1370
(614) TABLE-US-00076 TABLE 75 FOB scores in C57/B16 mice 3 hrs PBS 0,0,0,0 619173 7,7,7,7 619174 7,7,7,7 619178 7,7,7,7 619179 7,7,7,7 619180 7,7,7,7 619181 7,7,7,7 619182 7,7,7,7 619185 7,6,6,7 619186 6,6,6,7 619187 5,7,5,7 619191 5,5,3,5 619201 3,3,3,1 619202 6,6,6,6 619203 5,1,5,5 619216 4,4,4,4 619217 2,2,2,2
Study 3 with MOE Oligonucleotides
(615) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(616) TABLE-US-00077 TABLE 76 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 619218 1371 619245 1398 619246 1399 619247 1400 619251 1404 619252 1405 619259 1412 619260 1413 619276 1429 619278 1431 619280 1433 619284 1437 619292 1445 619297 1450 619298 1451 619307 1466
(617) TABLE-US-00078 TABLE 77 FOB scores in C57/B16 mice 3 hrs PBS 0,0,0,0 619218 4,2,7,7 619245 4,4,4,4 619246 4,5,5,4 619247 1,1,1,1 619251 4,7,4,4 619252 6,6,6,0 619259 6,6,4,5 619260 4,4,4,4 619276 3,3,4,4 619278 4,7,2,7 619280 7,7,7,7 619284 0,0,0,0 619292 6,5,5,5 619297 7,4,4,4 619298 0,0,0,0 619307 0,0,0,0
Study 4 with MOE Oligonucleotides
(618) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(619) TABLE-US-00079 TABLE 78 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 619266 1419 619268 1421 619316 1475 619317 1476 619336 1503 619337 1504 619338 1505 619339 1506 619341 1508 619342 1509 619343 1510 619344 1511 619346 1513 619350 1517 619351 1518 619413 8020
(620) TABLE-US-00080 TABLE 79 FOB scores in C57/B16 mice 3 hrs PBS 0,0,0,0 619266 2,2,2,2 619268 6,6,7,7 619316 5,5,5,7 619317 2,3,3,4 619336 1,1,1,7 619338 0,0,7,7 619339 0,5,7,7 619341 7,7,7,7 619342 6,6,6,6 619343 6,6,6,6 619344 7,7,7,7 619346 5,5,7,7 619350 6,6,7,7 619351 6,6,7,7 619413 7,6,7,6
Example 15: Tolerability of Antisense Oligonucleotides Targeting Human C9ORF72 in Rats
(621) Antisense oligonucleotides from the Examples above were tested in a standard rat model to assess tolerability of the oligonucleotides. The rodents were assessed by standard FOB assays and measurement of GFAP and/or AIF expression levels. Groups of Sprague-Dawley rats were administered intrathecally with 2,000 μg or 3,000 μg of ISIS oligonucleotide as specified in the Tables below.
(622) Rat FOB Assay
(623) At 3 hours, one week, 2 weeks, 4 weeks, 6 weeks, and 8 weeks post injection the movement of 7 different parts of the body was evaluated for each rat. The 7 body parts were (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; and (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts was evaluated, the sub-scores were summed for each rat and then averaged for each group. Saline treated rats generally receive a score of 0.
(624) Study 1 with 5-10-5 MOE Oligonucleotides at 3.000 g
(625) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(626) TABLE-US-00081 TABLE 80 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS No SEQ ID NO: 2 619185 1338 619186 1339 619187 1340 619191 1344 619201 1354 619203 1356 619217 1370 619218 1371 619251 1404 619252 1405 619259 1412 619266 1419 619268 1421 619278 1431 619284 1437 619346 1513 619350 1517 619351 1518
(627) TABLE-US-00082 TABLE 81 FOB scores in Sprague-Dawley rats 3 hrs PBS 0,0,0 619185 7,7,6 619186 0,6,6 619187 7,0,6 619191 6,0,0 619201 1,4,4 619203 5,1,5 619217 4,4,4 619218 4,2,4 619251 6,6,6 619252 6,6,6 619259 0,6,6 619266 4,4,3 619268 6,6,6 619278 6,6,6 619284 1 619346 0,0,6 619350 4,0,3 619351 3,3,3
Study 2 with 5-10-5 MOE Oligonucleotides at 3,000 μg
(628) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(629) TABLE-US-00083 TABLE 82 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 619176 1329 619183 1336 619253 1406 619260 1413 619276 1429 619292 1445 619293 1446 619307 1466 619317 1476 619338 1505 619339 1506 619342 1509
(630) TABLE-US-00084 TABLE 83 FOB scores in Sprague-Dawley rats 3 hrs PBS 0,1,1 619176 7,7,6 619183 6,6,6 619253 7,6,6 619260 6,5,5 619276 4,5,5 619292 6,6,0 619293 ND 619307 ND 619317 6,6,7 619338 7,7,7 619339 7,6,3 619342 6,6,6
Study 3 with 5-8-5 MOE Oligonucleotides at 3,000 μg
(631) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(632) TABLE-US-00085 TABLE 84 Antisense agonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS No SEQ ID NO: 2 672595 1340 672599 1344 672602 1347 672624 1372 672636 1399 672637 1400 672640 1403 672642 1405 672651 1414 672652 1415
(633) TABLE-US-00086 TABLE 85 FOB scores in Sprague-Dawley rats 3 hr PBS 0, 0, 0, 0 672595 4, 0, 3, 0, 4, 4, 4 672599 3, 0, 3, 0, 1, 3 672602 3, 3, 1, 0, 0, 3 672624 3, 0, 0, 7, 3, 3, 3 672636 5, 5, 5, 5 672637 1, 1, 2, 1 672640 6, 6, 5, 1, 6, 0 672642 6, 7, 0, 7, 6, 6 672651 6, 1, 1, 6, 3, 2, 3 672652 6, 1, 1, 5, 4, 4
Study 4 with 5-8-5 MOE Oligonucleotides at 3,000 μg
(634) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.
(635) TABLE-US-00087 TABLE 86 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 672664 1427 672665 1428 672670 1433 672671 1434 672675 1438 672676 1439 672678 1441 672679 1442 672681 1444 672683 1446 672693 1464 672697 1468 672699 1470 672700 1471 672723 1512 672730 1519
(636) TABLE-US-00088 TABLE 87 FOB scores in Sprague-Dawley rats ISIS No 3 hr PBS 1, 1, 1, 0 672664 6, 6, 6, 5 672665 4, 0, 4, 0, 4, 1 672670 4, 2, 4, 4 672671 4, 0, 0, 2, 5, 3 672675 3, 3, 0, 2, 1, 1 672676 1, 5, 0, 1, 1, 4 672678 0, 6, 6, 4, 6, 6 672679 3, 0, 0, 2, 3, 4 672681 1, 2, 2, 2 672683 0, 2, 5, 5, 0, 4 672693 ND 672697 6, 6, 6, 6 672699 0, 0, 3, 4, 4, 1 672700 4, 7, 4, 4 672723 4, 4, 4, 4 672730 2, 2, 3, 3
Study 5 with 5-10-5 MOE Oligonucleotides at 3,000 μg
(637) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below and indicate that several oligonucleotides were tolerable in this model.
(638) TABLE-US-00089 TABLE 88 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of SEQ ISIS No ID NO: 2 619411 8004 619412 8012 627833 8001 655153 7916 655173 7992 655178 8014 655179 8016 655202 8098 655231 8183 655232 8186 655233 8189 655417 14089 655420 14331 671081 8110 671082 8140 671083 8230 671084 14316 672561 mRNA
(639) TABLE-US-00090 TABLE 89 FOB scores in Sprague-Dawley rats 3 hr PBS 0,0,0,0 619411 6,6,6,6 619412 4,6,6,0 627833 6,6,6,1 655153 6,6,6,1 655173 6,6,6,0 655178 5,5,6,6 655179 6,6,6,6 655202 6,0,6,6 655231 4,4,4,4 655232 0,0,0,0 655233 6,6,6,6 655417 1,6,6,7 655420 5,7,5,5 671081 5,5,5,5 671082 5,6,5,7 671083 7,6,7,6 671084 6,0,4,3 672561 4,4,4,1
Study 6 with 5-8-5 MOE Oligonucleotides at 2,000 μg
(640) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below and indicate that several oligonucleotides were tolerable in this model.
(641) TABLE-US-00091 TABLE 90 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 687978 14315 688022 7918 688077 7992 688088 8003 688089 8004 688099 8014 688100 8015
(642) TABLE-US-00092 TABLE 91 FOB scores in Sprague-Dawley rats 3 hr PBS 0, 0, 0, 0 687978 3, 3, 3, 3 688022 3, 3, 3, 3 688077 0, 3, 1, 3, 3, 3 688088 3, 0, 3, 3, 3 688089 1, 3, 3, 3, 3 688099 3, 4, 0, 3, 3 688100 0, 3, 4, 4
Study 7 with 5-8-5 and 5-10-5 MOE Oligonucleotides at 2,000 μg
(643) The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below and indicate that several oligonucleotides were tolerable in this model.
(644) TABLE-US-00093 TABLE 92 Antisense oligonucleotides targeted to SEQ ID NO: 2 Start Site of ISIS SEQ ID No NO: 2 688101 8016 688348 7993 688356 8015 688380 8184 688382 8187 688400 14090 688407 14304 688415 14312 688416 14313 688417 14314
(645) TABLE-US-00094 TABLE 93 FOB scores in Sprague-Dawley rats 3 hr PBS 0, 0, 0, 0 688101 3, 2, 2, 2 688348 2, 1, 2, 2 688356 3, 3, 3, 3 688380 0, 0, 1, 0 688382 2, 2, 2, 2 688400 0, 3, 3, 3 688407 2, 2, 2, 2 688415 3, 0, 3, 3 688416 3, 3, 3, 3 688417 4, 4, 3, 3
Example 16: Acute Tolerability of Oligonucleotides from WO 2014/062691
(646) Oligonucleotides described in WO 2014/062691 were tested in an acute tolerability study in mice. The tested oligonucleotides include ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083, which are 5-10-5 MOE gapmers with a full phosphorothioate backbone and each cytosine is a 5-methylcytosine. The sequences are provided in the Table below. Mice were separated into groups of 3 or 4 mice. Each mouse in each group of mice was administered a single ICV dose of either 700 ug of the oligonucleotides in the table below. At 3 hours post injection, each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse shows any movement without stimuli (4) the mouse demonstrates forward movement after its lifted; (5) the mouse demonstrates any movement after its lifted; (6) the mouse responds to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the ICV dose, and met all other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the dose but met all other criteria, it would receive a score of 1. Saline treated mice generally receive a score of 0. Results are presented as the average score for each treatment group in the Table below. These results demonstrate that ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 were poorly tolerated.
(647) TABLE-US-00095 TABLE 94 Antisense oligonucleotides from WO 2014/062691 ISIS No Sequence SEQ ID NO 576816 GCCTTACTCTAGGACCAAGA 20 576974 GGGACACTACAAGGTAGTAT 401 577061 TACAGGCTGCGGTTGTTTCC 97 577065 CCCGGCCCCTAGCGCGCGAC 98 577083 GGTAACTTCAAACTCTTGGG 382
(648) TABLE-US-00096 TABLE 95 FOB scores in mice 3 hrs 5 hrs 576816 7,7,7 7,7,7 576974 6,5,6 7,5,7 577061 7,7,7 7,7,7 577065 6,6,6 7,7,7 577083 7,7,7 7,7,7
(649) Gapmers from the studies described above, including compounds ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 which were previously disclosed in WO 2014/062691, are tested for tolerability in Sprague-Dawley rats. Rats are injected intrathecally with 3 mg of a single dose of ISIS oligonucleotide. A control group of rats is injected intrathecally with PBS. Acute tolerability is assessed 3 hours post-dose using a functional observational battery (FOB). This score is used to evaluate the acute tolerability of a compound with lower scores denoting better tolerated compounds. Control animals usually have a score of ‘0’ or ‘1’. At 3 hours post injection, the rats are observed by placing each rat on the cage top and evaluating certain functions, assigning a number of ‘0’ or ‘1’ depending on whether the rat exhibits normal function in the region of interest (0) or does not (1) for each function, and then adding the total scores. Seven regions are assessed, including tail, hind paws, hind legs, hind end, front posture, fore paws, and head.
(650) Poor acute tolerability in mice is generally predictive of poor acute tolerability in rats. For example, ISIS 619185 (see Example 14 hereinabove) had an acute tolerability score of 7,6,6,6 (4 animals) in mouse, and an acute tolerability score of 7,7,6 (3 animals) in rats (See Example 15 hereinabove). ISIS 619342 (see Example 14 hereinabove) had an acute tolerability score of 6,6,6,6 (4 animals) in mouse, and an acute tolerability score of 6,6,6 (3 animals) in rats (see Example 15 hereinabove). Both compounds were deemed to be poorly tolerated acutely. It is therefore expected that the compounds ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083, which were previously disclosed in WO 2014/062691, will show similarly high FOB scores in rats as they did in mice.