Gene for controlling erectness growth of rice leaf blades and application thereof

Abstract

A method for controlling the building of architecture of gramineous crops and application thereof. The gene CYC U4;1 (Os10g41430) has a specific expression in a rice pulvinus (which is believed to have a specific expression in other gramineous crops), with a CDS sequence as shown in SEQ ID NO: 2, and an encoded amino acid sequence as shown in SEQ ID NO: 3. Also a promoter sequence of the gene, with the sequence as shown in SEQ ID NO: 1. Transgenic lines obtained by cloning a promoter and full-length CDS of CYC U4;1 to pCAMBIA1301 and transferring this into rice Nipponbare are all characterized by having smaller leaf-stem angles than those of wild rice, accordingly, the expression level of the gene CYC U4;1 can be increased or decreased with genetic engineering technology to control the plant architecture development, thereby improving the plant architecture and increasing the density of germplasm.

Claims

1. A method for controlling leaf erectness development of rice plants, comprising cloning a cDNA nucleic acid sequence of SEQ ID NO: 2 or a truncated portion of the cDNA with a sequence of base pairs 345 to 639 of SEQ ID NO: 2 into a plant expression vector, genetically transforming rice plants with the plant expression vector, wherein the genetic transformation is mediated by an agrobacterium, and screening for calluses that comprise the plant expression vector, and growing the genetically transformed rice plants, wherein the plant expression vector comprises the cloned cDNA nucleic acid sequence.

2. The method of claim 1, further comprising amplifying a promoter region comprising a nucleic acid sequence of SEQ ID NO: 1, and cloning a fragment of the amplified promoter region into to the plant expression vector.

3. The method of claim 1, wherein the plant expression vector is constructed to have the complete cDNA nucleic acid sequence of SEQ ID NO:2.

4. The method of claim 2, wherein the plant expression vector is constructed to have the complete cDNA nucleic acid sequence of SEQ ID NO:2.

5. The method of claim 4, wherein leaf-stem angles of the genetically transformed rice plants are decreased relative to a non-transformed control plant.

6. The method of claim 1, wherein the plant expression vector is constructed to have the truncated portion of the cDNA with a sequence of base pairs 345 to 639 of SEQ ID NO: 2.

7. The method of claim 6, wherein the plant expression vector is an RNAi vector.

8. The method of claim 7, wherein leaf-stem angles of the genetically transformed rice plants are increased relative to a non-transformed control plant.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows verification of specific expression of CYC U4;1 in a rice pulvinus by Realtime qRT-PCT.

(2) FIGS. 2A and 2B show the GUS staining results of pCYCU4::GUS transgenic rice, in which FIG. 2A shows the phenotype of the transgenic rice plant, and FIG. 2B shows the microscopic cross-sectional view of the GUS staining in the transgenic rice plant, with the arrow indicating the expression of CYC U4;1 in the leaf pulvinus.

(3) FIGS. 3A and 3B show phenotypes and transgenic expression levels of pCYCU4::CYC U4;1 transgenic rice (marked as CYC U4;1) in comparison to the wild type rice (marked as Ni for Nipponbare), in which, FIG. 3A compares the phenotype and transgenic expression level of the wild type rice (Ni) and transgenic rice (CYC U4;1) in a maturation stage, and FIG. 3B compares the phenotype and transgenic expression level of the wild type rice (Ni) and transgenic rice (CYC U4;1) in a seedling stage.

(4) FIGS. 4A and 4B show the phenotypes and transgenic expression levels of RNAi-CYC U4;1 transgenic rice (marked as RNAi-CYCU4) in comparison to the wild type rice (marked as Ni), in which, FIG. 4A compares the phenotype and transgenic expression level of the wild type rice (Ni) and transgenic rice (RNAi-CYCU4) in the maturation stage, and FIG. 4B compares the phenotype and transgenic expression level of the wild type rice (Ni) and transgenic rice (RNAi-CYCU4) in the seedling stage.

(5) FIGS. 5A and 5B show and compare the phenotype and expression level of a plurality of independent pCYCU4::CYCU4;1 and RNAi-CYC U4;1 transgenic lines, in which, FIG. 5A shows multiple plants in the RNAi-CYC U4;1 transgenic lines having wide leaf-stem angle, and FIG. 5B shows multiple plants in the pCYCU4::CYCU4;1 transgenic lines having narrow leaf-stem angle.

DETAILED DESCRIPTION OF THE INVENTION

(6) The present invention is further illustrated in the following embodiments.

Embodiment 1

(7) A gene CYC U4;1 for controlling erectness development of rice leaves is obtained by using a gene specific expression chip in leaf blades and pulvini created by the inventors, and a gene CYC U4;1 with a specific expression at the leaf pulvinus is selected from differentially expressed genes of the chip with a reverse genetics method, and the specific expression of CYC U4;1 at the leaf pulvinus is verified with real-time qRT-PCR.

(8) The details are as follows. A gene CYC U4;1 for controlling erectness development of rice leaves is obtained with the following method. The total volume of a reaction system is 50 μl, with a template including Nipponbare CDNA 1 ul (about 50 ng), 10×KOD enzyme reaction buffer (5 μl), 25 mM MgCL.sub.2 (2 μl), 5 mM dNTP (5 μl), 5 uM primers (5 μl) (with a stepwise PCR means, primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-1 having SEQ ID NO: 5 are used the first time, and primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-2 having SEQ ID NO: 6 are used the second time, with each primer at 2.5 μl), KOD enzyme (1 μl) and the balance of ddH.sub.2O (sterile deionized water) which is added to the total volume of 50 μl.

(9) The reaction procedure is as follows: denaturing at 94° C. for 5 min, 94° C. for 30 sec, 55° C. for 1 min and 68° C. for 2 min for 35 cycles in total, and elongating at 68° C. for 10 min.

(10) The primers used are as follows:

(11) TABLE-US-00002 CYCU4-U: (SEQ ID NO: 4) ATATgagctcATGAGGACGGGGGAGGTGGCGGAGGCGGTG; CYCU4-L-1: (SEQ ID NO: 5) CGTCTTTGTAGTCGACGGCGAGCTGATGCTGCTGCTG; CYCU4-L-2: (SEQ ID NO: 6) ATATtctagactaCTTGTCGTCATCGTCTTTGTAGTCGACGGCGAG.

(12) A sequence of the gene CYC U4;1 containing the nucleotide as described in SEQ ID NO: 2 is finally obtained, and an amino acid sequence encoded with the gene is as shown in SEQ ID NO: 3.

(13) Real time qRT-PCT is used to verify the specific expression of CYC U4;1 in a rice pulvinus as follows: A leaf blade and a leaf pulvinus are taken from the rice seedling of Nipponbare growing for one week, the total RNA is extracted with a TiangenRNApre Plant Kit (Tiangen), then a first-chain cDNA is synthesized with a Takara PrimeScript First-strand cDNA synthesis kit (TaKaRa), and the relative expression level of CYCY U4;1 in the leaf blade and leaf pulvinus is detected by the real-time quantitative PCR. The primers for the real-time quantitative PCR are as follows: CYCU4;1: R-TGAGGTGGACTTCCTCTTTG (SEQ ID NO: 7); F-CCAGGTAGGTCATCTCGCTC (SEQ ID NO: 8). It is found that the gene CYC U4;1 has a specific expression at the leaf pulvinus as shown in FIG. 1.

Embodiment 2

(14) The application of the gene CYC U4;1 to controlling of the erectness of the rice leaves is performed in a process as follows:

(15) 1) Building of Plant Expression Vector pCYCU4;1-GUS

(16) A promoter region of CYC U4;1 is amplified, and a fragment is cloned to a pCAMBIA1300GN GUS vector (Ren Z H, Gao J P, Li L G, et al. A rice level quantitative trait locus for salt tolerance encodes a sodium transporter [J]. Nature genetics, 2005, 37(10): 1141-1146) by using a HindIII/BamH1 enzyme digestion site.

(17) The promoter region of CYC U4;1 is obtained by means of the following.

(18) The total volume of a reaction system is 50 μl, with a template including a Nipponbare genome DNA 1 ul (about 50 ng), 1×KOD enzyme reaction buffer (5 μl), 25 mM MgCL.sub.2 (2 μl), 5 mM dNTP (5 μl), 5 uM primers (5 μl) (primers pCYCU4-U having SEQ ID NO: 9 and pCYCU4-L having SEQ ID NO: 10, each of 2.5 μl), KOD enzyme (1 μl) and the balance of ddH.sub.2O (sterile deionized water) which is added to the total volume of 50 μl. The reaction procedure is as follows: denaturing at 94° C. for 5 min, 94° C. for 30 sec, 55° C. for 1 min and 68° C. for 2 min for 35 cycles in total, and elongating at 68° C. for 10 min.

(19) The primers used are as follows:

(20) TABLE-US-00003 pCYCU4-U: (SEQ ID NO: 9) atatAAGCTTacttgtactacctcattggcacaggcac; pCYCU4-L: (SEQ ID NO: 10) atatGGATCCcgatcgctcgccacgaggaggaagg.

(21) The promoter region of the gene CYC U4;1 as shown in SEQ ID NO: 1 is finally obtained.

(22) 2) Building of Plant Expression Vector pCYCU4::CYC U4;1

(23) The promoter region of CYC U4;1 is amplified with a stepwise method (a method for amplifying the promoter region is the same as Step 1)), a fragment is cloned to pCAMBIA1301 by using a HindIII/BamH1 enzyme digestion site to obtain pCAMBIA1301-pCYCU4;1, then a full-length cDNA (as shown in SEQ ID NO: 2) of CYC U4;1 connected with a FLAG label is cloned to pCAMBIA1301-pCYCU4;1 by using Sac1/Xba1 to obtain a plant expression vector pCYCU4::CYC U4;1, which is transferred into the Nipponbare.

(24) 3) Building of Plant Expression Vector RNAi-CYC U4;1

(25) CYC U4;1 (345-639 bp) is cloned to an RNAi vector pTCK303 by using Kpn1/BamH1 and Sac1/Spe1 enzyme digestion sites and then transferred into the Nipponbare.

(26) 4) Genetic Transformation of Rice

(27) In Steps 1) to 3), the transformation of the rice is performed with a genetic transformation method mediated with agrobacterium EHA105, with the details as follows:

(28) {circle around (1)} Callus induction. Rice seeds are shelled, and clear saturated grains are soaked in 70% ethanol for 1 min at first and rinsed 1 to 2 times with sterile water; and then, the grains are soaked in an NaClO solution containing 2% active chlorine (in case of 40 ml of NaClO solution containing the active chlorine of more than 5.2%, 60 ml water is added) added with 1 to 3 drops of Tween 20, for 30 min (generally 40 min, and 1 h at the most). Shaking is performed from time to time and then sterile water is used for rinsing 4 to 5 times. The grains are poured onto a sterilized flat plate and dried with filter paper for about 1 hour. The grains are placed into an N6D solid culture medium (10 grains/25 ml/bottle), with seed embryos facing upwards or in contact with the culture medium, and cultured in darkness at 28° C. for 25 to 30d. The N6D2 culture medium includes N6 salts and vitamins, 0.5 g/l of casein hydrolysate, 30 g/l of cane sugar, 2 mg/l of 2,4-D, and 2.5 g/l of Phytagel (Sigma), at pH5.8.

(29) {circle around (2)} Culture of agrobacteria and co-culture of rice calluses. A sterilized spoon is used to obtain the agrobacteria by scraping, and the agrobacterium is slightly tapped to a loose state against a tube wall with a spoon back, with OD600=0.8-1.0. The pre-cultured calluses are aired on the sterile filter paper and then centralized in a vessel and transferred into an agrobacteria solution in one step, a centrifugal tube is slightly rotated to uniformly distribute the agrobacterial solution, and standing is performed for about 15 to 20 min. The agrobacteria solution is poured out, the calluses are placed on the sterile filter paper for 1.5h to ensure that the agrobacteria solution is completely absorbed, then transferred into ½ N6D AS and cultured in darkness at 20° C. for 2-3 days, and the agrobacteria can be removed when a bacterial film appears at a place where the calluses are in contact with the culture medium. A ½ N6D AS culture medium includes N6D2, 10 g/l of glucose, and 100-400 μmol/1 of acetosyringone (added on the spot when in use), at pH5.2.

(30) {circle around (3)} Removal of agrobacteria. The calluses subjected to co-culture are added into a 50 ml centrifugal tube and cleaned more than 3 times with sterile water until the liquid is clear. The sterile water is poured out, and the calluses are cultured with N6D+Cn (500 mg/L) (or AP500 ml/L) at 100 rpm for 15-20 min for 2 to 3 times. The calluses are placed on the sterile filter paper and dried for about 2h as appropriate. The dried calluses are transferred into N6D-AS and cultured in darkness at 28° C. for 7 to 10d with the addition of cephalosporin Cn (250 mg/L).

(31) {circle around (4)} Screening of calluses. The calluses which are not contaminated by the agrobacteria are picked out, and combined with Cn250 mg/L and Hn (50 mg/L) during the first time for screening for 15 to 20d. For the second time, the operation is the same as above except for that Cn is not added, instead hygromycin (Hn) is added, and all the calluses are transferred again completely for 15 to 20d. For the third time, the new calluses are chosen out and screened with Hn for 15 to 20d. It is not necessary to arrange the order as above, however, the screening time for the calluses on the Hn shall be ensured to be at least above 45d, and it would be best to screen the newly grown calluses picked out for the third time for 20d. An N6D screening culture medium includes N6D+Cn (250 mg/L)+Hn (50 mg/L) at PH=5.8-5.9.

(32) {circle around (5)} Differentiation and rooting. All the calluses screened the fourth time are transferred into MS and cultured in darkness with Hn (50 mg/L) for pre-differentiation (at PH 5.9) for 12 to 15d. Fresh well-growing calluses are chosen and transferred into MS (PH 6.0) for light culture for 15 to 20d. Green buds can be seen growing, and the culture medium is generally changed every 15d. The green buds growing to more than 1 cm are chosen, with surplus surrounding calluses stripped and the roots cut-off (with about 0.5 cm left), and are transferred into a test tube for rooting culture in ½ MS. An MS differentiation culture medium includes MS salts and vitamins, 2 g/l of casein hydrolyzate, 30 g/l of cane sugar, 25 g/L of sorbitol, 2 mg/l of 6-BA, 0.5 mg/l of NAA, 0.2 mg/l of Zeatin, 0.5 mg/l of KT, 3.0 g/l of Phytagel (pH 5.8), 50 mg/l of hygromycin B, and 200 mg/l of cephalosporin; and a ½ MS rooting culture medium includes ½MS salts, MS vitamins, 30 g/l of cane sugar, 1 mg/l of paclobutrazol, 0.5 mg/l of NAA, 50 mg/l of hygromycin, and 2.5 g/l of Phytagel, at pH 5.8.

(33) 5) Transplanting, identification of expression level and phenotype analysis. 40 lines are genetically built from each of the rooting transgenic plants and transplanted in a greenhouse, and leaf blades are taken to undergo expression level identification based on real-time qRT-PCR and GUS staining analysis. RNAi-CYCU4;1: R-GTCGCCTACATCTACCTC (having SEQ ID NO: 11); F-GATAATTCATCTCCATCAAGC (having SEQ ID NO: 12).

(34) 6) Results:

(35) (1) By transferring the obtained vector into the rice Nipponbare and with a pCYCU4;1::GUS transgenic rice report system, it is indicated that CYC U4;1 is mainly expressed in the leaf pulvinus as shown in FIGS. 2A and 2B.

(36) (2) By cloning the promoter and full-length CDS of CYC U4;1 to pCAMBIA1301 and transferring this into the Nipponbare, the transgenic lines obtained are characterized by having a smaller leaf-stem angle than those of wild rice (Nipponbare) as shown in FIGS. 3A and 3B. It shows that CYC U4;1 has the function of controlling the erectness development (leaf-stem angle) of the rice leaves.

(37) (3) By cloning CYC U4;1 (345-639 bp) to the RNAi vector pTCK303 to make an RNAi (RNA interference) experiment on the rice Nipponbare, it is found that the rice successfully transgenically transformed by RNAi has a larger leaf-stem angle than that of the wild rice (Nipponbare) as shown in FIGS. 4A and 4B.

(38) (4) By the phenotype and expression level analysis of the plurality of obtained independent pCYCU4::CYCU4;1 and RNAi-CYC U4;1 transgenic lines, it shows that the expression level of CYC U4;1 is related to the magnitude of the leaf-stem angle of the rice as shown in FIGS. 5A and 5B.