Profiling chemically modified DNA/RNA units for disease and cancer diagnosis
11339441 · 2022-05-24
Assignee
Inventors
Cpc classification
H01J49/0036
ELECTRICITY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
The present invention relates to high-throughput methods comprising direct infusion electrospray ionization mass spectrometry (ESI-MS), multistep tandem mass spectrometry (MS.sup.n), consecutive reaction monitoring (CRM), ion mobility spectrometry mass spectrometry (IMS-MS), high-resolution MS, and IMS-MS, for genome-wide (whole cell or tissue) profiling of DNA and RNA nucleotides/nucleosides having a wide variety of variant structural modifications. In particular, these methods are contemplated for providing a specific profile of variant DNA and/or RNA chemically modified nucleic acids (i.e. structures) associated with specific medical conditions. Medical conditions may include, but are not limited to: cancer; including prostate, lung, uterus, larynx, ovary, breast, kidney, and many other types of cancers; specific stages of cancer; bacterial infections; viral infections; genetic and metabolic disorders; and any condition involving changes in DNA and/or RNA structural modifications.
Claims
1. A method for identifying a whole cell with a modified nucleic acid structure profile, comprising: (a) providing, (i) a biological sample comprising a whole-cell, said whole-cell comprising nucleic acids; and (ii) a mass spectrometer; (b) disrupting said whole-cell in a mixture comprising a denaturation solution and an affinity capture media under conditions that form an affinity-captured individual nucleic acid; (c) eluting said individual nucleic acid from said affinity-captured individual nucleic acid to create a mononucleotide mixture; (d) infusing said mononucleotide mixture into said mass spectrometer to measure a molecular mass of said individual nucleic acid; (e) identifying the presence of a modified nucleic acid structure of said nucleic acid based upon said measured molecular weight; (f) repeating steps c-e so as to identify a genome-wide modified nucleotide structure profile for said whole-cell; and (g) identifying said whole-cell with said genome-wide modified nucleotide structure profile.
2. The method of claim 1, wherein said mononucleotide is a ribonucleotide (RNA).
3. The method of claim 1, wherein said mononucleotide is a deoxyribonucleotide (DNA).
4. The method of claim 1, wherein said whole-cell is a mammalian cell.
5. The method of claim 1, wherein said whole-cell is any type of cell or microorganism.
6. The method of claim 1, wherein said identified whole-cell is selected from the group consisting of a single cell microorganism, a control cell, a healthy cell, a cancer cell, an infected cell and a stressed cell.
7. The method of claim 1, wherein said mass spectrometer comprises ion mobility spectrometry-mass spectrometry (IMS-MS) and/or high-resolution mass spectrometry.
8. The method of claim 7, wherein a heat-map plot is derived from said mass spectrometry then used to identify an isobaric modified nucleic acid for including in said profile.
9. The method of claim 1, wherein said affinity capture media is selected from the group consisting of biotin-streptavidin coupling, iminothiolane coupling, disulfide coupling, poly-A coupling and antisense coupling.
10. The method of claim 1, wherein said affinity capture media comprises a plurality of beads.
11. The method of claim 10, wherein said plurality of beads is selected from the group consisting of glass beads, magnetic beads and paramagnetic beads.
12. The method of claim 1, further comprising contacting said mononucleotide mixture with an immunoassay to identify said modified nucleic acid structure profile.
13. The method of claim 1, wherein said modified nucleic acid structure comprises a post-transcriptional modification.
14. A method for identifying a whole cell with a modified nucleic acid structure profile, comprising: (a) disrupting a whole-cell comprising nucleic acids in a mixture comprising a denaturation solution and an affinity capture media under conditions that form an affinity-captured individual nucleic acid; (b) forming a mononucleotide mixture by eluting an individual nucleic acid from said affinity-captured individual nucleic acid; (c) infusing said mononucleotide mixture into a mass spectrometer to measure a molecular mass of said individual nucleic acid; (d) identifying the presence of a modified nucleic acid structure of said nucleic acid based upon said measured molecular weight; (e) repeating steps b-d so as to identify a genome-wide modified nucleotide structure profile for said whole-cell; and (f) identifying said whole-cell with said genome-wide modified nucleotide structure profile.
15. The method of claim 14, wherein said mononucleotide mixture comprises nucleotides comprising ribose sugar.
16. The method of claim 14, wherein said mononucleotide mixture comprises nucleotides comprising a sugar moiety consisting of ribose sugar.
17. The method of claim 14, wherein said mononucleotide mixture comprises nucleotides comprising deoxyribose sugar.
18. The method of claim 14, wherein said mononucleotide mixture comprises nucleotides comprising a sugar moiety consisting of deoxyribose sugar.
19. The method of claim 14, wherein said whole-cell is a mammalian cell.
20. A method for identifying a whole cell with a modified nucleic acid structure profile, comprising: (a) disrupting a whole-cell comprising nucleic acids in a mixture comprising a denaturation solution and an affinity capture media comprising a plurality of beads under conditions that form an affinity-captured individual nucleic acid; (b) forming a mononucleotide mixture by eluting an individual nucleic acid from said affinity-captured individual nucleic acid; (c) infusing said mononucleotide mixture into a mass spectrometer to measure a molecular mass of said individual nucleic acid, wherein said mass spectrometer comprises ion mobility spectrometry-mass spectrometry (IMS-MS) and/or high-resolution mass spectrometry; (d) identifying the presence of a modified nucleic acid structure of said nucleic acid based upon said measured molecular weight; (e) repeating steps b-d so as to identify a genome-wide modified nucleotide structure profile for said whole-cell; and (f) identifying said whole-cell with said genome-wide modified nucleotide structure profile, wherein said identified whole-cell is selected from the group consisting of a single cell microorganism, a control cell, a healthy cell, a cancer cell, an infected cell, and a stressed cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) METLIN hits; o species detected also in the blank.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
DESCRIPTION OF THE INVENTION
(32) The present invention relates to high-throughput methods comprising direct infusion electrospray ionization mass spectrometry (ESI-MS), multistep tandem mass spectrometry (MS.sup.n), consecutive reaction monitoring (CRM), ion mobility spectrometry mass spectrometry (IMS-MS), high-resolution MS, and IMS-MS, for genome-wide (whole cell or tissue) profiling of DNA and RNA nucleotides/nucleosides having a wide variety of variant structural modifications. In particular, these methods are contemplated for providing a specific profile of variant DNA and/or RNA chemically modified nucleic acids (i.e. structures) associated with specific medical conditions. Medical conditions may include, but are not limited to: cancer; including prostate, lung, uterus, larynx, ovary, breast, kidney, and many other types of cancers; specific stages of cancer; bacterial infections; viral infections; genetic and metabolic disorders; and any condition involving changes in DNA and/or RNA structural modifications.
(33) The technology involves extraction of the total nucleic acids content from target cells/tissues, bodily fluids, or any other pertinent source of biological material; separation of DNA from RNA; digestion of either fraction into mono-nucleotide/nucleoside components; analysis; identification of modified variant components and quantification of their expression levels. The diagnosis is determined by comparing the global modification profiles (i.e., the patterns represented by the combination of both identity and relative abundance of the observed species), to that obtained from healthy or diseased cells/tissues. The diagnosis is not based on one individual species that may be linked to the condition of interest. It relies instead on the detection of multiple modifications (including patterns) and/or the mutual variations of their expression levels.
(34) The application of this technology is contemplated to involve two or more separate steps. The initial setup phase will involve the utilization of mass spectrometry and ion mobility spectrometry analysis, followed by database-aided interpretation, to identify the panel of variants of canonical mono-nucleotide/nucleoside components that are linked to the condition of interest. Once the panel is established, the deployment phase will utilize standard immunoassay techniques (e.g., simple strips or microarray, platforms based on ELISA and similar methods) to perform detection in the field, such as in diagnostic labs, hospitals, pharmacies, physician practices, etc.
(35) I. Advantages of the Technology (Relative to Existing Technology) are Described Below.
(36) A) Other technologies are not capable of providing comprehensive profiles of variant DNA and/or RNA components, in contrast to the profiles shown herein. Thus established approaches for the analysis/detection of nucleic acids are blind to the vast majority of chemical modifications of RNA that are present in a cell or tissue. Unlike the methods of the present inventions, combined mass spectrometry and immunoassays have not been used to identify/quantify nucleic acid variants at whole-cell levels, or at the level of cell sub-compartments and organelles.
(37) B) The technology developed and described herein, enables one to link panels of chemical DNA and/or RNA modifications to specific cellular malfunctions, without the need to identify them as either a cause or effect of the cell state of interest.
(38) C) The methods of the present inventions offer greater diagnostic accuracy by linking mutual fluctuations of expression levels to the state of interest, rather than just the appearance/disappearance of individual markers.
(39) D) To the best of the knowledge of the inventors, alternative approaches based on mass spectrometry and immunoassays have not been employed to observe panels of both DNA and RNA modifications simultaneously, for the purpose of correlating their profiles (identity and mutual relative abundances) to specific cell states.
(40) E) The methods of the present inventions involve a small amount of sample consumption. A small fraction of biopsy, or surgically removed tissue, may be submitted to the technology, while preserving the bulk of the sample for pathology examination and any other type of analysis.
(41) F) The methods of the present inventions may potentially be included in non-invasive procedures through the use of blood, urine, saliva, tears, amniotic fluid, tissue biopsies, and any possible biological sample containing nucleic acids.
(42) G) Sample preparation allows for the utilization of a relatively small portion of the entire cellular content. The remaining components are still available for additional analysis (e.g., protein content for phenotypic expression analysis; DNA for genomic expression; RNA for transcriptomics analysis, etc.).
(43) H) Could be readily adapted for unattended, automated operation by utilizing existing robotic systems, thus providing an excellent platform for high-throughput screening applications.
(44) I) The immunoassay-based detection scheme will provide the basis for very inexpensive, convenient, easy to use, point of care diagnostic applications.
(45) J) As a diagnostic tool, it could be employed to simultaneously recognize different possible risk factors, or identify the stage (benign, benign nodule, early vs. late stage) of a certain cancer; to identify the etiologic agent of an infection; to monitor the course and assess the effectiveness of therapeutic treatment. For example, when a stage of cancer is detected, treatment options which may be initiated include but are not limited to: active surveillance/watchful waiting, surgery, cryosurgery, ultrasound treatment, radiotherapy, hormone treatment, chemotherapy, etc. or combination thereof.
(46) As another example, when methods described herein distinguish between a viral, such as a poliovirus, HIV-1, etc., a yeast (fungi) and bacteria cell infection in a cell, such as from a patient, then an appropriate antiviral treatment (i.e. a broad-spectrum inhibitor for picornavirus, antiretroviral therapies, respectively), antifungal treatment (such as amphotericin B (and its lipid formulations), various azole derivatives, echinocandins, and flucytosine) or antibacterial treatment (i.e. an antibiotic, such as amoxicillin, fluoroquinolones or cephalosporins, etc.), respectively, may be initiated to that patient.
(47) K) Methods described herein can be used for identifying epigenetic changes in gene expression in organisms under different growth conditions.
(48) II. Introduction.
(49) The elucidation of the biological significance of whole cell or tissue DNA structural modifications and RNA post-transcriptional modifications is hampered by the dearth of effective high-throughput sequencing approaches for detecting, locating, and tracking their levels as a function of predetermined experimental factors. While RNA is primarily described herein, these methods are applicable to identifying and associating DNA structural modifications with cell physiological stages, cancer and disease states.
(50) Therefore, with the goal of confronting this knowledge gap, a strategy was discovered and developed for completing global surveys of total deoxynucleotide modifications and total ribonucleotide modifications in a cell, which is based on the analysis of whole cell or tissue extracts by direct infusion electrospray ionization mass spectrometry (ESI-MS). Thus, in one embodiment, a direct infusion electrospray ionization mass spectrometer (ESI-MS) is used to identify and quantify at least one or more modification in a DNA structure. In another embodiment, a direct infusion electrospray ionization mass spectrometer (ESI-MS) is used to identify and quantify at least one or more modification in a RNA structure.
(51) The methods described herein, eschews chromatographic separation to promote instead the direct application of MS techniques capable of providing detection, differentiation, and quantification of post-transcriptional modifications (PTMs) in complex ribonucleotide mixtures. Accurate mass analysis was used to carry out database-aided identification of PTMs, whereas multistep tandem mass spectrometry (MS.sup.n) and consecutive reaction monitoring (CRM) provided the necessary structural corroboration. Thus, in one embodiment, multistep tandem mass spectrometry (MS.sup.n) and consecutive reaction monitoring (CRM) are used to identify and quantify at least one or more modification in a DNA structure. In another embodiment, multistep tandem mass spectrometry (MS.sup.n) and consecutive reaction monitoring (CRM) are used to identify and quantify at least one or more modification in a RNA structure.
(52) Heat-map plots derived from these data obtained by ion mobility spectrometry mass spectrometry (IMS-MS) provided comprehensive modification profiles that are unique for certain cell types and metabolic states. Thus isolated tRNA samples were used as controlled sources of PTMs in standard-additions quantification. Intrinsic internal standards enabled direct comparisons of heat-maps obtained under different experimental conditions, thus offering the opportunity to simultaneously evaluate the global effects of such conditions on the expression levels of total cellular or tissue PTMs. This type of comparative analysis is contemplated to support the investigation of the system biology of RNA modifications. Thus, in one embodiment, an ion mobility spectrometry mass spectrometry (IMS-MS) is used to identify and quantify at least one or more modification in a DNA structure. In another embodiment, an ion mobility spectrometry mass spectrometry (IMS-MS) is used to identify and quantify at least one or more modification in a RNA structure.
(53) A. Value of Total RNA Variant Analysis from Biological Samples.
(54) One tenet of systems biology is that the behavior of a biological system arises from the complex network of functional interactions between its components. RNA is uniquely positioned in such a network to accurately capture the overall behavior of biological systems, as well as the specific metabolic and epigenetic state of a cell. The RNA building blocks display numerous variations of the four canonical bases, which contribute to defining the breathtaking diversity of structures and functions characteristic of natural RNA (Chang and Varani, 1997; Carell et al., 2012). These post-transcriptional modifications (PTMs) are introduced by the activity of specialized enzymes that, in many cases, have been identified and investigated (Ferré-D'Amaré, 2003). Over one hundred ribonucleotide PTMs and corresponding metabolic pathways are currently described in the RNA Modifications (Limbach et al., 1994; Cantara et al., 2011) and MODOMICS (Dunin-Horkawicz et al., 2006; Machnicka et al., 2012) databases. However, with the exception of a handful of PTMs involved in molecular recognition and stabilization of RNA structure (Kowalak et al., 1994; Ofengand, 2002; Helm, 2006) their biological function is still largely unknown. The observation that methylation of the 3′ nucleotide protects miRNAs from uridylation, a prelude to exonucleolytic degradation (Li et al., 2005), suggests that many PTMs may act as signals or modulators of vital cellular processes. This type of observation has been made possible by the availability of targeted analytical approaches based on bisulfite chemistry (Frommer et al., 1992; Herman et al., 1996) or specific restriction enzymes (Singer-Sam et al., 1990; Issa et al., 1994), which enable the detection of methylation sites by high-throughput sequencing techniques (Ajay et al., 2011; Koboldt et al., 2013). Unfortunately, there are no high-throughput approaches for the majority of other PTMs. For this reason, their functional elucidation has been severely hampered by the inability to detect, locate, and track their levels as a function of predetermined experimental factors.
(55) Mass spectrometry (MS)-based approaches have historically played a determinant role in the discovery and characterization of RNA modifications (McCloskey, 1979; McCloskey, J. A., 1985; Crain, 1990a; Nordhoff et al., 1996). This platform affords the ability to recognize the characteristic mass signatures associated with the different variants, as well as the unique fragmentation patterns necessary to confirm their structures (Banoub, J. H. and Limbach, P. A., 2010 and reference therein). High-resolution determinations enable the unambiguous differentiation of mononucleotides with very similar elemental compositions that produce nearly overlapping isotopic distributions (Quinn et al., 2013). Multistep tandem mass spectrometry (MS.sup.n)(Solouki et al., 1996; Collings et al., 2001) and ion mobility spectrometry mass spectrometry (IMS-MS) (von Helden et al., 1995; Clemmer and Jarrold, 1997; Verbeck et al., 2002) have been proven capable of tackling mixtures of isobaric mononucleotides that share the same elemental composition, but display different structures (Quinn et al., 2013). These capabilities are exemplified by the analysis of the isomeric species uridine and pseudouridine, which include either an N- or C-glycosidic bond between the pyrimidine ring and ribose unit. This distinctive feature confers different stability to collisional activation, which is substantiated by a greater incidence of base loss from the N- than the C-glycosidic form (Wu and McLuckey, 2004). Unique conformations associated with the different ring attachments influence their interactions with background gas during IMS-MS analysis, thus enabling unambiguous differentiation even when both isomers are present simultaneously in the same sample (Quinn et al., 2013). Thus, in one embodiment, methods combine one or more types of mass spectrometric (MS) methods, including but not limited to high resolution, multistep tandem mass spectrometry (MS.sup.n), ion mobility spectrometry mass spectrometry (IMS-MS), etc., used to identify and quantify at least one or more modification in a DNA structure. In another embodiment, embodiment, methods combine one or more types of mass spectrometry (MS) methods, including but not limited to high resolution, multistep tandem mass spectrometry (MS.sup.n), ion mobility spectrometry mass spectrometry (IMS-MS), etc., are used to identify and quantify at least one or more modification in a RNA structure.
(56) Modified ribonucleotides can be analyzed in complex mixtures obtained by hydrolyzing larger RNA samples into mononucleotide components, which may be further treated with phosphatase to obtain the corresponding nucleosides (Crain, 1990b). The ensuing samples are typically resolved by coupling liquid chromatography (Esmans et al., 1998; Chan et al., 2010; Su et al., 2014) or capillary electrophoresis (Apruzzese and Vouros, 1998) with MS detection (i.e., LC- and CE-MS, respectively), which are meant to provide separation and reduction of chemical background, while avoiding undesirable analyte bias. In previous work, we investigated the merits of direct infusion electrospray ionization (ESI) (Yamashita and Fenn, 1984; Banks et al., 1994) to perform nucleotide analysis in the absence of front-end chromatographic procedures (Quinn et al., 2013). The direct approach was evaluated by using standard samples that contained the canonical ribo- and deoxyribonucleotides with the addition of pseudouridine that constitutes the most abundant variant present in nature (Charette and Gray, 2000). Recently this method was extended to investigations of mixtures obtained directly from cell samples that contained the full complement of natural PTMs expressed by the selected organism. The capability of this approach was accessed to unambiguously recognize modified mononucleotides from the remaining background in the absence of chromatography, as well as the possibility of determining their abundance in complex biological samples. The reproducibility of this type of analysis was determined to learn whether this approach could provide comprehensive epitranscriptomic profiles and reveal possible correlations between RNA modifications and specific cellular states.
(57) B. Applications.
(58) Exposure of cells to external stimuli results in immediate adaptation through new regulatory responses affecting cellular memory to maximize survival. Often, these adverse external stimuli produce cellular anomalies that have been typically characterized by DNA methylations, histone modifications, and, more recently, activities involving various RNA species. Thus, DNA and RNA, and subsets thereof, are decorated with modifications. RNA in particular has post-transcriptional modifications that may have structural and functional roles within the cell. Thus, in one embodiment, a mass spectrometry platform is used to identify and quantify at least one or more modification in a DNA structure. In another embodiment, a mass spectrometry platform is used to identify and quantify at least one or more modification in a RNA structure.
(59) 1. Identifying Cancer Cells and Stages of Cancer.
(60) A direct comparison between normal and malignant prostate samples described herein, revealed 13 common modifications and 1 and 6 unique RNA variants, respectively. In particular, heat maps of total RNA (including modified variants) distinguished between benign and cancerous prostate tissue. A heat map (or cluster analysis) relates to a graph of the number of each modified RNA structure identified using methods described herein. Analysis of benign and prostate tissue,
(61) The systematic exploration of the interactome is typically supported by genomics and proteomics approaches that focus on nucleic acids and protein components. However, other cellular components traditionally viewed as products or intermediates of specific pathways can participate in regulatory mechanisms by influencing the interactome. For example, RNA is involved in protein synthesis and gene regulation, but its ability to undergo extensive post-transcriptional modification provides new opportunities for enzyme-based pathways to feedback at the mRNA-translation level to regulate protein expression. Therefore, an MS-based strategy was developed, as described herein, to obtain comprehensive maps of RNA modifications, which were then used to explore the complex signaling pathways responsible for the multistage processes that take cells from normalcy to malignancy. See,
(62) An exemplary comparison between types of modified yeast cells, a control strain and TRM1 or PHP1P knockdowns revealed significant changes in RNA modification expression (indicated by % difference and PCA analysis) showed {circumflex over ( )}modifications that occur in TRM1 knock down, ¥ modifications that occur in LHP1P knock down, * modifications found in the control, but not other samples, in
(63) 2. Identifying Virally Infected Cells.
(64) As shown herein, methods of the present inventions were used to distinguish between poliovirus, LA virus and HIV-1, in addition to distinguishing between yeast (fungi) and bacteria cells. Therefore, the inventors contemplate using methods of the present inventions comprising MS for identifying microbes, i.e. virus and bacteria, and fungi. Thus, in one embodiment, the inventors contemplate methods comprising MS for identifying the type of infection using maps of isolated RNA having modified structures. In one embodiment, a mass spectrometry platform is used to identify and quantify at least one or more modification in a DNA structure associated with a virally infected cell. In another embodiment, a mass spectrometry platform is used to identify and quantify at least one or more modification in a RNA structure associated with a virally infected cell. For examples, see below and in the Examples.
(65) Additionally, typical technologies employed for the analysis of viral RNA, such as RT-PCR, rely on hybridization/amplification and strand amplification techniques that fail to detect covalent modifications for the lack of ad hoc complementary nucleotides capable of sustaining strand extension. In other words, strand amplification techniques do not replicate the covalent modifications present on the original RNA strand due to the unavailability of a complementary base. In contrast, mass spectrometry is capable of identifying these covalent modifications when large sample amounts are present based on their characteristic mass to charge ratios and fragmentation properties. As a result of the sample size requirement, we have developed a magnetic bead based DNA probe hybridization technique to isolate sufficient amounts of viral RNA for MS analysis. Thus MS-based approaches require the availability of RNA samples that were not produced by strand-amplification techniques. For this reason, we further explored the application of affinity capture to obtain sufficient amounts of viral RNA directly from virions, infected cells, or culture media. The selected strategy involved the utilization of antisense oligonucleotides complementary to the specific target, which were anchored to paramagnetic beads for rapid separation.
(66) Therefore in order to begin determining whether MS analysis of ribonucleotide modifications at the whole genome level would provide information on targeting viral RNA, total RNA from S. cerevisiae was isolated using a classic phenol/chloroform extraction and digested to mononucleotides using a cocktail of specific nucleases. Global RNA modification profiles revealed 41 hits across technical and biological replicates with a reproducibility of ±4.4% and ±7.8% relative standard deviation (% RSD), respectively. Surprisingly, 13 RNA structures were found, which were known to be in other organisms, but not in yeast. Individual modification levels were absolutely and/or relatively quantified by either standard-additions method with known amounts of purified tRNA.sup.Phe, or by using canonical nucleotides as intrinsic internal standards. See an exemplary overview of this method is shown in
(67) Additionally (and concurrently with viral RNA studies described herein), studies were performed on HeLa cells to examine RNA modification content in total RNA versus isolated mRNA. Isolation of mRNA was performed using affinity capture techniques designed to target the poly A tail found common in mRNA species, see an exemplary overview of this method in
(68) 3. Identifying Infections.
(69) In additional to viral infections, as shown herein, methods of the present inventions were used to distinguish between E. coli and S. cerevisiae, such that 26 modifications were common, whereas 14 and 17 were unique for each. Therefore, the inventors contemplate using methods of the present inventions comprising MS for identifying microbes and fungi. Thus, in one embodiment, the inventors contemplate methods comprising MS for identifying the type of infection using maps of isolated RNA having modified structures.
(70) 4. Identifying Changes in Cell Physiology.
(71) As shown herein, methods of the present inventions were used to show changes in modified RNA structures associated with induction of proteins, such as the stress protein Hog1,
(72) In an exemplary embodiment, a mass spectrometry platform is used to monitor changes in RNA modifications potentially present in S. cerevisiae under various external stimuli.
(73) C. Information Obtained During the Development of the Present Inventions.
(74) With the rare exceptions of 2-O′-methylation, adenosine-N6-methylation, and pseudouridylation, current high-throughput sequencing approaches (e.g., RNA-seq and similar next-generation techniques) are incapable of detecting PTMs, owing to the fact that analysis takes place on DNA copies, rather than genuine RNA samples bearing the PTMs. The lack of sufficient data on PTM expression and distribution has significantly hampered the elucidation of their biological functions. MS-based approaches are contemplated to fill this gap in information by enabling PTM recognition and quantification on the basis of their unique mass and fragmentation signatures. These types of approaches have traditionally relied on liquid chromatography and capillary electrophoresis to reduce chemical background and provide separation before analysis. We recently demonstrated proof-of-principle for their possible implementation without any high-resolution separation, which will greatly simplify their incorporation in large scale, high-throughput applications. The method developed and described here was found capable of providing comprehensive surveys of ribonucleotide modifications at the full-transcriptome level. Direct infusion analysis with either high-resolution MS or IMS-MS detection enabled the positive identification of PTMs in complex cellular extracts based on their individual molecular masses, unique fragmentation patterns, and characteristic conformational features. Eliminating typical front-end chromatographic steps streamlined the operations without affecting detection sensitivity and characterization capabilities. Combining lysis and nucleic acid extraction in a single step led to minimal carryover of cellular components, which did not have any appreciable consequence on the ability to detect modified ribonucleotides. The proposed workflow provided comprehensive PTM information by using as little as ˜800 μg of wet cell pellet or ˜69 microL of culture at 0.3 OD.sub.600 (corresponding to ˜1.2×10.sup.7 cells). Contemplative estimates show that the same analysis could be comfortably completed by using as little as 25 micrograms of human tissue, well below the amount of material attainable from typical biopsy operations.
(75) The proposed approaches rely on database searching and gas-phase activation techniques to positively identify the observed PTMs. However, these methods do not preclude the identification of new PTMs that are absent from the available databases, i.e. not previously reported. Indeed, it is likely that many of the observed signals that did not return hits in these experiments may correspond to yet undiscovered and/or unidentified PTMs. Identification of the presence of new PTM RNA structures in total cell extracts using methods of the present inventions provides an additional benefit over previous methods in light of the almost exclusive emphasis placed by earlier studies on tRNA/rRNA analysis (McCloskey, 1979; McCloskey, J. A., 1985; Crain, 1990a; Chan et al., 2010; Su et al., 2014). In summary, the information provided herein, clearly demonstrated that methods of the present inventions comprising various MS platforms, in concert or individually, are capable of providing the information necessary to support structural RNA characterization.
(76) The utilization of isolated/commercial tRNA standard provided an excellent avenue for accomplishing quantification in the absence of pure stocks of ribonucleotide variants. Reinterpreting a classic standard-additions strategy, purified tRNA from commercial sources was added to total RNA extracts immediately before ribonuclease digestion, which enabled the release in situ of accurately known amounts of specific PTMs. In this way, proper signal-concentration curves were obtained in parallel for the PTMs in the standard, thus enabling their multiplexed determination in the total ribonucleotide mixture. Further, we evaluated also the possibility of utilizing the endogenous canonic ribonucleotides as a proxy internal reference.
(77) This approach allowed us to determine the relative abundance of PTMs with no addition of individual standards. The fact that the results matched the quantitative data from standard-additions determinations provided validation and enabled us to use AvPs to accurately monitor changes of expression levels across multiple samples. The results demonstrated that the typical technical reproducibility (i.e., sample to sample of the same culture) was significantly better than the biological one (i.e., culture to culture), thus substantiating the robustness of the proposed workflow. The observed reproducibility levels (expressed as average RSD % for detected PTMs) were obtained without the utilization of stable-isotope standards, which is particularly challenging when multiple PTMs are targeted at the same time. As a natural development of any strategy based on MS platforms, future work will explore the possibility of incorporating different isotope labeling techniques in our approach. It is expected that their implementation will further improve the technical reproducibility, but it is not clear whether they will have any beneficial effect on the biological one. In the meantime, the reproducibility observed for our label-free approach allowed us to define the boundaries for deciding whether any fluctuation observed in yeast samples might be simply ascribable to experimental inconsistencies, or assumed legitimate biological significance.
(78) The heat-maps afforded by IMS-MS analysis clearly substantiated the possibility of visualizing in a very direct and compact format the full complement of PTMs produced by a cell, i.e. a full profile, which will be expected to promote large-scale comparative studies of complete epitranscriptomes. Thus in one embodiment, a heat map showing types of RNA structural modifications associated with the presence of cancer cells is contemplated. Thus in a further embodiment, a heat map showing types of RNA structural modifications associated with the stage of cancer is contemplated. In particular, prostate cancer is diagnosed based upon a heat map showing types of RNA structural modifications associated with prostate cancer. Thus in a further embodiment, a heat map showing types of RNA structural modifications associated with the stage of cancer is contemplated.
(79) The unique features identified by dispersing the signals on the t.sub.D and m/z dimensions can lead to an immediate appreciation of qualitative variations between the types of PTMs in different samples. The ability to complete direct data subtraction offers the opportunity to detect and quantify more subtle variations of expression levels manifested by common PTMs. The possibility to observe concomitant variations of modifications in comprehensive and self-consistent fashion will enable the investigation of their functional relationships at the system biology level. In particular, it is contemplated to use methods described herein to investigate up- or down-regulation of specific PTMs as a function of growth conditions.
(80) References: The following references are herein incorporated by reference in their entirety. Ajay, S. S., Parker, S. C. J., Ozel Abaan, H., Fuentes Fajardo, K. V., and Margulies, E. H. (2011). Accurate and comprehensive sequencing of personal genomes. Genome Res 21, 1498-1505. Apruzzese, W. A., and Vouros, P. (1998). Analysis of DNA adducts by capillary methods coupled to mass spectrometry: a perspective. Journal of Chromatography 794, 97-108. Banks, J. F., Shen, S., Whitehouse, C. M., and Fenn, J. B. (1994). Ultrasonically assisted electrospray ionization for LC/MS determination of nucleosides from a transfer RNA digest. Analytical Chemistry 66, 406-414. Banoub, J. H., and Limbach, P. A. (2010). Mass Spectrometry of Nucleosides and Nucleic Acids (Boca Raton Fla.: CRC Press Inc.). Biemann, K., and McCloskey, J. A. (1962). Application of mass spectrometry to structure problems. VI. Nucleosides. J. Am. Chem. Soc. 84, 2005-2007. Bushberg, J. T., Seibert, J. A., Leidholdt Jr., E. M., and Boone, J. M. (2012). The essential physics of medical imaging (Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins). Cantara, W. A., Crain, P. F., Rozenski, J., McCloskey, J. A., Harris, K. A., Zhang, X., Vendeix, F. A. P., Fabris, D., and Agris, P. F. (2011). The RNA Modification Database, RNAMDB: 2011 update. Nucleic Acids Res. 39, D195-201. Carll, T., Brandmayr, C., Hienzsch, A., Müller, M., Pearson, D., Reiter, V., Thoma, I., Thumbs, P., and Wagner, M. (2012). Structure and function of noncanonical nucleobases. Angew. Chem. Int. Ed. Engl. 51, 7110-7131. Castro-Perez, J., Roddy, T. P., Nibbering, N. M. M., Shah, V., McLaren, D. G., Previs, S., Attygalle, A. B., Herath, K., Chen, Z., Wang, S.-P., et al. (2011). Localization of fatty acyl and double bond positions in phosphatidylcholines using a dual stage CID fragmentation coupled with ion mobility mass spectrometry. J. Am. Soc. Mass Spectrom. 22, 1552-1567. Chan, C. T. Y., Dyavaiah, M., DeMott, M. S., Taghizadeh, K., Dedon, P. C., and Begley, T. J. (2010). A quantitative systems approach reveals dynamic control of tRNA modifications during cellular stress. PLoS Genet. 6, e1001247. Chang, K. Y., and Varani, G. (1997). Nucleic acids structure and recognition. Nat. Struct. Biol. 4 Suppl, 854-858. Charette, M., and Gray, M. W. (2000). Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49, 341-351. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159. Clemmer, D. E., and Jarrold, M. F. (1997). Ion mobility measurements and their applications to cluster biomolecules. J. Mass Spectrom. 32, 577-592. Collings, B. A., Campbell, J. M., Mao, D., and Douglas, D. J. (2001). A combined linear ion trap time-of-flight system with improved performance and MSn capabilities. Rapid Communications in Mass Spectrometry 15, 1777-1795. Crain, P. F. (1990a). Mass spectrometric techniques in nucleic acid research. Mass Spectrom Rev 9, 505-554. Crain, P. F. (1990b). Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Methods Enzymol. 193, 782-790. Crain, P. F. (1990c). Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Meth. Enzymol. 193, 782-790. Damen, C. W. N., Chen, W., Chakraborty, A. B., van Oosterhout, M., Mazzeo, J. R., Gebler, J. C., Schellens, J. H. M., Rosing, H., and Beijnen, J. H. (2009). Electrospray ionization quadrupole ion-mobility time-of-flight mass spectrometry as a tool to distinguish the lot-to-lot heterogeneity in N-glycosylation profile of the therapeutic monoclonal antibody trastuzumab. J. Am. Soc. Mass Spectrom. 20, 2021-2033. Dunin-Horkawicz, S., Czerwoniec, A., Gajda, M. J., Feder, M., Grosjean, H., and Bujnicki, J. M. (2006). MODOMICS: a database of RNA modification pathways. Nucleic Acids Res. 34, D145-149. Dwivedi, P., Wu, C., Matz, L. M., Clowers, B. H., Siems, W. F., and Hill, H. H., Jr (2006). Gas-phase chiral separations by ion mobility spectrometry. Anal. Chem. 78, 8200-8206. Esmans, E., Broes, D., Hoes, I., Lemière, F., and Vanhoutte, K. (1998). Liquid chromatography-mass spectrometry in nucleoside, nucleotide and modified nucleotide characterization. Journal of Chromatography A 794, 109-127. Fabris, D., Turner, K. B., and Hagan, N. A. (2010). Electrospray Ionization-Mass Spectrometry for the Investigation of Protein-Nucleic Acids Interactions. In Mass Spectrometry of Nucleosides and Nucleic Acids, (J. Banoub and P. Limbach eds., CRC Press, Taylor and Francis Group, LLC, London, U. K.), pp. 303-327. Ferré-D'Amaré, A. R. (2003). RNA-modifying enzymes. Curr. Opin. Struct. Biol. 13, 49-55. Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (U.S.A: Cold Spring Harbor Laboratory Pr). Frommer, M., McDonald, L. E., Millar, D. S., Collis, C. M., Watt, F., Grigg, G. W., Molloy, P. L., and Paul, C. L. (1992). A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. U.S.A. 89, 1827-1831. Giles, K., Pringle, S. D., Worthington, K. R., Little, D., Wildgoose, J. L., and Bateman, R. H. (2004). Applications of a travelling wave-based radio-frequency-only stacked ring ion guide. Rapid Commun. Mass Spectrom. 18, 2401-2414. Von Helden, G., Wyttenbach, T., and Bowers, M. T. (1995). Conformation of macromolecules in the gas phase: use of matrix-assisted laser desorption methods in ion chromatography. Science (New York, N. Y 267, 1483-1485. Helm, M. (2006). Post-transcriptional nucleotide modification and alternative folding of RNA. Nucleic Acids Res. 34, 721-733. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. (1996). Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. U.S.A. 93, 9821-9826. Issa, J. P., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., and Baylin, S. B. (1994). Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat. Genet. 7, 536-540. Koboldt, D. C., Steinberg, K. M., Larson, D. E., Wilson, R. K., and Mardis, E. R. (2013). The next-generation sequencing revolution and its impact on genomics. Cell 155, 27-38. Kowalak, J. A., Dalluge, J. J., McCloskey, J. A., and Stetter, K. O. (1994). The role of posttranscriptional modification in stabilization of transfer RNA from hyperthermophiles. Biochemistry 33, 7869-7876. Lapthorn, C., Pullen, F., and Chowdhry, B. Z. (2013). Ion mobility spectrometry-mass spectrometry (IMS-MS) of small molecules: Separating and assigning structures to ions. Mass Spectrom Rev 32, 43-71. Li, J., Yang, Z., Yu, B., Liu, J., and Chen, X. (2005). Methylation protects miRNAs and siRNAs from a 3′-end uridylation activity in Arabidopsis. Curr. Biol. 15, 1501-1507. Limbach, P. A., Crain, P. F., and McCloskey, J. A. (1994). Summary: the modified nucleosides of RNA. Nucleic Acids Res 22, 2183-2196. Machnicka, M. A., Milanowska, K., Osman Oglou, O., Purta, E., Kurkowska, M., Olchowik, A., Januszewski, W., Kalinowski, S., Dunin-Horkawicz, S., Rother, K. M., et al. (2012). MODOMICS: a database of RNA modification pathways—2013 update. Nucleic Acids Research 41, D262-D267. McCloskey, J. A. (1979). Characterization of nucleosides by mass spectrometry. Nucleic Acids Symp Ser s109-13. McCloskey, J. A. (1985). Mass spectrometry of nucleic acid constituents and related compounds. In Mass Spectrometry in the Health and Life Sciences, A. L. Burlingame, N. Castagnoli, Eds., (Amsterdam: Elsevier), pp. 521-546. Miller, J. H. (1972). Experiments in molecular genetics (Cold Spring Harbor Laboratory). Monroe, M. (2012). Molecular Weight Calculator, v. 6.49. world wide web://ncrr.pnl.gov/software/. Nordhoff, E., Kirpekar, F., and Roepstorff, P. (1996). Mass spectrometry of nucleic acids. Mass Spectrom. Rev. 15, 67-138. Ofengand, J. (2002). Ribosomal RNA pseudouridines and pseudouridine synthases. FEBS Lett. 514, 17-25. Quinn, R., Basanta-Sanchez, M., Rose, R. E., and Fabris, D. (2013). Direct infusion analysis of nucleotide mixtures of very similar or identical elemental composition. J. Mass Spectrom. 48, 703-712. Singer-Sam, J., Grant, M., LeBon, J. M., Okuyama, K., Chapman, V., Monk, M., and Riggs, A. D. (1990). Use of a Hpall-polymerase chain reaction assay to study DNA methylation in the Pgk-1 CpG island of mouse embryos at the time of X-chromosome inactivation. Mol. Cell. Biol. 10, 4987-4989. Smith, C. A., O'Maille, G., Want, E. J., Qin, C., Trauger, S. A., Brandon, T. R., Custodio, D. E., Abagyan, R., and Siuzdak, G. (2005). METLIN: a metabolite mass spectral database. Therapeutic Drug Monitoring 27, 747-751. Solouki, T., Pasa-Tolic, L., Jackson, G. S., Guan, S., and Marshall, A. G. (1996). High-resolution multistage MS, MS2, and MS3 matrix-assisted laser desorption/ionization FT-ICR mass spectra of peptides from a single laser shot. Anal. Chem. 68, 3718-3725. Su, D., Chan, C. T. Y., Gu, C., Lim, K. S., Chionh, Y. H., McBee, M. E., Russell, B. S., Babu, I. R., Begley, T. J., and Dedon, P. C. (2014). Quantitative analysis of ribonucleoside modifications in tRNA by HPLC-coupled mass spectrometry. Nat Protoc 9, 828-841. Tomer, K. B., Guenat, C. R., and Deterding, L. J. (1988). Consecutive reaction monitoring in a four-sector mass spectrometer: MS4 and one step beyond. Anal. Chem. 60, 2232-2236. Verbeck, G. F., Ruotolo, B. T., Sawyer, H. A., Gillig, K. J., and Russell, D. H. (2002). A fundamental introduction to ion mobility mass spectrometry applied to the analysis of biomolecules. J Biomol Tech 13, 56-61. Wu, J., and McLuckey, S. A. (2004). Gas-phase fragmentation of oligonucleotide ions. International Journal of Mass Spectrometry 237, 197-241. Yamashita, M., and Fenn, J. B. (1984). Electrospray ion source. Another variation on the free-jet theme. J. Phys. Chem. 88, 4671-4675. World wide web://metlin.scripps.edu/index.php World wide web://mods.rna.albany.edu/ World wide web://modomics.genesilico.pl/ 1. Johansson, M. & Bystrom, A.: Dual function of the tRNA(m(5)U54)methyltransferase in tRNA maturation. RNA 8, 324-335 (2002). 2. Copela, L. A., Chakshusmathi, G., Sherrer, R. L., & Wolin, S. A.: The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. RNA 12, 644-654 (2006). 3. Rylova, S. N., Amalfitano, A., et al.: The CLN3 Gene is a Novel Molecular Target for Cancer Drug Discovery. Cancer Research 62, 801-808 (2002).
EXPERIMENTAL
(81) The following examples serve to illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
(82) In the experimental disclosures which follow, the following abbreviations apply: N (normal); M (molar); mM (millimolar); μM (micromolar); mol (moles); mmol (millimoles); (micromoles); nmol (nanomoles); pmol (picomoles); g (grams); mg (milligrams); μg (micrograms); ng (nanograms); pg (picograms); L and (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); U (units); min (minute); s and sec (second); deg (degree); ° C. (degrees Centigrade/Celsius).
Example I
(83) The Following Describes Exemplary Methods and Materials Used During the Development of the Present Inventions.
(84) A. Preparation of Cellular Extracts.
(85) Saccharomyces cerevisiae strain BY4741 was grown in yeast extract, peptone, dextrose (YPD) and synthetic complete (SC) media. Cell suspensions were streaked onto YPD agar plates and incubated at 30° C. overnight. Five individual colonies were selected from each plate and placed into individual tubes containing 6 mL of either YPD or SC medium. Growth tubes were incubated at 30° C. with 200-rpm gyration. Optical density at 600 nm (OD.sub.600) was monitored on a ThermoFisher Scientific (Waltham, Mass.) Nanodrop 2000c spectrophotometer until a value slightly greater than 0.3 units was achieved. Each liquid culture was diluted to a final 0.3 OD.sub.600 to ensure that the tubes contained comparable “cell concentrations” (i.e., number of cell per volume unit). A 3-mL aliquot of each culture was centrifuged at 6000 g for 5 min to obtain pellets that contained approximately the same number of cells. In this respect, we determined that each 3-mL culture with 0.3 OD.sub.600 provided a wet pellet weighing on average 34.9×10.sup.−3 g. Escherichia coli K-12 strain MG1655 was grown in synthetic complete (SC) medium according to established procedures (Fritsch and Maniatis, 1989; Miller, 1972). Harvesting was carried out in analogous way.
(86) Each pellet was disrupted by using Denaturation Solution (Life Technologies, Grand Island, N.Y.) in the presence of 0.5 mm diameter glass beads (BioSpec Products, Bartlesville, Okla.). When required by the standard-additions protocol, accurately known aliquots of S. cerevisiae tRNA.sup.Phe (Sigma-Aldrich, St. Louis, Mo.) were introduced at this point into the lysate to serve as internal standard. Total RNA was extracted by using the ToTALLY RNA Extraction Kit (Life Technologies, Grand Island, N.Y.), which is based on a typical phenol/chloroform procedure. The RNA was precipitated by using cold isopropanol and then treated with DNase 1 (New England Biolabs, Ipswich, Mass.) in 1× DNase buffer to remove any remaining DNA. The recovered RNA was subsequently desalted by ethanol precipitation overnight and reconstituted in 50 μL of RNase-free water (Sigma-Aldrich, St. Louis, Mo.). The concentration of intact total RNA from each sample was measured by UV absorbance at 260 nm. Nuclease P1 and phosphodiesterase 1 from snake venom (Sigma-Aldrich, St. Louis, Mo.) were employed to complete the digestion of RNA into individual mononucleotides, as previously described (Crain, 1990b). Immediately before analysis, final samples were diluted 1:10 in 150 mM ammonium acetate and 10% isopropanol.
(87) B. Mass Spectrometry.
(88) Samples were analyzed by direct infusion electrospray ionization (ESI) on either a ThermoFisher Scientific (Waltham, Mass.) LTQ-orbitrap Velos mass spectrometer or a Waters (Milford, Mass.) Synapt G2 HDMS IMS mass spectrometer. Analyses were performed in nanoflow ESI mode by using quartz emitters produced in house by a Sutter Instruments Co. (Novato, Calif.) P2000 laser pipette puller. Up to 5 μL samples were typically loaded into each emitter by using a gel-loader pipette tip. A stainless steel wire was inserted in the back-end of the emitter to supply an ionizing voltage that ranged between 0.9 and 1.2 kV. Source temperature and desolvation conditions were adjusted by closely monitoring the incidence of ammonium adducts and water clusters (Fabris, D. et al., 2010).
(89) For high-resolution determinations, the LTQ-orbitrap instrument was calibrated by using an anion mixture that contained sodium dodecyl-sulfate, sodium taurocholate, and Ultramark. These standards enabled calibration over a range of 150-2000 m/z with up to 100 ppb mass accuracy. Tandem mass spectrometry (MS/MS) was accomplished by isolating the precursor ions of interest in the linear trap quadrupole (LTQ) element, which were then collided with N2 to activate fragmentation. Multistep activation experiments (MS.sup.n) (Collings et al., 2001; Solouki et al., 1996) were completed by properly isolating first-generation and subsequent fragments prior to activation. The fragmentation of mass-selected ions was activated by using a typical 25V collision voltage. Ensuing products were mass analyzed either in the LTQ or the Orbitrap region of the instrument. Consecutive reaction monitoring (CRM)(Tomer et al., 1988) was performed by dialing the selected precursor.fwdarw.fragment transitions in the instrument data system. Series of diagnostic CRM experiments were performed in systematic fashion by inputting lists of precursor.fwdarw.fragment transitions specific for the different modifications, which were completed by the instrument with no further user intervention.
(90) In IMS-MS experiments, apparent drift time (to) was determined by allowing ions to move through the travelling wave (Tri-WAVE) element of the instrument (Giles et al., 2004), before transferring them for mass analysis into the time-of-flight (TOF) stage operated in single reflectron mode. The instrument was calibrated by using a 2 mg/mL solution of cesium iodide in 50:50 water/methanol, which afforded up to 10 ppm mass accuracy. For comprehensive mixture analysis, the Tri-WAVE region was held at a pressure of approximately 4.40 mbar (uncalibrated gauge reading) by a 90 mL/min flow of N.sub.2 and 180 mL/min of He. It was operated with an approximately 650 m/s IMS wave velocity, a 40 V wave height, a 109 m/s transfer wave velocity, and a 2.0 V transfer wave height. Time aligned parallel (TAP) dissociation and mass-selected time-aligned fragmentation of isobars were performed by raising the transfer voltage to 17 V and the cell pressure to ˜4.60 mbar (uncalibrated gauge reading) with a flow of 140 mL/min N2 and 180 mL/min He. At the same time, IMS wave velocity was raised to ˜700 m/s, transfer wave velocity to −600 m/s, and transfer wave height to 4.0 V.
(91) C. Data Analysis.
(92) High-resolution and fragmentation data obtained on the LTQ-orbitrap instrument were processed by Xcalibur 2.1 software (ThermoFisher Scientific, Waltham, Mass.). Mass calculations and predictions of elemental composition were performed by using the Molecular Weight Calculator software made available by the Pacific Northwest National Laboratory (Monroe, 2012). A data reduction step was implemented prior to database searching to simplify the operations and minimize the incidence of false positives. Instead of relying on a predefined intensity threshold to discriminate signal from noise, the experimental masses to be employed in the searches were selected according to a deconvolution algorithm included in the Xcalibur 2.1 software (Bushberg et al., 2012). This algorithm requires the detection of full-fledged .sup.12C and .sup.13C signals to correctly assign the charge state of observed species. If the .sup.13C peak of a low-abundance component was not recognized from the background (and a plausible charge was not assigned), then the mass of the corresponding .sup.12C was filtered out regardless of whether its intensity afforded an acceptable signal-to-noise ratio. The resulting mass list was then searched against the METLIN database (world wide web://metlin.scripps.edu/index.php) and a non-redundant registry obtained by combining the entries present in the RNA Modifications (world wide web://mods.rna.albany.edu/) and MODOMICS databases (world wide web://modomics.genesilico.pl/). Matching between experimental data and database information was carried out by using software developed in house.
(93) IMS-MS data were displayed in the form of heat-map plots with arrival time (t.sub.D) and mass to charge ratio (m/z) placed on the x- and y-axis, respectively, by using OriginPro 9.1 (Origin Lab, North Hampton, Mass.). A color gradient provided in each plot was used to communicate the signal intensity expressed in arbitrary ion counts. For data subtraction analysis, appropriate scaling factors were utilized to align the intensity scales of the selected plots. Such factors were calculated to match the combined intensities of the four canonical ribonucleotides (i.e.,
(94)
with cr.sub.i corresponding to the respective absolute intensity in arbitrary counts) observed in each plot. Taking advantage of this proxy, de facto internal reference, it was possible also to express the abundance of each species in relation to that of the canonical ribonucleotides according to:
(95)
in which AvP.sub.x is the abundance versus proxy of a certain species obtained from its absolute intensity (ai.sub.x) normalized to the combination of the abundances of the canonical ribonucleotides
(96)
Home-built software was employed to process the experimental data, calculate AvP values and, when necessary, apply appropriate scaling factor for data alignment. The same application was employed also to perform point-by-point subtraction of aligned data. The software application developed in house is the object of a manuscript in preparation. The results were visualized in heat-map format by utilizing OriginPro 9.1 (Origin Lab, North Hampton, Mass.).
(97) Please refer to
Example II
(98) The Following Example Describes Direct Infusion Analysis of Cellular Nucleotide Mixtures.
(99) A sensible but deceptively challenging way to reduce sample losses and analyte bias consists of reducing the number of sample-handling steps included in a prospective experimental workflow. Classic phenol-chloroform extraction was used to simultaneously achieve cell lysis and rapid isolation of nucleic acid components (Chomczynski and Sacchi, 1987), followed by digestion into separate mononucleotides (Crain, 1990b). Owing to the absence of high-resolution separation steps, the final samples were anticipated to contain the desired mononucleotide analytes and also unrelated cellular components carried through the entire workflow (Scheme 1, see METLIN hits; o species detected also in the blank. A broad distribution of signals with very different intensities covered the entire range between m/z 300 and 700—the region in which PTMs are typically observed. Abundant signals were readily assigned to the deprotonated molecular ions of canonical ribonucleotides (i.e., [NMP-H].sup.−, where N indicates any nucleoside)(Quinn et al., 2013). Their experimental masses exhibited an average of ˜100 ppb deviation from values calculated from the corresponding elemental compositions, which matched the typical accuracy afforded by these types of LTQ-orbitrap determinations (Quinn et al., 2013).
(100) The complexity of whole-cell extracts was also confronted by utilizing IMS-MS, which enables the differentiation of ions according to their size/conformation. In this technique, ions are dispersed on the time dimension as they travel across a low-pressure region of the instrument (Dwivedi et al., 2006; Lapthorn et al., 2013). The probability of undergoing low-energy collisions with background gas is a function of their conformation, which determines the travel time. The corresponding data are displayed in the form of heat-maps or 3D plots, in which the different dimensions consist of arrival time (t.sub.D), mass to charge ratio (m/z), and signal intensity. A representative heat-map obtained from the same yeast extract is shown in
Example III
(101) The Following Example Describes Identification of Modified Ribonucleotides.
(102) The vast majority of the detected signals were readily assigned with the aid of database searching. Initial data reduction followed a conservative approach that eschewed the application of a pre-determined threshold to eliminate background noise on the basis of signal intensity, but relied instead on the detection of recognizable isotopic envelopes to differentiate signal from noise. This task employed a deconvolution algorithm included in the instrument's data system, which was designed to infer the charge state of any given signal from the respective isotopic distribution (Bushberg et al., 2012). When the ESI-MS data shown in
(103) The searches were performed against a database specialized on RNA modifications, as well as a more comprehensive metabolomics registry capable of handling unrelated species present in the workflow carryover. The latter consisted of the METLIN database (hosted and maintained by the Scripps Institute) (Smith et al., 2005; world wide web://metlin.scripps.edu/index.php), which comprises in excess of 75,000 endogenous and exogenous metabolites from a broad selection of living organisms, ranging from bacteria, to plants, to animals and humans. In addition, a non-redundant index of known RNA PTMs was generated in house by combining the information contained in the RNA Modifications Database (hosted by the RNA Institute of University at Albany) (Limbach et al., 1994; Cantara et al., 2011; world wide web://mods.rna.albany.edu/) and MODOMICS (hosted by the International Institute of Molecular and Cell Biology in Warsaw) (Dunin-Horkawicz et al., 2006; Machnicka et al., 2012; world wide web://modomics.genesilico.pl/). After redundant entries were eliminated, we ensured that the mass of each PTM appeared in both the nucleoside and nucleotide form to allow for the recognition of possible products present in the nuclease digests. For each entry, the mass of the deprotonated and protonated species (i.e., [M−H].sup.− and [M+H].sup.+) were calculated to enable proper matching data obtained in either polarity. The final custom registry included 254 searchable entries.
(104) A total of 268 database hits were obtained when the reduced experimental data were searched against METLIN, whereas 40 were found in the custom registry (Table 1). The observed experimental masses matched very closely those found in the databases. The majority of hits provided an average deviation between experimental and calculated masses that fell within the accuracy assessed from canonical ribonucleotides, whereas weaker signals displayed slightly higher deviations. The majority of such hits corresponded to modifications typically observed in S. cerevisiae's ribosomal-RNA (rRNA) or transfer-RNA (tRNA), but 13 of them had not been previously reported for this organism according to the information included in the RNA Modifications and MODOMICS databases (marked with asterisk in Table 1). This observation may be a consequence of the broader scope of these analyses, which was not limited to specific rRNA/tRNA fractions but targeted whole-cell extracts. With merely a few exceptions, the majority of the hits afforded by the custom registry were also found in METLIN. This observation provides an indication of the excellent but not absolute overlap between the databases employed in the study. In particular, the greater breadth afforded by METLIN enabled the putative assignment of other notable but unrelated species of cellular origin (marked with a red tick in
(105) The m/z values obtained from the IMS-MS determination (provided on the y-axis of the heat-map in
Example IV
(106) The Following Example Describes Assignment of Structure and a Confirmation Process.
(107) As part of the confirmation process for identifying a PTM RNA structure, a close match between experimental and theoretical masses calculated from known elemental compositions assists with achieving a positive identification. For species of this size, the level of closeness can is seen by the sub-ppm accuracy afforded by the instrument. This can greatly reduce the number of possible elemental compositions that could match the experimental data, thus minimizing the risk of erroneous interpretations (Quinn et al., 2013). However, regardless of the accuracy afforded by the available instrumentation, positive identification cannot be based solely on matching mass values, but must receive further corroboration by gas-phase fragmentation data consistent with the putative analyte structure. The facile cleavage of the N-glycosidic bond represents a characteristic dissociation channel that is diagnostic of nucleotide structures (Biemann and McCloskey, 1962; Crain, 1990a) and can be frequently employed to discriminate between isomeric forms present simultaneously in a sample (Quinn et al., 2013). Cleavage products can immediately reveal whether the modifying group may be situated on the phosphoribose or nucleobase moiety of the PTM structure. Further, these first-generation fragments can be submitted to subsequent isolation/activation steps in MS.sup.n experiments to obtain additional details on the nature and position of the modification (Quinn et al., 2013).
(108) These points are exemplified by the analysis of the species detected at m/z 376.0684 in
(109) The information obtained from these types of determinations corroborated the vast majority of the hits returned by database searching (marked with in Table 1). The exception consisted of a few species for which limited signal intensity hindered the direct application of multiple activation steps. In this case, an alternative approach was implemented, which involved the application of consecutive reaction monitoring (CRM) (Tomer et al., 1988) to detect diagnostic precursor-product relationships characteristic of target nucleotides (Quinn et al., 2013). This technique affords excellent noise suppression and high duty cycle, which enhance the ability to detect low-abundance analytes in the presence of elevated background. However, its implementation requires prior knowledge of characteristic transitions to be monitored during analysis. In our case, this approach was facilitated by the predictable nature of ribonucleotide dissociation pathways (i.e., the above described base loss followed by ribose and nucleobase fragmentation), which provided series of specific precursor.fwdarw.product transitions for each entry of our non-redundant registry. The actual analyses were performed in automated mode with no operator intervention. In this way, the results of multiple CRM experiments were combined to corroborate the identity of low-abundance analytes and, in most cases, confirm the simultaneous presence of isomeric species (Table 1).
(110) In the case of IMS-MS determinations, gas-phase dissociation was employed in analogous fashion to corroborate the initial assignments obtained by searching the observed m/z values in the custom registry. As described in previous work, the assignments were confirmed by activating in parallel the species dispersed on the time dimension by the ion mobility element, before transfer to the mass analyzer (Quinn et al., 2013). Called time aligned parallel (TAP) dissociation (Castro-Perez et al., 2011; Damen et al., 2009), this technique provided extensive fragmentation data that matched those observed for the yeast extract in the LTQ-orbitrap determinations. In addition, we explored an alternative characterization strategy that mimicked more traditional tandem MS spectrometry by fragmenting those species that were recognized as potential PTMs. As illustrated for the methyl-G species described above, this type of determination was completed by isolating the precursor ion at m/z 378 in the mass-selective quadruple, by allowing the various isomers to disperse on the time domain in the ion mobility element, and by then activating their gas-phase dissociation before final mass analysis. In what could be defined as mass-selected time-resolved dissociation experiment, the data obtained at different intervals displayed fragmentation patterns that were characteristic of the various methyl-G isomers (
(111) None of the approaches described in this report employ specific t.sub.D values to achieve positive identification of the various species, which is instead based on corroborating fragmentation information. The time domain was used to achieve separation between isomers and to enable the observation of their specific fragmentation patterns. t.sub.D determinations showed an average reproducibility of ±0.006 ms over repeated analyses on different days, which could potentially support the utilization of t.sub.D as a unique identifying characteristic. However, in light of the number of experimental variables that may affect such quantity, reproducibility of this type of experiment across different instruments/platforms is contemplated before t.sub.D values can be employed directly for identification purposes. In the meantime, the ability to achieve positive corroboration was determined by the comprehensive nature of the structural information afforded by gas-phase dissociation in combination with the rather conservative principles employed for initial data reduction. Filtering out signals that did not possess recognizable isotopic patterns increased the efficiency of database searches and the effectiveness of subsequent analyses. While this criterion might have caused the occasional rejection of potentially valid information, conservative data reduction minimized the incidence of false positives by removing questionable signals from the initial mass lists. In this way, subsequent analyses targeted the species that had a legitimate probability of yielding viable fragmentation data for assignment confirmation.
Example V
(112) The Following Example Describes Absolute Versus Relative Assessment of Modification Levels.
(113) The implementation of these MS approaches, either individually or in concert, can provide a comprehensive inventory of the PTMs detectable in a lysate. However, the ability to merely identify their presence is not sufficient to support functional studies based on the evaluation of their expression levels as a function of experimental variables. The selected platform must be able to provide valid information on the respective abundances to appreciate possible up- or down-regulation and explore functional hypotheses. Classic quantitative approaches require the availability of target analyte in neat form to generate a calibration curve through serial dilutions, or to perform incremental additions to the original sample according to the standard additions method. Unfortunately, the broad implementation of such strategies has been severely limited by the inadequate availability of standards for the majority of known modifications. The workflow proposed here presents the opportunity to overcome this challenge by utilizing purified tRNA samples as intrinsic sources of PTMs in standard-addition determinations. According to this strategy, tRNA was added to the sample as an internal standard capable of releasing its PTMs at once during the RNase digestion step (Scheme 1). Samples containing incremental amounts of tRNA were then used to generate the signal/concentration curves necessary to determine unknown concentrations.
(114) A basis for this strategy was tested by exploring the utilization of S. cerevisiae tRNA.sup.Phe (commercially available in isolated form) as a controlled source of selected PTMs. In preliminary experiments, predetermined amounts were submitted to the entire workflow to replicate actual application conditions. The concentration of intact tRNA.sup.Phe was monitored by UV absorption determinations through the steps preceding RNase digestion (Scheme 1), which revealed an average ˜25% sample recovery. Upon hydrolysis, ESI-MS analysis on the LTQ-orbitrap displayed signals for the entire complement of PTMs represented in this type of tRNA, with no trace of undigested substrate (
(115) Based on these results, we tested the utilization of tRNA.sup.Phe in a modified standard-addition procedure that involved mixing weighed amounts of S. cerevisiae pellet with accurately known increments of standard. This modus operandi ensured that standard and endogenous RNA underwent together the entire workflow. Also in this case, UV determinations were used to evaluate RNA recovery, which matched the ˜25% average observed earlier for isolated standard. The excellent match between recoveries observed in the absence/presence of cell material indicated that lysis debris did not significantly interfere with phenol-chloroform extraction and subsequent workflow operations. The data obtained from the standard-addition series were used to generate the curves necessary to complete the quantitative determination of the PTMs in the extract (Table 2). The absence of accurate estimates of cellular volumes precluded a correct translation of extract concentrations into actual cellular concentrations. For this reason, the total amounts of PTMs in the sample were more conveniently expressed in terms of mol per gram of wet pellet (mol/g, Table 2), which were based on the weight of initial cell material employed in the determination. For conversion purposes, we estimated that 1 g of wet pellet corresponded to ˜86 mL of a culture suspension with 0.3 OD.sub.600. The results clearly displayed the typical gulf between abundant canonic ribonucleotides and low-abundance modifications representing the bulk of the observed analytes, which showcased the excellent dynamic range afforded by this approach. In the context of the detection limits obtained from isolated tRNA.sup.Phe (Table 1S), the observed values indicated that valid determinations could be comfortably accomplished for even the least abundant modifications (i.e., ac.sup.4Cm and cmnm.sup.5s.sup.2U) with as little as 800 μg of wet pellet (˜69 μL of a culture suspension with 0.3 OD.sub.600). It should be noted that, although this determination covered a subset of the entire complement of cellular PTMs—those represented in tRNA.sup.Phe—the utilization of different tRNAs or other controlled sources of natural PTMs could extend the coverage to virtually any type of modified ribonucleotides, thus making this strategy viable for a wide range of possible applications.
(116) The proposed strategy can circumvent but not eliminate the hurdles associated with the dearth of suitable standards for rigorous quantitative determinations. In many cases, however, obtaining the absolute amount of a given PTM is not as crucial as monitoring its relative abundance versus others in the sample. In proteomics studies, for example, the ability to appreciate mutual variations of post-translational modifications—reliable indicators of up- and down regulation—is at least as valuable as the ability to determine their absolute levels. For this reason, we explored the possibility of utilizing the four canonical ribonucleotides, whose overall amounts and distributions are dependent on the cell's genetic makeup, as a convenient internal reference to observe relative variations within a given organism. More specifically, we combined their signal intensities to establish a multicomponent reference, which could fit the MS definition of a proxy base-peak, for quantifying the various PTMs in terms of abundance versus proxy (i.e., AvP). As shown in Table 2, this information was readily attainable for PTMs in the extract, regardless of their representation in a putative standard, thus providing a self-consistent and comprehensive measure of their relative abundances in the sample. We evaluated the effectiveness of this approach by comparing experimental AvP values obtained from isolated tRNA.sup.Phe with putative figures calculated for a fixed concentration by using the respective signal/concentration curves (Table 1S). The excellent match between corresponding values provided the justification for a broader application of this treatment to monitor the relative variations of PTM levels in actual cell material.
Example VI
(117) The Following Example Describes Reproducibility of PTM Analysis.
(118) Separate aliquots of the same S. cerevisiae pellet were submitted in parallel to the entire workflow to assess the technical reproducibility (precision) of the approach. The analysis of five individual samples consistently produced 40 hits. Their relative abundances were expressed in AvP units to enable direct comparisons of their distributions (Table 3). Overall, the values displayed an average of ±4.4% relative standard deviations (RSD %) for the PTMs, which offered a measure of the reproducibility of these determinations. Not surprisingly, the species at the higher end of the AvP scale displayed better reproducibility (i.e., smaller RSD % values) than those at the lower end, owing to the greater susceptibility of the latter to possible fluctuations of experimental conditions throughout the workflow. For comparison purposes, the reproducibility of the ESI-MS analysis itself was evaluated separately by repeating the determination of the same digestion mixture for a total of five times. The results provided an average RSD % of ±1.6% calculated from the PTMs in the sample, thus suggesting that workup operations, such as extraction/lysis, digestion, etc., contributed the lion's share of the overall ±4.4% uncertainty intrinsic in these determinations. It should be noted that in general the observed reproducibility benefited significantly from the utilization of relative rather than absolute notations.
(119) Indeed, any experimental inconsistency affecting detection is typically expected to influence analyte and reference in the same direction, as they both undergo simultaneously the same procedure. When abundances are expressed in relation to the reference, these effects tend to cancel out, thus minimizing the impact of analytical fluctuations. This explains the observation that RSD % obtained directly from ion counts (absolute notation) were distinctively larger than those calculated from the corresponding AvPs (relative notation, Table 3).
(120) In order to weigh sample-to-sample variability (i.e., biological reproducibility) against the observed technical reproducibility, we performed parallel analyses of individual samples grown in separate cultures under otherwise identical conditions. These experiments produced consistently the same hits obtained from the technical repeats, but their relative abundances displayed an average RSD % of ±7.8 (Table 3). At least at first sight, sample-to-sample fluctuations are typically ascribable to variations of total RNA in each sample. However, great effort was placed into growing the cultures in parallel under identical conditions, harvesting them at the same growth phase, and diluting the culture before aliquoting to approximate the same number of cells per sample. In addition, a closer look at the results revealed that the PTMs manifested widely different fluctuation levels from one another (e.g., compare ±14% for D with ±2.9% for ac.sup.4C/f.sup.5Cm). Any variation of overall RNA content would be expected to affect PTMs in the same direction, leading to comparable swings. Therefore, these considerations ruled out possible variations of total RNA as a source of uncertainty and suggested the influence of uncontrolled experimental variables that will warrant further investigation. When evaluating the uncertainty intrinsic in these determinations it was observed that biological reproducibility of ±7.8% included also the ±4.4% contribution of the underlying technical reproducibility present in each determination. This shows the example range for S. cerevisiae. Taken together, these figures provided a measure of the typical range within which the incidence of PTMs may vary sample-to-sample under strictly controlled conditions in these yeast experiments. Determining such range for the specific system under investigation is contemplated for increased confidence whether a certain variation is significant and may be unambiguously attributed to actual biological factors rather than mere sample variability.
Example VII
(121) The Following Example Describes Epitranscriptomic Profiling.
(122) Heat-maps generated by IMS-MS analysis were analyzed as direct representations of global PTM profiles. In this type of plot, the independent variables describing molecular mass and ion mobility behavior are dispersed onto orthogonal dimensions. Their intersection is unique for each analyte and enables their accurate differentiation. For this reason, a heat-map can provide a comprehensive view of the distribution of species in the sample. As exemplified in
(123) Visual comparison are contemplated to provide qualitative information on the presence/absence of a certain PTM or PTMs, then actual data subtraction can reveal more subtle differences between related heat-maps and provide an assessment of the different levels of common PTMs. This type of analysis was accomplished by expressing the intensity scales in AvP units to enable axes alignment and point-by-point subtraction. The resulting differential plot highlighted the subtle changes experienced by low-abundance species, such as ac.sup.4C and f.sup.5Cm (
(124) TABLE-US-00001 TABLE 1 Hits obtained by searching the ESI-MS data in FIG. 1 against the non-redundant database generated in house (by combining data from the RNA Modifications and Modomics Databases, see Examples). The experimental mass of the neutral species is expressed in mass units (u). Monoisotopic mass was calculated from the respective elemental composition. Exp. Mono- mass isotopic (u) (u) Hit.sup.1 323.0519 323.05185 C.sup.‡ 324.0359 324.03587 Y.sup.‡, U.sup.‡ 326.0515 326.05152 D.sup.‡ 337.0675 337.06750 m.sup.3C, m.sup.5C, Cm.sup.‡, m.sup.4C* 338.0515 338.05152 m.sup.3Y*, Um.sup.‡, m.sup.5U, m.sup.1Y, Ym.sup.‡*, m.sup.3U 347.0631 347.06308 A.sup.‡ 348.0471 348.04710 I.sup.‡ 361.0787 361.07873 m.sup.1A, m.sup.2A*, m.sup.6A, m.sup.8A*, Am.sup.‡ 363.0580 363.05800 G.sup.‡ 365.0623 365.06242 ac.sup.4C.sup.‡*, f.sup.5Cm.sup.‡* 375.0942 375.09438 m.sup.6Am*, m.sup.1Am*, m.sup.6.sub.2A.sup.‡* 377.0762 377.07365 m.sup.1G.sup.‡, m.sup.2G.sup.‡, m.sup.7G.sup.‡, Gm.sup.‡ 379.0762 379.07807 ac.sup.4Cm.sup.‡* 381.0572 381.05733 ncm.sup.5U* 391.0893 391.08923 m.sup.1Gm*, m.sup.2.sub.2G, preQ1*, m.sup.2.sub.7G 427.0429 427.04505 cmnm.sup.5s.sup.2U 492.1005 492.10059 t.sup.6A.sup.‡ 588.1580 588.15811 yW.sup.‡ .sup.1Full names available at world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. .sup.‡Assignments corroborated by tandem mass spectrometry (i.e., MS.sup.n and CRM determinations). Modifications previously unreported in S. cerevisiae.
(125) TABLE-US-00002 TABLE 2 Quantitative determination of ribonucleotides present in total RNA extract of S. cerevisiae. This standard-additions determination used tRNA.sup.Phe purified from S. cerevisiae to achieve in situ release of PTM standards (see Examples). Name abbreviation and neutral experimental mass in mass units (u) are provided for each ribonucleotide. Exp. mass Conc. Amount Exp. Hit.sup.1 (u) (M).sup.2 (mol/g).sup.3 AvP.sup.4 C 323.0519 2.60 × 10.sup.−5 1.25 × 10.sup.−7 28.7 U/Ψ 324.0359 2.26 × 10.sup.−5 1.09 × 10.sup.−7 22.0 D 326.0515 2.40 × 10.sup.−6 1.16 × 10.sup.−8 2.95 m.sup.3C, m.sup.5C, 337.0675 2.48 × 10.sup.−7 1.19 × 10.sup.−9 2.45 × 10.sup.−1 Cm, m.sup.4C m.sup.3Y, Um, 338.0515 NA NA 1.03 m.sup.5U, m.sup.1Y, Ym, m.sup.3U A 347.0631 2.41 × 10.sup.−5 1.16 × 10.sup.−7 21.6 I 348.0471 NA NA 1.44 × 10.sup.−1 m.sup.1A, m.sup.2A, 361.0787 4.40 × 10.sup.−7 4.40 × 10.sup.−9 1.02 × 10.sup.−1 m.sup.6A, Am, m.sup.8A G 363.0580 2.42 × 10.sup.−5 1.17 × 10.sup.−7 27.7 ac.sup.4C, f.sup.5Cm 365.0623 NA NA 4.75 × 10.sup.−1 m.sup.6Am, m.sup.1Am, 375.0942 NA NA 5.01 × 10.sup.−3 m.sup.6.sub.2A m.sup.1G, m.sup.2G, 377.0762 1.32 × 10.sup.−7 .sup. 6.34 × 10.sup.−10 1.02 m.sup.7G, Gm ac.sup.4Cm 379.0762 NA NA 6.85 × 10.sup.−3 ncm.sup.5U 381.0572 NA NA 3.37 × 10.sup.−2 m.sup.1Gm, m.sup.2.sub.2G, 391.0893 5.64 × 10.sup.−7 2.72 × 10.sup.−9 6.26 × 10.sup.−1 preQ1, m.sup.2.sub.7G cmnm.sup.5s.sup.2U 427.0429 NA NA 1.02 × 10.sup.−2 t.sup.6A 492.1005 NA NA 1.34 × 10.sup.−1 yW 588.1580 2.50 × 10.sup.−7 1.20 × 10.sup.−9 1.84 × 10.sup.−1 .sup.1Full names available at world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. .sup.2The concentration of each PTM in the extract was calculated from the respective curve afforded by the standard-additions determination. This amount accounts also for the ~25% recovery estimated from the standard tRNA.sup.Phe added to each sample. NA indicates PTMs that could not be determined due to their absence in the standard tRNA.sup.phe. .sup.3The amount of each PTM per gram of wet pellet was calculated from the respective extract concentration by taking in account the initial weight of intact S. cerevisiae material. .sup.4For each PTM, the value of abundance versus proxy (AvP) was calculated from the respective signal intensity as percentage of the sum of the intensities of the four canonic ribonucleotides (see Examples). Each value was the average of five repeat analyses. This amount represents a relative measure of the abundance of each PTM in the sample, which can be always calculated across the board in the absence of PTM standards (see Examples).
(126) TABLE-US-00003 TABLE 3 Reproducibility of ESI-MS analysis of total RNA extract from S. cerevisiae grown in YPD medium. Technical Biological reproducibility.sup.2 reproducibility.sup.3 Exp. AvP AvP mass Ave. RSD Ave RSD Hit.sup.1 (u) AvP % AvP % C 323.0519 28.7 ±5.0 29.1 ±4.9 Y, U 324.0359 22.0 ±4.1 22.1 ±9.1 D 326.0515 2.95 ±3.7 1.18 ±14 m.sup.3C, m.sup.5C, 337.0675 2.45 × 10.sup.−1 ±5.5 7.04 × 10.sup.−1 ±7.5 Cm, m.sup.4C m.sup.3Y, Um, 338.0515 1.03 ±3.6 7.28 × 10.sup.−1 ±5.5 m.sup.5U, m.sup.1Y, Ym, m.sup.3U A 347.0631 21.6 ±4.7 21.3 ±6.6 I 348.0471 1.44 × 10.sup.−1 ±3.8 7.31 × 10.sup.−2 ±6.1 m.sup.1A, m.sup.2A, 361.0787 1.02 × 10.sup.−1 ±6.9 4.53 × 10.sup.−1 ±11 m.sup.6A, m.sup.8A, Am G 363.0580 27.7 ±2.6 27.4 ±2.2 ac.sup.4C, f.sup.5Cm 365.0623 4.75 × 10.sup.−1 ±2.2 4.87 × 10.sup.−1 ±2.9 m.sup.6Am, 375.0942 5.01 × 10.sup.−3 ±9.9 5.15 × 10.sup.−2 ±11 m.sup.1Am, m.sup.6.sub.2A m.sup.1G, m.sup.2G, 377.0762 1.02 ±2.5 7.52 × 10.sup.−1 ±4.8 m.sup.7G, Gm ac.sup.4Cm 379.0762 6.85 × 10.sup.−3 ±4.0 7.34 × 10.sup.−3 ±5.4 ncm.sup.5U 381.0572 3.37 × 10.sup.−2 ±6.3 2.76 × 10.sup.−2 ±13 m.sup.1Gm, 391.0893 6.26 × 10.sup.−1 ±4.9 2.25 × 10.sup.−1 ±9.9 m.sup.2.sub.2G, preQ1, m.sup.2.sub.7G cmnm.sup.5s.sup.2U 427.0429 1.02 × 10.sup.−1 ±1.2 4.62 × 10.sup.−3 ±6.5 t.sup.6A 492.1005 1.34 × 10.sup.−1 ±6.5 5.89 × 10.sup.−2 ±8.9 yW 588.1580 1.84 × 10.sup.−1 ±1.3 1.86 × 10.sup.−2 ±9.7 Ave. Ave. ±4.4% ±7.8% .sup.1Full names available at world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. .sup.2Assessed by applying the proposed workflow to five separate aliquots of the same S. cerevisiae pellet. For each PTM, abundance versus proxy (AvP) was calculated from the respective signal intensity as percentage of the sum of the intensities of the four canonic ribonucleotides (see Examples). Average and relative standard deviation (RSD %) are reported. .sup.3Assessed from five different samples of S. cerevisiae grown under identical conditions in separate YPD cultures.
(127) TABLE-US-00004 TABLE 4 Hits provided by a total RNA extract from S. cerevisiae grown in synthetic complete medium (SC). Exp. mass Exp. Rel. dev. Hit.sup.1 (u) AvP.sup.2 (%).sup.3 C 323.0519 21.5 +28.8 Y, U 324.0359 25.7 −15.4 D 326.0515 2.62 +11.9 m.sup.3C, m.sup.5C, Cm, m.sup.4C 337.0675 1.13 −129 m.sup.3Y, Um, m.sup.5U, m.sup.1Y, Ym, m.sup.3U 338.0515 1.24 −18.4 ho.sup.5U 340.0308 9.94 × 10.sup.−2 NA A 347.0631 23.7 −9.20 I 348.0471 1.42 × 10.sup.−1 +1.61 m.sup.1A, m.sup.2A, m.sup.6A, Am 361.0787 4.78 × 10.sup.−1 −130 m.sup.1I, Im 362.0628 2.52 × 10.sup.−2 NA G 363.0580 29.1 −5.13 ac.sup.4C, f.sup.5Cm 365.0624 5.72 × 10.sup.−1 −18.6 m.sup.6Am, m.sup.1Am, m.sup.6.sub.2A 375.0944 3.53 × 10.sup.−2 −150 m.sup.1G, m.sup.2G, m.sup.7G, Gm 377.0737 1.32 −25.3 ac.sup.4Cm 379.0781 1.75 × 10.sup.−2 −87.4 ncm.sup.5U 381.0573 9.02 × 10.sup.−2 −91.2 m.sup.1Gm, m.sup.2.sub.2G, preQ1, m.sup.2.sub.7G 391.0892 4.85 × 10.sup.−1 +25.4 ncm.sup.5Um 395.0730 2.33 × 10.sup.−2 NA mcm.sup.5U 396.0570 6.24 × 10.sup.−2 NA mcm.sup.5s.sup.2U 412.0342 6.37 × 10.sup.−2 NA i.sup.6A 415.1257 1.54 × 10.sup.−1 NA t.sup.6A 492.1006 1.49 × 10.sup.−1 −10.7 Ar(p) 559.0717 9.71 × 10.sup.−3 NA yW 588.15811 4.20 × 10.sup.−2 +126 .sup.1Full names available at world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. .sup.2Abundance versus proxy (AvP) calculated from the respective signal intensity as percentage of the sum of the intensities of the four canonic ribonucleotides (see Examples). Each value was the average of five repeat analyses. .sup.3Relative deviations between AvPs obtained from S. cerevisiae grown in YPD and SC under otherwise identical conditions. NA indicates deviations that could not be calculated due to the absence of the corresponding species in the YPD samples.
(128) TABLE-US-00005 TABLE 4A Exemplary names and structures of RNA having modifications identified in a total RNA extract fromS. cerevisiae grown in synthetic complete medium (SC) as identified in Table 4. Structures from world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. Names (common) Structure(s), respectively Hit (X- Not in database) (X- Not in database) C cytidine
(129) TABLE-US-00006 TABLE 1S Figures of merit obtained from the analysis of isolated tRNA.sup.Phe from S. cerevisiae (FIG. 8). The abbreviation for each ribonucleotide is provided together with the corresponding monoisotopic neutral mass in mass units (u) and the number of equivalents present in each mole of initial tRNA.sup.Phe. .sup.3Theo- .sup.3Experi- Exp. .sup.1Detection retical mental mass Equivalent limit .sup.2Response AvP AvP Species (u) per mole (mol) (m, q) (%) (%) C 323.0519 15 3.44 × 10.sup.−17 1.61 × 10.sup.11, 24.7 24.6 5.01 U/Ψ 323.0279 14 2.68 × 10.sup.−17 1.53 × 10.sup.11, 21.9 21.6 2.03 × 10.sup.1 D 326.0514 2 1.80 × 10.sup.−17 1.82 × 10.sup.11, 3.73 3.75 3.01 × 10.sup.1 m.sup.3C, 337.0674 3 5.50 × 10.sup.−17 1.41 × 10.sup.11, 4.33 4.34 m.sup.5C, Cm 8.00 × 10.sup.1 A 347.0630 17 9.58 × 10.sup.−17 1.31 × 10.sup.11, 22.8 22.1 9.20 m.sup.1A 361.0787 1 9.29 × 10.sup.−17 3.52 × 10.sup.10, 3.60 × 10.sup.−1 3.75 × 10.sup.−1 3.03 × 10.sup.1 G 363.0579 18 1.55 × 10.sup.−17 1.71 × 10.sup.11, 31.5 31.7 3.78 × 10.sup.1 m.sup.2G, Gm 377.0718 3 5.29 × 10.sup.−18 1.24 × 10.sup.11, 3.81 3.61 5.88 × 10.sup.1 m.sup.2.sub.2G 391.0892 1 2.44 × 10.sup.−17 1.71 × 10.sup.11, 1.75 1.60 2.07 × 10.sup.1 yW 588.1571 1 4.14 × 10.sup.−17 1.10 × 10.sup.11, 1.13 1.16 1.71 × 10.sup.1 .sup.1The limit of detection (LOD) was obtained by calculating the moles of each ribonucleotide, which provided at least a 3:1 signal to noise ratio. The results are the average of five repeat determinations. The calculation accounted for an average of ~0.093 uL sample consumption during ESI-MS analysis and a ~25% sample recovery for the entire work flow (see Examples). .sup.2The response for each ribonucleotide was calculated by averaging the signals of five repeat determinations for samples with decreasing concentration of tRNA.sup.Phe. Each signal average was plotted against the respective concentration to obtain signal/concentration curves with the indicated slopes (m in counts/M) and intercepts (q in counts). .sup.3For each ribonucleotide, the value of abundance versus proxy (AvP) was calculated by dividing the respective intensity by the sum of the intensities of the four canonic ribonucleotides (see Examples). The experimental AvP was calculated directly from the ESI-MS data. The theoretical value was obtained from the intensity that would be expected from the analysis of exactly 1M of tRNA.sup.Phe, which was calculated by substituting the equivalents per mole of each species into the respective response curve. The excellent match between theoretical and experimental justifies the utilization of AvP to monitor fluctuations of PTM expression (see Examples).
(130) TABLE-US-00007 TABLE 2S Hits provided by a total RNA extract from E. coli grown in synthetic complete medium (SC). Exp. Average mass AvP Deviation Hit (u) (%) (%).sup.1 C 323.0519 21.4 +2.40 × 10.sup.−1 Y, U 324.0357 22.1 −15.0 D 326.0510 2.27 × 10.sup.−1 +1.68 × 10.sup.2.sub. m.sup.3C, m.sup.5C, Cm, m.sup.4C 337.0673 8.08 × 10.sup.−2 173 m.sup.3Y, Um, m.sup.5U, m.sup.1Y, Ym, 338.0513 2.44 × 10.sup.−1 134 m.sup.3U A 347.0628 25.7 −7.95 I 348.0468 3.54 × 10.sup.−3 190 m.sup.5Cm, m.sup.4Cm, m.sup.4.sub.4C 351.0830 1.31 × 10.sup.−2 NA mo.sup.5U 354.0463 3.53 × 10.sup.−3 NA G 363.0575 30.8 −5.61 ac.sup.4C, f.sup.5Cm 365.0617 4.95 × 10.sup.−1 14.3 mnm.sup.5U 367.0776 2.86 × 10.sup.−3 NA m.sup.1G, m.sup.2G, m.sup.7G, Gm 377.0720 2.26 × 10.sup.−1 141 cmo.sup.5U, chm.sup.5U 398.0362 1.58 × 10.sup.−1 NA .sup.1Deviation from the average AvP obtained for the same PTM in S. cerevisiae grown in SC under identical conditions.
Example VIII
(131) This Example Describes Comprehensive Ribonucleotide Modification Maps as Tracking Tools for the Multistage Processes Involved in Cell Transformation from Normalcy to Malignancy.
(132) The systematic exploration of the interactome is typically supported by genomics and proteomics approaches that focus on nucleic acids and protein components. However, other cellular components traditionally viewed as products or intermediates of specific pathways can participate in regulatory mechanisms by influencing the interactome. For example, RNA is involved in protein synthesis and gene regulation, but its ability to undergo extensive post-transcriptional modification provides new opportunities for enzyme-based pathways to feedback at the mRNA-translation level to regulate protein expression. Therefore, an MS-based strategy to was developed to obtain comprehensive maps of RNA modifications, which were then used to explore the complex signaling pathways responsible for the multistage processes that take cells from normalcy to malignancy.
(133) A. Methods.
(134) RNA samples were obtained by phenol-chloroform extraction of E. coli MG1655 and S. cerevisiae 2998. When appropriate, aliquots of S. cerevisiae tRNA.sup.phe (Sigma-Aldrich) were introduced into the lysate as an internal standard. Additionally, S. cerevisiae BY1473 and the TRM and LHP1P knockdowns were obtained from Thermo Scientific. The starting material was hydrolyzed to mononucleotide mixtures by digestion with specific nucleases. Sample solutions were diluted to final concentrations of ˜3 μM total ribonucleotides (NMPs) in 100 mM ammonium acetate and 10% 2-propanol.
(135) Direct infusion nanospray analyses were performed either on a Thermo Scientific LTQ-Orbitrap Velos, or a Waters Synapt G2 HDMS mass spectrometer. High-resolution determinations and MS.sup.n were completed on the former by using an automated procedure. Ion mobility determinations and time aligned parallel (TAP) fragmentation were completed on the latter. Data interpretation employed Waters Driftscope software. (see
(136) B. Results.
(137) Data of each E. coli extract was collected in negative mode from m/z 300-700. Typical experimental masses of canonical ribonucleotides exhibited an average of ˜800 ppb deviation from their calculated theoretical values. Reduced data from each extract was searched against a non-redundant database compiled by combining data from the RNA Modifications and Modomics Databases. A total of 36 hits were consistently obtained and subjected to fragmentation to confirm analyte structure by observing the characteristic cleavage of the N-glycosidic bond found in each ribonucleotide. Discrimination of isobaric species was achieved by employing MS.sup.n and IMS-MS experiments on each isobaric mixture.
(138) Repeat analyses of an accurately known amount of naturally modified tRNA.sup.phe that was subjected to the entire workflow resulted in a sample recovery of ˜25%. Cellular expression levels of RNA modifications were monitored quantitatively through the standard additions method by introducing incremental amounts of tRNA.sup.phe to the lysed material. Table A provides exemplary LOD and signal response information while Table AA shows exemplary structures including at least one new RNA modification found in E. coli.Tables B-D provide additional exemplary results of this analysis.
(139) In order to obtain a convenient but rigorous way to compare relative abundances between samples, the abundance versus proxy (AvP) was calculated for each hit by dividing the respective intensity by the sum of the intensities of the four canonical ribonucleotides. The validity of this quantity was supported by the excellent match between experimental and theoretical values calculated for 1 M of tRNA.sup.phe, knowing its normal content of RNA modifications. This quantity was then utilized to assess the technical and biological reproducibility of the proposed workflow, which amounted to ±9.4% and ±22% RSD %, respectively.
(140) 1. Comparison of Modified RNA Structure Profiles Between E. coli and S. cerevisiae.
(141) Based on these results, we tested the ability of this method to differentiate different organisms altogether. In one exemplary experiment, direct comparison between profiles afforded by E. coli and S. cerevisiae grown in the same type of medium lead to the identification of 26 common hits and 10 and 13 unique hits, respectively. Use of this platform has enabled discrimination of varying microorganisms by cellular type as well as metabolic state with a reproducibility of ±1.71% RSD. In one exemplary experiment, maps obtained from E. coli and S. cerevisiae were compared, 26 modifications were common, whereas 14 and 17 were unique for each. As shown in
(142) Interactome analysis is typically supported by genomics and proteomics approaches focused on gene and protein activities. However, cellular components traditionally viewed as products or intermediates of specific pathways can participate in regulatory mechanisms. For example, RNA is involved in protein synthesis and gene regulation and, at the same time, may undergo extensive post-transcriptional modification. This feature provides the opportunity for enzyme-based pathways to feedback at the mRNA level to regulate protein expression.
(143) 2. Comparison of Modified RNA Structure Profiles Between Benign and Malignant Samples of Biopsy Tissues.
(144) Thus, comprehensive maps were obtained in similar fashion from human prostate, and benign prostate areas, breast, lung and uterus tissues from different individuals showing tissue-specific features that were reproducible across donors. For an example, see prostate information in
(145) Additionally, a direct comparison between normal and malignant prostate samples revealed at least 13 common modifications with at least 1 and 6 unique modifications, respectively, which indicated the potential for correlations between malignancy and variations of modification biogenesis. Thus, in one embodiment, at least two uniquely modified RNA nucleotides in a prostate biopsy sample, (as compared to a biopsy sample from a normal area of prostate) correlates with the development of a malignant cancer.
(146) 3. Comparison of Modified RNA Structure Profiles that are Up-Regulated and/or Down Regulated Between Organisms Having Altered Gene Expression.
(147) Even further, this information indicated that modified RNA molecules might correlate with changes in gene expression pathways involved with the development of cancer cells and tissues. Therefore, the following describes utilizing these types of modification profiles as starting points for identification of corresponding pathways that may be up- or down-regulated. In order to test for malignancy and variations of modification biogenesis associated with changes in PTM profiles, an exemplary gene associated with certain prostate cancers known to cause downstream expression of RNA modifications common to those mapped in the malignant prostate tissue samples was used (
(148) In summary, these methods are contemplated for use in providing results that may be new avenues for use in providing additional diagnostic tools in medicine. 1. Johansson, M. & Bystrom, A.: Dual function of the tRNA(m(5)U54)methyltransferase in tRNA maturation. RNA 8, 324-335 (2002). 2. Copela, L. A., Chakshusmathi, G., Sherrer, R. L., & Wolin, S.A.: The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. RNA12, 644-654 (2006). 3. Rylova, S. N., Amalfitano, A., et al.: The CLN3 Gene is a Novel Molecular Target for Cancer Drug Discovery. Cancer Research 62, 801-808 (2002).
Example IX
(149) This example relates to using methods of the present inventions for identifying virus-infected cells. The following describes investigating post-transcriptional modifications of host cell RNA and viral RNA by affinity capture and MS analysis. Further, this example relates to RNA viruses, which mutate rapidly and are difficult to control, which pose major health concerns. Therefore, these methods are contemplated to be further useful for analyzing the status of infection of RNA viruses.
(150) The development of effective therapeutic strategies for HIV and other retroviruses is challenging in part because the viral genomic RNA integrates as DNA within the host's genome where it serves as a template for expressing new genomic RNA and viral mRNA. Additional challenges include that established techniques for RNA analysis, such as RT-PCR, use hybridization and amplification procedures that cannot “copy” covalent PTMs present on the original strand. In other words, established techniques for RNA analysis cannot replicate covalent PTMs present in nucleotides expressed by the original RNA nucleotide strand.
(151) In contrast, mass spectrometry is capable of identifying the native PTMs, individually or as part of RNA strands, isolated directly from cells based upon their characteristic mass signature and fragmentation properties. Thus, methods of DNA-probe hybridization were developed and used to capture different types of viral RNAs for mass spectrometric (MS) analysis of post-transcriptional modifications (PTMs). While cellular RNA is extensively decorated with covalent modifications by post-transcriptional processes, little is known about possible modifications of viral RNA before integration or packaging into new infectious particles. Therefore, methods for identifying host genomic RNA, then viral RNA, or combinations thereof, is contemplated to lead to new strategies for selectively targeting viral RNA and thus new therapeutics. Developing an approach based on affinity purification to isolate viral RNA from overwhelming quantities of cellular RNA is contemplated to enable the MS analysis of ribonucleotide modifications at the whole genome level.
(152) Complementary probes were designed during the development of the present inventions that target highly conserved regions of viral RNA, such as their 5′-untranslated region (5′-UTR) to circumvent the possible sequence variability associated with ability of RNA viruses to mutate rapidly. An E. coli strain expressing a 5′UTR of HIV-1, a HeLa cell expressing virus, and a yeast strain containing the virus-like particle (LA virus) was selected as model systems to develop a strategy based on affinity capture by antisense oligodeoxynucleotides (ODNs). Paramagnetic beads were derivatized with ODNs complementary to the infrequently mutating 5′-untranslated region. The amount of beads was scaled up to obtain sufficient amounts of viral RNA, which was estimated to contain 2.6 nmol of ODNs.
(153) A. Methods.
(154) The development of each step of the proposed workflow was supported by MS determinations performed on a Bruker solariX Fourier transform ion cyclotron resonance (FTICR) mass spectrometer equipped with a 12T superconducting magnet; a Thermo Scientific LTQ-Orbitrap Velos instrument; or a Waters Synapt G2 HDMS ion mobility spectrometry mass spectrometer (IMS-MS). Analyses were accomplished by nanoflow electrospray ionization in negative ion mode. Typical samples were desalted by buffer-exchange against 150 mM ammonium acetate by using Millipore Microcon ultrafiltration devices. Samples were diluted to a final 1-μM concentration and added with 10% isopropanol immediately before analysis. Detection of RNA modifications was carried out by first treating the desired RNA sample with specific nucleases to digest it into individual mononucleotide components.
(155) B. Results.
(156) Initially the utilization of antisense oligonucleotides that were labeled with a biotin group at the 5′-end to enable immobilization onto streptavidin-coated beads. When a test sample was applied to the derivatized beads, followed by salt washes and final thermal elution, the fraction of interest was found to contain both target and antisense oligonucleotides (see,
(157) During the development of the present inventions the following steps were taken in order to determine a method for affinity capture RNA for MS analysis: a) Test different strategies to prepare affinity capture media based on specific target-antisense interactions; b) Develop strategies to guide the selection of antisense oligonucleotides with the ability to capture viral RNA in total cell lysates; c) Evaluate different technologies to verify the purity of captured genomic RNA; d) Apply the above approaches to perform actual analysis of RNA modifications in viral RNA. Several examples of affinity capture media are shown in
(158) Therefore, appropriately designed sets of affinity media were then employed to purify genomic RNA from isolated HIV-1 virions, poliovirus, hepatitis C virus, and S. cerevisiae L-A virus. These experiments afforded mixed results that highlighted the challenge of identifying the best possible regions of viral RNA to be targeted by the capture interactions. Computational tools that consider the presence of possible secondary structures and the putative stability of antisense annealing are typically employed to guide the selection process. For example, sfolds, see
(159) 1. E. coli Expressing Virus.
(160) Similar methods were used for isolating RNA structures from E. coli expressing virus, (i.e. a recombinant HIV-1 5′UTR).
(161) In addition to the results shown in
(162) 2. HeLa Cells and Virus Expressing HeLa Cells.
(163) Additionally (and concurrently with viral RNA studies described herein), studies were performed on HeLa cells to examine RNA modification content in total RNA versus isolated mRNA. Isolation of mRNA was performed using affinity capture techniques designed to target the poly A tail found common in mRNA species, see an exemplary overview of this method in
(164) Therefore, these approaches were further applied to HeLa cells to initially compare modification content in total RNA versus isolated mRNA. The latter was isolated from the initial material by affinity capture techniques targeting the poly-A tail common to mRNA molecules. Gel electrophoresis and reverse transcription polymerase chain reaction (RT-PCR) were applied to assess the success of the capture. Hits observed by searching data obtained from HeLa cells isolated mRNA against the non-redundant database generated in house (i.e. at the University of Albany by combining data from the RNA Modifications and Modomics Databases).
(165) Profiles of virally infected cells were compared to uninfected cells, see,
(166) Thus, MS approaches allow for quantification of RNA modifications in both total RNA and isolated mRNA. 1. Rose, R. E., Giza, J., Fabris, D. Comprehensive ribonucleotide modification maps as possible tracking tools for the multistage processes involved in cell transformation from normalcy to malignancy (ASMS, 2014).
(167) 3. Yeast Expressing Virus.
(168) Therefore in order to begin determining whether MS analysis of ribonucleotide modifications at the whole genome level would provide information on targeting viral RNA, total RNA from S. cerevisiae (2 strains) was isolated using a classic phenol/chloroform extraction and digested to mononucleotides using a cocktail of specific nucleases.
(169) a. S. cerevisiae w303 Strain.
(170) An additional capture method, using the w303 yeast strain containing the LA virus as a model system, a strategy to isolate viral RNA was developed based on the hybridization of antisense DNA probes immobilized on magnetic beads. Paramagnetic beads were derivatized with antisense oligodeoxynucleotides (ODNs) to target viral RNA within the total RNA of w303. The region targeted by the ODNs was the infrequently mutating 5′ untranslated region of the LA virus. This region is known to be conserved, making it ideal within a sequence of highly mutable ribonucleotides. A capture system prepared as described above was then employed to isolate the RNA of L-A virus-like-particles (VLP's) from total lysates of w303 yeast. In this case, both MS and gel electrophoresis were employed to analyze the elution fraction for the possible presence of extraneous RNA species. Upon digestion with ribonucleases, MS analysis revealed the presence of up to 23 RNA modifications that were assigned with the aid of database searching.
(171) Analysis of LA virus RNA revealed the presence of nine PTMs which have a modification that was not previously reported on this RNA. In comparison, analogous analysis total RNA extracts from non-infected yeast displayed up to 40 modifications. Of these, 12 hits were in common with those observed in the L-A VLP's, thus supporting the hypothesis that viral RNA may be differentially modified. Through MS analysis, 30 PTMs were identified on isolated viral RNA, none of which were reported for this RNA. A total of 72 PTMs were observed on the total RNA of the w303 yeast strain as compared to uninfected yeast strains.
(172) Surprisingly, the same types of PTMs were detected in total RNA obtained from yeast strain BY4741 not containing LA virus and capable of expressing up to 41 PTMs′. This observation is consistent with the fact that enzymes responsible for PTM biogenesis are not necessarily viral proteins, but are instead encoded by host yeast genome. 1. Reyes-Darias, J., Sánchez-Luque, F., & Berzal-Herranz, A. (2012). HIV RNA dimerisation interference by antisense oligonucleotides targeted to the 5′ UTR structural elements. Virus Research, 169(1), 63-71. Retrieved Oct. 21, 2014. 2. Icho, Tateo, and Reed B. Widmer. “The Double-stranded RNA Genome of Yeast Virus L-A Encodes Its Own Putative RNA Polymerase by Fusing Two Open Reading Frame.” The Journal of Biological Chemistry264.April 25 (1989): 6716-723. Web. 3. Rose, R. E., Giza, J., Fabris, D. Comprehensive ribonucleotide modification maps as possible tracking tools for the multistage processes involved in cell transformation from normalcy to malignancy. (ASMS, 2014).
(173) b. S. cerevisiae BY4741 Strain.
(174) Uninfected yeast strain BY4741 has been shown to express up to 40 PTMs.sup.1, some of which were also observed in the w303 yeast strain, as well as isolated viral RNA. This observation is consistent with the fact that enzymes producing PTMs may not be solely encoded by the virus, but also by the host yeast genome. 1. Quinn, R., Basanta-Sanchez, M., Rose, R. E. & Fabris, D.: Direct infusion analysis of nucleotide mixtures of very similar or identical elemental composition. J. Mass Spectrom. 48, 703-12 (2013). 2. Holmberg, A., Blomstergren, A., Nord, O., Lukacs, M., Lundeberg, J., Uhlen, M.: The biotin-streptavidin interaction can be reversibly broken using water at elevated temperatures. Electrophoresis 26, 501.510 (2005). 3. Bischoff, R., Coull, J. M., Regnier, F. E.: Introduction of 5′-Terminal Functional Groups into Synthetic Oligonucleotides for Selective Immobilization. Analytical Biochem. 164, 336-344 (187).
Example X
(175) This Example Describes the Epitranscriptomics of Long Noncoding (Lnc)RNAs in S. cerevisiae, i.e. Changes in PTM RNA Structures Related to a Change in Growth Conditions and/or Gene Expression.
(176) Ribonucleic acids (RNA) are involved in a variety of regulatory processes that allow for functions of biological systems. RNA is related to gene expression such that certain RNA modifications have been found to be over or under expressed in cancerous tissues, making these modifications target for potential biomarkers (Koshida et al. 2011) in addition to their use in profiling a disease state. These modifications can be detected using MS and IMS-MS approaches that allow for the identification and differentiation of different isobaric species of RNA modifications.
(177) A. Introduction.
(178) Exposure of cells to external stimuli results in immediate adaptation through new regulatory responses affecting cellular memory to maximize survival or death. These responses result in wide ranges of anomalies caused by epigenetic events which have historically been characterized by DNA methylations, histone modifications and/or activities involving long noncoding ribonucleic acids (lncRNAs). It is now apparent that several RNA species are post-transcriptionally modified and, are responsible for structural and functional roles within the cell. For this reason, methods were developed using mass spectrometry to globally profile these RNA modifications in S. cerevisiae including to investigate the role of lncRNAs; known to cause disruption of early transcriptional processes, to discover relationships between known epigenetic events and related RNA processing pathways. In particular, S. cerevisiae were grown under different conditions, including under salt conditions for inducing hog1 expression,
(179) B. Methods.
(180) S. cerevisiae strains were grown in-house in either YPD (i.e. rich medium) or SC (synthetic complete) media at 30° C. and 37° C. Where applicable, strains were either induced with 0.4M NaCl or exposed to UV irradiation for 15 min. Total RNA was obtained by phenol-chloroform extraction. Extracts were hydrolyzed to mononucleotide mixtures by digestion with specific nucleases. Sample solutions were diluted to final concentrations of ˜3 μM total ribonucleotides in 150 mM ammonium acetate and 10% 2-propanol. Hydrolyzed ribonucleotide mixtures from whole-cell extracts were used in order to enable both characterization and quantification of all PTMs in the transcriptome. This approach involves initial assignment by database searching, followed by structure confirmation supported by gas-phase fragmentation data.
(181) Direct infusion nanospray analyses were performed either on a Thermo Scientific LTQ-Orbitrap Velos or a Waters Synapt G2 HDMS mass spectrometer. High-resolution determinations and MS.sup.n analyses were completed on the former utilizing automated procedures developed in-house. Ion mobility determinations and fragmentation were completed on the latter. Data interpretation employed OriginPro software. See exemplary methods,
(182) C. Preliminary Data.
(183) S. cerevisiae were grown under different conditions including high salt to induce expression of at least one different gene, then analyzed for differences in modified PTM RNA structures.
(184) 1. S. cerevisiae were Grown Under Different Media Conditions.
(185) High-resolution mass spectrometry and ion mobility spectrometry-mass spectrometry approaches have enabled detection of 40 ribonucleotide (PTM) modifications in whole-cell lysates of S. cerevisiae strain BY4741 (WT) with a biological reproducibility of ±7.8% relative standard deviation in rich media. At least eight of these structures were previously unreported for this microorganism. To assess the feasibility of the platform to monitor changes in growth conditions, S. cerevisiae was also grown in stringent media. In this case, a total of 49 modifications were detected whereas 8 were unique. Of the 41 common hits whose abundance swung outside the accepted biological deviation, 28 were overexpressed and 3 underexpressed in stringent media proving the ability to monitor and quantify single modification fluxes. 13 of the common PTMs that were previously unreported for this microorganism was likely due to the attention paid in the past to rRNA and tRNA analysis, whereas the comprehensive nature of this approach captured any type of PTM present in the total RNA extract. Therefore, this method identified additional PTM RNA structures over previous methods.
(186) 2. S. cerevisiae Induced to Express Hog1.
(187) In similar fashion, global surveys were examined to investigate correlations between epigenetic mechanisms governed by external stimuli and regulatory events involving lncRNAs. When samples of S. cerevisiae treated with high salt were analyzed, we found unique PTMs absent in untreated cells, as well as others that were up-/down-regulated. We identified PTMs whose induction, like that of a discrete set of −200 long non-coding RNAs (lncRNAs), is dependent on the stress-activated protein kinase Hog1, thus suggesting that PTMs may be involved in the activity of different classes of RNAs.
(188) Specifically, WT S. cerevisiae was treated with NaCl to induce the expression of hog1,
(189) TABLE-US-00008 TABLE A E. coli RNA structures “hits” obtained by searching raw data against an in house database (at the U Albany by combining data from the RNA Modifications and Modomics Databases) database. Experi- Mono- mental isotopic mass mass (Da) (Da) Hit 323.05210 323.05185 C.sup.‡ 324.03600 324.03587 Y.sup.‡, U.sup.‡ 326.05129 326.05152 D.sup.‡ 338.05163 338.05152 m3Y, Um.sup.‡, m5U, m1Y, Ym.sup.‡, m3U 347.06299 347.06308 A.sup.‡ 348.04709 348.04710 I.sup.‡ 351.08301 351.04677 m5Cm, m4Cm, m44C.sup.‡* 363.05768 363.05800 G.sup.‡ 365.06245 365.06242 ac4C.sup.‡*, f5Cm.sup.‡* 367.07800 367.07807 mnm5U.sup.‡ 375.09455 375.09438 m6Am, m1Am, m62A.sup.‡ 377.07342 377.07365 m1G.sup.‡, m2G.sup.‡, m7G.sup.‡, Gm.sup.‡ 379.07777 379.07807 ac4Cm.sup.‡ 398.03611 398.03626 cmo5U, chm5U 411.06762 411.06789 cmnm5U.sup.‡ 425.08330 425.08354 acp3U.sup.‡, cmnm5Um.sup.‡ 489.12579 489.12608 Q.sup.‡ 492.10031 492.10059 t6A.sup.‡ 506.11613 506.11624 m6t6A, hn6A .sup.‡Assignments corroborated by tandem MS determinations *Modifications that were not previously detected in E. coli
(190) TABLE-US-00009 TABLE AA E. coli RNA structures. X represents a structure not found in the referenced databases. Hit Names (common) Structure(s), respectively C.sup.‡ cytidine
(191) TABLE-US-00010 TABLE B Summary of RNA modification analysis in total RNA extract from E. coli. Exemplary structures (also termed “Figures”) of merit associated with this analysis: LOD and Signal Response. Mono- Theo- Experi- isotopic Detection retical mental mass Equivalent limit Response AvP AvP Name (Da) per mole (mol) (m, q) (%) (%) C 322.0441 15 3.44 × 10.sup.−17 1.6 × 10.sup.11, 24.5 24.5 5.0 × 10.sup.0 U/Ψ 323.0279 14 2.68 × 10.sup.−17 1.5 × 10.sup.11, 21.9 21.9 2.0 × 10.sup.1 D 325.0437 2 1.80 × 10.sup.−17 1.8 × 10.sup.11, 3.6 3.5 3.0 × 10.sup.1 m3C, 336.0597 3 5.50 × 10.sup.−17 1.4 × 10.sup.11, 4.3 4.3 m5C, Cm 8.0 × 10.sup.1 A 346.0552 17 9.58 × 10.sup.−17 1.3 × 10.sup.11, 23.2 23.1 9.2 × 10.sup.0 m1A 360.0709 1 9.29 × 10.sup.−17 3.5 × 10.sup.10, 1.1 0.9 3.0 × 10.sup.1 G 362.0501 18 1.55 × 10.sup.−17 1.7 × 10.sup.11, 30.4 30.5 3.7 × 10.sup.1 m2G, Gm 376.0658 3 5.29 × 10.sup.−18 1.2 × 10.sup.11, 3.6 3.4 5.8 × 10.sup.1 m22G 390.0813 1 2.44 × 10.sup.−17 1.7 × 10.sup.11, 1.7 1.6 2.0 × 10.sup.1 yW 587.1501 1 4.14 × 10.sup.−17 1.1 × 10.sup.11, 1.1 1.0 1.7 × 10.sup.1 *Recovery of tRNA phe monitored by UV absorption was ~25% *LOD obtained by calculating moles of each NMP which provided at least a 3:1 S/N at a consumption of ~0.093 μL. *Response was calculated by plotting signal average against concentration to obtain curves with m in counts/M and q in counts *AvP was calculated by dividing intensity by the sum of the intensities of the canonical NMPs *Experimental AvP calculated directly from the ESI-MS data *Theoretical AvP obtained from the intensity of exactly 1M of tRNA Phe and calculated by substituting equivalents per mole into the response curve.
(192) TABLE-US-00011 TABLE C Absolute Quantification. Mono Experi- isotopic Concen- mental mass tration Amount AvP Name (Da) (M) (mol/g) (%) C 323.05185 2.12 × 10.sup.−7 1.33 × 10.sup.−9 26.88 Y, U 324.03587 1.66 × 10.sup.−7 1.04 × 10.sup.−9 19.45 D 326.05152 1.16 × 10.sup.−8 .sup. 7.28 × 10.sup.−11 1.68 m3Y, Um, 338.05152 — — 1.05 m5U, m1Y, Ym, m3U A 347.06308 2.14 × 10.sup.−7 1.34 × 10.sup.−9 21.69 I 348.04710 — — 0.04 m5Cm, m4Cm, 351.08315 — — 0.03 m44C G 363.05800 2.27 × 10.sup.−7 1.42 × 10.sup.−9 31.98 ac4C, f5Cm 365.06242 — — 0.52 mnm5U 367.07807 — — 0.28 m6Am, m1Am, 375.09438 — — 0.02 m62A m1G, m2G, 377.07365 1.06 × 10.sup.−8 .sup. 6.64 × 10.sup.−11 0.95 m7G, Gm ac4Cm 379.07807 — — 0.04 cmo5U, 398.03626 — — 0.16 chm5U cmnm5U 411.06789 — — 0.01 acp3U, 425.08354 — — 0.16 cmnm5Um Q 489.12608 — — 0.66 t6A 492.10059 — — 0.59 m6t6A, 506.11624 — — 0.09 hn6A *Determination of NMPs present in total RNA extract from E. coli. *The addition of accurately known amounts of S. cerevisiae tRNA Phe enabled an absolute quantitative determination by following the method of the standard additions
(193) TABLE-US-00012 TABLE D Reproducibility. Canonical Bases (% RSD) E. Coli S. cerevisiae LB SC GMM YPD SC Tech ±2.65 ±2.59 ±2.37 ±3.38 ±2.64 Bio ±3.29 ±6.28 ±3.40 ±3.26 ±2.83 Total Modifications (% RSD) E. coli S. cerevisiae LB SC GMM YPD SC Tech ±9.44 ±3.58 ±8.47 ±4.99 ±9.82 Bio ±22.2 ±22.46 ±16.8 ±5.53 ±13.08 *Technical reproducibility: five repeat analysis of the same biological sample. * Biological reproducibility: five separate biological samples (i.e., different growths). *Reproducibility was monitored across varying microorganisms and media to fully assess the capabilities of the platform.
(194) TABLE-US-00013 TABLE E Computational tools such as sFold produce tens of thousands of hits. Filtering possible targets by GC content, sequence length, and binding energy provided >1,000 viable probes for the 5′-UTR of poliovirus. binding Sequence GC energy position Target sequence Antisense probe content (kcal/mol) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . SEQ ID NOS: 2, 3 108-132 AGACGCACAAAACCAAGUUCAAUAG CTATTGAACTTGGTTTTGTGCGTCT 40.00% −16.2 SEQ ID NOS: 4, 5 109-133 GACGCACAAAACCAAGUUCAAUAGA TCTATTGAACTTGGTTTTGTGCGTC 40.00% −15.5 SEQ ID NOS: 6, 7 105-129 CUUAGACGCACAAAACCAAGUUCAA TTGAACTTGGTTTTGTGCGTCTAAG 40.00% −14.9 SEQ ID NOS: 8, 9 101-125 GUAACUUAGACGCACAAAACCAAGU ACTTGGTTTTGTGCGTCTAAGTTAC 40.00% −14.2 SEQ ID NOS: 10, 11 104-128 ACUUAGACGCACAAAACCAAGUUCA TGAACTTGGTTTTGTGCGTCTAAGT 40.00% −14.2 SEQ ID NOS: 12, 13 103-127 AACUUAGACGCACAAAACCAAGUUC GAACTTGGTTTTGTGCGTCTAAGTT 40.00% −13.7 SEQ ID NOS: 14, 15 102-121 UAACUUAGACGCACAAAACC GGTTTTGTGCGTCTAAGTTA 40.00% −13.6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
(195) TABLE-US-00014 TABLE F W303 strain of S. cerevisiae with LA virus. Mono- isotopic mass Total RNA (Da) Modification BY4741 (w303) Captured RNA 323.0518509 C 28.6897 17.10844703 14.3068139 324.0358664 Y, U 22.0071 22.68117951 16.4082196 326.0515165 D 2.95185 0.242827734 0.03969875 337.0675009 m3C, m5c, Cm m4C 0.24501 0.04172404 0.02371869 338.0515165 Um, m5U, m1Y, Ym, 1.03044 0.70030307 0.14116665 m3U, m3Y 340.0307811 hoSU 1.861016805 340.0671666 m5D 0.199075464 347.0630843 A 21.6258 26.98758691 42.3932503 348.0470998 I 0.14405 0.074473048 351.0467655 f5C 0.025845435 351.083151 m5Cm, m4Cm, m44C 0.017545894 0.01631697 352.0307811 f5U 1.52901622 353.0624155 hm5C, nm5U, s2Um 0.07431334 0.0278083 354.0464311 mo5U 0.465418505 361.0787343 m1A, m2A, A, Am, m8Am 0.10186 0.086536289 362.0627499 m1I, Im 0.009356357 363.0579989 G 27.6773 33.22278654 26.8917161 364.0420145 X 0.079187778 365.0624155 ac4C, f5Cm 0.47447 0.563964615 0.37881489 366.0464311 f5Um 0.040026878 367.0780656 mnm5U 0.064362474 369.0395716 nm5s2U 0.011154386 375.0943844 m5Am, m1Am, m62A 0.00501 0.049270419 376.0784 m1Im 0.014828818 377.0736489 m1G, m2G, Gm 1.02117 0.333555441 379.0780656 ac4Cm 0.00685 0.005040526 381.0573302 ncm5U 0.03373 0.24798213 382.0413458 cm5U 0.150752208 383.0552217 mnm5s2U 0.007783258 389.0736489 ac6A 0.13312548 391.089299 m1Gm, m22G, m2Gm, 0.62563 0.184991373 0.17409085 preQ1, “m2, 7G” 395.0729802 ncm5Um 0.012101901 396.0569958 mcm5U 0.050911349 398.0362604 cmo5U, chm5U 0.26312128 404.084548 G+ 0.005922319 405.1049491 m22Gm, “m2, 2, 0.002464382 7G”, “m2, 7Gm” 411.0678949 cmnm5U 0.038101975 412.0519104 mcmo5U, mchm5U 0.068860358 427.0450509 cmnm.sup.5s.sup.2U 0.01016 492.100592 t.sup.6A 0.13385 495.868906 f5se2U 0.001166759 559.0716734 Ar(p) 0.06270116 575.066588 Gr(p) 0.217770255 588.1581068 yW 0.1837
(196) TABLE-US-00015 TABLE G Exemplary names and structures of RNA having modifications identified in yeast having knockdown genes associated with prostate cancer see FIG. K for percentage difference as up regulated (+ or no sign in front of number) and down regulated (− in front of number) or (—) as no change. Structures from world wide web://mods.rna.albany.edu/ Hosted by The RNA Institute, College of Arts and Sciences, State University of New York at Albany and world wide web://modomics.genesilico.pl/. TRM1 LHP1P Structure name Names (common) Structure(s), respectively (% difference) (% difference) C cytidine
(197) TABLE-US-00016 TABLE H Global Profiling. Hits observed by searching data obtained from S. cerevisiae against a non-redundant database generated by combining data from the RNA Modifications and Modomics Databases. Experi- Mono- mental isotopic mass mass (Da) (Da) Hit 323.052 323.052 C.sup.‡ 324.036 324.036 Y.sup.‡, U.sup.‡ 326.052 326.052 D.sup.‡ 337.068 337.068 m.sup.3C, m.sup.5C, Cm.sup.‡, m.sup.4C* 338.052 338.052 m.sup.3Y*, Um.sup.‡, m.sup.5U, m.sup.1Y, Ym.sup.‡*, m.sup.3U 347.063 347.063 A.sup.‡ 348.047 348.047 I.sup.‡ 361.079 361.079 m.sup.1A, m.sup.2A*, m.sup.6A, m.sup.8A*, Am.sup.‡ 363.058 363.058 G.sup.‡ 365.062 365.062 ac.sup.4C.sup.‡*, f.sup.5Cm.sup.‡* 375.094 375.094 m.sup.6Am*, m.sup.1Am*, m.sup.6.sub.2A.sup.‡* 377.076 377.074 m.sup.1G.sup.‡, m.sup.2G.sup.‡, m.sup.7G.sup.‡, Gm.sup.‡ 379.076 379.078 ac.sup.4Cm.sup.‡* 381.057 381.057 ncm.sup.5U* 391.089 391.089 m.sup.1Gm*, m.sup.2.sub.2G, m.sup.3Gm, preQ1*, m.sup.2.sub.7G 427.043 427.045 cmnm.sup.5s.sup.2U 492.101 492.101 t.sup.6A.sup.‡ 588.158 588.158 yW.sup.‡ .sup.‡Assignments corroborated by tandem mass spectrometry determinations. *Modifications that were not previously detected in S. cerevisiae.
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in biochemistry, chemistry, microbiology, molecular biology, and medicine, or related fields are intended to be within the scope of the following claims.