Early and non invasive method for assessing a subject's risk of having pancreatic ductal adenocarcinoma and methods of treatment of such disease
11740243 · 2023-08-29
Assignee
- INSERM (Institut National de la Santé et de la Recherche Médicale) (Paris, FR)
- Centre National De La Recherche Scientifique (Cnrs) (Paris, FR)
- UNIVERSITÉ CLAUDE BERNARD—LYON (Villeurbanne, FR)
- CENTRE LEON BERARD (Lyons, FR)
- KIST (KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY) (Seoul, KR)
Inventors
Cpc classification
A61P1/00
HUMAN NECESSITIES
A61P1/18
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
G01N31/00
PHYSICS
G01N33/53
PHYSICS
Abstract
A non invasive diagnostic method of pancreatic ductal adenocarcinoma (PDAC) in a subject is provided. The method comprises the step of measuring the level of βig-h3 protein in a blood sample wherein the serum level of βig-h3 is positively correlated with the risk of having a PDAC. By following studies on 2 distinct cohorts of 20 and 104 of PDAC patients, and on PDAC mouse model, the inventors show that βig-h3 can be directly detected in the blood sample and βig-h3 is expressed very early in tumorigenesis in pancreatic neoplastic lesions. Also provided is a βig-h3 protein, for use in the treatment of PDAC. The inventors found that βig-h3 bind directly on CD8.sup.+ T cells by reducing their activation and cytotoxic properties. Furthermore, the use of neutralizing βig-h3 antibodies in PDAC mouse model reduced tumor growth by enhancing CD8.sup.+ T cell anti-tumoral response. Thus, neutralizing βig-h3 which acts as a novel immunological check-point target in PDAC therefore allows to restore beneficial anti-tumor immunity in PDAC.
Claims
1. A method of treating a patient afflicted with pancreatic ductal adenocarcinoma having a stroma comprising cancer associated fibroblasts producing transforming growth factor β-induced protein (βig-h3), comprising selecting an anti-βig-h3 neutralizing antibody capable of binding to stroma-produced βig-h3 protein and inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, administering to the patient a therapeutically effective amount of the anti-βig-h3 neutralizing antibody binding to stroma-produced βig-h3 protein and inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, obtaining specific binding of said anti-βig-h3 neutralizing antibody to stroma-produced βig-h3, inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, and inhibiting the inhibition of cluster of differentiation 8 (CD8)+T cell activation.
2. A method to activate the anti-tumoral cluster of differentiation 8 (CD8)+T cell response of a patient affected with a cancer having a stroma comprising cancer associated fibroblasts expressing or secreting a transforming growth factor β-induced protein (βig-h3), comprising selecting an anti-βig-h3 neutralizing antibody capable of inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, and administering to the patient a therapeutically effective amount of the anti-βig-h3 neutralizing antibody inhibiting interaction between βig-h3 protein and αVβ3 integrin.
3. The method according to claim 2, wherein the cancer is a solid tumor selected from the group consisting of pancreatic cancer, esophageal cancer, squamous cell carcinoma, gastric carcinoma, hepatic carcinoma, colon cancer, and melanoma.
4. The method according to claim 3, wherein the solid tumor is pancreatic cancer.
5. The method according to claim 3 wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
6. A method of reducing of tumor growth in vivo or inducing neutralization of tumor growth in vivo in a patient afflicted with pancreatic ductal adenocarcinoma having a stroma comprising cancer associated fibroblasts producing βig-h3 protein, comprising selecting an anti-βig-h3 neutralizing antibody capable of binding to stroma-produced βig-h3 protein and inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, administering to the patient a therapeutically effective amount of the anti-βig-h3 neutralizing antibody inhibiting interaction between βig-h3 protein and αVβ3 integrin, obtaining specific binding of said anti-βig-h3 neutralizing antibody to stroma-expressed βig-h3, inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, and inhibiting the inhibition of cluster of differentiation 8 (CD8)+T cell activation.
7. A method to activate the anti-tumoral cluster of differentiation 8 (CD8)+T cell response of a patient affected with a cancer having a stroma comprising cancer associated fibroblasts expressing or secreting a transforming growth factor β-induced protein (βig-h3) and obtaining anti-transforming growth factor β-induced protein (βig-h3) neutralizing effect on tumor growth in vivo, comprising selecting an anti-βig-h3 neutralizing antibody capable of inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, administering to the patient a therapeutically effective amount of the anti-βig-h3 neutralizing antibody inhibiting interaction between βig-h3 protein and αVβ3 integrin, inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, wherein tumor growth in vivo is reduced.
8. The method of claim 7, further comprising the step of inhibiting tumor cell growth.
9. The method according to claim 7, wherein the cancer is a solid tumor selected from the group consisting of pancreatic cancer, esophageal cancer, squamous cell carcinoma, gastric carcinoma, hepatic carcinoma, colon cancer, and melanoma.
10. The method according to claim 9, wherein the solid tumor is pancreatic cancer.
11. The method according to claim 9, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
12. A method of treating a patient afflicted with pancreatic ductal adenocarcinoma having a stroma comprising cancer associated fibroblasts producing βig-h3 protein, comprising selecting an anti-βig-h3 neutralizing antibody capable of binding to stroma-produced βig-h3 protein and inhibiting interaction between stroma-produced βig-h3 protein and αVβ3 integrin, administering to the patient a therapeutically effective amount of the anti-βig-h3 neutralizing antibody specifically binding to βig-h3, and neutralizing an interaction between βig-h3 protein and αVβ3 integrin.
Description
FIGURES
(1)
(2) A. Protocol isolation of ductal cells and CAFs. B. Relative expression of βig-h3 in ductal and CAF isolated compartments (RT-qPCR using TBP as a house keeping reference gene). C βig-h3 production by CAF in control ex vivo condition of stimulated for 24 h with TGF-β1. **P<0.01
(3)
(4) βig-h3 directly modulates CD8.sup.+ T cell activation. OT1 T cells were pretreated with rβig-h3 for 24 h and then Ag-specific activated by adding OVA peptide at 2 different concentrations (10 and 1 ng/ml). Pretreated conditions are represented in red. Not treated conditions are represented in gray. A) Quantification of the divided CFSE.sup.low OT1 cell after 98 h of in vitro cell culture B) Quantification of the total number of OT1 cells after 98 h of in vitro cell culture, B) Quantification of the activated CD69.sup.+OT1 cells after 98 h of in vitro cell culture C) Quantification of the activated CD44.sup.+ OT1 cells after 98 h of in vitro cell culture. D) Quantification of the total number of CD69.sup.+OT1 cells after 98 h of in vitro cell culture, E) Quantification of the number of OT1 in presence/absence of CAF cells and anti-βig-h3 neutralizing Ab or control Ab cells after 98 h of in vitro cell culture F) Quantification of the number of OT1 cells in presence/absence of CAF supernatant and with anti-βig-h3 neutralizing Ab or control Ab cells after 98 h of in vitro cell culture. G) Quantification of anti-tumoral CD8.sup.+ T cells from draining lymph nodes (DLN) of p48;Kras mice after 5 days in culture with tumoral cell line (KC). Representative of 3 independent experiments. *P<0.05. **P<0.01
(5)
(6) Quantification of intra-pancreatic CD8.sup.+ T cells (A), EPCAM (ductal tumoral compartment) (B) and αSMA(CAF compartment) (C). Representative of 3 independent experiments *P<0.05. **P<0.01
(7)
(8) A. ELISA determination of the amount of βig-h3 in WT and KC mice at the age of 2 months. B) ELISA determination of the amount of βig-h3 in the sera of 20 healthy volunteers and 20 PDAC patients. *P<0.05, ***<0.001.
(9)
(10)
(11)
EXAMPLE 1
Material & Methods
Mouse Models
(12) p48-Cre;Kras.sup.G12D were bred and housed in specific pathogen-free conditions and used as a model of development of PANINs. These mice develop PANIN lesions starting from 1.5 months. In order to determine the role of βig-h3 molecule in the regulation of specific immune response OT1/Rag2 KO transgenic mice expressing unique OT1 T cell receptor (CD8.sup.+ T cells) were used. Furthermore, a neutralizing antibody against βigh3 was used in order to assess the impact of the molecule in the early stages of PANIN development.
(13) Mouse pancreas of p48-Cre;Kras.sup.G12D or WT animals were isolated by collagen disruption. Ducts were isolated using DBA-lectin—FITC and subsequent anti-FITC magnetic beads and CAFs by using anti-PDGFRα-PE and anti-PE magnetic beads and MACS Miltenyi technology. Alternatively, for increase purity we FACS sort them. The purified populations were injected in Matrigel in recipient mice (immunocompetant WT C57B16 mice). Antibody i.p injection with anti-TGFBIp neutralizing monoclonal antibody (provided by In-San Kim, Korea Institute of Science and Technology Seoul, Korea) or control monoclonal antibody (BioXCell, USA) at a concentration of 300 μg/kg was done in p48-Cre;Kras.sup.G12D once per week for 4 weeks. Altenatively, p48-Cre;Kras.sup.G12D cell line (2 different cell lines generated as described previously by Agbunag et al., 2006 from pancreata of p48-Cre;Kras.sup.G12D 2.5 month old mice), infused with anti-TGFBIp neutralizing monoclonal antibody or control Ab were sc injected in matrigel in immunocompetant WT C57B16 mice.
(14) The impact of T cell population on the tumor tumorigenesis after s.c. transplantation can be assessed by antibody depletion with anti-CD8 (CD8.sup.+ T cells), anti-CD4 (CD4.sup.+ T cells) or anti-Gr1 (for monocytes/macrophages) all from BioXCell, USA.
Biological Resources
(15) Pancreas slides from patients with PANINs, IPMN or PDAC were collected from Bucarest, Romanian National Institute for Diabetes, Marseille Hopital La Timone and Lyon, Hopital Edouard Herriot. 6-μm sections from paraffin embedded pancreas were stained for immunhistochemistry and immuno fluoresce. All experimental procedures were approved by Romanian National Ethics Committee and French National Ethics Committee. Sera were recovered from CRB (Centre de Ressources Biologiques Centre Leon Berard, Lyon France) BB-0033-00050.
Cell Culture
(16) Cells extracted from draining lymph nodes, pancreas (by collagenase distruption as previously described Agbunag et al., 2006), spleen were cultured in 96-U-shaped-well plates (300 000 cells/well) in presence of neutralizing anti-βigh3 Ab or control Ab (BioXCell, USA) at a final concentration of 6 μg/ml for 24 hours.
Flow Cytometry Analysis
(17) For extracellular staining, draining lymph nodes cells or perfused pancreata were stained with CD8 V450 rat antibody (BD Bioscience), mouse CD4 V500 rat antibody (BD Bioscience), mouse CD44 A700 rat antibody (BD Bioscience), CD69 FITC (ImmunoTools). For intracellular staining, draining lymph nodes cells were activated with PMA and ionomycin (1 μg/ml) for 4 hrs at 37° C. in 5% CO.sub.2 in RPMI 1640 medium (Invitrogen) supplemented with 10% FCS (Biowest), 10 mM HEPES, 100 U/ml penicillin G, 100 μg/ml streptomycin, 2 mM L-glutamine (Invitrogen) in the presence of Golgi plug (BD Pharmingen). After activation, cells were stained with CD8 V450 rat antibody (BD Bioscience), mouse CD4 V500 rat antibody (BD Bioscience), permeabilized using Cytofix-Cytoperm (BD Pharmingen) and further stained with anti-IFNγ (clone XMG1.2, BD Pharmingen), anti-Granzyme B (clone GB12, Invitrogen) and. Flow cytometry analyses was carried out with BD Fortessa Flow Cytometer (BD Biosciences) and analyzed with either BD FACS Diva software v5.0.1 (BD) or FlowJo (Tree Star, Inc.).
Reverse Transcription and qPCR
(18) RNAs were extracted by Qiagen kit from pelleted islets according to the manufacturer. RNA concentrations were measured at Nanodrop. Reverse transcription (RT) was made on equivalent quantity of extracted RNAs (superior to 300 ng). From cDNA, quantitative Polymerase Chain Reaction (qPCR) was made with Power SYBR® Master Mix (Life technologies) with following primers, TBP Forward 5′-TGGTGTGCACAGGAGCCAAG-3′(SEQ ID N° 3), TBP Reverse 5′-TTCACATCACAGCTCCCCAC-3′(SEQ ID N° 4) and βig-h3 All-in-one™ qPCR (cat no MQP028379) primers from GeneCopoeia.
Immunofluorescence and Confocal Microscopy
(19) Slides with 5 μm sections of mouse pancreas included in paraffin were deparaffined. Sections were unmasked by unmasking solution (Vector H 3300) then saturated with antibody diluent (Dako) during 30 minutes and incubated with primary antibody diluted in antibody diluent over night at 4° C. (βig-h3 rabbit antibody from Sigma, αSMA from Genetex, CK19 CK19 Troma III from DSHB). For cultured cells, cells were cytospined on slides and fixed in 0.4% paraformaldehide for 10 min and then permeabilized in 0.1% TRITONX-100® (octyl phenol ethoxylate) for 10 min. Cells were washed in PBS 0.05% TWEEN® (polysorbate) and the blocked with antibody diluent (Dako) 15 min before staining o.n. at 4° C. with, βig-h3 rabbit antibody from Sigma, CD61 from Ebioscience, pErk from Cell Signalling. Slides were incubated with species specific anti-Fab′2-Alexa 647 and Alexa 555 (Molecular Probes) and mount with Vectashield Mounting medium with DAPI. Representative images of the localization of each molecule are shown. All confocal analysis were multiple repeats, and at least 20 images were analyzed for each molecule. The method use for colocalization quantifications was previously described (10). Data were rendered and analyzed using Zen software (Zeiss).
Statistical Analysis
(20) P values were calculated with Student's t test, (GraphPad Prism) as specified in figure legends. *P<0.05; **P<0.01; ***P<0.001. ****P<0.0001
Results
βig-h3 is Expressed Early in Tumorigenesis in Pancreatic Neoplasia
(21) We have previously shown that in WT pancreas in C57B16βig-h3 protein is expressed at low levels in islets of Langerhans (Patry et al., 2015). No expression of the protein was detected in the exocrine compartment. In contrast, in p48Cre;Kras.sup.G12D (KC) mice developing neoplasia starting from 1.5 months (Hingorani et al., 2003), we found a significant expression of the protein around the neoplastic lesions. This expression was maintained, but heterogeneous, at later stages of the neoplastic development (ie 4.5 and 7 months). Furthermore, we have identified by immunofluorescence staining that βig-h3 expression was localized around neoplastic ductal cells (PANINs) expressing ductal marker cytokeratin 19 (CK19) and that is was mostly colocalized with the stromal marker αSMA as soon as 1.5 months of PANIN development. In order to check for the relevance of the expression protein pattern in patients with pancreatic cancer, we have performed immunohistochemistry staining on pancreas adenocarcinoma (PDAC). 15 patients with PDAC have been analyzed and all of them showed the protein expressed in the extracellular compartment in the stroma around neoplastic ducts but also in the diffuse carcinoma. Altogether, these results demonstrate for the first time that βig-h3, a TGF-β/Activins superfamily target, is expressed early during neoplasia in mice and that this expression was found with the same pattern of staining in human PDAC.
βig-h3 is Restricted to the Microenvironment Compartment in Pancreatic Neoplasia
(22) Since the pattern of βig-h3 expression showed colocalization with αSMA, we next investigated which types of cells were producing the protein. Therefore we have isolated from 2.5 months pancreas, the ductal cells and the cancer associated fibroblasts (CAFs) by magnetic beads sorting (
Secreted Sig-h3 Dampens CD8.SUP.+ T Cell Ag-Specific Responses
(23) We have previously shown that βig-h3 was able to inhibit diabetogenic T cells to kill islet beta cells by directly blocking Lck kinase in inactive conformation (Patry et al., 2015). In order to determine if βig-h3 was able to modulate CD8.sup.+ T cell Ag-specific responses. We treatead OT1 CD8+ T cell with recombinant βig-h3 and further treat the cells with specific OVA SIINFEKL cognate peptide (at 2 different concentrations). We demonstrate that βig-h3 pretreatment was able to significantly decrease Ag-specific responses as measured by the number of total (
βig-h3 Neutralization In Vivo Enhances Local CD8.SUP.+ T Cell Response
(24) In order to test the impact in vivo we have treated KC mice with a neutralizing βig-h3 Ab or isotype control antibody starting starting from the age of 21 days (immediately after weaning). We treated the mice for once per week for 4 weeks and then evaluated the neoplasia in the pancreas by FACS staining, immunohistochemistry and immunofluorescence. Treated mice displayed reduced CK19 staining compared to littermate control Ab treated mice. Furthermore, this response was associated with increased number of CD8.sup.+ T cells in neoplastic pancreas as detected by immunofluorescence and FACS analysis (
(25) In order to test if only the local pancreatic anti-tumoral was sufficient to drive the elimination of neoplastic cells, we have performed injection of KC cell line into immunocompetent B6 mice. KC cell line treated with anti-bigh3 neutralizing Ab or control Ab were injected sc in B6 (in Matrigel) and sacrificed 10 days later. The use of βig-h3 neutralizing Ab leads to significant decrease in tumor size and weight. More importantly this results were correlated with decreased EPCAM staining and as well as CAF number (
βig-h3 Can be Used as a Marker of Early Neoplasic Development
(26) Since βig-h3 expression occurs early in pancreatic neoplasia we hypothesized that βig-h3 could be detected in the sera and use as a “predictive marker”. We have use ELISA to detect the amount of βig-h3 in the sera of WT of KC mice. We have detected significant increase in the amount of bigh3 in the sera of KC mice (69.32±35.70N=6) compared to WT mice the detection was below the threshold of the ELISA test (
(27) As a proof of concept in human PDAC we have tested the sera of 20 healthy volunteers from blood bank and 20 patients with PDAC for the presence of soluble βig-h3 as a potential diagnosis marker. As shown in
EXAMPLE 2
βig-h3 Interacts with CD61 on T Cell Surface
(28) βig-h3 has been reported to signal through binding to αvβ3 integrins (Tumbarello D A, et al. Mol Cancer 2012; 11:36). Therefore, we searched for the expression of β3 (CD61) at the surface of CD8+ T cells. We found that both CD8+ T cell present in lymph nodes and in tumors express CD61 and further noticed that the expression of CD61 was significantly higher in tumor CD8+ T cells compared to peripheral CD8+ T cells (
CD8+ T Cells are Mandatory for βig-h3 Neutralization Effect In Vivo
(29) Since βig-h3 neutralization leads to local accumulation of CD8+ T cells, we thought to investigate the direct contribution of CD8+ T cells to the process. To test this hypothesis, we injected KC cell line treated with βig-h3 neutralizing or control Ab in Rag2KO mice. The mice were further injected i.v with CD8+ T cells isolated from pancreatic-draining lymph nodes of KC mice (
βig-h3 Can be Used as a Marker of PDAC
(30) As a proof of concept in human PDAC we have tested an additional cohort of sera of 49 healthy volunteers from blood bank and 104 patients with PDAC for the presence of soluble βig-h3 as a potential diagnosis marker. As shown in
(31) TABLE-US-00001 TABLE 1 Useful nucleotide and amino acid sequences for practicing the invention SEQ Nucleotide ID NO or amino acid sequence 1 MALFVRLLAL ALALALGPAA TLAGPAKSPY QLVLQHSRLR (βig-h3 GRQHGPNVCA VQKVIGTNRK YFTNCKQWYQ RKICGKSTVI AA SYECCPGYEK VPGEKGCPAA LPLSNLYETL GVVGSTTTQL sequence) YTDRTEKLRP EMEGPGSFTI FAPSNEAWAS LPAEVLDSLV SNVNIELLNA LRYHMVGRRV LTDELKHGMT LTSMYQNSNI QIHHYPNGIV TVNCARLLKA DHHATNGVVH LIDKVISTIT NNIQQIIEIE DTFETLRAAV AASGLNTMLE GNGQYTLLAP TNEAFEKIPS ETLNRILGDP EALRDLLNNH ILKSAMCAEA IVAGLSVETL EGTTLEVGCS GDMLTINGKA IISNKDILAT NGVIHYIDEL LIPDSAKTLF ELAAESDVST AIDLFRQAGL GNHLSGSERL TLLAPLNSVF KDGTPPIDAH TRNLLRNHII KDQLASKYLY HGQTLETLGG KKLRVFVYRN SLCIENSCIA AHDKRGRYGT LFTMDRVLTP PMGTVMDVLK GDNRFSMLVA AIQSAGLTET LNREGVYTVF APTNEAFRAL PPRERSRLLG DAKELANILK YHIGDEILVS GGIGALVRLK SLQGDKLEVS LKNNVVSVNK EPVAEPDIMA TNGVVHVITN VLQPPANRPQ ERGDELADSA LEIFKQASAF SRASQRSVRL APVYQKLLER MKH 2 ctccttgcac gggccggccc agcttccccg cccctggcgt ccgctccctc ccgctcgcag cttacttaac (βig-h3 ctggcccggg cggcggaggc gctctcactt ccctggagcc gcccgcttgc ccgtcggtcg ctagctcgct nucleic cggtgcgcgt cgtcccgctc catggcgctc ttcgtgcggc tgctggctct cgccctggct ctggccctgg acid gccccgccgc gaccctggcg ggtcccgcca agtcgcccta ccagctggtg ctgcagcaca sequence) gcaggctccg gggccgccag cacggcccca acgtgtgtgc tgtgcagaag gttattggca ctaataggaa gtacttcacc aactgcaagc agtggtacca aaggaaaatc tgtggcaaat caacagtcat cagctacgag tgctgtcctg gatatgaaaa ggtccctggg gagaagggct gtccagcagc cctaccactc tcaaaccttt acgagaccct gggagtcgtt ggatccacca ccactcagct gtacacggac cgcacggaga agctgaggcc tgagatggag gggcccggca gcttcaccat cttcgcccct agcaacgagg cctgggcctc cttgccagct gaagtgctgg actccctggt cagcaatgtc aacattgagc tgctcaatgc cctccgctac catatggtgg gcaggcgagt cctgactgat gagctgaaac acggcatgac cctcacctct atgtaccaga attccaacat ccagatccac cactatccta atgggattgt aactgtgaac tgtgcccggc tgctgaaagc cgaccaccat gcaaccaacg gggtggtgca cctcatcgat aaggtcatct ccaccatcac caacaacatc cagcagatca ttgagatcga ggacaccttt gagacccttc gggctgctgt ggctgcatca gggctcaaca cgatgcttga aggtaacggc cagtacacgc ttttggcccc gaccaatgag gccttcgaga agatccctag tgagactttg aaccgtatcc tgggcgaccc agaagccctg agagacctgc tgaacaacca catcttgaag tcagctatgt gtgctgaagc catcgttgcg gggctgtctg tagagaccct ggagggcacg acactggagg tgggctgcag cggggacatg ctcactatca acgggaaggc gatcatctcc aataaagaca tcctagccac caacggggtg atccactaca ttgatgagct actcatccca gactcagcca agacactatt tgaattggct gcagagtctg atgtgtccac agccattgac ctrttcagac aagccggcct cggcaatcat ctctctggaa gtgagcggtt gaccctcctg gctcccctga attctgtatt caaagatgga acccctccaa ttgatgccca tacaaggaat ttgcttcgga accacataat taaagaccag ctggcctcta agtatctgta ccatggacag accctggaaa ctctgggcgg caaaaaactg agagtttttg tttatcgtaa tagcctctgc attgagaaca gctgcatcgc ggcccacgac aagaggggga ggtacgggac cctgttcacg atggaccggg tgctgacccc cccaatgggg actgtcatgg atgtcctgaa gggagacaat cgctttagca tgctggtagc tgccatccag tctgcaggac tgacggagac cctcaaccgg gaaggagtct acacagtctt tgctcccaca aatgaagcct tccgagccct gccaccaaga gaacggagca gactcttggg agatgccaag gaacttgcca acatcctgaa ataccacatt ggtgatgaaa tcctggttag cggaggcatc ggggccctgg tgcggctaaa gtctctccaa ggtgacaagc tggaagtcag cttgaaaaac aatgtggtga gtgtcaacaa ggagcctgtt gccgagcctg acatcatggc cacaaatggc gtggtccatg tcatcaccaa tgttctgcag cctccagcca acagacctca ggaaagaggg gatgaacttg cagactctgc gcttgagatc ttcaaacaag catcagcgtt ttccagggct tcccagaggt ctgtgcgact agcccctgtc tatcaaaagt tattagagag gatgaagcat tagcttgaag cactacagga ggaatgcacc acggcagctc tccgccaatt tctctcagat ttccacagag actgtttgaa tgttttcaaa accaagtatc acactttaat gtacatgggc cgcaccataa tgagatgtga gccttgtgca tgtgggggag gagggagaga gatgtacttt ttaaatcatg ttccccctaa acatggctgt taacccactg catgcagaaa cttggatgtc actgcctgac attcacttcc agagaggacc tatcccaaat gtggaattga ctgcctatgc caagtccctg gaaaaggagc ttcagtattg tggggctcat aaaacatgaa tcaagcaatc cagcctcatg ggaagtcctg gcacagtttt tgtaaagccc ttgcacagct ggagaaatgg catcattata agctatgagt tgaaatgttc tgtcaaatgt gtctcacatc tacacgtggc ttggaggctt ttatggggcc ctgtccaggt agaaaagaaa tggtatgtag agcttagatt tccctattgt gacagagcca tggtgtgttt gtaataataa aaccaaagaa acata 3 TGGTGTGCACAGGAGCCAAG (TBPi Forward primer) 3 TTCACATCACAGCTCCCCAC (TBPi Reverse primer)
REFERENCES
(32) Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.