Tissue scaffold

Abstract

There is provided a tissue scaffold and a method for making a tissue scaffold. The tissue scaffold comprises elastin and optionally fibrin and/or collagen. The elastin in the scaffold may be cross-linked. The elastin that is cross-linked preferably comprises solubilised elastin and is unfractionated.

Claims

1. A method for forming a tissue scaffold, comprising cross-linking a composition, the composition comprising elastin, collagen, and fibrin; wherein the elastin comprises solubilised elastin and insoluble elastin.

2. The method of claim 1, further comprises a step of solubilising elastin.

3. The method of claim 1, wherein the elastin is solubilised by contacting with oxalic acid.

4. The method of claim 2, wherein the step of solubilising the elastin is carried out at a temperature less than or equal to 50° C.

5. The method of claim 1, wherein the collagen is in the form of a collagen hydrogel.

6. The method of claim 1, wherein the fibrin is in the form of a fibrin gel.

7. The method of claim 1, wherein the cross-linking is chemical cross-linking.

8. The method of claim 7, wherein the chemical cross-linking comprises contacting the composition with an aldehyde cross-linking agent.

9. The method of claim 8, wherein the aldehyde cross-linking agent is glutaraldehyde.

10. The method of claim 1, wherein the cross-linking takes place in the presence of CO.sub.2.

11. The method according to claim 10, wherein the cross-linking takes place in the presence of 2 to 10% CO.sub.2.

12. The method of claim 1, further comprising lyophilising the composition following the cross-linking.

13. The method of claim 1, further comprising washing to remove agents involved in solubilising and/or cross-linking.

14. The method of claim 13 further comprising lyophilisation prior to the washing.

15. The method of claim 13, wherein the washing comprises washing with a reducing agent.

16. The method of claim 15, wherein the reducing agent is selected from the group consisting of sodium borohydride and agents with similar carbonyl group reactivity.

17. The method of claim 1, further comprising sterilising the scaffold.

18. The method according to claim 17, wherein the sterilising of the scaffold comprising contacting the scaffold with ethanol.

Description

(1) Examples of the invention are now described by way of example only, with reference to the accompanying drawings, in which:

(2) FIG. 1 shows elastin scaffold fabrication process from insoluble elastin (A), mixed with 0.5M oxalic acid (B), crosslinked with 1% GTA and incubated at 37° C. for 1 hour (C), frozen at −80° C. overnight (D), and lyophilised for 48 hours (E);

(3) FIG. 1 shows scaffolds fabricated without crosslinking agent (A), or with cross-linking agent (B);

(4) FIG. 2 shows a scaffold stabilisation study without crosslinking agent (A), and with crosslinking agent (B) after 28 days in PBS;

(5) FIG. 3 shows a live/dead assay at 1(A), 3 (B) and 7 (C) days for adipose derived stem cells (ADSC) growing on the scaffolds, with green points indicating alive cells;

(6) FIG. 4 shows a cell proliferation assay using alamar blue at 1, 3 and 7 days;

(7) FIG. 6 shows scanning electron microscopy (SEM) images of elastin scaffolds;

(8) FIG. 7 shows live/dead assay on days 1, 3 and 7 for different combination scaffolds (3A=Collagen/Elastin/Fibrin 2:1:1; 3B=Elastin/Collagen/Fibrin 2:1:1; 3C=Fibrin/Collagen/Elastin 2:1:1; 3D=Fibrin/Collagen/Elastin 1:1:1);

(9) FIG. 8 shows a cell proliferation assay (alamar blue activity) for combination scaffolds (3A=Collagen/Elastin/Fibrin 2:1:1; 3B=Elastin/Collagen/Fibrin 2:1:1; 3C=Fibrin/Collagen/Elastin 2:1:1; 3D=Fibrin/Collagen/Elastin; 1:1:1);

(10) FIG. 9 shows SEM Images illustrating differences in fibril network and pore structure of each individual combination, A) 3A=Collagen/Elastin/Fibrin 2:1:1, B) 3B=Elastin/Collagen/Fibrin 2:1:1, C) 3C=Fibrin/Collagen/Elastin 2:1:1, D) 3D=Fibrin/Collagen/Elastin 1:1:1;

(11) FIG. 10 shows wettability of elastin scaffolds at 0 seconds (A), 4 seconds (B), 9 seconds (C) and water contact angle measurement per second (D);

(12) FIG. 11 shows water contact angle measurements per second for elastin-based scaffolds;

(13) FIG. 12 shows an accelerated degradation profile of an elastin scaffold over a period of time;

(14) FIG. 13 shows accelerated degradation profiles of elastin-based composite scaffolds;

(15) FIG. 14 shows SEM images of elastin scaffolds (50× and 1000×) and pore % from 0-120+μm;

(16) FIG. 15 shows pore size pattern for elastin-based composite scaffolds;

(17) FIG. 16 shows mechanical testing of anelastin scaffold: pre-test scaffold (A), post-test scaffold (B), stress distribution on the scaffold (C) and break strength of the elastin scaffold (D) (*** denotes the statistical significance of p<0.0001);

(18) FIG. 17 shows mechanical properties for elastin-based composite scaffolds;

(19) FIG. 18 shows developing chorio-allantoic membrane (CAM) on an elastin scaffold on embryonic day (ED) 12 (A), total vascular area (B), the processed image for CAM analysis (C) and a number of bifurcation points (D);

(20) FIG. 19 shows Vascular area (%) for elastin-based composite scaffolds;

(21) FIG. 20 shows a gene expression profile of an elastin scaffold;

(22) FIG. 21 shows gene expression profiles for elastin-based composite scaffolds;

(23) FIG. 22 shows the difference in swelling ratio between Elastin/Collagen and Elastin/Fibrin scaffolds;

(24) FIG. 23 shows the difference in degradation profiles between Elastin/Collagen and Elastin/Fibrin scaffolds;

(25) FIG. 24 shows the microstructure of Elastin/Collagen and Elastin/Fibrin scaffolds using SEM;

(26) FIG. 25 shows the pore size of distribution of Elastin/Collagen and Elastin/Fibrin scaffolds;

(27) FIG. 26 shows the results of a live/dead assay for Elastin/Collagen and Elastin/Fibrin scaffolds; and

(28) FIG. 27 shows the vascular area for Elastin/Collagen and Elastin/Fibrin scaffolds at day 12.

EXAMPLE 1—ELASTIN SCAFFOLDS

(29) Fabrication Method and Materials

(30) Insoluble elastin powder was obtained from Sigma (the source of elastin was derived from bovine neck ligament) (FIG. 1A). 100 mg of insoluble elastin powder was mixed with 1 ml of 0.5M oxalic acid (C.sub.2H.sub.2O.sub.4) (freshly prepared) at room temperature (FIG. 1B).

(31) To cross-link the protein, a homobifunctional cross-linking agent, 1% glutaraldehyde (GTA) (v/v), was added to the solution (FIG. 1C). The solution was cast in a well of a 24 well plate and incubated at 37° C. with 5% CO.sub.2 for one hour (FIG. 1C).

(32) The mixture was frozen at −80° C. overnight (FIG. 1D) and lyophilised for 48 hours to form a scaffold (FIG. 1E).

(33) The fabricated scaffold was brought to room temperature and washed with 0.1M Glycine buffer at pH=10.4 with 2 washes of 15 minutes each and washed with tris-glycine buffer for 15 minutes. To remove excess of oxalic acid and unbound glutaraldehyde, scaffolds were washed with 0.1% w/v sodium boro-hydride (NaBH.sub.4) a reducing agent for approximately 8 hours on a shaker.

(34) Subsequently, scaffolds were washed with distilled warm water (60° C.) for 15 minutes and two washes of distilled water for 30 minutes each to remove remaining unbound glutaraldehyde from the scaffold.

(35) For sterilisation, scaffolds were washed with 70% ethanol for 15 minutes and then with PBS.

(36) Structural Integrity and Stability

(37) The fabricated crosslinked elastin scaffold was intact (FIG. 2B). However, the non-crosslinked scaffold was dismantled/disintegrated (FIG. 2A).

(38) An in vitro scaffold stabilisation study was carried out by comparing scaffolds with and without cross-linking for 28 days in PBS at 37° C. and 5% CO.sub.2. It was found that non-crosslinked scaffolds (FIG. 3A) were dismantled/disintegrated after 28 days in PBS and in contrast crosslinked scaffolds were intact (FIG. 3B). This indicates that this method of fabrication effectively produced an integral scaffold,

(39) Biological Activity

(40) To evaluate the efficacy and biological activity of the scaffolds, adipose-derived stem cells (ADSCs) were cultured under standard culture conditions i.e. incubation at 37° C. with 5% CO.sub.2 in MesenPRO RS™ basal cell culture medium (ThermoFisher, UK) supplemented with 2% MesenPRO RS™ growth supplement (ThermoFisher, UK) and 1% penicillin/streptomycin (Sigma-Aldrich, UK). 50000 cells were seeded on 6 mm diameter scaffolds and cultured for 1, 3 and 7 days. Cell survival and proliferation were studied using live/dead and alamar blue assays respectively. ADSCs were alive and adhered to the scaffold by day 1 and exhibited non-aggregated morphology on days 3 and 7 (FIG. 4). Additionally, cells maintained their non-aggregated behavior and demonstrated spindle morphological structure (FIG. 4) suggesting they retain their stem characteristics during the culture period.

(41) Cell proliferation was quantitatively measured by alamar blue activity, a cell metabolic assay, and the absorbance at 570 nm was measured using a spectrophotometer at days 1, 3, and 7 (n=3 per time point) (FIG. 5).

(42) Scanning Electron Microscopy

(43) Elastin scaffolds were washed with distilled water in an ultra-sonic cleaner for 3 minutes to remove salts and dried for 24 hours in a lyophiliser. Scaffolds were mounted on stubs and sputter-coated with carbon under vacuum. All images were obtained using a secondary electron detector in a Philips XL 30 Field Emission SEM, operated at 5 kV and average working distance was 10 mm.

(44) The SEM images in FIGS. 6A and 6B show that elastin scaffolds have an homogeneous structure and are porous in nature. FIG. 6A is at 50× magnification and FIG. 2 is at 250× magnification.

(45) Discussion

(46) This is a very cost-effective and time-efficient way to fabricate elastin scaffolds because, as of the priority date of this application, 5 mg of insoluble elastin from bovine neck ligament cost £69.70 GBP (E1625) whereas 1 mg of soluble α-elastin costs £272.50 GBP (E6527) from Sigma™ as the commercial supplier.

(47) The live/dead assay results showed that cells maintained their spindle morphological structure which is one of the characteristics of ADSCs. Since ADSC have contact inhibition behavior (Majd et al., 2011) by using an elastin scaffold within the scope of the invention, the inventors were able to maintain contact inhibition behavior up to day 7 (FIG. 4). This cell morphology can maintain ADSCs phenotype and multipotent characteristics without undergoing any differentiation (Zhang and Kilian, 2013). An increase in the alamar blue absorbance is an indication of constant cell proliferation. These results also show that the fabricated scaffold was non-toxic to the cells.

EXAMPLE 2—ELASTIN/COLLAGEN/FIBRIN SCAFFOLDS

(48) Fabrication Method and Materials

(49) Tube 1: Elastin powder (9.7% w/v)+0.5M oxalic acid+3% glutaraldehyde (w/v).

(50) Tube 2: Collagen hydrogel—prepared using 80% rat tail collagen type I (v/v) (First Link, Birmingham, UK) and 10% of 10× Minimal Essential Medium (Invitrogen, Paisley, UK), neutralised using 5M and 1M sodium hydroxide (Sigma-Aldrich, Dorset, UK) and added 10× DMEM.

(51) Tube 3: Fibrin gel—prepared with 2% fibrinogen (w/v) dissolved in 1 ml of PBS and for fibrillogenesis, 1% thrombin (w/v) was added along with 0.1M CaCl2

(52) Tubes 1 to 3 were mixed in varying ratios, cast and then incubated at 37° C. with 5% CO.sub.2 for 1 hour. The final volume after mixing the 3 tubes was always 1 ml, which was then cast. For scaffolds that were 21:1 (collagen/elastin/fibrin), 500 μl of Tube 2 were mixed with 250 μl of Tube 1 and 250 μl of Tube 3 (Also referred to herein as scaffold 3A). For scaffolds that were 2:1:1 (elastin/collagen/fibrin), 500 μl of Tube 1 was mixed with 250 μl of Tube 2 and 250 μl of Tube 3 (Also referred to herein as scaffold 3B). For scaffolds that were 2:1:1 (fibrin/elastin/collagen), 500 μl of Tube 3 were mixed with 250 μl of Tube 1 and 250 μl of Tube 2 (Also referred to herein as scaffold 3C). For scaffolds that were 1:1:1, 333.3 μl of each tube were mixed and cast (Also referred to herein as scaffold 3D).

(53) The mixture was freeze-dried for 48 hours.

(54) Washing: First, a wash for 15 minutes with tris-glycine buffer. Second, to remove excess and unbound glutaraldehyde, scaffolds were washed with 0.1% sodium boro-hydride (NaBH.sub.4) a reducing agent for approximately 8 hours on a shaker.

(55) Biocompatibility

(56) To evaluate biocompatibility of each combination scaffold, 50000 adipose derived stem cells (ADSC) were seeded per scaffold and cultured up to 7 days. Cell survival and proliferation at 1, 3 and 7 days after seeding were studied using live/dead and alamar blue assays respectively.

(57) As an example, results for the three-component scaffolds show that ADSC were alive and adhered to the scaffold (FIG. 7) and were proliferating until day 7 (FIG. 8). The same results were observed in two-component scaffolds (i.e. scaffolds comprising elastin and collagen, or elastin and fibrin).

(58) Microstructure

(59) Microstructure of each scaffold was studied using SEM. Results for three-component scaffolds (FIG. 9) showed that each scaffold combination has a unique ultrastructural fibril network and pore size. Similar observations were made for two-component scaffolds. This variation in the structure could alter ADSC behaviour and differentiation as well as biomechanical properties of the scaffolds (See Ghasemi-Mobarakeh et al (2015)).

EXAMPLE 3—WATER CONTACT ANGLE (WCA)

(60) The wettability of the elastin scaffold was investigated by developing an experimental setup and a 30 μL distilled water droplet was dispensed onto each scaffold and several images were taken over the time interval between 0 to 5 seconds. The time at 0 seconds was considered the initial time of contact with a liquid medium (water). The WCA was calculated using Young's equation and the angle was measured from the water-scaffold interface to the line tangent and perimeter of the water droplet (Fu et al (2014)). The calculated WCA is a demonstration of water-material interaction.

(61) The calculated WCA for elastin at 0 seconds was 102±7.75° and it was reduced to 73.88±5.90° at 4 seconds. Over the time WCA continued to decrease over time and at reached 0° at 9 seconds which indicated complete wettability of the elastin scaffold (FIG. 10).

(62) However, by combining elastin with other natural polymers such as fibrin and collagen at different ratios the WCA for 3A (68.18±3.38° at 0 seconds to 0° at 3 seconds), 3C (67.46±4.51° at 0 seconds to 0° at 4 seconds) was altered and showed complete wettability by 4 seconds. Interestingly WCA for 3B (112.34±5.37° at 0 seconds to 99.32±14.55° at 10 seconds) and 3D (120.18±5.36° at 0 seconds to 113.23±8.93 at 10 seconds) (FIG. 11) did not show complete wettability even at 10 seconds making them hydrophobic as for any material >90° is considered to be hydrophobic therefore elastin, 3A and 3C scaffolds demonstrated hydrophilic nature and showed high cohesion towards water and gained complete wettability by 9 seconds. but scaffolds 3B and 3D showed to hydrophilic nature with low cohesion towards the water.

EXAMPLE 4—ACCELERATED TRYPSIN DEGRADATION

(63) To measure the stability of scaffolds, an accelerated degradation profile was carried out by using 1× trypsin. An initial weight of scaffolds was measured using XS205 Mettler Toledo® digital scale. The scaffolds were placed in 24 well-plate with 1× trypsin and incubated at 37° C. and with 5% CO.sub.2. At each time point, scaffolds were washed with distilled water and lyophilised and weight was measured.

(64) A net change in the weight was measured as a parameter of the degradation. In vitro accelerated degradation results indicated that elastin scaffold degraded from day 1 (136.06±11.90 mg). By the day 5, there was 25% decrease in the weight and this trend continued and by day 42 there was 70% degradation of the scaffold (FIG. 12).

(65) The degradation profile for the elastin-based co-polymers was identical for 3A, 3C and 3D. By day 7 almost 40% scaffolds were degraded this pattern was continued until day 42 where almost 70% of scaffolds were degraded. However, 3B, which has 50% of elastin, was the most stable scaffold with 55% degradation until day 42 (FIG. 13). This shows that different degradation pattern of elastin-based scaffolds can be used for various tissue engineering application depending upon regenerative properties of each tissue type.

EXAMPLE 5—STRUCTURAL PROPERTIES

(66) To measure pore size range and porosity, all SEM images were quantitively analysed using ImageJ bundled with 64-bit Java 1.6.0 (NIH, USA). A threshold function was used to visualise all pores in the scaffold. Additionally, friction area, particle analysis function was used.

(67) Calculated pore size percentages for the scaffolds were in the range of 0-120+μm and 28% pores were in the range of 0-19 μm, 48% pores in the range of 20-79 μm and remaining 24% in the range of 80-120+μm (FIG. 14) and total porosity of scaffold was 48%.

(68) When elastin was combined with other polymers, 70% pores were present in the 0-59 and remaining 50% in the range of 60-120+μm in 3A. In 3B, the majority of pores (65%) were in the range of 20-59 μm but in 3C pore pattern was uniform and 55% pores were in the range of 20-59 μm. However, in 3D 75% pores were in the 0-59 μm range (FIG. 15).

(69) Pore and porosity play a vital role in the angiogenesis and diffusion of nutrients. The results suggest that elastin-based scaffolds could be used for various tissue engineering applications.

EXAMPLE 6—MECHANICAL PROPERTIES

(70) The elastin scaffold was tested to failure using bi-axial BioTester (CellScale Biomaterials Testing, Canada). The system includes 2 high-performance actuators with temperature-controlled media bath to avoid scaffold drying while testing cell-seeded scaffolds. To analyse real-time stress distribution, a time synchronised high-resolution CCD camera for the acquisition and processing of the test results was used.

(71) The wet mechanical properties of elastin scaffold at day 0 was 154±1 mN and after seeding hADSC cells for 28 days the strength of the scaffold significantly (p<0.0001) increased to 185.5±1.5 mN (FIG. 16). This demonstrates that cells seeded in the scaffolds add to the mechanical integrity of scaffold by tissue remodelling mechanism.

(72) The calculated break strength for the 3A 74.33±3.78 mN, 119.33±33.12 nN for 3B, 103.34±20.23 mN for 3C and 71.68±4.72 mN for 3D. This demonstrates that after adding another co-polymer the mechanical properties of elastin decrease. It is believed that this is due to the non-fibril arrangement of the polymers (Lake et al. (2012)).

EXAMPLE 7—ANGIOGENESIS

(73) Pathogen-free fertilised eggs were obtained from a commercial supplier and incubated for 3 days at 38° C. with 40-45% humidity. On an, embryonic day (ED), 3 (ED 3) ex ovo glass bowl set-up was constructed to grow the embryonic culture and maintained at 37.5° C. with 3% CO.sub.2 and an average humidity in the range of 80-85% (3). At ED 9 elastin scaffold were placed on the developing chorio-allantoic membrane (CAM) to allow infiltration of blood vessels and at ED 12 embryos were euthanised as per home office guideline, and scaffolds were excised and fixed in 4% glutaraldehyde and analysed.

(74) A total calculated vascular area for ED 10 was 4.78±2.12% and this vascular area increased to 6.01±3.34% at ED 11 although this increment was not statistically significant but developed two large vessels with a number of capillary plexus. This trend continues to follow on ED 12 with the calculated vascular area was 8.34±2.67% (FIG. 18).

(75) When elastin was combined with fibrin and collagen, in different ratios, then there was an increase in the total vascular area % by day 12. The calculated % vascular area was 12.97±0.61% for 3A, 11.33±1.52% for 3B, 14.41±0.67% for 3C and 16.52±0.57 for 3D (FIG. 19). Therefore, it appears beneficial to use a combination of polymers to enhance angiogenetic properties of elastin. A CAM assay acted as ex vivo bioreactor to understand vascular invasion into the elastin-based scaffolds. In view that scaffolds have pore distribution in the range of 0 μm-120+μm which act as a pro-angiogenetic material for blood vessels infiltration.

EXAMPLE 8—CELLULAR DIFFERENTIATION

(76) To understand human adipose-derived cells (hADSCs) differentiation pathway on the elastin scaffold, a total 5×10.sup.5/mm.sup.3 hADSC of passage 4 seeded on scaffolds. RNA was isolated by using TRIzol (Invitrogen, Paisley, UK) method on day 1, 7 14 and total RNA yield was quantified by using spectrophotometer (Spectronic Camspec Ltd, Garforth, UK). cDNA synthesis was carried out using Precision nanoscript 2 reverse transcription kit (Primer Design, Southampton, UK) and quantitative PCR was performed with custom designed and synthesised primers (Table 1) (Primer Design, Southampton, UK).

(77) TABLE-US-00002 TABLE 1  Forward and reverse primers Name of gene Forward primer Reverse primer MYOD1 CGCCTGAGCAAAGTAAATGAG GCCCTCGATATAGCGGATG (SEQ ID: 1) (SEQ ID: 2) PPARG GAATAAAGATGGGGTTCTCAT AACTTCAGCAAACTCAAACTT ATCC (SEQ ID: 3) (SEQ ID: 4) CEBPA CGGCAACTCTAGTATTTAGGA CAAATAAAATGACAAGGCAC TAAC (SEQ ID: 5) GATT (SEQ ID: 6) RUNX2 TTCTCCCCTTTTCCCACTGA CAAACGCAATCACTATCTAT (SEQ ID: 7) ACCAT (SEQ ID: 8) SOX9 GGACCAGTACCCGCACTTG AATCCGGGTGGTCCTTCTTG  (SEQ ID: 9) (SEQ ID: 10) OCT4 CACTAAGGAAGGAATTGGGA GGGATTAAAATCAAGAGCAT ACA (SEQ ID: 11)  CATTG (SEQ ID: 12) REX1 CGTTTCGTGTCCCTTTCA CCTCTTGTTCATTCTTGTTCGT (SEQ ID: 13) ATT(SEQ ID: 14)

(78) Gene expression of and mesenchymal lineage-specific differentiation markers Adipogenic (CEBPA and PPARG), Osteogenic (RUNX2), Myogenic (MYOD1), Chondrogenic (SOX9) and MSC markers (OCT4 and REX1) were studied in hADSCs.

(79) Differentiation profile of hADSC on the elastin scaffold. OCT4, CEBPA, PPARG and MYOD1 showed an identical trend of significant upregulation by 0.03-0.04 units on day 7 and 14 in comparison to day 1 (p<0.0001). However, there was no significant upregulation on day 14 in comparison to day 7. RUNX2 did not show any trend. SOX9 exhibited negligible expression (<0.027) at all three-time points identical to all the other scaffolds reported above, although it showed a significant upregulation on day 14 (0.025, p<0.05) in comparison to day 1 (0.027). REX1 exhibited an initial downregulation on day 7 (0.036 to 0.028, p<0.0001), followed by a significant upregulation trend on day 14 (0.031, p<0.0001) (FIG. 20).

(80) In 3A, Oct-4 shows significant downregulation on day 7 and 14 (0.028, p<0.0001) from day 1 (0.031). Rex-1 downregulated significantly on day 7 (0.026, p<0.0001) and 14 (0.029, p<0.0001) in comparison to day 1 (0.031). However, expression on day 14 was significantly higher than day 7 (p<0.0001), whereas MyoD-1 was constant at 0.032. CEBP showed a marginal upregulation on day 7 (p<0.05) and significantly downregulated to 0.025 on day 14 (p<0.0001). In 3B, Oct-4, RUX-2 and CEBP showed significant downregulation on day 7 and 14 (p<0.0001) in comparison and there was no significant difference between expression on day 7 and 14. In 3C, Oct-4 showed a steady and significant downregulation from 0.030 on day to 0.029 on day 14 (p<0.001). Rex-1 and RUNX-2 downregulated significantly (p<0.0001) from 0.032 on day 1 to 0.030 and 0.029 respectively on day 7. In 3D, Oct-4, CEBP, PPAR-gamma and MyoD-1 showed identical trend of significant downregulation by 0.04-0.06 units on day 7 and 14 in comparison to day 1 (p<0.0001)

EXAMPLE 9—BINARY ELASTIN-BASED SCAFFOLDS

(81) Elastin/Collagen—1:1 ratio Elastin/Fibrin—1:1 ratio

(82) The elastin, collagen and fibrin were prepared as shown in Example 2. Swelling ratio

(83) FIG. 22 shows the difference in swelling ratio between Elastin/Collagen and Elastin/Fibrin scaffolds. Swelling ratio is an indication of the interaction between a solvent and a polymer. It shows exchange of the affinity and enthalpy between two phases. The higher the crosslinking density inside a polymer then the lower the swelling property, and vice-versa. The swelling ratio (SR) of the elastin and its composites was measured from dry mass and wet mass with the following equation

(84) $\begin{array}{cc}\mathrm{SR}=\frac{M_w-M_d}{M_w}& \left(1\right)\end{array}$
where M.sub.d is the dry weight of the scaffold and M.sub.w is the wet weight of the scaffold. A wet mass of the scaffold was measured by immersing into 2 ml of distilled water. Dry and wet mass measured with the digital scale (XS205 Mettler Toledo®) and the SR was calculated using equation (1) Degradation

(85) FIG. 23 shows the difference in degradation profiles between Elastin/Collagen and Elastin/Fibrin scaffolds. The experimental protocol was the same as described in Example 4. Microstructure

(86) FIG. 24 shows the microstructure of Elastin/Collagen (A) and Elastin/Fibrin (B) scaffolds using SEM. Pore size distribution

(87) FIG. 25 shows the pore size of distribution of Elastin/Collagen and Elastin/Fibrin scaffolds. Biological activity

(88) FIG. 26 shows the results of a live/dead assay for Elastin/Collagen and Elastin/Fibrin scaffolds. The experimental protocol was the same as described in Example 1. Angiogenesis

(89) FIG. 27 shows the vascular area for Elastin/Collagen and Elastin/Fibrin scaffolds at day 12. The experimental protocol was the same as described in Example 7.

REFERENCES

(90) ADAIR, G. S., DAVIS, H. F. & PARTRIDGE, S. M. 1951. A Soluble Protein derived from Elastin. Nature, 167, 605-605. ANNABI, N., MITHIEUX, S. M., BOUGHTON, E. A., RUYS, A. J., WEISS, A. S. & DEHGHANI, F. 2009. Synthesis of highly porous crosslinked elastin hydrogels and their interaction with fibroblasts in vitro. Biomaterials, 30, 4550-4557. BANGA, I. 1966. Structure and function of elastin and collagen. BUTTAFOCO, L., KOLKMAN, N., ENGBERS-BUIJTENHUIJS, P., POOT, A., DIJKSTRA, P., VERMES, I. & FEIJEN, J. 2006. Electrospinning of collagen and elastin for tissue engineering applications. Biomaterials, 27, 724-734. DAAMEN, W. F., VEERKAMP, J. H., VAN HEST, J. C. M. & VAN KUPPEVELT, T. H. 2007. Elastin as a biomaterial for tissue engineering. Biomaterials, 28, 4378-4398. GRAY, W. R. 1973. Molecular model for elastin structure and function. Nature, 246, 461-466. HUANG, W., ROLLETT, A. & KAPLAN, D. L. 2015. Silk-elastin-like protein biomaterials for the controlled delivery of therapeutics. Expert Opin Drug Deliv, 12, 779-91. LEACH, J. B., WOLINSKY, J. B., STONE, P. J. & WONG, J. Y. 2005. Crosslinked alpha-elastin biomaterials: towards a processable elastin mimetic scaffold. Acta Biomater, 1, 155-64. NIVISON-SMITH & WEISS 2011 Regenerative Medicine and Tissue Engineering—Cells and Biomaterials Chapter 15—Elastin Based Constructs ISBN978-953-307-663-8 DOI:10.5772/837 MAJD, H., QUINN, T. M., WIPFF, P. J. & HINZ, B. 2011. Dynamic expansion culture for mesenchymal stem cells. Methods Mol Biol, 698, 175-88. RYAN, A. J. & O'BRIEN, F. J. 2015. Insoluble elastin reduces collagen scaffold stiffness, improves viscoelastic properties, and induces a contractile phenotype in smooth muscle cells. Biomaterials, 73, 296-307. SKOPINSKA-WISNIEWSKA, J., KUDERKO, J., BAJEK, A., MAJ, M., SIONKOWSKA, A. & ZIEGLER-BOROWSKA, M. 2016. Collagen/elastin hydrogels cross-linked by squaric acid. Mater Sci Eng C Mater Biol Appl, 60, 100-8. STOKLASOVA, A., RANDOVA, Z., ROCKOVA, V. & LEDVINA, M. 1992. Soluble elastins, their preparation and characterization. Sb Ved Pr Lek Fak Karlovy Univerzity Hradci Kralove, 35, 217-23. ZHANG, D. & KILIAN, K. A. 2013. The effect of mesenchymal stem cell shape on the maintenance of multipotency. Biomaterials, 34, 3962-9.

(91) GHASEMI-MOBARAKEH, LALEH ET AL. 2015 “Structural Properties of Scaffolds: Crucial Parameters towards Stem Cells Differentiation.” World Journal of Stem Cells 7.4 (2015): 728-744. PMC. Web. FU W, LIU Z, FENG B, HU R, HE X, WANG H 2014 Electrospun gelatin/PCL and collagen/PLCL scaffolds for vascular tissue engineering. Int J Nanomedicine.; 9:2335-44. LAKE S P, HADI M F, LAI V K, BAROCAS V H. 2012. Mechanics of a fiber network within a non-fibrillar matrix: model and comparison with collagen agarose co-gels. Annals of biomedical engineering. 40(10):2111-21. AUERBACH R, KUBAI L, KNIGHTON D, FOLKMAN J. 1974. A simple procedure for the long-term cultivation of chicken embryos. Dev Biol.; 41(2):391-4.