Phage-based detection of borreliosis and means therefor

11739388 · 2023-08-29

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention relates to methods of detecting Borrelia burgdorferi sensu lato or for detecting Borrelia associated with Relapsing Fever (RF), kits for carrying out such methods, and methods of treating Borrelia burgdorferi sensu lato or RF infections in a subject. Uses of phage specific for Borrelia are also provided.

Claims

1. A method of determining infection of a subject by either Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia with phage specific for Borrelia by determining presence or the absence of the phage dispensed from and specific to Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in a blood sample derived from the subject infected or suspected of being infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia, the method comprising the steps of: a) extracting phage nucleic acid from the blood sample by i) incubating the Borrelia in ammonium hydroxide and ii) adding phenol-chloroform to the Borrelia and ammonium hydroxide mixture, b) detecting the presence or absence of the phage nucleic acid dispensed from and specific to Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the blood sample obtained from a subject infected or suspected of being infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia; and c) determining the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia infection of the subject wherein detection of the phage specific to either of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample is indicative of infection of the subject of Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia, and the lack of detection of phage dispensed by Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample indicates the subject is not infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia.

2. The method of claim 1, wherein the phage nucleic acid encodes a terminase protein.

3. The method of claim 1, wherein the phage nucleic acid comprises a nucleic acid according to the sequence of: a) SEQ ID NOS: 1-10; or a nucleic acid with greater than or equal to 70-99.5% sequence homology with SEQ ID NOS: 1-10; or a fragment thereof, or wherein the phage nucleic acid is capable of encoding a protein according to any one of SEQ ID NOS: 36-45 or a fragment thereof, or b) SEQ ID NOS: 84 or 86; or a nucleic acid with greater than or equal to 70-99.5% sequence homology with SEQ ID NOS: 84 or 86; or a fragment thereof, or wherein the phage nucleic acid is capable of encoding a protein according to any one of SEQ ID NOS: 85 or 87 or a fragment thereof.

4. The method of claim 1, wherein the phage nucleic acid detected comprises SEQ ID NO. 35; or a nucleic acid with greater than or equal to 70-99.5% sequence homology to SEQ ID NO. 35.

5. The method of claim 1, wherein the sample is plasma or whole blood.

6. The method of claim 1, wherein the sample is one that has been obtained in the early or late stage of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia infection.

7. The method of claim 1, wherein the Borrelia burgdorferi sensu lato may be any of Borrelia afzelii, Borrelia spielmanii, Borrelia valaisiana, Borrelia garinii, Borrelia finlandensis, Borrelia bugdorferi sensu strictu, Borrelia bissettii, Borrelia bavariensis, Borrelia japonica, Borrelia lusitaniae, Borrelia sinica, Borrelia spielmanii, Borrelia tanukii, Borrelia turdi, Borrelia valaisiana, Borrelia yangtze, Borrelia mayonii, Borrelia carolinensis, and Borrelia andersonii, Borrelia lonestari, and Borrelia Americana or any combination thereof.

8. The method of claim 1, wherein the Relapsing Fever Borrelia may be any of Borrelia miyamotoi, Borrelia hermsii, Borrelia recurrentis, Borrelia crocidurae, Borrelia duttoni, Borrelia hispanica, Borrelia parkeri and Borrelia turicatae or any combination thereof.

9. The method of claim 1, wherein the method may determine the presence or the absence of a species ofBorrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample, the method comprising the steps of: a) detecting the presence or absence of the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia species specific phage in the sample; and b) determining the presence of the species of the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample on the basis of the detection of the species specific phage, or the absence of the species of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample on the basis of the lack of detection of the species specific phage.

10. The method of claim 1, wherein the method additionally comprises treatment of a patient for Lyme disease, the patient's sample having tested positive for Borrelia burgdorferi sensu lato.

11. The method of claim 1, wherein the method additionally comprises treatment of a patient for Relapsing Fever, the patient's sample having tested positive for Relapsing Fever Borrelia.

12. The method of claim 10 or 11, wherein treatment comprises administering at least one antibiotic.

13. The method of claim 1 wherein the method further comprises subjecting the isolated nucleic acid to amplification by real time polymerase chain reaction.

14. The method of claim 2 wherein the method further comprises a forward primer which is a nucleic acid comprising SEQ ID NO: 70 to amplify a Borrelia bugdorferi sensu strictu specific terminase gene.

15. The method of claim 14 wherein the method further comprises a reverse primer which is a nucleic acid comprising SEQ ID NO: 71 to amplify the Borrelia bugdorferi sensu strictu specific terminase gene.

16. The method of claim 2 wherein the method further comprises a primer which is a nucleic acid comprising any one of SEQ ID NOS: 88 to 93 to amplify a Borrelia miyamotoi specific terminase gene.

17. The method of claim 16 wherein the method further comprises a forward primer which is a nucleic acid comprising SEQ ID NO: 89 or 92 to amplify the Borrelia miyamotoi specific terminase gene.

18. The method of claim 17 wherein the method further comprises a reverse primer which is a nucleic acid comprising SEQ ID NO: 90 or 93 to amplify the Borrelia miyamotoi specific terminase gene.

Description

(1) The present invention will now be described, by way of example, with reference to the accompanying figures, in which:—

(2) FIG. 1 shows phylogenetic analysis based on the terminase protein showing that the Lyme Borrelia species are closely related to each other but naturally separated from other Borrelia strains. Scale bar represents 0.2 amino acid changes per site.

(3) FIG. 2 shows phylogenetic analysis based on the holin protein showing that the Lyme Borrelia species are closely related to each other but naturally separated from other Borrelia strains. Scale bar represents 0.2 amino acid changes per site.

(4) FIG. 3 shows phylogenetic analysis based on the endolysin protein showing that the Lyme Borrelia species are closely related to each other but naturally separated from other Borrelia strains. The top 10 (from B. Afzelii to B. Valaisiana) are Lyme Borrelia strains, The next 8 (from B. hermsii to B. duttonii) are Relapsing fever Borrelia strains. Scale bar represents 0.2 amino acid changes per site.

(5) FIG. 4 shows phylogenetic analysis based on the portal protein showing that the Lyme Borrelia species are closely related to each other but naturally separated from other Borrelia strains. Scale bar represents 0.2 amino acid changes per site.

(6) FIG. 5 shows phylogenetic analysis shows phylogenetic analysis based on the integrase protein showing that the Lyme Borrelia species are closely related to each other but naturally separated from other Borrelia strains. Scale bar represents 0.2 amino acid changes per site.

(7) FIG. 6 shows the detection limit of the phage-based method of the present invention, based on analysis of bacterial spiked human blood.

(8) FIG. 7 shows the detection limit of the phage-based method of the present invention in comparison to the standard bacterial 16S-based method.

(9) FIG. 8 shows the specificity of the phage-based method according to the present invention for four species of Borrelia burgdorferi sensu lato.

(10) FIG. 9 shows a series of five tenfold dilutions (10.sup.6 down to 10.sup.2 copies) of plasmid DNA carrying the terminase gene fragment. 10 technical repeats were performed for each dilution. As shown, positive amplifications were observed from four diluted plasmid DNA samples down to 10.sup.2 copies.

(11) FIG. 10 shows a linear relationship between the concentration of plasmid DNA template and Ct values across with a strong correlation coefficient (R2=0.99). In addition, the amplification efficiency of BbFAM was 100%.

(12) FIG. 11 shows the performance of the phage-based assay against 222 serum samples of different background (Lyme positive, Lyme negative, Lyme borderline, healthy volunteers).

(13) The present invention will now be described with reference to the following examples, which are by way of illustration alone. The following examples are not intended to completely define or otherwise limit the scope of the invention.

EXAMPLES

(14) Lyme Disease

(15) Borrelia burgdorferi Sensu Lato Isolates

(16) Lab cultures of Borrelia burgdorferi sensu lato (s.l.) strains were provided by professor Sven Bergström (Umeå University, Sweden). Two Borrelia miyamotoi strains were provided by the CDC (Centers for Disease Control and Prevention, USA). The lab strains were maintained in BSKII medium. Routine characterisation was carried out using phase contrast microscope.

(17) PCR and Sequencing

(18) DNA was extracted from serum samples using a novel method of combining ammonium hydroxide and phenol chloroform. 600 μL of samples (was incubated in the presence of 1.2 ml 0.7 M ammonium hydroxide at 100° C. for 5 min, followed by 10 min at 100° C. with the tube open. After the tube was cooled to room temperature, the samples were extracted with the same volume of phenol-chloroform (1:1). After incubation time of 5 min at RT, the solution was centrifuged for 10 min at 18 000 g. The clear supernatant was transferred into a new 2 ml tube and mixed with 0.1 volume of 3 M sodium acetate. This suspension was then mixed with 0.7 volumes of room-temperature isopropanol. DNA was precipitated down by centrifuging at 21 000 g for 10 min at 4° C. After decanting the supernatant, 1.5 ml of room-temperature 70% ethanol was added followed by centrifuging at 21 000 g for 10 min at 4° C. The resulting DNA pellet was briefly air dried for 5 min, and dissolved in 50-100 μl of a suitable buffer (such as elution buffer, EB, which is 10 mM Tris-Cl, pH 8.5).

(19) PCR primers were designed manually against conserved regions in all known Borrelia phage terminase gene sequences. The primers amplify a 194 bp product from 8 lab all Lyme Borrelia burgdorferi s.l. strains. PCRs were carried out in a LabCycler (SensoQuest GmbH, Göttingen, Germany) in a total volume of 50 μl, containing 0.25 mM dNTPs, 3 mM MgCl2, 2 μM primers, 50 ng of template DNA, 0.5 unit of Taq polymerase (Bioline), and 5 μl 10×Taq buffer (Bioline). Amplification conditions were: 94° C. for 2 min, 30 cycles of 94° C. for 45 sec, 48° C. for 45 sec, 72° C. for 1 min, with a final extension of 10 min at 72° C. PCR products were gel-purified using a Qiagen gel extraction kit, and subjected to TOPO TA cloning (Invitrogen). Sequencing was carried out by GATC Biotech. Sequencing results were edited using Chromas 2.33, searched using a nucleotide BLAST (NCBI).

(20) Borrelia burgdorferi Sensu Lato Species Identification

(21) A previous reported Multi locus sequence typing (MLST) scheme was used to distinguish different genotypes of Borrelia.

(22) Phylogenetic Analysis

(23) Phylogenetic analysis were constructed using the program Molecular Evolutionary Genetics Analysis (MEGA) package version 4.1 (Beta) (Tamura et al., 2007; Kumar et al., 2008). Alignment Explorer/CLUSTAL in MEGA 4.1 (Beta) was used to align the DNA sequences. NJ and MP analysis were conducted on a nucleotide data set; for NJ a maximum composite likelihood model was used and for MP a close-neighbour-interchange with a search level of 3 was used. Supports for clades were estimated using a bootstrap analysis implemented in MEGA using 1,000 replicates. The trees were rooted with phage Lambda (NC_001416) as an outgroup.

(24) Nucleic Acid Hybridisation

(25) “Hybridization” refers to the association of two nucleic acid sequences to one another by hydrogen bonding. Typically, one sequence will be fixed to a solid support and the other will be free in solution. Then, the two sequences will be placed in contact with one another under conditions that favour hydrogen bonding.

(26) Factors that affect this bonding include: the type and volume of solvent; reaction temperature; time of hybridization; agitation; agents to block the non-specific attachment of the liquid phase sequence to the solid support (Denhardt's reagent or BLOTTO); concentration of the sequences; use of compounds to increase the rate of association of sequences (dextran sulphate or polyethylene glycol); and the stringency of the washing conditions following hybridization.

(27) “Stringency” refers to conditions in a hybridization reaction that favour association of very similar sequences over sequences that differ. For example, the combination of temperature and salt concentration should be chosen that is approximately 120 to 200° C. below the calculated Tm of the hybrid under study. The temperature and salt conditions can often be determined empirically in preliminary experiments in which samples of genomic DNA immobilized on filters are hybridized to the sequence of interest and then washed under conditions of different stringencies. See Sambrook et al. at page 9.50.

(28) Variables to consider when performing, for example, a Southern blot are (1) the complexity of the DNA being blotted and (2) the homology between the probe and the sequences being detected. The total amount of the fragment(s) to be studied can vary a magnitude of 10, from 0.1 to 1 mg for a plasmid or phage digest to 10-9 to 10-8 g for a single copy gene in a highly complex eukaryotic genome. For lower complexity polynucleotides, substantially shorter blotting, hybridization, and exposure times, a smaller amount of starting polynucleotides, and lower specific activity of probescan be used. For example, a single-copy yeast gene can be detected with an exposure time of only 1 hour starting with 1 mg of yeast DNA, blotting for two hours, and hybridizing for 4-8 hours with a probe of 108 cpm/mg.

(29) For a single-copy mammalian gene a conservative approach would start with 10 mg of DNA, blot overnight, and hybridize overnight in the presence of 10% dextran sulphate using a probe of greater than 108 cpm/mg, resulting in an exposure time of 24 hours.

(30) Several factors can affect the melting temperature (Tm) of a DNA-DNA hybrid between the probe and the fragment of interest, and consequently, the appropriate conditions for hybridization and washing. In many cases the probe is not 100% homologous to the fragment. Other commonly encountered variables include the length and total G+C content of the hybridizing sequences and the ionic strength and formamide content of the hybridization buffer. The effects of all of these factors can be approximated by a single equation: where Ci is the salt concentration (monovalent ions) and n is the length of the hybrid in base pairs (slightly modified from Meinkoth & Wahl (1984) Anal. Biochem. 138: 267-284).

(31) In designing a hybridization experiment, some factors affecting nucleic acid hybridization can be conveniently altered. The temperature of the hybridization and washes and the salt concentration during the washes are the simplest to adjust. As the temperature of the hybridization increases (i.e. stringency), it becomes less likely for hybridization to occur between strands that are no homologous, and as a result, background decreases. If the radiolabeled probe is not completely homologous with the immobilized fragment (as is frequently the case in gene family and interspecies hybridization experiments), the hybridization temperature must be reduced, and background will increase. The temperature of the washes affects the intensity of the hybridizing band and the degree of background in a similar manner. The stringency of the washes is also increased with decreasing salt concentrations.

(32) In general, convenient hybridization temperatures in the presence of 50% formamide are 42° C. for a probe with is 95% to 100% homologous to the target fragment, 37° C. for 90% to 95% homology, and 32° C. for 85% to 90% homology. If the homology between the probe and the target fragment are not known, the simplest approach is to start with both hybridization and wash conditions which are nonstringent. If non-specific bands or high background are observed after autoradiography, the filter can be washed at high stringency and re-exposed. If the time required for exposure makes this approach impractical, several hybridization and/or washing stringencies should be tested in parallel. Nucleic acid Probe Assays.

Example 1: Efficacy of Phage-Based Test, as Shown in Spiked Blood

(33) A known number of cells of Borrelia burgdorferi s.s. B31 strain (1000, 100, 10, and 1 cell/cell) were added into 1 ml of commercial available healthy human whole blood (3 replicas). Total DNA was extracted from 100 μl of the spiked blood, respectively using the Qiagen blood and tissue kit. The extracted DNA was then used as a template for PCR amplification of the terminase gene (primers used were as shown in SEQ ID No. 70 and 71—forward and reverse).

(34) As clearly demonstrated in the gel picture shown in FIG. 6, the PCR products were seen in the DNA from blood samples spiked with 100 cells or more of the B31 strain. This showed that 100 Borrelia cells will be needed to generate a positive terminase PCR test. This also demonstrated that the terminase PCR detection limit is 100 Borrelia/ml of blood, this concentration reflects the normal Borrelia concentration in Lyme patients. No terminase PCR product can be seen from the total DNA extracted from whole blood without Borrelia spiking (see lanes marked blood only). A false signal for the presence of detection was not found.

(35) Comparison with Known Methodologies

(36) The present invention, as described above, using the terminase PCR targeting B. burgdorferi s.l. was practiced on samples with known concentrations of Borrelia burgdorferi strain B31. The sensitivity of the present test was compared with bacteria-based PCR, our terminase PCR targeting B. burgdorferi s.l. phage-based PCR. The test of the present invention showed a markedly higher sensitivity compared to the known test, and could detect bacteria at a concentration ˜1 bacterium per ml (see Table 1).

(37) TABLE-US-00008 TABLE 1 Current bacterial PCR Number of Borrelia based on bacterial bacteria/ml 5S-23S Leicester phage PCR <100 Positive Positive <10 Weak signal Positive <1 Negative Positive

Conclusion

(38) The phage-based PCR was positive against Lyme Borrelia suspension with a concentration of less than 1 bacterium per ml, while the bacterial PCR was negative.

Example 2: Comparative Study of Methods of Present Invention with Conventional 16sPCR Method

(39) Four individual Borrelia burgdorferi B31 cultures were diluted to 10 Borrelia/ml, 100 μl of these diluted cultures were then subjected to DNA extraction using the Qiagen blood and tissue kit. The resulting extracted DNA was then used as a template for PCR amplification of the terminase gene (primers used were as shown in SEQ ID No. 70 and 71—forward and reverse) and as a template for PCR amplification of the 16S (a bacterial gene for ribosomal RNA, commonly as a molecular diagnostic tool for detecting presence of absence of bacteria). As can be seen in the gel picture shown in FIG. 7, two strong positive results were seen with terminase PCR, while only one weak positive with 16S PCR was identified. The leftmost two lanes are PCR negatives (ie did not include starting material derived from cultures), the rightmost lane is PCR positive (ie included a high concentration of bacterial cells).

Conclusion

(40) This example demonstrated that the efficiency of terminase PCR is higher than 16S PCR.

Example 3: Demonstrate of Test According to Present Invention on Different Borrelia Burgdorferi s.l. Species

(41) Terminase PCR was carried out against a set of different Borrelia genotypes (different isolates).

(42) The gel picture of FIG. 8 shows the results of this PCR: B31=Borrelia burgdorferi B31; the numbers are Borrelia strains as shown in the table below:

(43) TABLE-US-00009 TABLE 2 Isolate names Scientific names 3 VS185 P9 Borrelia burgdorferi s.s. 4 NE218 Borrelia valaisiana 5 ACA1 Borrelia afzelii 6 UK filtered Borrelia burgdorferi s.s. 7 190 P9 Borrelia garinii 8 China23 Borrelia burgdorferi s.s.

(44) This demonstrated that this terminase PCR technique of the present invention can amplify the four key strains of Borrelia burgdorferi s.l. group, which are Burgdorferi, afzelii, and valaisiana. This terminase PCR technique was also applied to other bacteria, such as Clostridium difficile, Burkholderia thailandensis, E. coli, Salmonella, legionellae, and haemophilia strains. None of these bacteria generated any PCR product with terminase primer.

(45) Further analysis was carried out to determine the efficiency of the method to distinguish between Lyme Borrelia and relapsing fever Borrelia strains.

(46) Primers and TaqMan probes (Table 3) were designed based on the B. burgdorferi terminase gene sequence (GenBank accession NC 000948.1) using PrimerQuest® Tool (IDT). To ensure the specificity of the primer/probe combinations (referred to as ‘BbFAM’), BLAST analysis using sequences submitted to GenBank was performed. All hits with e-value <0.01 were Lyme Borrelia species dominated by B. burgdorferi with one hit of each of the following Borrelia strains: B. mayonii, B. garinii, B. afzelii, B. bisettii, and B. valasiana. In addition, ‘In silico’ was performed against all the available bacterial species, PCR product of the correct sizes was only observed from plasmid fractions of Borrelia burgdorferi. This demonstrated that the primer/probe combinations can detect the Lyme Borrelia strains. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™. Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Both primers, the probe and PrimeTime Gene Expression Master Mix were supplied by IDT.

(47) TABLE-US-00010 TABLE 3 Sequences of primers and probes for terminase real-time PCR (BbFAM) Expected amplicon GeneBank Sequence (5′ to 3′) size (bp) accession no. Probe TGCTGGGTCTAAATATGCTATCGGGC 147 NC_000948.1 (SEQ ID NO. 81) Primer F GAGTGGATAGCAAGCACTGAT (SEQ ID NO. 79) PrimerR ATCATCAACTCGCTCCATAACA (SEQ ID NO. 80)

(48) As seen in table 4, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. All Lyme Borrelia strains (1-6) tested generated a positive PCR with a threshold cycle (Ct) value <30. No Ct value can be detected from Relapsing fever Borrelia strains. Apart from ‘in silico’ PCR, ‘wet experiment’ was also carried out to confirm that no PCR products were observed when BbFAM PCR was performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.

(49) TABLE-US-00011 TABLE 4 BbFAM PCR against different Lyme Borrelia and Relapsing fever Borrelia strains. Isolate Names Scientific Names BbFAM PCR results 1 VS185 P9 Borrelia burgdorferi Positive 2 NE218 Borrelia valasiana Positive 3 ACA1 Borrelia afzelii Positive 4 UK filtered Borrelia burgdorferi Positive 5 190 P9 Borrelia garinii Positive 6 China23 Borrelia burgdorferi Positive 7 1120 Borrelia duttonii Negative 8 Her HS1 Borrelia hemsii Negative 9 CA128 Borrelia bisettii Negative 10 HT31 Borrelia miyamotoi Negative 11 FR64b Borrelia miyamotoi Negative

(50) To test the robustness, efficiency and the limit of detection (LOD) of the BbFAM PCR, a series of five tenfold dilutions of a plasmid carrying terminase gene fragment were amplified with BbFAM. To construct a standard for real time PCR, a plasmid carrying the terminase gene fragment was made. This plasmid served as the positive control and helped the calculations of the copy numbers in each PCR. The terminase plasmid was constructed as described below:

(51) PCR primers were designed using Primer Blast against terminase gene sequence (SEQ ID No 1). The primers were FTer721:AGACTAAGATGCGGGCAAGA (SEQ ID NO. 82) and RTer721:TTGCATCAAGAGCGTCATCA (SEQ ID NO. 83). A 721 bp PCR product was generated. PCRs were carried out in a LabCycler (SensoQuest GmbH, Göttingen, Germany) in a total volume of 50 μl, containing 0.25 mM dNTPs, 3 mM MgCl2, 3 μM primers, 50 ng of template DNA, 0.5 unit of Taq polymerase (Bioline), and 5 μl 10×Taq buffer (Bioline). Amplification conditions were: 94° C. for 2 min, 30 cycles of 94° C. for 30 sec, 50° C. for 30 sec, 72° C. for 1 min, with a final extension of 10 min at 72° C. PCR products were gel-purified using a Qiagen gel extraction kit, and subjected to cloning using NEB® PCR Cloning Kit according to the standard protocol. The positive clones were confirmed by PCR and sequencing. The resulting plasmid carrying terminase gene fragments were purified using Qiagen plasmid kit and used as positive controls. The concentration of DNA was measured with a Qubit Fluorometer (Invitrogen). The copy number of the plasmid DNA with the terminase gene fragment was calculated according the following formula (available online):

(52) Number of copies = 6.022 × 10 23 ( copies / mol ) × DNA amount ( ng ) DNA length ( bp ) × 10 9 ( ng / g ) × 650 ( g / mol / bp )

(53) To work out the limit of detection (LOD) of the Taqman real time PCR, firstly 10-fold serial dilutions of the plasmid DNA carrying terminase fragment were tested to evaluate the performance of Taqman PCR. Each dilution (10.sup.6-10.sup.2) was tested by BbFAM PCR with five replicates (Table 5).

(54) Next, the plasmid DNA was diluted from 1000 copies numbers to 100, 80, 60, 40, 20, 10, 5, and 1 copies/PCR. Ten replicates were used for each dilution. Probit analysis in SPSS was performed to calculate the LOD of 32 copies of plasmids with 95% probability.

(55) The results were summarised in the following two tables:

(56) TABLE-US-00012 TABLE 5 Taqman real time PCR performance on plasmid DNA carrying terminase gene fragment Copy number/PCR Average Ct 10.sup.6 20.63 10.sup.5 24.32 10.sup.4 28.03 10.sup.3 31.12 10.sup.2 34.27

(57) TABLE-US-00013 TABLE 6 Determination of LOD of Taqman real time PCR (10 replicates for each dilution) Number of PCR positive Copy number/PCR Number of replicates replicates (% of positive) 100 10 10 (100%) 80 10 10 (100%) 60 10 10 (100%) 40 10 10 (100%) 20 10 6 (60%) 10 10 5 (50%) 5 10 2 (20%) 1 10 0

(58) The LOD determined by Probit analysis with 95% probability was 30 copies of plasmid DNA.

(59) The copy numbers of plasmid DNA template per PCR ranged from 10.sup.6 to 10.sup.2. As shown in FIG. 10, positive amplifications were observed from all the plasmid DNA samples. As shown in FIG. 11, a linear relationship between the concentration of DNA template and Ct values across with a strong correlation coefficient (R.sup.2=0.99). In addition, the amplification efficiency of BbFAM was 100%. This demonstrated the high sensitivity and efficiency of the PCR.

(60) To rule out the possibility of human DNA interference, human DNA and healthy whole blood were purchased from Sigma. Total DNA was extracted from the healthy whole blood. Both DNAs were examined using BbFAM PCR. No Ct values were observed from any PCRs, while positive PCR targeting human housekeeping genes RNase P produced positives. This confirmed that the human DNA had no effect on BbFAM PCR.

Conclusion

(61) This experiment demonstrated that this terminase PCR is specific for Borrelia burgdorferi sensu lato and that using real time sequencing, the test has a very low limit of detection (LOD).

(62) PCR primers for holin, endolysin and for amplifying the region which contains both these genes (SEQ ID NO. 72-77; the region containing both genes=SEQ ID NO. 78) have also been demonstrated to be able to amplify the correct regions of Lyme Borrelia.

Example 4: Comparative Study of Methods of Present Invention with Conventional 16sPCR Method Practiced in Serum Sample

(63) Five Lyme-positive serum samples (S1-S5) (as tested and confirmed by antibody and clinical presentation tests) were subjected to DNA extraction using Qiagen Blood and tissue kit. The DNAs were then analysed using both terminase (top panel) and 16S (bottom panel) PCR primers, respectively (in the case of terminase, primers used were as in SEQ ID No. 70 and 71). As seen in the gel pictures shown in FIG. 9, four PCR positive results were observed for terminase (S1, S2, S4 and S5), while only two positive can be seen for 16S (S2 and S3). This was a pilot study prior to real time PCR experiments performed with large scale clinical trials (see below).

Conclusion

(64) This example demonstrated that terminase PCR has a much higher sensitivity than techniques based on 16s. +=control, a high concentration of bacterial cells.

Example 5: Clinical Results

(65) The sensitivity of the BbFAM PCR was also investigated against 222 serum samples, which are all derived from clinically-confirmed Lyme patients (among those patients, 91 of patients have ELISA and or Western Blot data).

(66) 207 out of the 222 patients showed BbFAM PCR positive, representing a sensitivity of 93.2%.

(67) 91 out of 222 patients had been examined by either ELISA and/or WB.

(68) Out of the 91 patients, 16 of them showed ELISA and/or WB positive, representing a sensitivity of 17.6%. Out of these 91 patients, 85 showed positive to BbFAM PCR, representing a sensitivity of 93.4%, which agrees well with the sensitivity calculated based on 222 patients. If you look into the correlation between BbFAM PCR results to the ELISA/WB data, you will find that the 16 ELISA and/or WB positive patients all showed BbFAM PCR positive. In addition, 6 patients from the 91 patient cohort who displayed BbFAM PCR negative also showed ELISA/WB negative. The vast majority of clinically confirmed patients in the 91 cohort only showed positive to BbFAM PCR, but negative to ELISA/WB, an indication of high sensitivity and reliability of BbFAM PCR. To compare the sensitivity of BbFAM with the current commercial Lyme PCR detection kit, GeneProof Borrelia burgdorferi PCR Kit was applied to 65 serum samples that were randomly selected from the 222 cohort. Only 7 out of 65 serum samples showed positive to GeneProof kit (a sensitivity of 10.8%).

SUMMARY

(69) This is the first study to use a molecular marker to investigate the distribution and diversity of Borrelia phages.

(70) A phylogentic tree constructed by the inventors on phage terminase gene shows that it is a good phylogenetic marker because the Borrelia phage sequences form a discrete yet genetically diverse group which is clearly separated from other spirochetes. Lyme disease infection (ie Borrelia burgdorferi sensu lato infection) forms a discrete well supported clade and these correlate well with bacteria.

(71) Summary for Lyme Disease 1) Overall ability to identify LD much higher sensitivity compared to bacterial 16S method. In addition, the clinical results also demonstrate that the phage terminase-based real time PCR is significantly more sensitive than bacterial 16S-based PCR (GeneProof PCR kit). 2) Relates to multiple species of Borrelia burgdorferi sensu lato (Table 4: Phage terminase-based real time PCR against different Lyme Borrelia and Relapsing fever Borrelia strains) 3) Early detection possible as the phage based test can detect a low concentration of bacteria. The real time PCR has a low detection limit of 30 copies of terminase gene.

Relapsing Fever

Example 6: Differentiation of Relapsing Fever (Borellia Hermsii) from Lyme Disease

(72) Primers and TaqMan probes (Table 8) were designed based on the B. hermsii terminase gene sequence using PrimerQuest® Tool (IDT). To ensure the specificity of the primer/probe combinations (referred to as ‘BhFAM’), BLAST analysis using sequences submitted to GenBank was performed. Big E-value drops were observed from 0.000004 to 0.004 between B. hermsii hit and the next closest blast hit of B. turicatae and B. parkeri.

(73) ‘In silico PCR’ was performed against all the available bacterial species, PCR product of the correct sizes was only observed from Borrelia hermsii. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™ Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Both primers, the probe and PrimeTime Gene Expression Master Mix were supplied by IDT. by IDT.

(74) TABLE-US-00014 TABLE 8 Sequences of primers and probe targeting terminase gene in B. hermsii (BhFAM) Expected amplicon GeneBank Sequence (5′ to 3′) size (bp) accession no. Probe AGGCACCAATAGCATATTTAGATCCTGCA 124 CP014792.1 Primer F GGAGAATGGGTTGCGTCATA Primer R GCGCAGTATTATCACCTCCAATA

(75) As seen in table 9, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. No positive can be seen from all Lyme Borrelia strains (1-6) and other relapsing fever Borrelia strains. Only B. hermsii generated the correct PCR product. Apart from ‘in silico’ PCR, ‘wet experiment’ was also carried out to confirm that no PCR products were observed when BhFAM PCR was performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.

(76) TABLE-US-00015 TABLE 9 BhFAM PCR against different Lyme Borrelia and Relapsing fever Borrelia strains Isolate Names Scientific Names BbFAM PCR results 1 VS185 P9 Borrelia burgdorferi Negative 2 NE218 Borrelia valasiana Negative 3 ACA1 Borrelia afzelii Negative 4 UK filtered Borrelia burgdorferi Negative 5 190 P9 Borrelia garinii Negative 6 China23 Borrelia burgdorferi Negative 7 1120 Borrelia duttonii Negative 8 Her HS1 Borrelia hermsii Positive 9 CA128 Borrelia bisettii Negative 10 HT31 Borrelia miyamotoi Negative 11 FR64b Borrelia miyamotoi Negative

Example 7: Differentiation of Relapsing Fever (Borrelia miyamotoi) from Lyme Disease

(77) Two sets of primers and TaqMan probes were designed based on two B. miyamotoi terminase genes using PrimerQuest® Tool (IDT) with manual inspection (referred to as ‘BmFAM’ and ‘Bm-2FAM’, respectively as shown in the Table 10). Both sets target different versions of terminase genes located on different plasmids, therefore they are complementary to each other in detecting B. miyamotoi. To ensure the specificity of the primer/probe combinations, BLAST analysis using sequences submitted to GenBank was performed. Big E-value drops were observed for both sets of Taqman probes. For example, BmFAB and Bm-1FAM showed E-value drops from 0.0002 to 0.79 and 0.006 to 1.6, respectively, between miyamotoi hits and the next closest blast hit. ‘In silico PCR’ (http://insilico.ehu.es/PCR/) was performed against all the available bacterial species, PCR product of the correct sizes was only observed from Borrelia miyamotoi. This demonstrated specificity of the primer/probe combinations in detecting B. miyamotoi strains. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™. Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Primers, probes and PrimeTime Gene Expression Master Mix were supplied by IDT.

(78) TABLE-US-00016 TABLE 10 Two sets of primer/probes (BmFAM and Bm-2FAM) targeting terminase genes in Borrelia miyamotoi strains Expected amplicon GeneBank Sequence (5′ to 3′) size (bp) accession no. BmFAM Probe AGTGCACTTTGTGTGCTTGAAATGGT 120 CP004220.1 Primer F AGCCTACCTAGATCCTGCTTAT Primer R GGGTCACTTGCTGGTAGTTT Bm-2FAM Probe ACGCTTCAGAGGCTCTAATTCTG  87 CP017131.1 Primer F GTGGAGATAAGGCAAGTGA Primer R CTTTATGAAGAGTAGTTGCTTC

(79) As seen in table 11, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. No Ct value can be detected from all Lyme Borrelia strains (1-6) and relapsing fever Borrelia strains. PCR positive can only be observed in B. miyamotoi DNA. In addition, no PCR products were observed when both sets of primer/probe were performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.

(80) TABLE-US-00017 TABLE 11 BmFAM and Bm-2FAM PCR against different Lyme Borrelia and Relapsing fever Borrelia strains. Isolate Names Scientific Names BbFAM PCR results 1 VS185 P9 Borrelia burgdorferi Negative 2 NE218 Borrelia valasiana Negative 3 ACA1 Borrelia afzelii Negative 4 UK filtered Borrelia burgdorferi Negative 5 190 P9 Borrelia garinii Negative 6 China23 Borrelia burgdorferi Negative 7 1120 Borrelia duttonii Negative 8 Her HS1 Borrelia hermsii Negative 9 CA128 Borrelia bisettii Negative 10 HT31 Borrelia miyamotoi Positive 11 FR64b Borrelia miyamotoi Positive

(81) As a pilot study, 43 tubs of blood/serum samples derived from healthy volunteers and Lyme patients were randomly chosen and subjected to test agasint BmFAM and BbFAM, respectively. Results were as follows: 7 (16.3%) tubes showed positive to BmFAM, while 26 (60.5%) showed positive to BbFAM. This demonstrated a potential low level of B. miyamotoi carriage in the population. Large scale clinical validation is on-going.

(82) Summary for Relapsing Fever 1) The phage-based test can specifically amplify RF Borrelia strains, and didn't amplify LD Borrelia strains. This makes it possible to design a phage terminase-based duplex PCR to diagnose LD and RF at the same time. 2) The phage-based RF tests have the ability to distinguish different RF Borrelia strains, such as B. miyamotoi and B. hermsii. This would enable clinicians to better manage and prescribe antibiotics once the RF species was known. With a fully validated phage-based RF test, clinicians would be better informed about which Borrelia species are causing the symptoms. 3) As a result of these successful initial validation results, large scale clinical validation is currently under way.