PCR primer pair and application thereof

Abstract

Provided are a PCR primer pair and an application thereof. The PCR primer pair comprises: a first primer and a second primer, wherein the first primer comprises a first specific sequence and a first random sequence; the first specific sequence is located on end 3′ of the first primer, and the first random sequence is located on end 5′ of the first primer; the second primer comprises a second specific sequence and a second random sequence, the second specific sequence is located on end 3′ of the second primer, and the second random sequence is located on end 5′ of the second primer; moreover, the first specific sequence and the second specific sequence are an upstream primer and a downstream primer directed to a target sequence, respectively; the first random sequence and the second random sequence are reverse complementary; a predetermined restriction enzyme cutting site is connected between the first specific sequence and the first random sequence; and a predetermined restriction enzyme cutting site is connected between the second specific sequence and the second random sequence.

Claims

1. A PCR primer pair, comprising a first primer and a second primer, wherein the first primer comprises a first specific sequence and a first random sequence, and the second primer comprises a second specific sequence and a second random sequence, wherein the first specific sequence is located at the 3′ end of the first primer and the first random sequence is located at the 5′ end of the first primer, the second specific sequence is located at the 3′ end of the second primer and the second random sequence is located at the 5′ end of the second primer, the first specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for a target sequence, the first random sequence and the second random sequence are reversely complementary, the first specific sequence is connected to the first random sequence via a first predetermined restriction enzyme cutting site, the second specific sequence is connected to the second random sequence via a second predetermined restriction enzyme cutting site, and the target sequence of the PCR primer pair does not comprise any predetermined restriction enzyme cutting site, wherein the first random sequence and the second random sequence each have a length of 15-45 bp, and the first specific sequence and the second specific sequence each have a length of 15-30 bp, wherein the first predetermined restriction enzyme cutting site and the second predetermined restriction enzyme cutting site each are a uracil (U) base site.

2. The PCR primer pair according to claim 1, wherein the 1.sup.st-5.sup.th bases from each of the 5′ end and the 3′ end of the first primer respectively have thio-modification, and the 1.sup.st-5.sup.th bases from each of the 5′ end and the 3′ end of the second primer respectively have thio-modification.

3. The PCR primer pair according to claim 2, wherein the thio-modification is selected from phosphorothioate modification and methyl-sulfate modification.

4. The PCR primer pair according to claim 1, wherein the first primer has a sequence as shown in SEQ ID NO.: 1-18, and the second primer has a sequence as shown in SEQ ID NO.: 19-36.

5. The PCR primer pair according to claim 1, wherein the first primer and the second primer each have a length of 30-70 bp.

6. The PCR primer pair according to claim 1, wherein the 1.sup.st-5.sup.th bases from each of the 5′ end and the 3′ end of the first primer respectively have a peptide nucleic acid modification.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The above and/or additional aspects and advantages of the present disclosure will become apparent and easily understood from the description of the embodiments in combination with the following drawings, in which

(2) FIG. 1 is a schematic diagram showing the structure of a PCR primer pair (i.e. a padlock primer) of the present disclosure according to an embodiment of the present disclosure;

(3) FIG. 2 is a schematic diagram showing the structure of a PCR primer pair (i.e. a padlock primer) of the present disclosure according to another embodiment of the present disclosure;

(4) FIG. 3 is a schematic diagram showing binding between primer and newly-generated strand in the circular amplification of the present disclosure according to an embodiment of the present disclosure;

(5) FIG. 4 is a schematic flow chart showing preparation of a linear library by using the PCR primer pair of the present disclosure according to an embodiment of the present disclosure;

(6) FIG. 5 is a graph showing results of fragment analysis and qubit quantitative detection of target libraries of various samples obtained in Example 1;

(7) FIG. 6 is a graph showing statistic results (i.e. uniformity detection results) of sequencing reads of different amplicon in target libraries of various samples obtained in Example 1; and

(8) FIG. 7 is a graph showing comparison results (i.e. stability detection results) of depth at a same position in two experiments in Example 1.

DETAILED DESCRIPTION

(9) Embodiments of the present disclosure are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are intended to be illustrative and for explanation of the present disclosure, which cannot be construed as limiting.

(10) It should be noted, the terms “first” and “second” are used for purposes of description and are not intended to indicate or imply relative importance or significance or impliedly indicate quantity of the technical feature referred to. Thus, the feature defined with “first” and “second” may comprise one or more this feature either explicitly or implicitly. Further, in the description of the present disclosure, “a plurality of” means two or more than two, unless specified otherwise.

PCR Primer Pair

(11) In a first aspect, the present disclosure in embodiments provides a PCR primer pair. According to embodiments of the present disclosure, the PCR primer pair comprises a first primer and a second primer, in which, the first primer comprises a first specific sequence and a first random sequence, and the second primer comprises a second specific sequence and a second random sequence, in which the first specific sequence is located at the 3′ end of the first primer and the first random sequence is located at the 5′ end of the first primer, the second specific sequence is located at the 3′ end of the second primer and the second random sequence is located at the 5′ end of the second primer, the first specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for a target sequence, the first random sequence and the second random sequence are reversely complementary, the first specific sequence is connected to the first random sequence via a first predetermined restriction enzyme cutting site, the second specific sequence is connected to the second random sequence via a second predetermined restriction enzyme cutting site, and the target sequence of the PCR primer pair does not comprise any predetermined restriction enzyme cutting site. The present inventors have surprisingly found that the PCR primer pair of the present disclosure can effectively reduce the GC bias during PCR amplification, thus increasing amplification specificity. Specifically, use of conventional primers will result in GC bias to some extent during PCR amplification of the next-generation sequencing library, but the PCR primer pair of the present disclosure (sometimes referred to as “Padlock Primer”) is capable of effectively reducing the GC bias during library PCR amplification. Moreover, for the PCR primer pair of the present disclosure, insertion of a predetermined restriction enzyme cutting site which is a sequence not comprised in a target sequence between the conventional primer and the complementary sequence, is capable of efficiently removing the conventional primer and the complementary sequence after PCR by cleaving the predetermined restriction enzyme cutting site of amplified products, thus facilitating subsequent library construction and purification. Furthermore, the enzyme-cleaved product is phosphorylated at the 5′ end and has an overhang of Adenine (A) at the 3′ end, which does not require additional end repair and can be directly used in adaptor ligation.

(12) Further, the PCR primer pair of the present disclosure is particularly suitable for multiplex PCR amplification, that is, the PCR primer pairs of the present disclosure designed for a plurality of target sequences, can be effectively mixed, that is, for multiplex PCR. This is based on 1) extremely high specificity of the PCR primer pair of the present disclosure; and 2) different and unique complementary random sequences of individual primer pairs for different amplification regions and same complementary random sequences of primer pair for same amplification regions, thus avoiding mutual interference between primers that are used for different amplification regions, and contributing to inhibiting the production of non-specific products.

(13) It should be noted that the “first random sequence” and the “second random sequence” of the present disclosure may be unfixed or fixed sequences as long as they are reversely complementary to each other.

(14) According to embodiments of the present disclosure, the first specific sequence and the second specific sequence each have a TM value of 55-65° C., and the first primer and the second primer each have a TM value of 65-75° C. Thus, the PCR reaction is subjected to a first round of linear amplification under a low annealing temperature of 55-65° C., followed by a second round of circular amplification under a high annealing temperature of 65-72° C. in subsequent cycles. During the circular amplification, the specific sequence of primer cannot bind to the specific site of templates directly because the specific sequence has a TM value of 55-65° C. which is lower than the high annealing temperature of circular amplification. Such a circular amplification can be effectively performed only when the 5′ end and the 3′ end of the padlock primer bind to the 5′ end and the specific site of templates respectively, i.e. performing the circular amplification through two recognition-site binding.

(15) The PCR primer pair of the present disclosure is suitable for PCR amplification and library construction for any form of DNA sample to be tested. It should be noted that the “DNA sample to be tested” described in the present disclosure is somewhat different from the conventional understanding which does not include treated DNA. However, in the present disclosure, the “DNA sample to be tested” may include both treated DNA and untreated DNA. Generally, during construction of sequencing library, the genomic DNA of sample will be fragmented and added with adaptor for sequencing, thus obtaining DNA fragments carrying sequencing adaptors corresponding to a sequencing platform, which will be subjected to subsequent amplification and other steps for obtaining sequencing products. Such a DNA fragment carrying sequencing adaptor corresponding to a sequencing platform is called as the “treated DNA”. Correspondingly, DNA fragments which are not treated according to the method as described above are called the “untreated DNA”. If the PCR primer pair of the present disclosure is for untreated DNA, specific target fragments can be amplified; but if the PCR primer pair of the present disclosure is for treated DNA, whole genomic DNA fragments can be amplified.

(16) According to some embodiments of the present disclosure, when the DNA sample to be tested is the treated DNA which carries a universal sequence, such as a sequencing adaptor, the first specific sequence and the second specific sequence have to specifically recognize a target sequence carrying the universal sequence accordingly, that is, the target sequence actually consists of a universal sequence and a target region sequence, in which the “universal sequence” herein means a sequence complement with the specific sequence of the PCR prime pair, including adaptor sequence for a sequencing platform, i.e. a sequencing adaptor. When the DNA sample to be tested is DNA fragments which do not carry a universal sequence, i.e. template for PCR reaction, the first specific sequence and the second specific sequence have to specifically recognize the target sequence accordingly. Meanwhile, if a sequencing library is required to be constructed, adaptor sequence for sequencing (i.e. a universal sequence) can be inserted into the random sequence or between the specific sequence and the random sequence for the first primer and the second primer respectively, so that PCR amplification products can be ligated with adaptors, thus can be effectively used in sequencing platforms.

(17) According to further embodiments of the present disclosure, at least one of the first primer and the second primer further comprises a tag sequence, by which a plurality of samples can be subjected to PCR amplification simultaneously, and the samples can be distinguished by corresponding tag sequences. The position of the tag sequence in the first primer and the second primer is not particularly limited as long as the tag sequence can distinguish different samples without affecting PCR amplification. According to some specific examples of the present disclosure, the tag sequence may be located between a specific sequence and a random sequence, by which a first tag sequence may be arranged between the first specific sequence and the first random sequence of the first primer, and/or a second tag sequence may be arranged between the second specific sequence and the second random sequence of the second primer. According to another embodiment of the present disclosure, the tag sequence may also be arranged within the random sequence, i.e. forming a part of the random sequence, by which, exhibiting the function of distinguishing different samples without affecting PCR amplification as well.

(18) According to embodiments of the present disclosure, the first random sequence and the second random sequence each have a length of 15-45 bp, and the first specific sequence and the second specific sequence each have a length of 15-30 bp.

(19) According to embodiments of the present disclosure, the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the first primer are respectively subjected to modification, and the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the second primer are respectively subjected to modification, so as to effectively prevent from cleavage by exonuclease. According to some specific examples of the present disclosure, the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the first primer are respectively subjected to thio-modification, and the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the second primer are respectively subjected to thio-modification.

(20) According to some embodiments of the present disclosure, the type of thio-modification is not particularly limited as long as the first primer and the second primer can be prevented from cleavage by exonuclease, such as cleavage by 5-3′ exonuclease or 3-5′ exonuclease. According to some specific examples of the present disclosure, the thio-modification is any one selected from phosphorothioate modification, methyl-sulfate modification and peptide nucleic acid modification.

(21) According to an embodiment of the present disclosure, the first predetermined restriction enzyme cutting site and the second predetermined restriction enzyme cutting site each are a uracil (U) base site cleaved by the USER enzyme. Thus, since the target sequence does not include the U base site cleaved by the USER enzyme, it is possible to efficiently remove the conventional primer and the complementary sequence after PCR by cleaving the predetermined restriction enzyme cutting site of amplified products via the USER enzyme, thus facilitating subsequent library construction and purification.

(22) In addition, it should be noted, referring to FIG. 1 which shows the schematic structure of the PCR primer pair of the present disclosure, the design strategy of the PCR primer pair of the present disclosure includes addition of a pair of complementary sequences at the 5′-ends of a conventional primer pair (including a forward primer and a reverse primer), thus forming a PCR primer pair (i.e. Padlock Primer, PP) which is reversely complementary at the 5′ end and overhanging at the 3′ end, in which two primers of the padlock primer pair form a stable primer-dimer structure, and the complementary sequences may be unfixed or fixed sequences. The first primer and the second primer of the PCR primer pair each have a length of 30-70 bp, and have a high TM value, generally of 65-75° C. The complementary sequences (i.e. the first random sequence and the second random sequence, being unfixed or fixed sequences) at the 5′-end of the padlock primer pair each have a length of 15-45 bp. The first specific sequence and the second specific sequence at the 3′-ends of the padlock primer pair, which are complementary to target sequences of a template, each have a length of 15-30 bp, and have a low TM value, generally of 55-65° C.

(23) Further, for the application of the PCR primer pair of the present disclosure, the PCR primer pair of the present disclosure is subjected to two different amplification processes (i.e. two rounds of amplification) to complete the PCR amplification, referring to FIG. 3, in the first round of amplification, the annealing temperature is 55-65° C. and the cycle number is 1; and in the second round of amplification, the annealing temperature is 65-72° C. and the cycle number is 5-35. During the first round of amplification, only the specific sequence at the 3′ end of the PCR primer pair can bind to template, thus the annealing temperature in this round is low. During the second round of amplification, the newly-generated template (i.e. the product of the first round of amplification) is firstly paired with the complementary sequence at the 5′ end of the PCR primer pair (i.e. the first random sequence or the second random sequence), followed by pairing with the specific sequence at the 3′ end (i.e. the first specific sequence or the second specific sequence), that is, two recognition sites for binding between primer and template, which greatly improved the annealing temperature of primer, resulting in a high annealing temperature.

(24) Further, it should be noted, in the second round of amplification, the circular amplification can be effectively performed only when the 5′ end and the 3′ end of the primer bind to the newly-generated template simultaneously, thus specificity of PCR amplification and binding between primer and template are greatly improved via two recognition sites, with improved PCR amplification efficiency. Therefore, using the PCR primer pair of the present disclosure for PCR amplification, is capable of significantly increasing the specificity of PCR amplification, effectively reducing the generation of non-specific products, and reducing the GC bias during amplification, compared to conventional PCR primers. Thus, use of such a primer pair in sequencing, especially in the next-generation sequencing library, can effectively reduce the genome-wide GC bias in library enrichment and amplification.

Application

(25) Further, in a second aspect, the present disclosure in embodiments also provides a PCR amplification kit. According to an embodiment of the present disclosure, the kit comprises the PCR primer pair as described above. According to an embodiment of the present disclosure, using the kit comprising the PCR primer pair of the present disclosure for PCR amplification, can bring low GC bias, high amplification specificity and excellent amplification effect during amplification, compared to conventional primers. In addition, the PCR primer pair of the present disclosure is particularly suitable as primers for multiplex PCR amplification.

(26) Further, the present disclosure in embodiments proposes use of the PCR primer pair and the kit comprising the PCR primer pair.

(27) In a third aspect, the present disclosure in embodiments provides a method for PCR amplification. According to an embodiment of the present disclosure, the method performs PCR amplification by using the PCR primer pair or the PCR amplification kit as described above. Thus, PCR amplification of template can be effectively achieved by using this method. Moreover, this method can increase specificity of PCR amplification, effectively reduce generation of non-specific products, and improve amplification efficiency.

(28) According to an embodiment of the present disclosure, the method comprises two rounds of amplification. In the first round of amplification, the PCR primer pair and a template are subjected to linear amplification under an annealing temperature of 55-65° C., and in the second round of amplification, a product of the linear amplification is subjected to circular amplification under an annealing temperature of 65-72° C. Thus, starting from the second PCR cycle (i.e. circular amplification in the second round), bases at the 5′ end of the first primer or the second primer can reversely complement with bases at the 5′ end of the newly-generated template, and the specific sequence at the 3′ end of the first primer or the second primer can reversely complement with bases at the 3′ end of the newly-generated template, that is, two recognition sites for binding between primer and template (referring to FIG. 3), thus increasing specificity of PCR amplification, and effectively decreasing the generation of non-specific products.

(29) According to an embodiment of the present disclosure, the two rounds of amplification are performed as the following amplification reaction procedure:

(30) TABLE-US-00001 step 1 preheating for 2 minutes at 98° C. step 2 denaturing for 10 seconds at 98° C. step 3 annealing for 2 minutes at 55-65° C. step 4 amplifying for 30 seconds at 72° C. step 5 denaturing for 10 seconds at 98° C. step 6 annealing for 1 minute at 65-72° C. step 7 repeating steps 5 and 6 for 5-35 cycles step 8 extending for 5 minutes at 72° C.

(31) Therefore, the GC bias during PCR amplification is low, the amplification specificity is high and the amplification effect is excellent.

(32) In a fourth aspect, the present disclosure in embodiments provides a method for preparing a circular DNA library.

(33) In the fourth aspect, provided in embodiments is a method for preparing a DNA library. In embodiments, the method comprises the steps of:

(34) (1) subjecting a DNA sample to be tested to first PCR amplification through the PCR amplification method as described above, so as to obtain a first PCR amplification product comprising a loop-like substance, in which

(35) the first specific sequence is connected to the first random sequence via a first predetermined restriction enzyme cutting site,

(36) the second specific sequence is connected to the second random sequence via a second predetermined restriction enzyme cutting site,

(37) the target sequence of the PCR primer pair does not comprise any predetermined restriction enzyme cutting site,

(38) the 5′ end and the 3′ end of the loop-like substance are not connected, and

(39) the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the first primer of the PCR primer pair are respectively subjected to thio-modification, and

(40) the 1-5.sup.th bases from each of the 5′ end and the 3′ end of the second primer of the PCR primer pair are respectively subjected to thio-modification, and

(41) (2) subjecting the first PCR amplification product comprising the loop-like substance to cleavage by using an enzyme corresponding to the first and second predetermined restriction enzyme cutting sites, and preparing a library based on enzyme-cleaved products, so as to obtain a target DNA library.

(42) According to embodiments of the present disclosure, a linear DNA library or a circular DNA library can be efficiently prepared through the method. The obtained DNA library has a good library quality, which exhibits good effect for DNA preservation or library sequencing.

(43) According to an embodiment of the present disclosure, the first predetermined restriction enzyme cutting site and the second predetermined restriction enzyme cutting site each are a uracil (U) base site cleaved by the USER enzyme. Thus, since the target sequence does not include the U base site cleaved by the USER enzyme, it is possible to efficiently remove the conventional primer and the complementary sequence after PCR by cleaving the predetermined restriction enzyme cutting site of amplified products via the USER enzyme, thus facilitating subsequent library construction and purification.

(44) According to an embodiment of the present disclosure, the step (2) is performed as follows:

(45) subjecting the first PCR amplification product comprising the loop-like substance to enzymatic cleavage followed by terminal repairing and adenine (A) addition, so as to obtain an enzyme-cleaved product containing adenine (A) base at terminal;

(46) ligating the enzyme-cleaved product containing A base at terminal with an adaptor, so as to obtain a ligation product, the ligation product being a linear DNA; and

(47) subjecting the ligation product to second PCR amplification, so as to obtain a second PCR amplification product, the second PCR amplification product constituting a linear DNA library, in which

(48) the second PCR amplification product is obtained by using a sequencing primer, and

(49) the sequencing primer is complementary to sequence of the adaptor.

(50) Therefore, a linear DNA library can be effectively obtained, and the obtained library is of good quality.

(51) According to some specific examples of the present disclosure, the enzymatic cleavage, the terminal repairing and the adenine (A) addition are performed by using the USER enzyme, T4 polynucleotide kinase, T4 DNA polymerase and Klenow fragment. Therefore, the enzymatic cleavage effect is good, and the obtained library is of good quality.

(52) According to another embodiment of the present disclosure, the step (2) is performed as follows:

(53) subjecting the first PCR amplification product comprising the loop-like substance to enzymatic cleavage, so as to obtain an enzyme-cleaved product containing the loop-like substance;

(54) subjecting the enzyme-cleaved product containing the loop-like substance to a ligation reaction by using a ligase, such that the 5′ end and the 3′ end of the loop-like substance are ligated, thus forming a ligation product;

(55) removing linear DNA from the ligation product, so as to obtain a circular DNA mixture; and

(56) subjecting the circular DNA mixture to third PCR amplification, so as to obtain a third PCR amplification product, the third PCR amplification product constituting a circular DNA library, in which

(57) in the third PCR amplification, the 3′ end sequence of a forward primer is reversely complementary to the first random sequence, and the 3′ end sequence of a reverse primer is reversely complementary to the second random sequence.

(58) Therefore, a circular DNA library can be effectively obtained, and the obtained library is of good quality.

(59) According to an embodiment of the present disclosure, the linear DNA is removed through a linear-chain digestion reaction.

(60) According to an embodiment of the present disclosure, the method further comprises the step of purifying the circular DNA mixture prior to the third PCR amplification. Thus, the obtained library is of good quality.

(61) Reference will be made in detail to examples of the present disclosure. It would be appreciated by those skilled in the art that the following examples are explanatory, and cannot be construed to limit the scope of the present disclosure. If the specific technology or conditions are not specified in the examples, a step will be performed in accordance with the techniques or conditions described in the literature in the art (for example, referring to J. Sambrook, et al. (translated by Huang P T), Molecular Cloning: A Laboratory Manual, 3rd Ed., Science Press) or in accordance with the product instructions. If the manufacturers of reagents or instruments are not specified, the reagents or instruments may be conventional products that are commercially available, for example, from Illumina Company.

EXAMPLE 1: DETECTING WHETHER A FETUS SUFFERS FROM ACHONDROPLASIA (ACH) BY USING A PADLOCK PRIMER

1.1 Primer Design for Padlock Primer (i.e. PCR Primer Pair of the Present Disclosure, Referred to as “PP Primer” Below)

(62) 18 pairs of multiplex PCR primers containing all mutation sites of Achondroplasia were designed by using Primer 3, and such 18 primer pairs are all padlock primers, as shown in Table 1. The 3′ end sequence of the padlock primer without any optimization has a TM value between 55° C. and 65° C. The 5′ end complementary sequence which is unfixed has a TM value between 65° C. and 75° C. GC content of amplicon regions is between 26% and 75%, as shown in Table 2. The structure of padlock primer is shown in FIG. 1.

(63) TABLE-US-00002 TABLE 1 Primer interval information Primer Amplicon GC Nos. Location Length content PP1 chr8:5716321-5716432 100 26.0% PP2 chr12:86270815-86270910 96 31.3% PP3 chr11:17313443-17313562 120 31.7% PP4 chr4:180398777-180398891 115 32.2% PP5 chr2:125045070-125045149 80 32.5% PP6 chr9:31232026-31232095 70 32.9% PP7 chr13:31598809-31598908 100 33.0% PP8 chr6:135870701-135870815 115 33.9% PP9 chr10:26455826-26455900 75 38.7% PP10 chr13:67263837-67263896 60 41.7% PP11 chr13:43696242-43696306 65 46.2% PP12 chr4:1803633-1803692 60 58.3% PP13 chr4:1807776-1807838 63 58.7% PP14 chr4:1807337-1807414 78 59.0% PP15 chr4:1807862-1807947 86 64.0% PP16 chr4:1806071-1806170 100 64.0% PP17 chr4:1808930-1809025 96 68.8% PP18 chr4:1803545-1803620 76 75.0% Note: PP: Padlock Primer; F: Forward primer; and R: Reverse primer

(64) TABLE-US-00003 TABLE 2 Primer sequence information Primer Nos. Sequence (5′-3′, SEQ ID NO:) PP1F CCCCCCCCATCCCCCCCCUTTCTTCGGGTGTTGACTTTCA (1) PP2F CCCCCCCCATGGGCCCGGUTTGACAATGGTGTATCTGGGC (2) PP3F CCCCCCCGATCGGGGCCCUTTCATCCTTACTTGGATATGCCC (3) PP4F CCCCCCGCATCCGGGGGGUTCCCTTAGAGAACAAAGTAAAAAGC (4) PP5F CCCCCCGCTTGGGCCGCCUTATTGTGTTTTTAGAGAAGCTCAAA (5) PP6F CCCCCCGGTTCCCCGCGGUTCAAAGTGAGCTCTTTGCCTTTT (6) PP7F CCCCCGCCTTCCGGCGCCUTTCAAGGTTGAAGCAAAAGCA (7) PP8F CCCCCGCGATCCCGCCGGUTACATTTCAGCTTTTGCAAACTT (8) PP9F CCCCCGCGTTGCGCGGGCUTGGGTCAAGGGAACTATCCCA (9) PP10F CCCCCGGGTAGGCCCCGGUTTTGGACACCTTTTCGTGTCA (10) PP11F CCCCGCCCTTCGCGCCCGUTGCCTGCTATTTGCTTTACCA (11) PP12F CCCCGCCGTTGCCGCGGGUTGTCATCTGCCCCCACAGAG (12) PP13F CCCCGGCCTACGGCCCCCUTGTGGAGTTCCACTGCAAGGT (13) PP14F CCCCGGCCTTGCGCGCCGUTGTGGAGGCTGACGAGGC (14) PP15F CCCCGGCCTTGGCGGGCCUTTGAAGATGATCGGGAAACAC (15) PP16F CCCCGGGCTACCCGCCGGUTAGTGCATCCACAGGGACC (16) PP17F CCCCGGGGATCCGCGGCCUTGACGTGCACAACCTCGACTA (17) PP18F CCCCGGGGTTGGGGGGGGUTGTGTTTGCCCACGACCTG (18) PP1R GGGGGGGGATGGGGGGGGUTAATGAGCCCTCAGCCTGC (19) PP2R CCGGGCCCATGGGGGGGGUTCACCCCAAATAGTTTGTGCC (20) PP3R GGGCCCCGATCGGGGGGGUTTGAGCGCAATGAGTTCAATA (21) PP4R CCCCCCGGATGCGGGGGGUTTCCTTTCTCCAAACAGTGACC (22) PP5R GGCGGCCCAAGCGGGGGGUTGCTCCCAATATTACGCAGTTC (23) PP6R CCGCGGGGAACCGGGGGGUTCATTTCTTTTGCAGGTTGTCA (24) PP7R GGCGCCGGAAGGCGGGGGUTCATCCTCCTACGGTGTTGAAA (25) PP8R CCGGCGGGATCGCGGGGGUTAGATGGCCTGATGGATTCTG (26) PP9R GCCCGCGCAACGCGGGGGUTCACACTAACGTTGTAATGCGCT (27) PP10R CCGGGGCCTACCCGGGGGUTGGCACTCAATAAGGGATTGG (28) PP11R CGGGCGCGAAGGGCGGGGUTGCTGCTTGTATTCACACCATTC (29) PP12R CCCGCGGCAACGGCGGGGUTCACCGCCGTCTGGTTGG (30) PP13R GGGGGCCGTAGGCCGGGGUTGTGCTTGAGCCACTGGATGT (31) PP14R CGGCGCGCAAGGCCGGGGUTGGCAGAGCGTCACAGCC (32) PP15R GGCCCGCCAAGGCCGGGGUTCGCCGCTACCGCACCTA (33) PP16R CCGGCGGGTAGCCCGGGGUTTCTTCATCACGTTGTCCTCG (34) PP17R GGCCGCGGATCCCCGGGGUTGTCCTACTGGCATGACCCC (35) PP18R CCCCCCCCAACCCCGGGGUTTAGGGACCCCTCACATTGTT (36) Note: PP refers to Padlock Primer; F refers to Forward primer; R refers to Reverse primer; predetermined restriction enzyme cutting site is the U base site cleaved by the USER enzyme; and each primer consists of 18 bp of random sequence, 1 bp of U base and a specific sequence from 5′ end to 3′ end.

1.2 Experimental Steps

(65) In this experiment, 10 cases of pregnant women's plasma were selected, including 5 cases of ACH-positive samples and 5 cases of ACH-negative samples. The experiment was conducted in duplicate.

1.2.1 Extraction of Cell-Free DNA

(66) 200 μL of plasma taken from respective ACH-positive samples and ACH-negative samples was extracted for DNA by using Magen beads, with products dissolved in 17 μL of TE, for use. Target libraries were prepared through the following steps, specifically referring to FIG. 4 showing the schematic flow chart of library preparation.

1.2.2 Multiplex PCR Amplification

(67) The extracted cfDNA from each sample were subjected to multiplex PCR amplification according to the amplification system shown in the following table:

(68) TABLE-US-00004 rTaq Buffer (10X)  2 μL cfDNA 16.3 μL   Forward and reverse primer pool  1 μL dNTP Mixture 0.5 μL  rTaq DNA Polymerase 0.2 μL  Total 20 μL Note: The forward and reverse primer pool was a mixture of all corresponding primers in Table 2 in an equal proportion.

(69) The amplification conditions for multiplex PCR amplification were as follows:

(70) TABLE-US-00005 step 1 98° C., 2 minutes step 2 98° C., 10 seconds step 3 58° C., 2 minutes step 4 72° C., 30 seconds step 5 98° C., 10 seconds step 6 68° C., 1 minute step 7 repeating steps 5 and 6 for 25 cycles step 8 72° C., 5 minutes

(71) The amplified products of samples each were purified with 1.8 times of volumes of Axygen beads, followed by dissolving in 37 μL of TE, for use.

1.2.3 Library Preparation

(72) The purified products of samples obtained in step 1.2.2 were respectively subjected to USER enzyme cleavage followed by terminal repairing, adenine (A) addition, adaptor ligation and PCR amplification as below.

(73) 1) Reaction system of USER enzyme cleavage, terminal repairing and adenine (A) addition

(74) TABLE-US-00006 10X PNK buffer  5 μL dNTP mix (2.5 mM)  1 μL dATP (10 mM)  2 μL T4 PNK  1 μL USER  2 μL Bsm  1 μL T4 Ploymerase 0.5 μL  Klenow Fragment 0.5 μL  DNA 37 μL Total 50 μL

(75) The reaction procedure of USER enzyme cleavage, terminal repairing and adenine (A) addition was reaction at 20° C. for 30 minutes and at 65° C. for another 30 minutes.

(76) 2) Reaction system of adaptor ligation

(77) TABLE-US-00007 Previous DNA 50 μL 10X PNK buffer  2 μL PEG 4000 (50%) 7.5 μL  Adaptor (100 μM) 0.5 μL  T4 DNA Ligase  2 μL Water  3 μL Total 65 μL

(78) The reaction procedure of adaptor ligation was reaction at 25° C. for 15 minutes and at 4° C. for another 10 minutes.

(79) The resulting products were purified with 1.2 times of volumes of Axygen beads, followed by dissolving in 21 μL of TE, for use.

(80) 3) PCR amplification

(81) The ligation products of samples obtained in the previous step each were subjected to PCR amplification according to the amplification system shown in the following table:

(82) TABLE-US-00008 Kappa HIFI premixed mixture (2X) 25 μL Ligation product 21 μL Forward universal primer  2 μL Reverse universal primer  2 μL Total 50 μL

(83) The forward universal primer is of a sequence from 5′ end to 3′ end (5′-3′):

(84) TABLE-US-00009 (SEQ ID NO: 37) TGTGAGCCAAGGAGTTGAAGTGGCGCATTGTCTTCCTAAGACCGCTTGG CCTCCGACTT.

(85) The reverse universal primer is of a sequence from 5′ end to 3′ end (5′-3′):

(86) TABLE-US-00010 (SEQ ID NO: 38) GAACGACATGGCTACGATCCGACTTGG.

(87) The PCR amplification procedure was as follows:

(88) TABLE-US-00011 Step 1 98° C., 2 minutes Step 2 98° C., 15 seconds Step 3 56° C., 15 seconds Step 4 72° C., 30 seconds Step 5 repeating steps 2-4 for 10 cycles Step 6 72° C., 5 minutes

(89) The resulting products were purified with 1.2 times of volumes of Axygen beads, followed by dissolving in 21 μL of TE, thus obtaining a target library, which was subsequently subjected to fragment analysis by 2100 Bioanalyzer and qubit quantification, results shown in FIG. 5 and Table 3.

(90) As seen in FIG. 5, samples 1-5 are positive samples, and samples 6-10 are negative samples.

(91) TABLE-US-00012 TABLE 3 Experimental starting amount and library output Samples Input Plasma (μL) Lib Output (ng) Sample 1 200 497 Sample 2 200 479 Sample 3 200 434 Sample 4 200 427 Sample 5 200 488 Sample 6 200 304 Sample 7 200 466 Sample 8 200 343 Sample 9 200 491 Sample 10 200 306

1.2.4 On-Machine Sequencing

(92) The qualified library was subjected to on-machine sequencing by using BGISEQ-500 sequencing platform and the sequencing type of PE50BP.

1.2.5 Data Analysis

(93) The obtained sequencing results were subjected to data analysis, specifically including: filtering off-machine sequencing reads, such that the reads having base quality less than 10 were removed, thus ensuring high quality for the data used for base frequency analysis; aligning the filtered clean reads to the human genome reference sequence HG19 (GRCH37) through alignment software bwa (V0. 7.7-r441); calculating coverage depth of 4 bases (ATCG) at sites to be detected based on the alignment results, and thus obtaining information such as most-likely mutation site and frequency thereof, sequencing error and frequency thereof and the like via the coverage depth; performing GC bias correction according to GC distribution in regions (where the mutation site and primer were presented), as well as the likely frequency of sequencing error; and detecting the mutation sites obtained as above by using the mutation detection tool GATK (V3.6) which is most accurate currently; and filtering and annotating through the corresponding mutation database.

(94) As a result, the present inventors have found that it is possible to accurately detect mutations as low as 1% by using the PCR primer pair of the present disclosure for multiplex PCR amplification and library construction. Specifically, 5 positive samples in the 10 samples were all detected to be positive, respectively with the mutation frequency of 5.3%, 7.2%, 3.5%, 5.6% and 6.2%; and 5 negative samples in the 10 samples were all detected to be negative, respectively with the mutation frequency of 0.3%, 0.1%, 0.2%, 0.2% and 0.1%, refer to Table 5. Moreover, the method of the present disclosure displays good specificity, with between 90% and 94% of alignment rate, and between 92% and 95% of capture efficiency; is of 100% of coverage (refer to Table 4); is of good uniformity, obtaining 0.1× average depth greater than 94% (refer to Table 4 and FIG. 6); and has good stability, as well as few differences between different samples (refer to FIG. 7).

(95) TABLE-US-00013 TABLE 4 PE50 + 10 off-machine data Original Alignment Capture Samples data rate efficiency Coverage Uniformity* Sample 1 8345502 91.2% 94.6% 100% 94.7% Sample 2 11127336 91.8% 92.5% 100% 94.7% Sample 3 8856963 91.5% 92.8% 100% 94.7% Sample 4 10252352 90.9% 94.4% 100% 94.7% Sample 5 10569812 94.4% 94.6% 100% 94.7% Sample 6 12563987 91.0% 94.3% 100% 94.7% Sample 7 11127336 92.2% 94.7% 100% 94.7% Sample 8 10200058 93.1% 92.3% 100% 94.7% Sample 9 9565862 92.8% 91.2% 100% 94.7% Sample 10 9282202 90.1% 93.2% 100% 94.7% *Uniformity: rate of the number of amplicon of which depth is greater than 0.1 X mean depth (18/19 = 94.7%).

(96) TABLE-US-00014 TABLE 5 Accuracy of mutation detection Samples Location Mutation type Detection ratio Sample 1 Chr4 1806119 G > A 5.3% Sample 2 Chr4 1806119 G > A 7.2% Sample 3 Chr4 1806119 G > A 3.5% Sample 4 Chr4 1806119 G > A 5.6% Sample 5 Chr4 1806119 G > A 6.2% Sample 6 Chr4 1806119 G > A 0.3% Sample 7 Chr4 1806119 G > A 0.1% Sample 8 Chr4 1806119 G > A 0.2% Sample 9 Chr4 1806119 G > A 0.2% Sample 10 Chr4 1806119 G > A 0.1%

(97) In addition, the present inventors also performed a series of experiments, and have discovered that the PCR primer pair of the present disclosure is useful not only for cfDNA samples, but also widely for samples like genomic DNA, FFPE, urine DNA, fresh frozen sample and the like; and can be applied for constructing both BGI-SEQ library and other libraries for platform, such as illumina and proton.

INDUSTRIAL APPLICABILITY

(98) The PCR primer pair of the present disclosure can be effectively used for PCR amplification of DNA samples to be tested, effectively reduce GC bias during PCR amplification, and improve amplification specificity. Such a PCR primer pair is particularly suitable for multiplex PCR amplification.

(99) Although specific embodiments of the present disclosure have been described in detail, it would be appreciated by those skilled in the art that various modifications and alternatives of the details can be made according to teachings of the present disclosure, which are all within the scope of the present disclosure. The full scope of the present disclosure is given by the appended claims and any equivalents thereof.

(100) Reference throughout this specification to terms “an embodiment”, “some embodiments”, “illustrative embodiment”, “an example”, “a specific example” or “some examples” means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. Thus, the description with reference to the terms “an embodiment”, “some embodiments”, “illustrative embodiment”, “an example”, “a specific example” or “some examples” throughout this specification are not necessarily referring to the same embodiment or example of the present disclosure. Furthermore, the particular features, structures, materials, or characteristics may be combined in any suitable manner in one or more embodiments or examples.