VACCINE AGAINST ACINETOBACTER BAUMANNII BASED ON CELLULAR COMPONENTS DEFICIENT IN LIPOPOLYSACCHARIDE
20220152184 · 2022-05-19
Assignee
- VAXDYN S.L. (Sevilla, ES)
- FUNDACIÓN PÚBLICA ANDALUZA PARA LA GESTIÓN DE LA INVESTIGACIÓN EN SALUD DE SEVILLA (Sevilla, ES)
- Servicio Andaluz De Salud (Sevilla, ES)
Inventors
- Michael James McConnell (Sevilla, ES)
- Meritxell García Quintanilla (Sevilla, ES)
- Marina Pulido Toledano (Sevilla, ES)
- María Pilar Pérez Romero (Sevilla, ES)
- Jerónimo Pachón Díaz (Sevilla, ES)
- Juan José Infante Viñolo (Sevilla, ES)
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
C07K14/212
CHEMISTRY; METALLURGY
International classification
Abstract
The invention refers to a composition comprising inactivated cells deficient in LPS from the genus Acinetobacter and/or outer membrane vesicles form the same and their use for the manufacture of a medicament, preferably a vaccine, for the prevention of diseases produced by organisms of the genus Acinetobacter.
Claims
1.-17. (canceled)
18. A method of producing an antibody or fragment thereof that targets Acinetobacter baumannii, comprising: a) contacting an antibody or fragment thereof or an antibody or antibody fragment library with an A. baumannii strain deficient in lipopolysaccharide (LPS) and/or an outer membrane vesicle (OMV) derived therefrom; and b) selecting those antibodies or fragments thereof having affinity or binding affinity or capable of specifically binding the A. baumannii strain and/or OMV derived therefrom.
19. The method of claim 18, further comprising isolating the antibody or fragment thereof identified in step b) above.
20. The method of claim 18, wherein the antibody or fragment thereof is a Fab, Fab′, Fab′-SH, Fv, scFv, F(ab′)2, Vhh, Nanobody, or diabody.
21. The method of claim 18, wherein the A. baumannii strain deficient in LPS is characterized by the partial or complete inactivation of one or more genes selected from the group consisting of lpxA, lpxC, and lpxD.
22. The method of claim 18, wherein the A. baumannii strain deficient in LPS is derived from ATCC strain 19606.
23. The method of claim 18, wherein the A. baumannii strain deficient in LPS is an ATCC 19606 strain with a mutation in one or more genes selected from the group consisting of lpxA, lpxC and lpxD.
24. A method of producing an antibody or fragment thereof that targets Acinetobacter baumannii, comprising: administering an A. baumannii strain deficient in lipopolysaccharide (LPS) and/or an outer membrane vesicle (OMV) derived therefrom to a mammal.
25. The method of claim 24, further comprising isolating the antibody or fragment thereof.
26. The method of claim 24, wherein the antibody or fragment thereof is a Fab, Fab′, Fab′-SH, Fv, scFv, F(ab′).sub.2, Vhh, Nanobody, or diabody.
27. The method of claim 24, wherein the A. baumannii strain deficient in LPS is characterized by the partial or complete inactivation of one or more genes selected from the group consisting of lpxA, lpxC, and lpxD.
28. The method of claim 24, wherein the A. baumannii strain deficient in LPS is derived from ATCC strain 19606.
29. The method of claim 24, wherein the A. baumannii strain deficient in LPS is an ATCC 19606 strain with a mutation in one or more genes selected from the group consisting of lpxA, lpxC and lpxD.
Description
DESCRIPTION OF THE FIGURES
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
EXAMPLES OF THE INVENTION
Example 1
[0134] Ethics Statement
[0135] All experiments involving the use of animals were approved by the University Hospital Virgen del Rocío Committee on Ethics and Experimentation (Evaluation code: 2013PI/296). In all experiments, efforts were made to minimize suffering, and any animals appearing moribund during the course of experimentation were immediately euthanized using thiopental.
[0136] Bacterial strains. A. baumannii ATCC 19606 is an antibiotic susceptible reference strain. An LPS-deficient derivative of ATCC 19606 was obtained by plating an overnight culture of ATCC 19606 on Mueller Hinton agar containing 10 mg/I of colistin, as described previously (Clinical Laboratory Standards Institute 2013) Strains with mutations in the genes involved in LPS biosynthesis were identified by sequencing the IpxA, IpxC and IpxD genes of the colistin resistant mutants that were present after overnight growth at 37° C. A strain with a large deletion in the IpxD gene was identified and designated IB010. Resistance to colistin was confirmed by broth microdilution according to Clinical Laboratory Standard Institute guidelines [23]. Absence of LPS was confirmed by measuring the endotoxin levels of three independent cultures of each strain using the QCL-1000 Limulus Amebocyte Assay (Lonza) according to the manufacturer's instructions. The Ab-154 strain is a previously characterized A. baumannii clinical isolate (Gautom, 1997. J. Clin. Microbiol. 35, 2977-2980).
[0137] Vaccine preparation and mouse immunization. The IWC vaccines (both LPS-containing and LPS-deficient) were prepared as described based on a previously described method (Moffatt et al., 2010. Antimicrob. Agents Chemother. 54, 4971-4977). Briefly, the ATCC 19606 and IB010 strains were grown in Mueller-Hinton broth to OD.sub.600 of 0.8. In the case of IB010, 10 μg/ml of colistin were added to the culture. In order to confirm that no reversion to wild type occurred during growth of IB010, three independent cultures of ATCC 19606 and IB010 were grown, and genomic DNA was isolated from each culture using the QIAmp DNA Mini Kit (Qiagen). The IpxD specific primers 5′ GCTAATTGGTGAAGGTAGTC 3′ and 5′ GACGAATCGTTTGAATCTGC 3′ were used to amplify genomic DNA from the cultures in order to confirm that the deletion in IpxD of IB010 was present after growth.
[0138] For vaccine preparation, bacteria were washed extensively in phosphate buffer saline before inactivation in 0.5 M formalin for 18 h with shaking at room temperature. Complete inactivation of the bacteria was confirmed by plating on blood agar. The concentration of inactivated cells was adjusted to 1×10.sup.10 cells/ml and combined 1:1 (v/v) with the aluminium-based adjuvant, Alhydrogel 2% (w/v) (InvivoGen). Vaccination was carried out in 6 to 8-week-old, female C57BL/6 mice by intramuscular injection of 100 μl of the vaccine into each quadriceps muscle on days 0 and 14. Control mice were injected similarly with a mixture of phosphate buffer saline and adjuvant.
[0139] Mouse model of A. baumannii infection. A mouse model of sepsis previously developed by our group and used for the evaluation of vaccines against A. baumannii was used to characterize the efficacy of the (Batson et al., 1950. J. Exp. Med. 91, 219-229; Rodriguez-Hernandez et al., 2000. J. Antimicrob. Chemother. 45, 493-501). This model produces a disseminated infection after intraperitoneal instillation of the inoculum, typically resulting in death within 24 to 48 hours. For preparation of the inocula, A. baumannii strains were grown for 18 h at 37° C. in Mueller-Hinton broth cultures and adjusted to the appropriated concentration in physiological saline as described previously (Moffatt et al., 2010. Antimicrob. Agents Chemother. 54, 4971-4977; Martin et al., 1998. J. Immunol. Methods 212, 187-192). Bacterial concentrations of the inocula were determined by plating on blood agar. Mice were infected on day 21 (one week after the second immunization) by intraperitoneal injection with 0.5 ml of the bacterial suspension and survival was monitored for 7 days.
[0140] Spleen bacterial loads and serum cytokine levels. Post-infection bacterial loads were determined in vaccinated and control mice 12 h after infection. Mice were euthanized with an overdose of thiopental and after collection of blood samples from the retro-orbital sinus, spleens were aseptically removed, weighed and homogenized in 2 ml of physiological saline. Serial log dilutions were plated on blood agar plates for bacterial quantification. Serum levels of interleukin-1β (IL-1β), tumor necrosis factor alpha (TNF-α), and interleukin-6 (IL-6) were determined in mice at 12 h post-infection using BD OptEIA mouse kits (BD Biosciences).
[0141] Enzyme-linked immunosorbent assays (ELISAs). For indirect enzyme-linked immunosorbent assays (ELISAs), 96-well plates were coated with 5×10.sup.7 bacterial cells/well in phosphate buffer saline by incubating at 4° C. overnight. ELISAs were performed using sera collected on days 0, 7 and 21 as described previously [28]. Antibody titers were measured against the strain which was used to immunize the mouse, and were defined as the dilution in which spectrophotometric readings were at least 0.1 units above background wells (wells containing no serum).
[0142] Statistical analysis. Antibody titers, bacterial loads, and cytokine levels were compared using the Kruskal-Wallis H test and the Mann-Whitney U test for independent samples, and the Friedmann and Wilcoxon tests for dependent samples. The Bonferroni correction was applied when appropriate. Survival data were compared using the log-rank test. All statistics were performed using SPSS version 15.0 software (SPSS Inc.), and a p value of 0.05 was considered significant.
[0143] Results
[0144] Selection of an LPS-deficient strain for vaccine development. Growth of ATCC 19606 in the presence of 10 μg/ml colistin resulted in numerous colistin-resistant derivatives with mutations in the IpxA, IpxC and IpxD genes (data not shown). One of these strains, IB010, contained a large deletion of 462 nucleotides in the IpxD (nucleotides 104-565) gene and was chosen for further use in vaccine studies. We reasoned that on the basis that the strain contained a large deletion, this strain would be less likely to revert to wild type during growth than strains containing single nucleotide changes or small deletions in the LPS biosynthesis genes. Broth microdilution experiments demonstrated that the minimum inhibitory concentration of the ATCC 19606 strain was 0.25 μg/ml and >128 μg/ml for IB010, demonstrating that, similar to results described previously, mutations in IpxD can result in resistance to colistin (Moffatt et al., 2010. Antimicrob. Agents Chemother. 54, 4971-4977). In order to ensure that the IB010 was genetically stable during growth, genomic DNA from three independent cultures of ATCC 19606 and IB010 were amplified with IpxD-specific primers to confirm that the deletion was present. As shown in
[0145] Antibody response to the LPS-deficient IWC vaccine. Formalin treatment of ATCC 19606 and IB010 resulted in no viable bacteria, indicating complete bacterial inactivation. In order to quantify the antibody response produced by immunization with inactivated IB010, indirect ELISAs were performed using sera collected from negative control mice (immunized with PBS and adjuvant) and mice vaccinated with 1×10.sup.9 inactivated IB010 cells. As a positive control, one group of mice was immunized with 1×10.sup.9 inactivated ATCC 19606 cells on the basis that we have previously shown that immunization with these cells induces a robust immune response and produces protective immunity against experimental infection (McConnell y Pachon, 2010. Vaccine 29, 1-5). As shown in
[0146] Levels of the IgG subtypes IgG1 and IgG2c, the IgG2a homolog in C57BL/6 (Martin et al., 1998. J. Immunol. Methods 212: 187-192), were determined in 21-day serum (
[0147] Effect of vaccination on post-infection bacterial loads. In order to characterize the effect of vaccination on post-infection tissue bacterial loads, we employed a mouse model previously developed by our group for the characterization of vaccine for preventing infection by A. baumannii (McConnell et al., 2011. Infect. Immun. 79, 518-526; McConnell et al., 2011. Vaccine 29: 5705-5710; McConnell y Pachon, 2010. Vaccine 29, 1-5). This model rapidly produces a disseminated infection in which bacteria are detected in distal organs as soon as one hour post-infection [16]. Vaccinated and control mice were infected with 2.0×10.sup.6 cfu (300×LD.sub.50) of the ATCC 19606 strain, and 12 hours after infection spleen bacterial loads were determined (
[0148] Effect of vaccination on post-infection serum cytokine levels and survival. In order to characterize the effect of immunization with the inactivated LPS deficient vaccine on cytokine levels, sera were collected from vaccinated and control mice 12 h post-infection and the levels of IL-1β, IL-6 and TNF-α were determined (
[0149] Vaccine efficacy was tested by infecting immunized and control mice with 2.25×10.sup.6 cfu (340.9×LD.sub.50) of the ATCC 19606 strain seven days after the second immunization, and survival was monitored over seven days (
[0150] In conclusion, these results provide important information regarding the development of a vaccine for the prevention of infections caused by A. baumannii based on whole bacterial cells lacking LPS. These results may also provide insights into the possibility of developing vaccines for other bacterial species based on strains lacking LPS.
Example 2
[0151] This example relates to the development of a vaccine against A. baumannii based on OMVS purified from said cultures of mutants without LPS.
[0152] To carry out this objective, the strains ATCC 19606T and its mutant without LPS IB010, which was generated in our laboratory from the ATCC 19606T strain and contains a deletion of 462 nucleotides between positions 103 and 565 of the gene IpxD.
[0153] Upon realizing the purification of the OMVs of said strains the following protocol was used: [0154] Strains are refreshed on blood agar or MHBII plates with colistin at 10 mcg/ml and grown overnight at 37° C. [0155] A liquid culture is used to growth ATCC 19606 or IB010. They are cultured with aeration at 180 rpm at 37° C. overnight. [0156] The next day cultures of 50 or 100 ml or 1 L in MHB are made and incubated overnight at 37° C. with aeration (180 rpm) [0157] After incubation, the cells are centrifuged at 4000 rpm during 30 min at 4° C. [0158] Next, the supernatant is filtered with a 0.22 micron filter. [0159] Afterwards, the OMVs are precipitated by ultracentrifugation for 90 minutes at 30000 rpm at 4° C.
[0160] Finally, the pellet is resuspended in PBS and the absence of viable bacteria is confirmed by plating. The OMVs are stored at −80° C.
[0161] (Protocol adapted from McConnell M J et al. 2011 Aug. 5; 29(34):5705-10)
[0162] Using the previous protocol different purifications of OMVs have been performed. [0163] Purifications of OMVs of the strains ATCC 19606 and IB010 for the production of OMVs after culturing 24, 48 and 72 hours. After the purification of OMVs the amount of protein was quantified using Bradford method and 10 mcg of the protein was visualized in a 10% polyacrylamide gel with Coomassie stain. [0164] In addition, purification have been performed with OMVs from the strain ATCC 19606 and IB010 in the presence and absence of Bip, which is an iron chelator, with the objective of verifying if the presence of the chelator resulted in the increased expression of proteins related with iron metabolism, for example, siderophore receptors. In this case, OMVs were purified for the quantification of proteins and for Coomassie staining of acrylamide gels and for the visualization of OMVs by electron microscopy.
[0165] Finally, OMVs were purified form the LPS mutant of a clinical isolate of A. baumannii Ab-167 which contains an ISAba1 insertion in the IpxC gene. Proteins were quantified and visualized on acrylamide gels by Coomassie staining. And proteins were quantified by Bradford and 2D Quant kit.
Example 3. Purification of Outer Membrane Proteins
[0166] A. baumannii ATCC 19606 was grown in 1 liter of Mueller-Hinton broth to an optical density at 600 nm (OD600) of 0.6, and pelleted bacteria were resuspended in 10 ml of 10 mM phosphate buffer, pH 7.2, and lysed by sonication. Unlysed cells were removed by centrifugation at 4,000×g for 5 min, and the supernatant was centrifuged at 20,000_g for 1 h to pellet cell envelopes. Inner membranes were selectively solubilized with 5 ml of 2% N-laurylsarcosinate by incubation at 37° C. for 30 min. The insoluble fraction was pelleted by centrifugation at 20,000_g for 1 h and then washed with 2 ml of 62.5 mM Tris-CI, pH 6.8.
[0167] Endotoxin was extracted from the preparation by use of a cold detergent wash step in which proteins were resuspended in 5% SDS and incubated at 4° C. for 10 min. SDS and endotoxin were subsequently removed by precipitating in methanol chloroform and resuspended in PBS.
[0168] Addition of the Adjuvant
[0169] The purified proteins at a concentration of 500 mcg/ml were mixed with aluminum phosphate adjuvant at a 1:1 ration.
CLAUSES
[0170] 1. An Acinetobacter cell deficient in LPS.
2. The Acinetobacter cell according to the preceding claim, obtained through partial or complete inactivation of one or various of the nucleic acids encoding the endogenous LPS biosynthesis genes.
3. The Acinetobacter cell according to the preceding claim, wherein the genes are selected from IpxA, IpxB and/or IpxC, or any combination thereof.
4. The Acinetobacter cell according to any one of the preceding claims, wherein the cell is obtained by deletions, and/or insertions of one or various nucleotides in the coding sequences of the genes.
5. The Acinetobacter cell according to any one of the preceding claims, wherein the cell is an attenuated Acinetobacter cell.
6. A composition comprising: [0171] a) a cell according to any one of claims 1-2, and [0172] b) a nucleic acid molecule, and/or a polypeptide.
7. The composition according to the preceding claim, wherein the nucleic acid molecule is recombinant and the polypeptide is recombinant.
8. The composition according to any one of claims 6-7, wherein the polypeptide is selected from: [0173] a) the peptide sequence SEQ ID NO: 27 (putative ferric siderophore receptor (A. baumannii ATCC 17978; accession number YP_001084684)) or a fragment thereof, wherein the fragments are biologically active fragments, and preferably selected from the list consisting of SEQ ID NO: 1 to SEQ ID NO: 11, or any of its combinations, or sequences having at least 85% sequence identity with peptide sequences SEQ ID NO: 1 to SEQ ID NO: 11, and/or [0174] b) the peptide sequence SEQ ID NO: 28 (putative ferric hydroximate siderophore receptor (A. baumannii ATCC 17978; accesión number YP_001084696)) or a fragment thereof, where the fragments are biologically active fragments, and preferably selected from the list consisting of SEQ ID NO: 12 to SEQ ID NO: 23, or any of its combinations, or sequences having at least 85% sequence identity with peptide sequences SEQ ID NO: 12 to SEC ID NO: 23.
9. The composition according to any one of claims 6-8, further comprising the amino acid sequence SEQ ID NO: 28 and the amino acid sequence SEQ ID NO: 27.
10. The composition according to any one of claims 6-9 further comprising a fusion protein comprising at least 2, preferably 3, more preferably 4 amino acid sequences form the list SEQ ID NO: 1 to SEQ ID NO: 23 or a variant of these sequences having at least 85% sequence identity with SEQ ID NO. 1 to SEQ ID NO: 23.
11. The composition according to claim 10, wherein the fusion protein further comprises the amino acid sequence SEQ ID NO: 24 or the amino acid sequence SEQ ID NO: 25.
12. The composition according to any one of claims 6-11, wherein the composition comprises a nucleotide sequence capable of transcribing an amino acid sequence as described in any one of claims 8-11.
13. The composition according to claim 12, wherein the nucleotide sequence is the SEQ ID NO: 26.
14. The composition according to any one of claims 6-13, further comprising an expression vector comprising the nucleotide sequence according to any one of claims 12-13
15. The composition according to any one of claims 6-14, further comprising outer membrane vesicles deficient in LPS, or cells according to any one of claims 1 to 5.
16. The composition according to any one of claims 6-14, further comprising at least one of the purified outer membrane proteins of A. baumannii with amino acid sequence SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46; SEQ ID NO: 47; SEQ ID NO: 48; SEQ ID NO: 49; SEQ ID NO: 50; SEQ ID NO: 51; SEQ ID NO: 52; SEQ ID NO: 53; SEQ ID NO: 54; SEQ ID NO: 55; SEQ ID NO: 56; SEQ ID NO: 57; SEQ ID NO: 58; SEQ ID NO: 59; SEQ ID NO: 60; SEQ ID NO: 61; SEQ ID NO: 62; SEQ ID NO: 63; SEQ ID NO: 64; SEQ ID NO: 65; SEQ ID NO: 66; SEQ ID NO: 67; SEQ ID NO: 68; SEQ ID NO: 69; SEQ ID NO: 70; SEQ ID NO: 71; SEQ ID NO: 72; SEQ ID NO: 73; SEQ ID NO: 74; SEQ ID NO: 75; SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, or combinations thereof.
17. An outer membrane vesicle that is deficient in LPS.
18. The outer membrane vesicle according to claim 17, obtained from a cell according to any one of claims 1-5.
19. The composition according to any one of claims 6-15, wherein the cells or the outer membrane vesicles are designed to produce the amino acid sequences according to any one of claim 8-11 or 16 and/or comprising the nucleotides or nucleic acids according to any one of claims 12-13.
20. A nucleotide sequence capable of transcribing any fusion protein according to any one of claims 10-11.
21. An expression vector comprising a nucleotide or a nucleic acid according to any one of claims 12-13.
22. The composition according to any one of claims 7 to 16 and 19 that is a pharmaceutical composition.
23. The composition according to claim 22, further comprising a pharmaceutically acceptable vehicle.
24. The composition according to any one of claim 22 or 23, further comprising another active ingredient.
25. The composition according to any one of claims 22-24, further comprising an adjuvant.
26. The composition according to any one of claims 7 to 16, 19 to 22 and 25, wherein the composition is a vaccine.
27. The composition according to any one of claims 7 to 16, 19 to 22, and 25 for use as a medicament.
28. The composition according to any one of claims 7 to 16, 19 to 22, and 25 for the prevention, improvement or the treatment of an infection caused by A. baumannii in un mammal.
29. The composition according to any one of claims 7 to 16, 19 to 22, and 25 for conferring protection against infection caused by A. baumannii in a mammal.
30. An antibody or active fragment thereof obtained by immunization of a mammal with the composition according to any one of claims 7 to 16, 19 to 22 and 25.
31. The antibody or fragment thereof of the previous claim, wherein the composition is a pharmaceutical composition and wherein said composition is used in therapy, particularly for the treatment and prevention of infection caused by A. baumannii.
ADDITIONAL CLAUSES
[0175] 1.—An Acinetobacter cell deficient in LPS obtained by partial or complete inactivation of one or various cellular nucleic acid molecules that encode endogenous LPS biosynthesis genes.
2.—The Acinetobacter cell according to the preceding claim, wherein the genes are selected from IpxA, IpxB and/or IpxC, or any of their combinations.
3.—A composition comprising: [0176] a) a cell according to any one of claims 1-2, and [0177] b) a recombinant nucleic acid molecule, and/or a recombinant polypeptide.
4.—The composition according to claim 3, wherein the polypeptide is selected from:
[0178] c) the peptide sequence SEQ ID NO: 27 (putative ferric siderophore receptor (A. baumannii ATCC 17978; accession number YP_001084684)) or a fragment thereof, wherein the fragments are biologically active fragments, and preferably selected from the list consisting of SEQ ID NO: 1 to SEQ ID NO: 11, or any of its combinations, or sequences having at least 85% sequence identity with peptide sequences SEQ ID NO: 1 to SEQ ID NO: 11, and/or [0179] d) the peptide sequence SEQ ID NO: 28 (putative ferric hydroximate siderophore receptor (A. baumannii ATCC 17978; accesión number YP_001084696)) or a fragment thereof, where the fragments are biologically active fragments, and preferably selected from the list consisting of SEQ ID NO: 12 to SEQ ID NO: 23, or any of its combinations, or sequences having at least 85% sequence identity with peptide sequences SEQ ID NO: 12 to SEC ID NO: 23.
5.—The composition according to any one of claims 3-4, wherein the composition comprises a nucleotide sequence capable of transcribing an amino acid sequence described in claim 4, preferably SEQ ID NO: 26.
6.—The composition according to any one of claims 3-5, further comprising an outer membrane vesicle deficient in LPS, or cells according to any one of claims 1 and 2.
7.—The composition according to any one of claims 3-6, further comprising at least one of the proteins purified from the outer membrane of A. baumannii SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46; SEQ ID NO: 47; SEQ ID NO: 48; SEQ ID NO: 49; SEQ ID NO: 50; SEQ ID NO: 51; SEQ ID NO: 52; SEQ ID NO: 53; SEQ ID NO: 54; SEQ ID NO: 55; SEQ ID NO: 56; SEQ ID NO: 57; SEQ ID NO: 58; SEQ ID NO: 59; SEQ ID NO: 60; SEQ ID NO: 61; SEQ ID NO: 62; SEQ ID NO: 63; SEQ ID NO: 64; SEQ ID NO: 65; SEQ ID NO: 66; SEQ ID NO: 67; SEQ ID NO: 68; SEQ ID NO: 69; SEQ ID NO: 70; SEQ ID NO: 71; SEQ ID NO: 72; SEQ ID NO: 73; SEQ ID NO: 74; SEQ ID NO: 75; SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, or any combination thereof.
8. An outer membrane vesicle deficient in LPS.
9. The outer membrane vesicle according to claim 8, obtained from a cell as described in any one of claims 1-2.
10. The composition according to any one of claims 3-7, wherein the cells or the outer membrane vesicles are designed to produce the polypeptide sequences according to any one of claims 4 and 7, and/or comprising the nucleic acid sequences of claim 5.
11. The composition according to any one of claims 3-7 and 10, wherein the composition is a pharmaceutical composition.
12. The composition according to any one of claims 3-7, 10 and 11 for use as a medicament.
13. The composition according to any one of claims 3-7, 10 and 11 for use in the prevention, improvement or treatment of an infection caused by A. baumannii in a mammal.
14. An antibody or active fragment thereof obtained by immunization of a mammal with the composition according to any one of claims 3 to 7, 10 and 11.
15. The antibody or the active fragment thereof according to the preceding claim, wherein the composition is a pharmaceutical composition, and where said composition is used in therapy, particularly for the treatment or prevention of an infection caused by A. baumannii.