LACTOCOCCUS LACTIS STRAINS FOR THE PREVENTION AND/OR THE TREATMENT OF VISCERAL PAIN
20220152126 · 2022-05-19
Inventors
- Muriel COCAIGN-BOUSQUET (Mons, FR)
- Hélène EUTAMENE (Balma, FR)
- Muriel MERCIER BONIN (Toulouse, FR)
- Vassilia Theodorou (Portet-sur-Garonne, FR)
- Valérie LAROUTE (Toulouse, FR)
- Marie-Line DAVERAN-MINGOT (Castanet, FR)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K35/744
HUMAN NECESSITIES
International classification
A61K35/744
HUMAN NECESSITIES
A23L29/00
HUMAN NECESSITIES
Abstract
A Lactococcus lactis strain or a cell fraction thereof for use in the prevention and/or treatment of visceral pain is provided.
Claims
1. A Lactococcus lactis strain able to produce at least 10 mM of γ-aminobutyric acid (GABA) in a time of culture lower or equal to 24 hours, for use in the prevention and/or the treatment of abdominal or visceral pain.
2. A Lactococcus lactis strain producing at least 20 μmole/min.Math.mg of the pyridocal-5′-phosphate (PLP)-dependent enzyme glutamate decarboxylase (GAD) in a time of culture comprised between 7 hours and 8 hours for use in the prevention and/or the treatment of abdominal or visceral pain.
3. The Lactococcus lactis strain according to claim 1 or claim 2, characterized in that said strain is selected in the group consisting of: CNCM I-5388, CNCM I-5386 and NCDO2118.
4. The Lactococcus lactis strain according to anyone of claims 1 to 3, characterized in that said strain is administered in presence of free glutamate.
5. A cell fraction obtained from the Lactococcus lactis strain as defined in any one of claims 1 to 3, for use in the prevention and/or the treatment of visceral pain.
6. A composition comprising the Lactococcus lactis strain as defined in any one of claims 1 to 3 or the cell fraction as defined in claim 4, for use in the prevention and/or the treatment of visceral pain.
7. The composition comprising the Lactococcus lactis strain according to claim 6, characterized in that it comprises a content of the L. lactis strain allowing the administration of at least 10.sup.6 colony forming units (cfu) of said L. lactis strain per day.
8. The composition according to claim 6, characterized in that it also comprises free glutamate.
9. The composition according to claim 6, characterized in that it is a food product.
10. The Lactococcus lactis strain according to any one of claims 1 to 3 or the cell fraction according to claim 5 or the composition according to any one of claims 6 to 9, characterized in that visceral pain is linked to a psychological stress events and/or anxiety.
11. The Lactococcus lactis strain according to any one of claims 1 to 3 or the cell fraction according to claim 5 or the composition according to any one of claims 6 to 9 for their use according to claim 10, characterized in that visceral pain is due to burning mouth syndrome (BMS).
12. A Lactococcus lactis strain, characterized in that said strain is selected in the group consisting of: CNCM I-5388, CNCM I-5386.
13. A cell fraction obtained from the Lactococcus lactis strain as defined in claim
12.
14. A composition comprising the Lactococcus lactis strain according to claim 12 or the cell fraction according to claim 13.
15. The composition comprising the Lactococcus lactis strain according to claim 14, characterized in that it comprises at least 10.sup.6 cfu per gram dry weight.
16. The composition according to claim 14, characterized in that it is a food product.
17. The composition according to claim 14 for use as a medicament.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0078] The present invention will be understood more clearly from the further description which follows, which refers to examples illustrating the capacity of the L. lactis strains in the present invention for reducing visceral pain, as well as to the appended figures.
[0079]
[0080]
[0081]
[0082]
[0083]
[0084] n=7 for the “PRS+CNCM I-5388” group (black/white diamond, dash-dotted line) and “PRS+CNCM I-5388+free glutamate” (black diamond, solid line)). *P<0.05; **P<0.01 vs. basal values for animals treated with vehicle, C. Results obtained with L. lactis NCDO2118 at 10 days. Data are expressed as means±SEM (n=9 for the “vehicle” group (white square, solid line); n=9 for the “PRS+vehicle” group (black square, solid line); n=12 for the “PRS+NCDO2118+free glutamate” group (black triangle, solid line); n=8 for the “PRS+NCDO2118” group (black/white triangle, dash-dotted line)) ***P<0.001 vs. basal values for animals treated with vehicle. .sup.+P<0.05; .sup.++P<0.01 vs. values for stressed animals treated with vehicle. D. Results obtained with L. lactis CNCM I-5388 at 10 days. Data are expressed as means±SEM (n=7 for the “vehicle” group (white square, dashed line); n=7 for the “PRS+vehicle” group (black square, solid line); n=8 for the “PRS+CNCM I-5388” group (black/white diamond, dash-dotted line) and n=7 for the “PRS+CNCM I-5388+free glutamate” (black diamond, solid line). **P<0.01 vs. basal values for animals treated with vehicle. .sup.+P<0.05 vs. values for stressed animals treated with vehicle.
[0085]
[0086]
DETAILED DESCRIPTION
EXAMPLE 1: Physiological Characterization of Bacterial Suspensions of Interest
1. Materials and Methods
[0087] 1.1.Bacterial Strains, Medium and Culture Conditions:
[0088] The data set is composed of four strains belonging to the Lactococcus lactis subsp. lactis. The two strains, NCDO2118 and NCDO2727 were isolated from vegetables while CNCM I-5388 and CNCM I-5386 have a dairy origin (raw milk and whey respectively).
[0089] In these strains, the gad cluster involved in GABA biosynthesis is located on the chromosome between kefA and rnhB genes (
[0090] Bacterial cultures were performed in duplicate in 2-L Biostat B-plus bioreactor (Sartorius, Melsungen, Germany) in medium M17 (Table 1) supplemented with 55 mM (8 g/L) free glutamate, 29 mM (5 g/L) arginine, 250 mM (45 g/L) glucose and 300 mM NaCl. Cultures were incubated at 30° C.
TABLE-US-00001 TABLE 1 Composition of medium M17. Ingredients g/L Tryptone 2.5 Peptic digest of animal tissue 2.5 Papaic digest of soybean meal 5 Meat extract 5 Yeast extract 2.5 Ascorbic acid 0.5 Magnesium sulphate 0.5 Sodium glycerophosphate 19
[0091] Fermentations were carried out under oxygen-limiting conditions, with air in the gaseous phase but without air bubbling. pH was maintained at 6.6 by KOH addition for 8 h, then pH was modified and regulated at 4.6.
[0092] Culture was inoculated with cells from pre-cultures grown in Erlenmeyer flask on similar medium, harvested during the exponential phase and concentrated in order to obtain an initial optical density (OD) at 580 nm of 0.25 in the fermenter.
[0093] Bacterial growth was estimated by spectrophotometric measurements at 580 nm (Libra S11, Biochom, 1 Unity of absorbance is equivalent to 0.3 g/L).
[0094] Samples were collected every 30 min for HPLC measurement of GABA concentration in the growth medium.
[0095] Cellular samples for oral administration were prepared as follows. Cells were harvested before the pH modification (i.e. at 7 h for NCDO2118 and NCDO2727).
[0096] The culture volume required for approximately 3×10.sup.11 cells was centrifuged at 5000 g and 4° C. for 10 min to pellet the bacterial cells.
[0097] Cells were washed twice with 0.9% NaCl and suspended in 0.9% NaCl containing 15% glycerol to a final concentration of 10×10.sup.9 cfu/mL and stored at −20° C. until use.
[0098] 1.2.GABA Extraction and Quantification:
[0099] GABA concentration in culture supernatant or reaction mixture of enzyme assay was measured by HPLC (Agilent Technologies 1200 Series, Waldbronn, Germany).
[0100] Prior to HPLC, proteins were precipitated by adding four volumes of methanol to one volume of sample. The mixture was centrifuged and the supernatant kept for HPLC analysis. Amino acids were automatically derived with OrthoPhtalic Aldehyde (OPA) and 9-fluorenylmethyl-chloroformiate (FMOC-C1). The derivatives were separated on Hypersil AA-ODS column (Agilent Technologies) at 40° C. by a linear gradient of acetate buffer (pH 7.2) with triethylamin (0.018%), tetrahydrofuran (0.3%) and acetonitrile. A diode array detector, at 338 nm for OPA derivatives and 262 nm for FMOC derivatives, was used.
[0101] 1.3. Glutamate Decarboxylase (GAD) Activity:
[0102] 50 mg of bacterial cells were harvested at 7 h of culture. Cells were washed twice with 0.2% KCl and suspended in sodium acetate buffer (100 mM, pH 4.6) containing 4.5 mM MgCl.sub.2, 22% glycerol and 1.5 mM DTT. Cells were disrupted by sonication (four cycles of 30 s and 60 s spaced out, 6.5 m/s) and kept on ice during the treatment. Cell debris were removed by centrifugation for 15 min at 10,000 g and 4° C.
[0103] The supernatant was used for enzyme assays, and the protein concentration of the extract was determined by the Bradford method with bovine serum albumin as the standard.
[0104] Enzyme assay was realized with 0.5 mL of substrate solution, consisting of 20 mM sodium glutamate, 2 mM pyridoxal phosphate (PLP) incubated at 30° C. then mixed with 0.5 mL supernatant. Every 30 min until 4 h, 100 μL were sampled and inactivated by boiling for 5 min to stop the decarboxylation reaction. Reaction mixtures were subsequently analyzed for the presence of GABA using HPLC.
[0105] The GAD activity was measured at 7 h and neutral pH condition.
[0106] One unit of enzyme activity was defined here as the amount of enzyme which converted 1 μmole of glutamate per min and per mg of protein.
2. Results
[0107] 2.1. In vitro GABA Production:
[0108] The biomass and GABA concentrations were measured all along the culture for NCDO2118, CNCM I-5388, CNCM I-5386 and NCDO2727 strains (
[0109] In the first 8 hours, the bacterium NCDO2118 as well as CNCM I-5388, CNCM I-5386 grew fast (growth rate around 0.7-0.8 h.sup.−1) at pH 6.6 compared to NCDO2727. GABA was accumulated at low levels for all strains. Then at 8 hours, the pH was lowered and controlled to 4.6, growth stopped thereafter and biomass decreased. This loss in cell viability was confirmed by plating.
[0110] Despite the growth arrest, the production of GABA by NCDO2118 strain or CNCM I-5388 and CNCM I-5386 continued with increased GABA production rate (Table 2). The maximal GABA concentration reached 60 mM at 24 hours for CNCM I-5388. Similar results were obtained with a second culture in bioreactor (independent duplicate). GABA production of 40-60 mM corresponds to the complete bioconversion of initial concentration of free glutamate into the bioreactor. Despite the strong similarity of the gad operon sequence and organization in all the four strains, GABA production pattern of the NCDO2727 strain characterized under similar culture conditions was very different with a very weak amount of GABA produced since GABA concentration is always below 0.2 mM (
TABLE-US-00002 TABLE 2 Specific rates of GABA production calculated between 7 and 11.5 hours (mmole/g cell dry weight/h) during growth of L. lactis NCDO2118, CNCM I-5388, CNCM I-5386 and NCDO2727 in bioreactor (in duplicates). NCDO2118 NCDO2727 CNCM I-5388 CNCM I-5386 μmax (h.sup.−1) 0.71 ± 0.05 0.21 ± 0.04 0.81 ± 0.08 0.71 ± 0.05 ν .sub.mean GABA 2.86 ± 0.39 0.02 ± 0.04 6.70 ± 2.67 1.09 ± 0.27 (mmole/g/h)
[0111] 2.2. In vitro GAD Activity:
[0112] High GAD activity was obtained in the NCDO2118 strain consistently with its high GABA production ability, while in the NCDO2727 strain, the amount was extremely low
[0113] (Table 3). Intermediary level of GAD activity was obtained for CNCM I-5386 strain while a very high activity was measured for the CNCM I-5388 strain. One can notice however that, under neutral pH condition at 7 hours, the GAD activity in the NCDO2118 strain, CNCM I-5388 or CNCM I-5386 was high despite the low GABA production accumulated in the bioreactor, suggesting that the enzymatic equipment for GABA production was already expressed in cells but not yet active.
TABLE-US-00003 TABLE 3 Specific GAD activity (μmole/min .Math. mg of protein) of the L. lactis strains after 7 hours of growth in M17 supplemented with free glutamate (8 g/L), arginine (5 g/L), and NaCl (300 mM) (n = 3 for each of the two cultures replicates in bioreactor). NCDO2118 NCDO2727 CNCM I-5388 CNCM I-5386 GAD 7 hours 42.7 ± 5.9 0.6 ± 0.4 826.2 ± 93.0 20.7 ± 4.3
EXAMPLE 2: Effect of L. lactis Strains of Interest in a Stress Model in Rat (Model
[0114] IBS)
1. Materials and Methods
[0115] 1.1. Animals and Surgical Procedure:
[0116] Adult female Wistar rats (200-225 g) were purchased from Janvier Labs (Le Genest St Isle, France) and individually housed in polypropylene cages under standard conditions (temperature 22±2° C. and a 12-h light/dark cycle). Animals were allowed free access to water and food (standard pellets 2016, Envigo RMS SARL, Gannat, France). All experiments were approved by the Local Animal Care and Use Committee, in compliance with European directive 2010/63/UE.
[0117] Under general anesthesia by intraperitoneal administration of 0.6 mg/kg acepromazine (calmivet, Vetoquinol, Lure, France) and 120 mg/kg ketamine (Imalgene 1000, Merial, Lyon, France), animals were prepared for abdominal striated muscle electromyography (EMG) according to a previously described technique (Morteau et al., 1994).
[0118] Three pairs of NiCr wire electrodes (60 cm length and 80 μm diameter) were implanted bilaterally in the striated muscles at 2 cm laterally from the midline. The free ends of electrodes were exteriorised on the back of the neck and protected by a glass tube attached to the skin.
[0119] 1.2. Colorectal Distension Procedure and EMG Recordings:
[0120] Female rats were accustomed to being in polypropylene tunnels (20 cm length and 7 cm diameter), where they could not move, escape or turn around, for several days before colorectal distension (CRD) in order to achieve familiarization with that environment.
[0121] A 4-cm long latex balloon, fixed on rigid catheter taken from an embolectomy probe (Fogarty), was used.
[0122] CRD which is a mechanical stimulus was performed after insertion of the balloon in the rectum at 1 cm from the anus. The tube was fixed at the basis of the tail. Isobaric distensions of the colon were performed from 0 to 60 mmHg by connecting the balloon to Distender Series IIR Barostat (G&J Electronics Inc, Toronto, Canada).
[0123] The first distension was performed at a pressure of 15 mmHg and an increment of 15 mmHg was added at each following step, until a maximal pressure of 60 mmHg was reached, each distension step lasting 5 min.
[0124] The striated muscle spike bursts, related to abdominal cramps, were recorded on an electroencephalograph machine (Mini VIII, Alvar, Paris, France) from implanted electrodes, using a short time constant (0.03 s) to remove low-frequency signals (<3 Hz). EMG recordings started 7 days after surgery.
[0125] The number of contractions for a period of 5 minutes represents the intensity of visceral pain.
[0126] 1.3. Stress Procedure:
[0127] All stress sessions were performed at the same time of day (between 10 am and 12 noon) to minimise any influence of circadian rhythm.
[0128] Partial restraint stress (PRS), a relatively mild non-ulcerogenic model of acute stress, was performed as previously described (Williams et al., 1988).
[0129] Female rats were sedated with diethyl-ether and their fore shoulders, upper forelimbs and thoracic trunk were wrapped in a confining harness of paper tape to restrict, but not prevent, body movements.
[0130] Animals were then placed in their home cage for 2 h.
[0131] 1.4. Experimental Protocol:
[0132] Four series of experiments, based on a 10-day treatment by oral gavage, were conducted using, for each series, three groups of 7 to 12 female rats equipped for EMG.
[0133] Rats were given L. lactis NCDO2118 or NCDO2727 by gavage once daily for 10 days. Washed bacterial cells (10.sup.9 cfu per day) were used in order to minimize the amount of GABA initially administered to rats. Unless otherwise stated, free glutamate (0.2% (w/v)) was added to the gavage mixture to favor in vivo GABA production.
[0134] For all conditions, basal abdominal response to CRD was recorded on Day 9 of the treatment and PRS-induced visceral hypersensitivity to CRD recorded on Day 10 of the treatment.
[0135] CRD measurements were performed 20 minutes after the 2 h PRS session.
[0136] On vehicle-treated animals, free glutamate (0.2% (m/v)) is verified as having no effect per se on basal and stress-induced colorectal sensitivity.
[0137] 1.5. Statistical Methods:
[0138] For animal experiments, data are reported as the means ±standard errors of the means (SEM). The software GraphPad Prism 6.0 (GraphPad, San Diego, Calif.) was used for statistical analysis. One-way ANOVA, followed by Tukey's Multiple Comparison test, was performed to compare data between the different groups of animals. Statistical significance was accepted at P<0.05.
2. Results
[0139] 2.1. Effect of Free Glutamate on Basal and Stress-Induced Colorectal Sensitivity
[0140] In rats treated with the vehicle under basal conditions (i.e. before PRS), gradual colorectal distension (CRD) increased the frequency of abdominal contractions in a pressure-dependent manner (
[0141] Compared with vehicle, administration of free glutamate did not affect the abdominal response to CRD (
[0142] In vehicle-treated rats, a 2-h PRS significantly increased the number of abdominal contractions in comparison with basal conditions; administration of free glutamate did not modify the visceral hypersensitivity response to CRD measured after the PRS session (
[0143] Thus, free glutamate had no effect per se on basal and stress-induced colorectal sensitivity.
[0144] 2.2. Effect of the L. lactis NCDO2118 on visceral hypersensitivity
[0145] The influence of L. lactis NCDO2118 and NCDO2727 on stress-induced visceral hypersensitivity to CRD is shown in
[0146] In vehicle-treated rats, a 2-h PRS significantly increased the number of abdominal contractions compared to basal conditions for all the pressures of distention applied from 30 mmHg (P<0.001,
[0147] Importantly, a 10-day oral administration of the L. lactis NCDO2118 suppressed the PRS-induced enhancement of abdominal contractions (P<0.01 for a distension pressure of 60 mmHg,
[0148] In contrast, oral administration of the L. lactis NCDO2727 had no effect on stress-induced visceral hypersensitivity (
[0149] In conclusion, acute restraint stress induced colonic hypersensitivity to distension in rats and this hypersensitivity phenotype was reversed by L. lactis NCDO2118 but not by L. lactis NCDO2727 after a 10-day daily oral administration (10.sup.9 cfu per day).
EXAMPLE 3: The Prevention of the Stress-Induced Visceral Hypersensitivity by L. lactis NCDO2118 is Due to its Ability to Deliver GABA In Vivo
1. Materials and Methods
[0150] 1.1. Bacterial Strains
[0151] The strains NCDO2118 and NCDO2727 were used. L. lactis NCDO2118 ΔgadB was constructed by double crossing over in the chromosome.
[0152] The GAD encoding gene gadB was deleted in order to interrupt the GABA pathway.
[0153] Two fragments of 829 and 981 bp were PCR amplified just upstream and downstream of the gadB coding sequence, respectively, with NCDO2118 chromosome as a matrix. Primers are listed in Table 4. The two fragments were fused by overlapping PCR. The pGhost9 vector was PCR amplified and linked to the fused fragments using Gibson assembly method (New Englang Biolabs). Resulting plasmid was verified by sequencing and introduced in L. lactis NCDO2118. Chromosomal deletion of gadB was then obtained by double crossing over as previously described (Maguin et al., 1996). Deletion of gadB sequence into the chromosome was verified by PCR. The culture conditions of the strains are the same as the one described in Example 1.
TABLE-US-00004 TABLE 4 Primers used for the inactivation of gadB in L. lactis NCDO2118. SEQ ID Primer name 5′-3′ sequence NO: Use for: 821-GBgadCR GGAATTCGATTTAGATGC 1 Amplification of CATAGGAGGATTTTC gabB upstream 894-GBgadC2F GATGAATATCGTACATCC 2 sequence TCCAATTTTTTAATG 892-GBkefA2F AAGCTTGATAAAACAAGA 3 Amplification of AAATATTCATGAAATTCA gabB downstream G sequence 893-GBkefA2R GGAGGATGTACGATATTC 4 ATCTTAAGAAAAATCAAA AGC 822-GBpGhost9EVF CATCTAAATCGAATTCCT 5 Amplification of GCAGCCCG pGhost9 backbone 891-GBpGh9EV2R TCTTGTTTTATCAAGCTTA 6 TCGATACCGTC 898-amt TTGGATTAGCTGCGGCAT 7 Verification of GadB(DCO) ATTTTATCG gabB deletion onto 899-avl GadB(DCO) CCTTGTTGACCATAATGC 8 the chromosome AAAGCAGGT
[0154] 1.2. Sequence Analysis of gad Operon:
[0155] In the NCDO2118 strain, the gad operon sequence was extracted from the chromosome sequence deposited in NCBI-GenBank database under the accession number CP009054.
[0156] To amplify the gad operon in NCDO2727 strain, two primers were used, GadSeq_F (5′-TCCAGAAATAACAGCTACATTGACATAATG-3′) and GadSeq_R (5′-TAACAGCCCCATTATCTAAGATTACTCC-3′). The amplification was carried out with 20 ng of genomic DNA in 25-4 reaction mixture using the Q5 High-Fidelity DNA polymerase (NEB) and according to the manufacturer's recommendation. PCR conditions consisted of an initial denaturation step of 3 min at 98° C., followed by 30 cycles of 98° C. for 10 sec, 64° C. for 30 sec, and 72° C. for 3 min and a final elongation step of 2 min at 72° C.
[0157] Then, the amplicon was purified using the QlAquick gel extraction kit (QlAgen).
[0158] The sequence was performed by Eurofins Genomics with a set of primers listed in Table 5. The sequence of the operon has been deposited in NCBI-GenBank database under the accession number MK225577.
[0159] Sequences of gad operon were compared by Blast alignment algorithm.
TABLE-US-00005 TABLE 5 Primers used for the sequencing of gad operon in L. lactis NCDO2727. Primer name 5′-3′ sequence SEQ ID NO: GabSeq_2_F AAAATATAGAAGGAGACTATTGCAAATA 9 GC GabSeq_2_R AAAAATTAATGGCCATCGTTGGTAGTTCT 10 C GabSeq_3 F TCTGTGCAGCAGAAATGGCGACGGTTGA 11 A GabSeq_3_R TCCCCATAAATTTTTCTTTTTCACTCGCAT 12 GabSeq_4_F CGGTTATTCCTCAAAAAGACTTATCATTA 13 A
2. Results
[0160] With this deletion, and under the same culture conditions, the mutant could grow similarly to the wild type (growth rate of 0.65 h.sup.−1). Under these conditions however, no GABA was produced (<0.29 mM at 24 h) and no GAD activity detected at 7 h.
[0161] The beneficial effect of L. lactis NCDO2118 treatment on stress-induced visceral hypersensitivity (P<0.001) was reversed when animals received the NCDO2118 ΔgadB isogenic strain (
EXAMPLE 4: Comparison of the Effects Obtained on Visceral Hypersensitivity with L. lactis Strains of Interest in a Stress Model in Rat (Model IBS)
1. Materials and Methods
[0162] The preparation of the animals is the same as the one described in Example 2.
[0163] Rats were given L. lactis NCDO2118 or CNCM I-5388 by gavage once daily for 4 or 9 days. Washed bacterial cells (10.sup.9 cfu per day) were used in order to minimize the amount of GABA initially administered to rats. Unless otherwise stated, free glutamate (0.2% (w/v)) was added to the gavage mixture to favor in vivo GABA production.
2. Results
[0164] The influence over time of L. lactis NCDO2118, CNCM I-5388 and CNCM I-5388 Agad on stress-induced visceral hypersensitivity to CRD is shown in
[0165] CNCM I-5388 and NCDO2118 in the presence of glutamate reduce the visceral hypersensitivity to the stress.
REFERENCES
[0166] Ait-Belgnaoui A. et al., Pain. 2005; 113:141-7. [0167] Bouin M. et al., Dig. Dis. Sci. 2001; 46:2542-2548. [0168] Camilleri M. et al., Clin. Gastroenterol. Hepatol. 2008; 6:772-781. [0169] Camilleri M et al., Am J Physiol Gastrointest Liver Physiol. 2012; 303:G775-85. [0170] Chang L. et al., Gastroenterology. 2011; 140:761-765. [0171] Coculescu E. et al., J. Med. Life. 2014; 7:512-515. [0172] Craig O. et al., Curr Opin Gastroenterol. 2018; 34:50-56. [0173] Dean B. B. et al., Am J Manag Care. 2005; 11:S17-26. [0174] de Castro L A. et al.,Pain Med. 2014; 15: 2164-5. [0175] Didari T. et al., World. J. Gastroenterol. 2015; 21:3072-3084. [0176] Ford A. C. et al., Am. J. Gastroenterol. 2014; 109:1547-1561. [0177] Gué M. et al., Neurogastroenterol Motil. 1997; 9(4):271-9. [0178] Hungin A. P. et al., Aliment. Pharmacol. Ther. 2013; 38:864-886. [0179] Keszthelyi D. et al., EJP. 2012; 16: 1444-1454. [0180] Kuiken S. D. et al., Aliment. Pharmacol. Ther. 2005; 22:157-164. [0181] Laroute V. et al., Microorganisms. 2017; 5. [0182] Maguin E. et al., J. Bacteriol. 1996; 178:931-935. [0183] Mayer E. A. et al., Gastroenterology. 1994; 107:271-293. [0184] Mayer E. A. et al., Gut. 2008; 57:384-404. [0185] Mazurak N. et al., J. Neurogastroenterol. Motil. 2015; 21:471-485. [0186] Mills S. et al., Int. J. Dairy Technol. 2010; 63:149-170. [0187] Miziara I D. et al., J. Psychosom. Res., 2009; 62:443-448. [0188] Moayyedi P. et al., Gut. 2010; 59:325-332. [0189] Morteau O. et al., Dig. Dis. Sci. 1994; 39:1239-1248. [0190] Nomura M. et al., Int. J. Syst. Bacteriol. 1999; 49:163-166. [0191] Pérez-Berezo T. et al., Nat. Commun. 2017; 8, 1314. [0192] Pokusaeva K. et al., Neurogastroenterol. Motil. 2017; 29, e12904. [0193] Posserud I. et al., Gastroenterology. 2007; 133:1113-1123. [0194] Radziwill-Bienkowska et al., Appl. Microbiol. Biotechnol. 2016; 100:9605-9617. [0195] Sun Y. et al., Chin J Dig Dis. 2006; 7:149-55. [0196] Sun A. et al., J. Oral Pathol. Med., 2013; 42:649-655. [0197] Wang Y. et al., J. Microbiol. Methods. 2011; 86:390-392. [0198] Williams C. L. et al., Am J Physiol. 1987; 253:G582-6. [0199] Williams C. L. et al., Gastroenterology. 1988; 94:611-621. [0200] Zhang C. et al., ISME J. 2016; 10:2235-2245. [0201] Zhou Q. et al., Pain. 2010; 148:454-461.