PANICUM VIRGATUM SOSEKI PROTEIN SOK2, CODING GENE AND APPLICATION THEREOF

Abstract

The present invention relates to a coding gene of the SOSEKI protein SOK2 and an application thereof, wherein through molecular regulation of the SOSEKI protein SOK2, the flowering time of Panicum virgatum is delayed, biomass is increased, lignin content in the cell wall of Panicum virgatum is reduced and the fermentable sugar yield is boosted.

Claims

1. A Panicum virgatum SOSEKI protein SOK2 comprising amino acid sequence of SEQ ID No. 2, and nucleotide sequence for coding the protein of SEQ ID No. 1.

2. An expression vector of the Panicum virgatum SOSEKI protein SOK2, wherein the expression vector is pANIC6B-PvSOK2, wherein the expression vector further comprising the nucleotide sequence SEQ ID NO. 1 of claim 1.

3. An application of the expression vector of claim 2, wherein the expression level of the SOK2 in Panicum virgatum is improved by utilizing the expression vector of claim 2.

4. An application of the Panicum virgatum SOSEKI protein SOK2 of claim 1, wherein the Panicum virgatum SOSEKI protein SOK2 is used to regulate plant biomass, cell wall quality, genetic improvement and molecular breeding of Panicum virgatum.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 is an electrophoretogram illustrating the PCR amplification of the plant SOSEKI protein PvSOK2 in Panicum virgatum.

[0021] FIG. 2 is a conceptual diagram illustrating the overexpression vector of the Panicum virgatum pANIC6B-PvSOK2.

[0022] FIG. 3 is a conceptual diagram illustrating the PCR result of the PvSOK2 overexpression transgenic Panicum virgatum plants, wherein 1#-10# represent the PvSOK2 overexpression transgenic Panicum virgatum plants, + represents the pANIC6B-PvSOK2 plasmid; —represents the wild Panicum virgatum plant and M represents the DL2000 DNA maker.

[0023] FIG. 4 is a conceptual diagram illustrating the qRT-PCR result of the PvSOK2 gene in the PvSOK2 overexpression transgenic Panicum virgatum plants, wherein Control represents the wild Panicum virgatum plant, and PvSOK2_OE-14/-35/-36 respectively represent three independent positive transgenic lines.

[0024] FIG. 5 is a conceptual diagram illustrating the statistical result of phenotype (A) and flowering time (B) of the PvSOK2_OE transgenic and wild Panicum virgatum plants, wherein Control represents the wild Panicum virgatum plant, and PvSOK2_OE-14/-35/-36 respectively represent three independent positive transgenic lines.

[0025] FIG. 6 is a conceptual diagram illustrating the test result of the biomass of the PvSOK2OE transgenic and wild Panicum virgatum plants, wherein Control represents the wild Panicum virgatum plant, and PvSOK2_OE-14/-35/-36 respectively represent three independent positive transgenic lines.

[0026] FIG. 7 is a conceptual diagram illustrating the test result of fermentable sugar yield of the PvSOK2OE transgenic and wild Panicum virgatum plants, wherein Control represents the wild Panicum virgatum plant, and PvSOK2_OE-14/-35/-36 respectively represent three independent positive transgenic lines.

DETAILED DESCRIPTION

[0027] Detailed embodiments and drawings are combined hereinafter to further elaborate the technical solution of the present invention.

[0028] The materials, reagents and molecular marker probes adopted in the following embodiments may be purchased from the market unless stated otherwise.

Embodiment 1: Cloning of the PvSOK2 Gene

[0029] According to the published genome information of Panicum virgatum in the Phytozome website (https://phytozome.jgi.doe.gov), primers PvSOK2-F and PvSOK2-R are designed on both sides of the PvSOK2 full-length sequence. Taking the Panicum virgatum cDNA as a template, the PCR amplification is performed with the aforesaid primers.

[0030] The primers' sequences are as follows:

TABLE-US-00001 PvSOK2-F: ATGGCGCTGCCCCACAGC PvSOK2-R: TGGTGATCTGGTCTGCTACTTCTGC

[0031] The PCR reaction system is: 2 μL of cDNA, 254, of 2×Buffer, 4 μL of 10 pM dNTP, 2 μL of 10 μM forward/reverse primer (respectively), 0.5 μL of 5 U/μL PrimerSTAR HS DNA polymerase and 14.54, of ddH2O. The sample is added on the ice and then mixed uniformly. The PCR reaction conditions are: 98° C. for 3 minutes; 98° C. for 5 seconds, 56° C. for 15 seconds; 72° C. for 30 seconds, 35 cycles, and 72° C. for 5 minutes. The PCR amplified product is detected by using 1% agarose gel electrophoresis, and then the fragment having a size of about 750 bp are obtained (shown in FIG. 1). The amplified fragment is extracted by using a Promega gel extraction kit and is routinely sequenced by Beijing Genomics Institute. The sequencing results show that the amplified sequence contains a complete open reading frame with a total length of 732 bases. As shown in SEQ ID NO. 2, the coding protein contains 243 amino acid residues and the sequence is shown in SEQ ID No. 1.

Embodiment 2: Construction of Recombinant Vector and Observation of Subcellular Localization by Transient Expression in Tobacco Cells

[0032] Taking the aforesaid sequence fragment as a template, the PvSOK2 is designed with a primer capable of being seamlessly joined with the expression vector pCABIA1300-cGFP, and the fragment is amplified by using a high-fidelity enzyme. The expression vector is digested by the HindIII restriction enzyme. After the PvSOK2 gene fragment and the pCABIA1300-cGFP vector fragment are extracted, a joining enzyme (purchased from Vazyme company) is adopted to join the two fragments through homologous recombination. The joined product is transformed into Escherichia coli DH5α competent cells by heat shock. Monoclonal bacterial colonies are selected and cultured in the liquid LB medium containing kanamycin for PCR amplification and sequencing identification, thereby obtaining the recombinant plasmid pCABIA1300-PvSOK2-cGFP.

[0033] The constructed recombinant vector pCABIA1300-PvSOK2-cGFP is transformed into the agrobacterium EHA105 and the strain is preserved. The bacterial solution is injected into tobacco by means of the transient expression technology to observe the subcellular localization. The fluorescence confocal results show that, different from typical transcription factors, the PvSOK2 can be localized in not only the tobacco cell nucleus but also the cell membrane, meaning that the gene may have other important biological functions other than functioning as a transcription factor.

Embodiment 3: Obtaining Transgenic Panicum Virgatum Plants Using the Overexpressing PvSOK2

[0034] The primers PvSOK2-pGWC-F and PvSOK2-pGWC-R for joining an entry vector are designed in the overexpression vector. 18 bases (seamless joining sequence) after the AhdI restriction site and the entry vector pGWC restriction site are introduced at the end of the primers. Taking the obtained PvSOK2 full-length sequence as a template, the PCR amplification is performed with the aforesaid primers.

[0035] The primers' sequences are as follows:

TABLE-US-00002 PvSOK2-pGWC-F: AAAGCAGGCTTTGACTTTATGGCGCTGCCCCACAGC PvSOK2-pGWC-R: GCTGGGTCTAGAGACTTTGGTGATCTGGTCTGCT

[0036] ACTTCTGC, wherein the underlined portions are the seamless joining sequences.

[0037] The amplified fragments are extracted. The pGWC vector is digested with the AhdI restriction enzyme and is then extracted. A joining enzyme (purchased from Vazyme company) is adopted to join the two fragments through homologous recombination. The joined product is transformed into Escherichia coli DH5a competent cells by heat shock. Monoclonal colonies are selected and cultured in the liquid LB medium containing kanamycin for sequencing identification. The recombinant strain plasmid is extracted and sequenced correctly by using the reagent kit, and the recombinant plasmid extracted fragments are integrated into the overexpression vector pANIC6B using the Gateway technology (shown in FIG. 2). The recombinant reaction is as follows: 100 ng of extracted fragments, 50 ng of pANIC6B vector plasmid, 1 μL of LR enzyme (Invitrogen, product No.: 11791020), supplementing to 10 μL with ddH2O; subsequently, culturing at a temperature of 25° C. for 6 hours, transforming into Escherichia coli DH5 competent cells to obtain the positive recombinant strain plasmid pANIC6B-PvSOK2 with correct sequencing, and then transforming into the agrobacterium EHA105.

[0038] In the method (Xi et al, Agrobacterium-mediated transformation of switchgrass and inheritance of the transgenes. 2009, Bioenergy Research, 2: 275-283), the pANIC6B-PvSOK2 is introduced into the lowland wild Panicum virgatum Alamo to obtain resistant seedlings, the vector universal primer ZmUbq-F and the downstream primer PvSOK2-R of the target gene are used to detect the target gene, and upstream and downstream primers (hph3+hph4) of the hygromycin-resistant gene are used to detect the hygromycin gene, thus finally determining the positive transgenic lines (shown in FIG. 3).

Embodiment 4: Molecular Identification of Transgenic Plants

[0039] The tender stem tissues of the aforesaid identified transgenic plants are taken and the total RNA is extracted by using a TriZol reagent kit (Invitrogen, product No.: 15596026). The content and purity of the total RNA are detected by using an agarose gel electrophoresis and nucleic acid analyzer (NanoDrop). Subsequently, 1.0 μg of total RNA is taken for reverse transcription, and a reverse transcriptase (Promega, product No.: M1701) is adopted to reverse-transcriptase it into cDNA, wherein the reverse transcriptional reaction process is referred to the Instructions. Taking the aforesaid cDNA as a template, the primers PvSOK2-qRT-F and PvSOK2-qRT-R are used for fluorescent quantitative PCR detection, and the reference gene is the Ubiquitin (UBQ) gene of Panicum virgatum. The sequences of the primers are as follows:

TABLE-US-00003 PvUBQ-F: TTCGTGGTGGCCAGTAAG PvUBQ-R: AGAGACCAGAAGACCCAGGTACAG PvSOK2-qRT-F: TACTTCAGCGGCAGCATCGTG PvSOK2-qRT-R: CCTCCTCCGTCGCCTTCCAT

[0040] The real-time fluorescent quantitative PCR reaction system is 20 μL, including 1 μL of forward/reverse primer (respectively), 2 μL of cDNA template, 10 μL of SYBR Green qRT Master Mix (purchased from Takara Bio Inc.) and ddH2O (supplements to 2 L). The model no. of the real-time fluorescent quantitative PCR is Roche480 and a two-step method is adopted to perform the reaction. The test results show that, compared with the wild Control, the expression levels of the PvSOK2 in the transgenic plants PvSOK2_OE-14, PvSOK2_OE-35 and PvSOK2_OE-36 are significantly increased (shown in FIG. 4).

Embodiment 5: Analysis of Flowering Time, Biomass and Fermentable Sugar Yield of Transgenic Plants

[0041] The flowering time and biomass of the transgenic plants growing for 6 months are measured. Compared with the control plant, the flowering time of transgenic plants is delayed (shown in FIG. 5). The aboveground materials of the Control and the PvSOK2¬_OE-14/-35/-36 plants growing for 6 months are collected and their fresh weights are measured respectively. The results show that the biomass of transgenic plants is increased by 19.3-33.6% compared with that of the wild plant (shown in FIG. 6). The fermentable sugar yield is detected by using the phenol sulfate method, wherein the specific detecting process is: using the cellulase and cellobiase mixture for the direct enzymatic hydrolysis of cell wall residues for 72 hours, and then taking it as the Control; using 1.5% H.sub.2SO.sub.4 to pretreat at a temperature of 121° C. for 60 minutes, and using the same amount of cellulase and cellobiase mixture for the enzymatic hydrolysis of cell wall residues for 72 hours, and then taking it as the treatment group. The fermentable sugar content in the enzymatic hydrolysis product is detected by using the phenol sulfate method (Dubois et al, Colorimetric Method for Determination of Sugars and Related Substances. 1956, Analytical Chemistry 28: 350-356). The saccharification efficiency is the ratio between the difference of fermentable sugar content before and after the enzymatic hydrolysis and the fermentable sugar content before the enzymatic hydrolysis. Thus, according to the following formula: fermentable sugar yield (g/plant)=carbohydrate yield (g/plant) in aboveground cell wall×saccharification efficiency, the fermentable sugar yield of transgenic plants calculated out is increased by about 65% compared with the wild plant (shown in FIG. 7).

[0042] The general principle defined in the specification may be realized in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the aforesaid embodiments but to the widest scope consistent with the principles and inventive features disclosed in the present invention.