ENGINEERED PLATELETS FOR TARGETED DELIVERY OF A THERAPEUTIC AGENT
20230265153 · 2023-08-24
Inventors
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
C07K2319/33
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
C07K14/70535
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides engineered platelets with chimeric platelet receptors (CPR) with a desired target specificity. Additionally, the engineered platelets may comprise cargo which may be released upon activation of the platelet. Additionally, the platelets may be generated in vitro from megakaryocytes engineered to generate non-thrombogenic platelets.
Claims
1-53. (canceled)
54. An engineered megakaryocyte or megakaryocyte progenitor cell line comprising a nucleic acid encoding a chimeric platelet receptor that recognizes and binds to a target antigen, wherein the chimeric platelet receptor comprises: (a) an intracellular domain of an immunoreceptor tyrosine-based activation motif (ITAM)-containing receptor that stimulates platelet activation; and (b) an extracellular target antigen-binding domain that comprises (i) a variable heavy chain of an antibody, or an antigen-binding fragment thereof, and (ii) a variable light chain of an antibody, or an antigen-binding fragment thereof.
55. an engineered megakaryocyte or megakaryocyte progenitor cell line that produces platelets with reduced thrombogenic potential, comprising a disruption of or deletion of at least two genes encoding: (a) a protein involved in recognition of primary stimuli of thrombus formation selected from the group consisting of: GPIb/V/IX, GPVI (GP6), ITGA2B, CLEC2, integrins αIIbβ3, α2β1, α5β1 and/or α6β1; (b) a protein involved in recognition of secondary mediators of thrombus formation selected from the group consisting of Par1, Par4, P2Y12, GPIb/V/IX, the Thromboxane receptor (TBXA2R), P2Y1, P2X1 and/or integrin αIIbβ3; and/or (c) a protein involved in the release of secondary mediators of thrombus formation selected from the group consisting of Cox1, HPS and/or thromboxane-A synthase (TBXAS1).
56. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the extracellular target antigen-binding domain comprises an scFv.
57. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the nucleic acid encoding the chimeric platelet receptor further comprises a platelet-specific promoter.
58. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 further comprising a heterologous nucleic acid encoding a therapeutic agent that is a protein, peptide or RNA.
59. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 wherein the nucleic acid encoding the therapeutic agent further comprises a platelet-specific promoter.
60. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 wherein the nucleic acid encoding the therapeutic agent further comprises an α-granule localization signal.
61. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 further comprising a mutation in one or more genes encoding polypeptides involved in thrombogenesis that reduces a thrombogenic function of platelets generated from the megakaryocyte or megakaryocyte progenitor cell line.
62. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the intracellular domain comprises an intracellular domain or fragment thereof from Glycoprotein VI (GPVI), C-type lectinlike receptor 2 (CLEC-2), Fc Fragment of IgG Receptor IIa (FCgR2A), high affinity immunoglobulin epsilon receptor subunit gamma (FCERG), C-Type lectin domain family 1 (CLEC1), or Fc fragment of IgG receptor II (FCGR2).
63. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the intracellular domain comprises an intracellular domain of any of SEQ ID NOs: 5, 7, 14 or 19.
64. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the target is: a) an antigen associated with a disease, disorder or condition; or b) a tumor antigen, tumor neoantigen or tumor autoantigen.
65. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 comprising a mutation or deletion in a gene encoding β2 microglobulin that reduces immunogenicity of platelets generated from the megakaryocyte or megakaryocyte progenitor cell line.
66. The megakaryocyte or megakaryocyte progenitor cell line of claim 54 comprising a mutation or deletion in a gene encoding an MHC I protein that reduces immunogenicity of platelets generated from the megakaryocyte or megakaryocyte progenitor cell line.
67. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 wherein the intracellular domain comprises an intracellular domain or fragment thereof from Glycoprotein VI (GPVI), C-type lectinlike receptor 2 (CLEC-2), Fc Fragment of IgG Receptor IIa (FCgR2A), high affinity immunoglobulin epsilon receptor subunit gamma (FCERG), C-Type lectin domain family 1 (CLEC1), or Fc fragment of IgG receptor II (FCGR2).
68. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 wherein the intracellular domain comprises an intracellular domain of any of SEQ ID NOs: 5, 7, 14 or 19.
69. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 wherein the target is: (a) an antigen associated with a disease, disorder or condition; or (b) a tumor antigen, tumor neoantigen or tumor autoantigen.
70. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 further comprising a mutation or deletion in a gene encoding β2 microglobulin that reduces immunogenicity of platelets generated from the megakaryocyte or megakaryocyte progenitor cell line.
71. The megakaryocyte or megakaryocyte progenitor cell line of claim 58 further comprising a mutation or deletion in a gene encoding an MHC I protein that reduces immunogenicity of platelets generated from the megakaryocyte or megakaryocyte progenitor cell line.
72. The engineered megakaryocyte or megakaryocyte progenitor cell line of claim 54 wherein the progenitor cell line is cultured from a myeloid progenitor cell line.
73. A method of using the megakaryocyte or megakaryocyte progenitor cell line of claim 54 to produce platelets comprising the chimeric platelet receptor, comprising steps of culturing the megakaryocyte or megakaryocyte progenitor cell line under conditions that generate platelets, and collecting the platelets; or an engineered platelet produced by said steps; or a method of using an engineered platelet to treat a disease or condition associated with a target, or to deliver a therapeutic agent to a subject having a disease or condition associated with said target, said engineered platelet comprising a chimeric platelet receptor comprising: (a) an intracellular domain of an immunoreceptor tyrosine-based activation motif (ITAM)-containing receptor that stimulates platelet activation; and (b) an extracellular target antigen-binding domain that comprises (i) a variable heavy chain of an antibody, or an antigen-binding fragment thereof, and (ii) a variable light chain of an antibody, or an antigen-binding fragment thereof.
74. The method of using the megakaryocyte or megakaryocyte progenitor cell line of claim 73 to produce platelets comprising incubating the platelets with one or more diagnostic or therapeutic agents to load the platelets with the diagnostic or therapeutic agents.
75. The method of claim 74 wherein the diagnostic or therapeutic agent is a small molecule or RNA.
76. The method of claim 74 wherein the diagnostic or therapeutic agent is a protein or peptide.
77. The engineered platelet or method of using the engineered platelet of claim 73 further comprising a loaded diagnostic or therapeutic agent.
78. A chimeric platelet receptor or a nucleic acid encoding the chimeric platelet receptor that comprises: (a) an intracellular domain of an immunoreceptor tyrosine-based activation motif (ITAM)-containing receptor that stimulates platelet activation; and (b) an extracellular target antigen-binding domain that comprises (i) a variable heavy chain of an antibody, or an antigen-binding fragment thereof, and (ii) a variable light chain of an antibody, or an antigen-binding fragment thereof.
Description
FIGURE LEGENDS
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
EXAMPLES
Example 1. Establishing Platelet Production in a Laboratory
[0354] iPSC-iMKCL will be obtained from the Koji Eto Lab at Megakaryon Corporation (Kyoto office/Kyoto Lab: Kyoto Research Park, 93, Awatacho, Chudoji, Shimogyo-ku, Kyoto, 600-8815, JAPAN and the Tokyo office: 337 Bldg #1, The University of Tokyo Institute of Medical Science 4-6-1, Shirokanedai, Minato-ku, Tokyo, 108-8639, JAPAN, in addition to a VERMES™ bioreactor (Satake Multimix) to allow rapid, high-quality platelet production.
[0355] Alternatively, a megakaryocyte line of choice, chosen after consultation with key opinion leaders (KOLs) will be obtained and cultured. Back-up cell lines will be established and stored at −80° C. Platelet production may take place in a VERMES™ bioreactor, or in a shaking flask with the six factors identified Ito et al., Cell, 174(3): 636-648.e18, 2018, which is hereby incorporated by reference in its entirety. The method is hypothezied to yield about 2.4×10.sup.6 platelets/ml in three days). A hybrid approach combining the techniques described herein also may be used. For example, Meg01 cells (ATCC® CRL-2021™ from Sigma Aldrich) may be combined with the six factors in a bioreactor with turbulence to result in less clinical translation.
[0356] An in vitro assay for CD62 (specifically displayed on platelets on activation) may be performed to ensure the platelets are active. For example, platelet CD62 will be measured using flow cytometry prior to activation. Adenosine diphosphate (ADP), thrombin, or collagen will be added to activate platelets, then percent of surface exposure of CD62 will be measured.
Example 2. Generating Non-Thrombogenic Platelets
[0357] Once the progenitor cell line is established, it can be edited before platelet production. Genes may be knocked out, such as genes that affect the thrombogenicity of a platelet. Cas9 may be introduced to the megakaryocytes using a retrovirus to assist the editing process. Then, guide RNA (gRNA) electroporation would be performed. A tracking of indels by decomposition (TIDE) analysis will be performed to confirm the knockout of desired regions.
[0358] The cloning efficiency of cells also will be measured to ensure the cells can be singly plated and grown up. In some embodiments of the invention described herein, the function of the edited platelets will be measured using in vitro assays of platelet function, for example, microfluidic chips are commercially available to test aggregation.
[0359] Then, the platelets will be moved to in vivo function testing. A mouse model as shown in Boulaftali et al. 2013, where endogenous mouse platelets can be depleted, may be used (See, Boulaftali et al. “Platelet ITAM signaling is critical for vascular integrity in inflammation”. JCI, 2013, which is hereby incorporated by reference in its entirety). A line of CLEC-2 knock-out (KO) human platelets will be generated to act as a control line.
[0360] The non-thrombogenic platelets (CLEC-2 and vascular endothelial cadherin (ve)) will be combined with a dye or beta-gal (β-Gal). Each mouse is transfused with a mix of control (CLEC-2) human platelets and non-thrombogenic edited platelets. The mouse will be injured according to the protocol of an assay, such as hemoglobin (Hb) skin accumulation or tail vein bleeding time.
[0361] Any clot formed as a result of the assay will be observed for the presence of edited platelets. The mice will be treated with rhodocytin (a snake venom component that acts through CLEC-2) to trigger CLEC-2 dependent platelet aggregation of the edited platelets. Mice will be examined for the presence of a clot. If no clot is present, the edited platelets are truly non-thrombogenic.
Example 3. Generating CPR-Expressing Platelets
[0362] To test whether the edited platelets can be activated by an engineered stimulus using a CPR, CPRs were designed between known ITAM containing platelet receptors (GPVI, CLEC-2, and FCgR2A) and a model single chain antibody specific to an antigen (e.g. CD19). The construct will be introduced either as an additional copy or by knock-in to the endogenous platelet receptor locus to replace the cognate extracellular domain of the receptor. The CPR expressing platelets will be generated in vitro and exposed to a cell line expressing CD19 (e.g., NALM-6 cell line) and a control CD19 negative cell line (e.g., B16 melanoma cell line).
[0363] The ability of the CPR expressing platelets to subsequently activate in response to the presence of CD19 will be assayed in vitro through microscopy. In some embodiments, a gene (e.g., TRAIL) will be expressed to increase cytotoxicity by the engineered platelets.
[0364] Using a similar technique, the CPR may be engineered to include portions of known ITAM containing platelet receptors (GPVI, CLEC-2, and FCgR2A) and single chain MHC class 1 and MHC class 2 receptors. The variant of MHC receptor used depends on the model used, e.g. New York esophageal squamous cell carcinoma 1 (NY-ESO-1) from Astarte Biologics. The construct may be introduced as either an additional copy or by knock-in to the endogenous platelet receptor locus replacing its cognate extracellular domain. These CPR-expressing platelets will be produced in vitro, and a peptide antigen will be added to the sample. The CPR-expressing platelets will be exposed to a T-cell line responsive to peptide-MHC (or to a naïve batch of mixed T cells), and T cell response to exposure will be observed. The platelets will be loaded with different cytokine cocktails to determine whether the T cell response can be modified.
Example 5. Testing Non-Thrombogenic CPR-Expressing Platelets In Vivo
[0365] Non-thrombogenic platelets derived from a CD19 expressing melanoma cell line (or other melanoma cell line) will be engineered to contain CTLA4 and PD-1 antibodies either passively or through retroviral transduction. Immunocompetent mice will be treated with these platelets and checked for melanoma treatment.
[0366] Using the CD19 Nalm-6 B Cell leukemia model, TRAIL will be expressed in non-thrombogenic platelets. FASL and CD40L are already present, which synergize with TRAIL to induce B Cell leukaemia death. NOD scid gamma mice (NSG) mice having a tumor will be treated with the engineered platelets. The mice will be observed for a therapeutic benefit to validate the approach.
[0367] Alternatively, experimental autoimmune encephalomyelitis (EAE) may be induced in mice using previously described protocol (vaccinated with maltose binding protein (MBP)). Human platelets with mouse MHC and/or L8057 mouse cells with mouse MHC will be loaded with MBP peptide used for immunization. Further, platelets will be loaded with at least one of cytotoxic components (to kill off specific cells) and TGF-β and other anti-inflammatories. A well-defined clinical score system will be used to establish whether the above is an effective model system for testing the efficacy of non-thrombogenic CPR-expressing platelets in vivo.
Example 6—Materials and Methods for Example 7
CRISPR Guide Design
[0368] Guides were designed by identifying the first common exon of the target exon of a gene. This exon was used as input to the CRISPOR algorithm for guide selection. Four guides per target gene were chosen based on their distribution across the exon and their specificity score, listed in table 21.
Lentiviral iPSC Transduction
[0369] Replication deficient lentiviral particles containing CPR constructs and mCherry were produced by Flash Therapeutics. hiPSC lines were routinely transduced by 18-24 h single exposure to LVPs using multiplicity of infection of 100 in presence of 10 μg ml.sup.−1 Protamine Sulfate (Sigma) in routine culture medium.
iPSC Cloning
[0370] HiPSCs were cloned by single cell sorting into 96 well plates. The day prior to sorting, iPSCs were treated with CloneR (Stem Cell Technologies). 96 well plates were coated with Biolaminin 521 LN (Biolamina). CloneR was kept in the media until day 2 post sorting. Colonies were harvested 15-20 days post sorting, by treating wells with ReLeSr and replating colonies into 24 well plates.
Flow Cytometry and Staining
[0371] Single-cell suspensions were stained for 20 min at room temperature using combinations of FITC-, PE-, PE-Cy7-, APC-, and APC-H7-conjugated antibodies. Background fluorescence were set against fluorochrome-matched isotype control antibodies and compensation matrices defined using single colour-stained cells.
CRISPR Editing—Screening
[0372] 24 hours prior to nucleofection media was swapped for CloneR containing media. On the day of nucleofection, 1 μl of 61 pmol/μL of Alt-R HiFi Cas9 V3 (Integrated DNA Technologies) was mixed with 2 μl of 91.5 pmol/μL of sgRNA in TE (Synthego) (a 1:3 molar ratio) directly and incubated for at least 1 hour at room temperature. 100,000-500,000 HiPSCs per nucleofection were harvested with GCDR (Stem Cell Technologies). Harvested cells were spun down and resuspended in 20 μL nucleofection buffer P3 (Lonza). Cas9/gRNA mix was then added to the 20 μL cell/buffer P3 mix, then nucleofection was performed using 16-well Nucleocuvette Strip with 4D Nucleofector system (Lonza). Following nucleofection, 80 μL of media was added to the nucleocuvette well, and cells were replated into a single well of a 24 well plate, in CloneR containing media. Media was changed two days later for mTeSR Plus.
CRISPR Editing—Sequential
[0373] 24 hours prior to nucleofection media was swapped for CloneR containing media. On the day of nucleofection, 5 μl of 61 pmol/μL of Alt-R HiFi Cas9 V3 (Integrated DNA Technologies) was mixed with 10 μl of 91.5 pmol/μL of sgRNA in TE (Synthego) (a 1:3 molar ratio) directly and incubated for at least 1 hour at room temperature. 1-2.5 million HiPSCs per nucleofection were harvested with GCDR (Stem Cell Technologies). Harvested cells were spun down and resuspended in 100 μL nucleofection buffer P3 (Lonza). Cas9/gRNA mix was then added to the 100 μL cell/buffer P3 mix, then nucleofection was performed using the 100 μL Nucleocuvette with 4D Nucleofector system (Lonza). Following nucleofection, 400 μL of media was added to the nucleocuvette well, and cells were replated into two wells of a 6 well plate and one well of a 24 well plate, in CloneR containing media. Media was changed two days later for mTeSR Plus. Cells were given 3-4 days total to recover, before the subsequent nucleofection was performed.
CRISPR KO Quantification
[0374] Genotyping was performed by first harvesting HiPSC cells using GCDR or ReLeSr. Genomic DNA was extracted using Kapa Express Extract Kit (Roche) following manufacturers instructions. Following genomic DNA extraction, the targeted genomic region was amplified using target locus specific primers (See table 2). PCR fragments were PCR purified and submitted for Sanger Sequencing (Source Bioscience). These sequences were then input into the ICE analysis software (Synthego) and thus editing efficiencies were quantified.
iPSC Cell Culture and Forward Programming to MK
[0375] The iPSC cell line RCIB-10 was forward programmed to megakaryocytes by the concurrent expression of TAL1, FLI1 and GATA1 from a doxycycline inducible promoter (see for example Dalby thesis, University of Cambridge “Forward programming of human pluripotent stem cells to a megakaryocyte-erythrocyte bi-potent progenitor population”; and Moreau 14 Sep. 2017 “Forward Programming Megakaryocytes from Human Pluripotent Stem Cells” BBTS Annual Conference Glasgow 2017). The parental RCIB-10 line was originally derived by episomal vector mediated expression of human OCT4, SOX2, KLF4 and MYC reprogramming factors from the donor cell line.
[0376] Cells were cultured under standard conditions with doxycycline for 10 days at which point the cells were harvested.
P-Selectin Based Activation Assay (CRP/TRAP-6/PMA)
[0377] To assay the activation of MKs in response to mixing with known agonists, 100,000-500,000 MKs were first harvested by centrifugation at 100G for 8 minutes and resuspended in 100 μL of Tyrode's buffer (134 mM NaCl, 12 mM NaHCO.sub.3, 2.9 mM KCl, 0.34 mM Na2HPO4, 1 mM MgCl2, 10 mM HEPES, pH 7.4) containing anti P-Selectin antibody (Biolegend, clone AK4, variable fluorophore at 1 μL/100 μL of cells). Where live cells were assayed by flow, this was performed by direct sampling from the tube without resuspension of cells. Agonists were subsequently added and incubated with MKs for 40 minutes, before fixation with 1% PFA for 15 minutes. Following PFA fixation, cells were resuspended in 300 μL Tyrode's buffer containing anti-CD42 antibody (1 μL/100 μL) was added to allow for mature MK identification. MKs were analysed either by imaging using confocal microscopy, or by flow cytometry. CRP (Cambcol) was added to cells at a concentration of 10 μg/ml, TRAP-6 (Abcam) at a concentration of 10 μM, PMA (Sigma) at a concentration of 300 ng/mL. When cells were used as agonists (Jurkats, DSMZ cat no: ACC 282 and BJABs—B Cell lymphoma line, Ghevaert lab stock) they were added in 1:1 number vs. MKs.
TABLE-US-00021 TABLE 21 gRNA primer sequences: HPS1 Exon 7 PAM Name Sequence sequence grna1_HPS1_1r GGGGTGAATCAGTCGCTCCA GGG [SEQ ID NO: 56] grna2_HPS1_2 GTCAACACCAGCCCCGAGCG GGG [SEQ ID NO: 57] grna3_HPS1_3 GCTGGAGCGGCACGTCATCC AGG [SEQ ID NO: 58] grna4_HPS1_4r CTTGGAGTGCACGAGCAGGA AGG [SEQ ID NO: 59] ITGA2B Exon 7 PAM Name Sequence sequence grna5_ITGA2B_1r CAGTAGCCGTCGAAGTACTC TGG [SEQ ID NO: 60] grna6_ITGA2B_2 ATTTTCTCGAGTTACCGCCC AGG [SEQ ID NO: 61] grna7_ITGA2B_3r CTCGAGAAAATATCCGCAAC TGG [SEQ ID NO: 62] grna8_ITGA2B_3r GGGAGGACACGTGCCACAAA AGG [SEQ ID NO: 63] GP6 Exon 3 PAM Name Sequence sequence grna9_GP6_1 GGGCGTGGACCTGTACCGCC TGG [SEQ ID NO: 64] grna10_GP6_2r ACGAGCTCCAGCTGGTCGCT GGG [SEQ ID NO: 65] grna11_GP6_3r CGGAGGTCCCTGGCACCGGA GGG [SEQ ID NO: 66] grna12_GP6_4 CCAGTGACCCTCCGGTGCCA GGG [SEQ ID NO: 67] Par1 Exon 2 PAM Name Sequence sequence grna13_Par1_1r GGAGCTGGTCAAATATCCGG AGG [SEQ ID NO: 68] grna14_Par1_2r TTCCTGAGAAGAAATGACCG GGG [SEQ ID NO: 69] grna15_Par1_3r ACACTCCGGTGTACACAGAT GGG [SEQ ID NO: 70] grna16_Par1_4r ACGATGGCCATGATGTTTAG TGG [SEQ ID NO: 71] Par4 Exon 2 PAM Name Sequence sequence grna17_Par4_1r ACTTGGCCTGGGTAGCCGCG GGG [SEQ ID NO: 72] grna18_Par4_2 GGTGCCCGCCCTCTATGGGC TGG [SEQ ID NO: 73] grna19_Par4_3 TGGTGGGGCTGCCGGCCAAT GGG [SEQ ID NO: 74] grna20_Par4_4r AGCAGTGCCCGTGAGCTGTC CGG [SEQ ID NO: 75] Cox1 Exon 7 3′ and exon 8 PAM Name Sequence sequence grna21_Cox1_1 ACTTCTGGCAAGATGGGTCC TGG [SEQ ID NO: 76] grna22_Cox1_2 TCACCAAGGCCTTGGGCCAT GGG [SEQ ID NO: 77] grna23_Cox1_3r TGTCTCCATAAATGTGGCCG AGG [SEQ ID NO: 78] grna24_Cox1_4 AACTGCGGCTCTTTAAGGAT GGG [SEQ ID NO: 79] P2Y12 Exon 3 PAM Name Sequence sequence grna29_P2Y12_1r GTAGTCTCTGGTGCACAGAC TGG [SEQ ID NO: 80] grna30_P2Y12_2r GAAAGAAAATCCTCATCGCC AGG [SEQ ID NO: 81] grna31_P2Y12_3 ATTCTTAGTGATGCCAAACT GGG [SEQ ID NO: 82] grna32_P2Y12_4r GATCGATAGTTATCAGTCCC AGG [SEQ ID NO: 83] B2M Exon 2 PAM Name Sequence sequence grna40_B2M_1r AAGTCAACTTCAATGTCGGA TGG [SEQ ID NO: 84] grna41_B2M_2r AGTCACATGGTTCACACGGC AGG [SEQ ID NO: 85] grna42_B2M_3 ACTTGTCTTTCAGCAAGGAC TGG [SEQ ID NO: 86] grna43_B2M_4 TCACGTCATCCAGCAGAGAA TGG [SEQ ID NO: 87]
TABLE-US-00022 TABLE 22 amplicon primers: HPS1 Sequencing primers RocO1_sHPS1_F1 F ATCTGGTGCAGAGTCCAAGC [SEQ ID NO: 88] RocO1_sHPS1_R1 R TGGAGGAGGTGATTCTTGGC [SEQ ID NO: 89] Product 387 size: ITGA2B Sequencing primers RocO3_ITGA2B_F1 F GGCTCCTGGCGGCTATTATT [SEQ ID NO: 90] RocO4_ITGA2B_R1 R CTTAGGCGGTGGGTTGGC [SEQ ID NO: 91] Product 360 size: ITGA2B Sequencing primers RocO5_GP6_F1 F AGCAGCGGGGTCCAGG [SEQ ID NO: 92] RocO6_GP6_R1 R CGTGGCACCACCACCC [SEQ ID NO: 93] Product 462 size: Par1 Sequencing primers RocO7_Par1_F1 F ACCCACTCCTCCTAGTAAGAAAACA T [SEQ ID NO: 93] RocO8_Par1_R1 R CAAACTGCCAATCACTGCCG [SEQ ID NO: 94] Product 541 size: Par4 Sequencing primers RocO9_Par4_F1 F ATGTCCAGCTGTTTCCCACC [SEQ ID NO: 95] RocO10_Par4_R1 R GCAGGTGGTAGGCGATCC [SEQ ID NO: 96] Product 415 size: Cox1 Sequencing primers RocO11_Cox1_F1 F CCAACCAGGGAAGAAGCAGT [SEQ ID NO: 97] RocO12_Cox1_R1 R TGGCACAAGCTTCCCACTC [SEQ ID NO: 98] Product 514 size: P2Y12 Sequencing primers RocO15_P2Y12_F1 F GAGGAGGCTGTGTCCAAAAA [SEQ ID NO: 99] RocO16_P2Y12_R1 R GGCTGCCTGTTGGTCAGAAT [SEQ ID NO: 100] Product 607 size: B2M Sequencing primers RocO58_B2M_F1 F TGACACCAAGTTAGCCCCAA [SEQ ID NO: 101] RocO59_B2M_R1 R GGGATGGGACTCATTCAGGG [SEQ ID NO: 102] Product 463 size:
TABLE-US-00023 TABLE 23 (Media recipes): Mesoderm DMEM/F12, HEPES 500 ml medium (Thermofisher 7.5% NaHCO3 (Thermofisher) 3.6 ml 100x L-Ascorbic acid 5 ml 2-phosphate sesquimagnesium salt hydrate (Sigma) Insulin-Transferrin- 10 ml Selenium (ITS -G) 100x (but use as 50x) (Thermofisher) MK medium IMDM without phenol 500 ml red 30% BSA (BioSera 8.4 ml SA-296) Insulin-Transferrin- 5 ml Selenium (ITS -G) 100x (Thermofisher) Beta Mercaptoethanol 500 μl 55 mM
Example 7
[0378] To generate a non-thrombogenic, iPSC derived platelet-like chassis, genes encoding key components of the endogenous thrombotic process must be deleted. In this instance, the genes targeted were Cox1, GPVI, HPS1, ITGA2B, P2Y12, Par1 and Par4. CRISPR/Cas9 mediated IN/DEL generation was chosen as the method for gene knock-out (KO). First, guides were designed to target Cas9 nuclease to the above mentioned targets (
[0379] To generate the non-thrombogenic chassis producing iPSC line, these KOs must all be introduced into the same cell. To achieve this, a sequential editing protocol was designed (
[0380] Given the number of megakaryocyte (MK) specific genes KO′d within these iPSCs, it remained unclear as to whether these iPSCs would still be able to differentiate into MK like cells. To understand this, iPSCs were forward programmed into MKs by doxycycline mediated induction of MK specific transcription factors GATA1, TAL1 and FLI1. Cell surface expression of known, well defined MK markers and viability was assayed during the forward programming process (
[0381] To validate the non-thrombogenicity of our 7×KO MKs, and also their retained function, we studied their degranulation response to known platelet agonists. MKs contain the same core signal transduction machinery, plasma membranes and components as platelets (given platelets are fragments of MKs), and thus MKs were used here as a surrogate for actual platelets. It is expected that the results seen in MKs would translate directly to platelets. To assay for degranulation, cell surface P-Selectin exposure was used as a marker. P-Selectin is an alpha-granule membrane protein, and is not usually present on the platelet surface. Upon platelet activation, alpha-granules fuse with the plasma membrane and exocytose their contents (degranulation), and their membrane components mix with the plasma membrane. P-Selectin thus becomes exposed and detectable by fluorescent antibody mediated staining. Resting 7×KO MKs feature lower basal levels of P-Selectin exposure than unedited wildtype MKs (
[0382] Platelets contain ITAM domain containing receptors—specifically CLEC2, FCERG and FCGR2A. CLEC2 is a type-II membrane protein, whilst FCERG and FCGR2A are type-I membrane proteins. Type-I membrane proteins are amenable to fusion with scFV antibody domains (and other N-terminal targeting mechanisms). Chimeric platelet receptors (CPRs) were thus designed as fusions between an scFV targeting the B cell antigen CD19 derived from the FMC63 antibody, a hinge domain, and the transmembrane and cytoplasmic domains of FCERG and FCGR2A. This yielded four potential receptor designs (
[0383] To validate that the receptor itself was expressed and cell surface localised, virally transduced iPSCs were stained with recombinant CD19 fluorescently labelled with FITC. CD19-FITC should only label iPSCs if they express the anti-CD19 scFV on their cell surface, in the correct orientation. Notably, colonies positive for transduction (i.e. mCherry positive) were also positive for CD19-FITC, indicating that the designed CPRs fold and correctly localise to the plasma membrane of the cells expressing them (
[0384] A clonal high CPR3 expressing iPSC line was forward programmed into MKs. Expression of the CPR3 construct did not impact the ability for iPSCs to forward program, as all classical MK specific markers were expressed within these cells. MK viability was not impacted by CPR3 expression either (
[0385] To study the functionality of the CPR, CPR3 expressing MKs and control untransduced MKs were mixed with a CD19 expressing B cell leukaemia line (BJABs) or CD19 negative T cell leukaemia line (Jurkats) and P-Selectin exposure was measured as before. Microscopy imaging of mixed cell populations demonstrated increased P-Selectin exposure specifically within CPR3 expressing MKs when mixed with the CD19+ve BJABs (
Example Embodiments
[0386] 1. A chimeric platelet receptor (CPR) comprising: [0387] (a) a first region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-19, 24-47, and 52-55; and [0388] (b) a second region selected from the group consisting of: (i) a linker or targeting domain encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 48-51; (ii) at least a portion of a protein selected from the group consisting of: myelin oligodendrocyte glycoprotein (MOG), glutamic acid decarboxylase 2 (GAD65), myelin associated glycoprotein (MAG), peripheral myelin protein 22 (PMP22), thyroid peroxidase (TPO), voltage-gated potassium channel (VGKC), proteolipid protein (PLP), acetylcholine receptor (AChR), tribbles pseudokinase 2 (TRIB2), N-methyl-D-aspartate (NMDA)-type glutamate receptor (GluR), glutamate decarboxylase 2 (GAD2), Armadillo repeat containing 9 (ARMC9), Cytochrome P450 Family 21 Subfamily A Member 2 (CYP21A2), calcium sensing receptor (CASR), nuclear autoantigenic sperm protein (NASP), insulin, thyroid stimulating hormone receptor (TSHR), thyroperoxidase, asioglycoprotein receptor, Cytochrome P450 Family 2 Subfamily D Member 6 (CYP2D6), lactoferrin (LF), tissue trans-glutaminase (TTG), H/K ATP-ase, Factor XIII (F8), beta2-glycoprotein I (Beta2-GPI), erythrocyte I/I, B2 integrin (ITGB2), granulocyte-colony stimulating factor (G-CSF), glycoprotein (GP) IIb/IIa, collagen II (COLII), fibrinogen (FBG) myeloperoxidase (MPO), cardiac myosin (CYO), proteinase 3 (PRTN3), trichohyalin (TCHH), bullous pemphigoid associated (BP), glycoprotein 1 (GP1), laminin-332 (LM332), transglutaminase (TGM), type VII collagen (COLVII), P80 Coilin (COIL), Desmoglein I (DSG1), Desmoglein III (DSG3), SRY-Box 10 (SOX10), small nuclear ribonucleoprotein U1 subunit (70SNRNP70), S-antigen (SAG), and Collagen alpha-3(IV) chain (a3(IV)NC1 collagen); (iii) at least a portion of an antibody selected from the group consisting of: 3F8, 8H9, Abagovomab, Abciximab, Abituzumab, Abrezekimab, Abrilumab, Actoxumab, Adalimumab, Adecatumumab, Atidortoxumab, Aducanumab, Afasevikumab, Afelimomab, Alacizumab pego, Alemtuzumab, Alirocumab, Altumomab pentetate, Amatuximab, Anatumomab mafenatox, Andecaliximab, Anetumab ravtansine, Anifrolumab, Anrukinzumab, Apolizumab, Aprutumab ixadotin, Arcitumomab, Ascrinvacumab, Aselizumab, Atezolizumab, Atinumab, Atorolimumab, Avelumab, Azintuxizumab vedotin, Bapineuzumab, Basiliximab, Bavituximab, BCD-100, Bectumomab, Begelomab, Belantamab mafodotin, Belimumab, Bemarituzumab, Benralizumab, Berlimatoxumab, Bermekimab, Bersanlimab, Bertilimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Biciromab, Bimagrumab, Bimekizumab, Birtamimab, Bivatuzumab mertansine, Bleselumab, Blinatumomab, Blontuvetmab, Blosozumab, Bococizumab, Brazikumab, Brentuximab vedotin, Briakinumab, Brodalumab, Brolucizumab, Brontictuzumab, Burosumab, Cabiralizumab, Camidanlumab tesirine, Camrelizumab, Canakinumab, Cantuzumab mertansine, Cantuzumab ravtansine, Caplacizumab, Capromab pendetide, Carlumab, Carotuximab, Catumaxomab, cBR96-doxorubicin immunoconjugate, Cedelizumab, Cemiplimab, Cergutuzumab amunaleukin, Certolizumab pegol, Cetrelimab, Cetuximab, Cibisatamab, Cirmtuzumab, Citatuzumab bogatox, Cixutumumab, Clazakizumab, Clenoliximab, Clivatuzumab tetraxetan, Codrituzumab, Cofetuzumab pelidotin, Coltuximab ravtansine, Conatumumab, Concizumab, Cosfroviximab, Crenezumab, Crizanlizumab, Crotedumab, CR6261, Cusatuzumab, Dacetuzumab, Daclizumab, Dalotuzumab, Dapirolizumab pegol, Daratumumab, Dectrekumab, Demcizumab, Denintuzumab mafodotin, Denosumab, Depatuxizumab mafodotin, Derlotuximab biotin, Detumomab, Dezamizumab, Dinutuximab, Diridavumab, Domagrozumab, Dorlimomab aritox, Dostarlimab, Drozitumab, DS-8201, Duligotuzumab, Dupilumab, Durvalumab, Dusigitumab, Duvortuxizumab, Ecromeximab, Eculizumab, Edobacomab, Edrecolomab, Efalizumab, Efungumab, Eldelumab, Elezanumab, Elgemtumab, Elotuzumab, Elsilimomab, Emactuzumab, Emapalumab, Emibetuzumab, Emicizumab, Enapotamab vedotin, Enavatuzumab, Enfortumab vedotin, Enlimomab pegol, Enoblituzumab, Enokizumab, Enoticumab, Ensituximab, Epitumomab cituxetan, Epratuzumab, Eptinezumab, Erenumab, Erlizumab, Ertumaxomab, Etaracizumab, Etigilimab, Etrolizumab, Evinacumab, Evolocumab, Exbivirumab, Fanolesomab, Faralimomab, Faricimab, Farletuzumab, Fasinumab, FBTA05, Felvizumab, Fezakinumab, Fibatuzumab, Ficlatuzumab, Figitumumab, Firivumab, Flanvotumab, Fletikumab, Flotetuzumab, Fontolizumab, Foralumab, Foravirumab, Fremanezumab, Fresolimumab, Frovocimab, Frunevetmab, Fulranumab, Futuximab, Galcanezumab, Galiximab, Gancotamab, Ganitumab, Gantenerumab, Gatipotuzumab, Gavilimomab, Gedivumab, Gemtuzumab ozogamicin, Gevokizumab, Gilvetmab, Gimsilumab, Girentuximab, Glembatumumab vedotin, Golimumab, Gomiliximab, Gosuranemab, Guselkumab, Ianalumab, Ibalizumab, IBI308, Ibritumomab tiuxetan, Icrucumab, Idarucizumab, Ifabotuzumab, Igovomab, IIadatuzumab vedotin, IMAB362, Imalumab, Imaprelimab, Imciromab, Imgatuzumab, Inclacumab, Indatuximab ravtansine, Indusatumab vedotin, Inebilizumab, Infliximab, Intetumumab, Inolimomab, Inotuzumab ozogamicin, Ipilimumab, Iomab-B, Iratumumab, Isatuximab, Iscalimab, Istiratumab, Itolizumab, Ixekizumab, Keliximab, Labetuzumab, Lacnotuzumab, Ladiratuzumab vedotin, Lampalizumab, Lanadelumab, Landogrozumab, Laprituximab emtansine, Larcaviximab, Lebrikizumab, Lemalesomab, Lendalizumab, Lenvervimab, Lenzilumab, Lerdelimumab, Leronlimab, Lesofavumab, Letolizumab, Lexatumumab, Libivirumab, Lifastuzumab vedotin, Ligelizumab, Loncastuximab tesirine, Losatuxizumab vedotin, Lilotomab satetraxetan, Lintuzumab, Lirilumab, Lodelcizumab, Lokivetmab, Lorvotuzumab mertansine, Lucatumumab, Lulizumab pegol, Lumiliximab, Lumretuzumab, Lupartumab amadotin, Lutikizumab, Mapatumumab, Margetuximab, Marstacimab, Maslimomab, Mavrilimumab, Matuzumab, Mepolizumab, Metelimumab, Milatuzumab, Minretumomab, Mirikizumab, Mirvetuximab soravtansine, Mitumomab, Modotuximab, Mogamulizumab, Monalizumab, Morolimumab, Mosunetuzumab, Motavizumab, Moxetumomab pasudotox, Muromonab-CD3, Nacolomab tafenatox, Namilumab, Naptumomab estafenatox, Naratuximab emtansine, Narnatumab, Natalizumab, Navicixizumab, Navivumab, Naxitamab, Nebacumab, Necitumumab, Nemolizumab, NEOD001, Nerelimomab, Nesvacumab, Netakimab, Nimotuzumab, Nirsevimab, Nivolumab, Nofetumomab merpentan, Obiltoxaximab, Obinutuzumab, Ocaratuzumab, Ocrelizumab, Odulimomab, Ofatumumab, Olaratumab, Oleclumab, Olendalizumab, Olokizumab, Omalizumab, Omburtamab, OMS721, Onartuzumab, Ontuxizumab, Onvatilimab, Opicinumab, Oportuzumab monatox, Oregovomab, Orticumab, Otelixizumab, Otilimab, Otlertuzumab, Oxelumab, Ozanezumab, Ozoralizumab, Pagibaximab, Palivizumab, Pamrevlumab, Panitumumab, Pankomab, Panobacumab, Parsatuzumab, Pascolizumab, Pasotuxizumab, Pateclizumab, Patritumab, PDR001, Pembrolizumab, Pemtumomab, Perakizumab, Pertuzumab, Pexelizumab, Pidilizumab, Pinatuzumab vedotin, Pintumomab, Placulumab, Plozalizumab, Pogalizumab, Polatuzumab vedotin, Ponezumab, Porgaviximab, Prasinezumab, Prezalizumab, Priliximab, Pritoxaximab, Pritumumab, PRO 140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ralpancizumab, Ramucirumab, Ranevetmab, Ranibizumab, Raxibacumab, Ravagalimab, Ravulizumab, Refanezumab, Regavirumab, Relatlimab, Remtolumab, Reslizumab, Rilotumumab, Rinucumab, Risankizumab, Rituximab, Rivabazumab pegol, Robatumumab, Rmab, Roledumab, Romilkimab, Romosozumab, Rontalizumab, Rosmantuzumab, Rovalpituzumab tesirine, Rovelizumab, Rozanolixizumab, Ruplizumab, SA237, Sacituzumab govitecan, Samalizumab, Samrotamab vedotin, Sarilumab, Satralizumab, Satumomab pendetide, Secukinumab, Selicrelumab, Seribantumab, Setoxaximab, Setrusumab, Sevirumab, Sibrotuzumab, SGN-CD19A, SHP647, Sifalimumab, Siltuximab, Simtuzumab, Siplizumab, Sirtratumab vedotin, Sirukumab, Sofituzumab vedotin, Solanezumab, Solitomab, Sonepcizumab, Sontuzumab, Spartalizumab, Stamulumab, Sulesomab, Suptavumab, Sutimlimab, Suvizumab, Suvratoxumab, Tabalumab, Tacatuzumab tetraxetan, Tadocizumab, Talacotuzumab, Talizumab, Tamtuvetmab, Tanezumab, Taplitumomab paptox, Tarextumab, Tavolimab, Tefibazumab, Telimomab aritox, Telisotuzumab vedotin, Tenatumomab, Teneliximab, Teplizumab, Tepoditamab, Teprotumumab, Tesidolumab, Tetulomab, Tezepelumab, TGN1412, Tibulizumab, Tildrakizumab, Tigatuzumab, Timigutuzumab, Timolumab, Tiragotumab, Tislelizumab, Tisotumab vedotin, TNX-650, Tocilizumab, Tomuzotuximab, Toralizumab, Tosatoxumab, Tositumomab, Tovetumab, Tralokinumab, Trastuzumab, Trastuzumab emtansine, TRBS07, Tregalizumab, Tremelimumab, Trevogrumab, Tucotuzumab celmoleukin, Tuvirumab, Ublituximab, Ulocuplumab, Urelumab, Urtoxazumab, Ustekinumab, Utomilumab, Vadastuximab talirine, Vanalimab, Vandortuzumab vedotin, Vantictumab, Vanucizumab, Vapaliximab, Varisacumab, Varlilumab, Vatelizumab, Vedolizumab, Veltuzumab, Vepalimomab, Vesencumab, Visilizumab, Vobarilizumab, Volociximab, Vonlerolizumab, Vopratelimab, Vorsetuzumab mafodotin, Votumumab, Vunakizumab, Xentuzumab, XMAB-5574, Zalutumumab, Zanolimumab, Zatuximab, Zenocutuzumab, Ziralimumab, Zolbetuximab, Zolimomab aritox; and (iv) a major histocompatibility complex (MHC) class 1 receptor or a major histocompatibility complex (MHC) class 2 receptor, wherein the MHC class 1 receptor is bound to a peptide derived from a tumor antigen, a neoantigen, or an autoantigen or the MHC class 2 receptor is bound to a peptide derived from a tumor antigen, a neoantigen, or an autoantigen.
[0389] 2. The chimeric platelet receptor of embodiment 1, wherein the chimeric platelet receptor binds at least one antigen.
[0390] 3. The chimeric platelet receptor of any one of embodiments 1 and 2, wherein the chimeric platelet receptor binds a tissue in the body of a subject.
[0391] 4. The chimeric platelet receptor of any one of embodiments 1-3, wherein the chimeric platelet receptor is an ITIM-containing receptor.
[0392] 5. The chimeric platelet receptor of any one of embodiments 1-4, wherein the chimeric platelet receptor is an ITAM-containing receptor.
[0393] 6. A therapeutic delivery system comprising: [0394] (a) an engineered platelet presenting the chimeric platelet receptor of any of embodiments 1-5; and [0395] (b) at least one therapeutic agent selected from the group consisting of: a toxin, a protein, a small molecule drug, and a nucleic acid packaged within a vesicle inside the platelet.
[0396] 7. The therapeutic delivery system of embodiment 6, wherein the engineered platelet is produced from an iPSC progenitor.
[0397] 8. The therapeutic delivery system of any one of embodiments 6 and 7, wherein the nucleic acid is a mRNA, a miRNA, shRNA, and a clustered regularly interspaced short palindromic repeats (CRISPR) sequence.
[0398] 9. The therapeutic delivery system of any one of embodiments 6-8, wherein the protein is selected from the group consisting of an antibody, an enzyme, a cytokine, and a CRISPR associated protein 9 (Cas9).
[0399] 10. The therapeutic delivery system of embodiment 9, wherein the enzyme is a nuclease.
[0400] 11. The therapeutic delivery system of embodiment 10, wherein the nuclease is a transcription activator-like effector nuclease (TALEN).
[0401] 12. The therapeutic delivery system of embodiment 9, wherein the antibody binds a tumor antigen or a neoantigen.
[0402] 13. The therapeutic delivery system of any one of embodiments 6-12, wherein the therapeutic agent is release from the platelet following activation of the platelet by an antigen recognized by the chimeric platelet receptor.
[0403] 14. A method of treating a disease, disorder, or condition in a subject, the method comprising: administering to the subject the therapeutic delivery system of any of embodiments 6-13, wherein the chimeric receptor is specific to an antigen associated with the disease, disorder, or condition.
[0404] 15. The method of embodiment 14, wherein the disease, disorder, or condition is selected from the group consisting of: a cancer, an autoimmunity, and an infection.
[0405] 16. The method of any of embodiments 14 and 15, wherein the cancer is selected from the group consisting of: Acute granulocytic leukemia, Acute lymphocytic leukemia, Acute myelogenous leukemia, Adenocarcinoma, Adenosarcoma, Adrenal cancer, Adrenocortical carcinoma, Anal cancer, Anaplastic astrocytoma, Angiosarcoma, Appendix cancer, Astrocytoma, Basal cell carcinoma, B-Cell lymphoma), Bile duct cancer, Bladder cancer, Bone cancer, Bowel cancer, Brain cancer, Brain stem glioma, Brain tumor, Breast cancer, Carcinoid tumors, Cervical cancer, Cholangiocarcinoma, Chondrosarcoma, Chronic lymphocytic leukemia, Chronic myelogenous leukemia, Colon cancer, Colorectal cancer, Craniopharyngioma, Cutaneous lymphoma, Cutaneous melanoma, Diffuse astrocytoma, Ductal carcinoma in situ, Endometrial cancer, Ependymoma, Epithelioid sarcoma, Esophageal cancer, Ewing sarcoma, Extrahepatic bile duct cancer, Eye cancer, Fallopian tube cancer, Fibrosarcoma, Gallbladder cancer, Gastric cancer, Gastrointestinal cancer, Gastrointestinal carcinoid cancer, Gastrointestinal stromal tumors, General, Germ cell tumor, Glioblastoma multiforme, Glioma, Hairy cell leukemia, Head and neck cancer, Hemangioendothelioma, Hodgkin lymphoma, Hodgkin's disease, Hodgkin's lymphoma, Hypopharyngeal cancer, Infiltrating ductal carcinoma, Infiltrating lobular carcinoma, Inflammatory breast cancer, Intestinal Cancer, Intrahepatic bile duct cancer, Invasive/infiltrating breast cancer, Islet cell cancer, Jaw cancer, Kaposi sarcoma, Kidney cancer, Laryngeal cancer, Leiomyosarcoma, Leptomeningeal metastases, Leukemia, Lip cancer, Liposarcoma, Liver cancer, Lobular carcinoma in situ, Low-grade astrocytoma, Lung cancer, Lymph node cancer, Lymphoma, Male breast cancer, Medullary carcinoma, Medulloblastoma, Melanoma, Meningioma, Merkel cell carcinoma, Mesenchymal chondrosarcoma, Mesenchymous, Mesothelioma, Metastatic breast cancer, Metastatic melanoma, Metastatic squamous neck cancer, Mixed gliomas, Mouth cancer, Mucinous carcinoma, Mucosal melanoma, Multiple myeloma, Nasal cavity cancer, Nasopharyngeal cancer, Neck cancer, Neuroblastoma, Neuroendocrine tumors, Non-Hodgkin lymphoma, Non-Hodgkin's lymphoma, Non-small cell lung cancer, Oat cell cancer, Ocular cancer, Ocular melanoma, Oligodendroglioma, Oral cancer, Oral cavity cancer, Oropharyngeal cancer, Osteogenic sarcoma, Osteosarcoma, Ovarian cancer, Ovarian epithelial cancer, Ovarian germ cell tumor, Ovarian primary peritoneal carcinoma, Ovarian sex cord stromal tumor, Paget's disease, Pancreatic cancer, Papillary carcinoma, Paranasal sinus cancer, Parathyroid cancer, Pelvic cancer, Penile cancer, Peripheral nerve cancer, Peritoneal cancer, Pharyngeal cancer, Pheochromocytoma, Pilocytic astrocytoma, Pineal region tumor, Pineoblastoma, Pituitary gland cancer, Primary central nervous system lymphoma, Prostate cancer, Rectal cancer, Renal cell cancer, Renal pelvis cancer, Rhabdomyosarcoma, Salivary gland cancer, Sarcoma, Sarcoma, bone, Sarcoma, soft tissue, Sarcoma, uterine, Sinus cancer, Skin cancer, Small cell lung cancer, Small intestine cancer, Soft tissue sarcoma, Spinal cancer, Spinal column cancer, Spinal cord cancer, Spinal tumor, Squamous cell carcinoma, Stomach cancer, Synovial sarcoma, T-cell lymphoma), Testicular cancer, Throat cancer, Thymoma/thymic carcinoma, Thyroid cancer, Tongue cancer, Tonsil cancer, Transitional cell cancer, Transitional cell cancer, Transitional cell cancer, Triple-negative breast cancer, Tubal cancer, Tubular carcinoma, Ureteral cancer, Ureteral cancer, Urethral cancer, Uterine adenocarcinoma, Uterine cancer, Uterine sarcoma, Vaginal cancer, and Vulvar cancer.
[0406] 17. The method of any of embodiments 14-16, further comprising incubating the engineered platelet with the at least one therapeutic agent selected from the group consisting of: a toxin, a protein, and a small molecule drug to produce the therapeutic delivery system.
[0407] 18. The method of embodiment 17, wherein the nucleic acid is selected from the group consisting of: a mRNA, a miRNA, shRNA, and a clustered regularly interspaced short palindromic repeats (CRISPR) sequence.
[0408] 19. The method of any one of embodiments 14-18, wherein the protein is selected from the group consisting of an antibody, an enzyme, and a CRISPR associated protein 9 (Cas9).
[0409] 20. The method of embodiment 19, wherein the enzyme is a nuclease.
[0410] 21. The method of embodiment 20, wherein the nuclease is a transcription activator-like effector nuclease (TALEN).
[0411] 22. The method of any of embodiments 17-21, wherein incubating occurs prior to administering.
[0412] 23. The method of any one of embodiments 14, 15, and 17-22, wherein the disease, disorder, or condition is an autoimmunity selected from the group consisting of: Autoimmune disseminated encephalomyelitis, Autoimmune inner ear disease, Batten disease/Neuronal Ceroid Lipofuscinoses, Chronic inflammatory demyelinating polyneuropathy, Encephalitis lethargica, Anti-basal ganglia, Guillain-Barré syndrome, Hashimoto's Encephalopathy, Anti-TPO, Isaac's syndrome/acquired neuromyotonia, Miller Fisher syndrome Morvan's syndrome, Multiple sclerosis, Myasthenia gravis, Narcolepsy PANDAS, Rasmussen's encephalitis, Stiff-person syndrome, Vogt-Koyanagi-Harada syndrome, Addison's disease, Autoimmune hypoparathyroidism, Autoimmune hypophysitis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune polyglandular syndrome I (APECED), Autoimmune polyglandular syndrome II, Autoimmune polyglandular syndrome III, Diabetes mellitus, type 1, Graves' disease, Hashimoto's autoimmune thyroiditis, Immunodysregulation, polyendocrinopathy, enteropathy, X-linked, Autoimmune hepatitis type 1, Autoimmune hepatitis type 2, Autoimmune pancreatitis, Coeliac disease, Crohn's disease, Pernicious anemia/atrophic gastritis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Ulcerative colitis, Acquired hemophilia A, Antiphospholipid syndrome, Autoimmune hemolytic anemia, Autoimmune lymphoproliferative syndrome, Autoimmune neutropenia, Evans syndrome, Felty's syndrome, Immune thrombocytopenic purpura, Polymyositis/dermatomyositis, Relapsing polychondritis, Rheumatoid arthritis, Still's disease, Alopecia areata, Bullous pemphigoid, Cicatricial pemphigoid, Dermatitis herpetiformis, Discoid lupus erythematosus, Epidermolysis bullosa acquisita, Linear morphea, Pemphigus foliaceus, Pemphigus vulgaris, Vitiligo, Behcet disease, Churg-Strauss syndrome, Cogan's syndrome, CREST syndrome, Anti-fibrillarin, Essential mixed cryoglobulinemia, Mixed connective tissue disease, POEMS syndrome, Scleroderma, Sjögren's syndrome, Systemic lupus erythematosus, Erythema elevatum diutinum, Kawasaki disease, Microscopic polyangiitis, Polyarteritis nodosa, Rheumatic fever, Takayasu arteritis Temporal arteritis, Wegener's granulomatosis, HLA-B27-associated acute anterior uveitis, Sympathetic ophthalmia, and Goodpasture's disease.
[0413] 24. An engineered platelet produced from a megakaryocyte comprising a mutation in the nucleic acid sequence resulting in disruption of a vesicle biogenesis pathway or a vesicle release pathway in the platelet, expression of a toxin, or deletion of a platelet receptor, mediator, or signal transduction protein compared to a platelet produced from a megakaryocyte without the mutation.
[0414] 25. The engineered platelet of embodiment 24, wherein the megakaryocyte is differentiated from an iPSC progenitor or the megakaryocyte is immortalized.
[0415] 26. The engineered platelet of any one of embodiments 24 and 25, wherein the mutation occurs in a gene encoding a component of the vesicle biogenesis pathway or a vesicle release pathway of the engineered platelet selected from the group consisting of: α-granules, dense granules, and large dense-core vesicle.
[0416] 27. The engineered platelet of any one of embodiments 24-26, wherein the deletion is of at least one gene selected from the group consisting of: Rab27a (RAS oncogene), HPS (haptoglobin) genes, integrin AIIbB3, GP1b-IX-V (Glycoprotein Ib complexed with glycoprotein IX), Par1 (protease activated receptor 1), Par4 (protease activated receptor 4), P2Y1 (purinergic receptor P2Y1), P2Y12 (purinergic receptor P2Y12), IP (PGI2R or prostaglandin 12 receptor), TP (TxA2R or Thromboxane A2 Receptor), TLR (toll-like receptor), GPVI, a2B1 (type 1 collagen receptor), GPIIbIIIA (Glycoprotein IIb Platelet Subunit Alpha), CLEC-2 (C-type lectinlike receptor 2), MyD88 (Myeloid Differentiation Primary Response 88), Galphaq (G-protein alpha pathway q), LIMK1 (LIM Domain Kinase 1), vWF (von Willebrand), Fibrinogen, PDGF (platelet derived growth factor), VEGF (vascular endothelial growth factor), Factor V, Factor VIII, Factor XI, Factor XIII, PF4 (platelet factor 4), NAP2 (Nucleosome Assembly Protein 2), Prothrombin, High Molecular Weight Kininogens, Plasminogen activator inhibitor 1, a2-antiplasmin, plasminogen, P-Selectin, CXCL4 (C-X-C motif chemokine ligand 4), CXCL7 (C-X-C motif chemokine ligand 7), FGF (fibroblast growth factor), EGF (elongation growth factor), HGF (hepatocyte growth factor), IGF (insulin-like growth factor), Angipoetin, Thromboxane synthase, PAF (platelet activating factor), cPLA2a, Thromospondin, CD40L, SgIII (Secretogranin III), Endostatin, TGF-β (transforming growth factor beta), Talin1, Kindlins, and ANO6 (Anoctamin 6).
[0417] 28. The engineered platelet of any one of embodiments 24-27, wherein the deletion is a knock-out of a gene encoding a pro-thrombotic factor.
[0418] 29. The engineered platelet of embodiment 24, wherein the gene is a β2 microglobulin gene, wherein the deletion results in endogenous MHC class 1 disruption and the generation of a non-immunogenic platelet.
[0419] 30. The engineered platelet of any one of embodiments 24-29, wherein the mutation reduces the thrombogenic potential of the engineered platelet compared to a platelet produced from a megakaryocyte without the mutation.
[0420] 31. A method of reducing activity in the immune system of a subject, the method comprising: [0421] (a) administering to the subject an engineered platelet presenting at least one receptor expressing a major histocompatibility complex (MHC) molecule bound to a peptide derived from a tumor antigen, a neoantigen, or an autoantigen; and at least a portion of a domain from an ITAM receptor.
[0422] 32. The method of embodiment 31, wherein the receptor expresses an MHC class I molecule.
[0423] 33. The method of embodiment 31, wherein the receptor expresses an MHC class II molecule.
[0424] 34. The method of any one of embodiments 31-33, wherein the MHC molecule stimulates an immune response to an antigen.
[0425] 35. The method of embodiment 34, wherein the antigen is associated with at least one disease, disorder, or condition selected from the group consisting of: a cancer, an autoimmunity, and an infection.
[0426] 36. A method of in vitro production of platelets, the method comprising: [0427] a) transfecting a plurality of induced pluripotent stem cell (iPSC) progenitors with an expression system, wherein the expression system is induced by an agent not found in an iPSC; [0428] b) establishing a megakaryocyte progenitor cell line by contacting the expression system with the agent to expand megakaryocytes; [0429] c) engineering the megakaryocyte to have at least one mutation selected from the group consisting of: insertion of a nucleic sequence encoding a chimeric platelet receptor of any one of embodiments 1-5, insertion of a nucleic acid sequence encoding a toxin, and deletion of a nucleic acid sequence encoding a platelet receptor; and [0430] d) removing the agent from the expression system to induce differentiation of the megakaryocytes into platelets.
[0431] 37. The method of platelet production of embodiment 36, wherein the mutation results in platelets with less immunogenicity compared to platelets from human donors.
[0432] 38. The method of platelet production of embodiment 37, wherein the platelet does not function analogously to platelets derived from a human donor.
[0433] 39. The method of platelet production of any one of embodiments 36-38, wherein the deletion prevents release of cargo in the vesicles of the engineered platelets in response to endogenous platelet activation signals.
[0434] 40. The method of platelet production of any of embodiments 36-39, wherein the toxin is attached to an α-granule localization signal.
[0435] 41. The method of platelet production of embodiment 40, wherein the α-granule localization signal directs the toxin to uptake into α-granule vesicles of the engineered platelet.
[0436] 42. The method of platelet production of any one of embodiments 36-38, further comprising contacting the platelets with at least one selected from the group consisting of: a toxin, and a small molecule drug under conditions to facilitate absorption by the platelet.
[0437] 43. The method of platelet production of any one of embodiments 36-42, wherein the expression system further comprises a platelet-specific promotors.
[0438] 44. A method of in vivo gene editing or gene therapy in a subject, the method comprising: [0439] (a) administering to the subject an engineered platelet comprising a chimeric platelet receptor of any one of embodiments 1-5 specific to a tissue to be edited, wherein the engineered platelet is cloaking an adenovirus loaded with genome engineering machinery; and [0440] (b) releasing the genome engineering machinery at the tissue.
[0441] 45. The method of embodiment 44, wherein the genome engineering machinery is a CRISPR/Cas gene editing system.
[0442] 46. A use of the therapeutic delivery system of any of embodiments 6-13, wherein the chimeric receptor is specific to an antigen associated with the disease, disorder, or condition in treating a disease, disorder, or condition in a subject.
[0443] 47. The use of embodiment 46, wherein the disease, disorder, or condition is selected from the group consisting of: a cancer, an autoimmunity, and an infection.
[0444] 48. The use of embodiment 47, wherein the cancer is selected from the group consisting of: Acute granulocytic leukemia, Acute lymphocytic leukemia, Acute myelogenous leukemia, Adenocarcinoma, Adenosarcoma, Adrenal cancer, Adrenocortical carcinoma, Anal cancer, Anaplastic astrocytoma, Angiosarcoma, Appendix cancer, Astrocytoma, Basal cell carcinoma, B-Cell lymphoma), Bile duct cancer, Bladder cancer, Bone cancer, Bowel cancer, Brain cancer, Brain stem glioma, Brain tumor, Breast cancer, Carcinoid tumors, Cervical cancer, Cholangiocarcinoma, Chondrosarcoma, Chronic lymphocytic leukemia, Chronic myelogenous leukemia, Colon cancer, Colorectal cancer, Craniopharyngioma, Cutaneous lymphoma, Cutaneous melanoma, Diffuse astrocytoma, Ductal carcinoma in situ, Endometrial cancer, Ependymoma, Epithelioid sarcoma, Esophageal cancer, Ewing sarcoma, Extrahepatic bile duct cancer, Eye cancer, Fallopian tube cancer, Fibrosarcoma, Gallbladder cancer, Gastric cancer, Gastrointestinal cancer, Gastrointestinal carcinoid cancer, Gastrointestinal stromal tumors, General, Germ cell tumor, Glioblastoma multiforme, Glioma, Hairy cell leukemia, Head and neck cancer, Hemangioendothelioma, Hodgkin lymphoma, Hodgkin's disease, Hodgkin's lymphoma, Hypopharyngeal cancer, Infiltrating ductal carcinoma, Infiltrating lobular carcinoma, Inflammatory breast cancer, Intestinal Cancer, Intrahepatic bile duct cancer, Invasive/infiltrating breast cancer, Islet cell cancer, Jaw cancer, Kaposi sarcoma, Kidney cancer, Laryngeal cancer, Leiomyosarcoma, Leptomeningeal metastases, Leukemia, Lip cancer, Liposarcoma, Liver cancer, Lobular carcinoma in situ, Low-grade astrocytoma, Lung cancer, Lymph node cancer, Lymphoma, Male breast cancer, Medullary carcinoma, Medulloblastoma, Melanoma, Meningioma, Merkel cell carcinoma, Mesenchymal chondrosarcoma, Mesenchymous, Mesothelioma, Metastatic breast cancer, Metastatic melanoma, Metastatic squamous neck cancer, Mixed gliomas, Mouth cancer, Mucinous carcinoma, Mucosal melanoma, Multiple myeloma, Nasal cavity cancer, Nasopharyngeal cancer, Neck cancer, Neuroblastoma, Neuroendocrine tumors, Non-Hodgkin lymphoma, Non-Hodgkin's lymphoma, Non-small cell lung cancer, Oat cell cancer, Ocular cancer, Ocular melanoma, Oligodendroglioma, Oral cancer, Oral cavity cancer, Oropharyngeal cancer, Osteogenic sarcoma, Osteosarcoma, Ovarian cancer, Ovarian epithelial cancer, Ovarian germ cell tumor, Ovarian primary peritoneal carcinoma, Ovarian sex cord stromal tumor, Paget's disease, Pancreatic cancer, Papillary carcinoma, Paranasal sinus cancer, Parathyroid cancer, Pelvic cancer, Penile cancer, Peripheral nerve cancer, Peritoneal cancer, Pharyngeal cancer, Pheochromocytoma, Pilocytic astrocytoma, Pineal region tumor, Pineoblastoma, Pituitary gland cancer, Primary central nervous system lymphoma, Prostate cancer, Rectal cancer, Renal cell cancer, Renal pelvis cancer, Rhabdomyosarcoma, Salivary gland cancer, Sarcoma, Sarcoma, bone, Sarcoma, soft tissue, Sarcoma, uterine, Sinus cancer, Skin cancer, Small cell lung cancer, Small intestine cancer, Soft tissue sarcoma, Spinal cancer, Spinal column cancer, Spinal cord cancer, Spinal tumor, Squamous cell carcinoma, Stomach cancer, Synovial sarcoma, T-cell lymphoma), Testicular cancer, Throat cancer, Thymoma/thymic carcinoma, Thyroid cancer, Tongue cancer, Tonsil cancer, Transitional cell cancer, Transitional cell cancer, Transitional cell cancer, Triple-negative breast cancer, Tubal cancer, Tubular carcinoma, Ureteral cancer, Ureteral cancer, Urethral cancer, Uterine adenocarcinoma, Uterine cancer, Uterine sarcoma, Vaginal cancer, and Vulvar cancer.
[0445] 49. The use of any one of embodiments 47 and 48, wherein the disease, disorder, or condition is an autoimmunity selected from the group consisting of: Autoimmune disseminated encephalomyelitis, Autoimmune inner ear disease, Batten disease/Neuronal Ceroid Lipofuscinoses, Chronic inflammatory demyelinating polyneuropathy, Encephalitis lethargica, Anti-basal ganglia, Guillain-Barré syndrome, Hashimoto's Encephalopathy, Anti-TPO, Isaac's syndrome/acquired neuromyotonia, Miller Fisher syndrome Morvan's syndrome, Multiple sclerosis, Myasthenia gravis, Narcolepsy PANDAS, Rasmussen's encephalitis, Stiff-person syndrome, Vogt-Koyanagi-Harada syndrome, Addison's disease, Autoimmune hypoparathyroidism, Autoimmune hypophysitis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune polyglandular syndrome I (APECED), Autoimmune polyglandular syndrome II, Autoimmune polyglandular syndrome III, Diabetes mellitus, type 1, Graves' disease, Hashimoto's autoimmune thyroiditis, Immunodysregulation, polyendocrinopathy, enteropathy, X-linked, Autoimmune hepatitis type 1, Autoimmune hepatitis type 2, Autoimmune pancreatitis, Coeliac disease, Crohn's disease, Pernicious anemia/atrophic gastritis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Ulcerative colitis, Acquired hemophilia A, Antiphospholipid syndrome, Autoimmune hemolytic anemia, Autoimmune lymphoproliferative syndrome, Autoimmune neutropenia, Evans syndrome, Felty's syndrome, Immune thrombocytopenic purpura, Polymyositis/dermatomyositis, Relapsing polychondritis, Rheumatoid arthritis, Still's disease, Alopecia areata, Bullous pemphigoid, Cicatricial pemphigoid, Dermatitis herpetiformis, Discoid lupus erythematosus, Epidermolysis bullosa acquisita, Linear morphea, Pemphigus foliaceus, Pemphigus vulgaris, Vitiligo, Behcet disease, Churg-Strauss syndrome, Cogan's syndrome, CREST syndrome, Anti-fibrillarin, Essential mixed cryoglobulinemia, Mixed connective tissue disease, POEMS syndrome, Scleroderma, Sjögren's syndrome, Systemic lupus erythematosus, Erythema elevatum diutinum, Kawasaki disease, Microscopic polyangiitis, Polyarteritis nodosa, Rheumatic fever, Takayasu arteritis Temporal arteritis, Wegener's granulomatosis, HLA-B27-associated acute anterior uveitis, Sympathetic ophthalmia, and Goodpasture's disease.
[0446] 50. A chimeric platelet receptor comprising: [0447] (a) a first region comprising at least a portion of a domain of an ITAM receptor; and [0448] b) a second region comprising region selected from the group consisting of: (i) a linker or targeting domain encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 48-51; (ii) at least a portion of a protein selected from the group consisting of: myelin oligodendrocyte glycoprotein (MOG), glutamic acid decarboxylase 2 (GAD65), myelin associated glycoprotein (MAG), peripheral myelin protein 22 (PMP22), thyroid peroxidase (TPO), voltage-gated potassium channel (VGKC), proteolipid protein (PLP), acetylcholine receptor (AChR), tribbles pseudokinase 2 (TRIB2), N-methyl-D-aspartate (NMDA)-type glutamate receptor (GluR), glutamate decarboxylase 2 (GAD2), Armadillo repeat containing 9 (ARMC9), Cytochrome P450 Family 21 Subfamily A Member 2 (CYP21A2), calcium sensing receptor (CASR), nuclear autoantigenic sperm protein (NASP), insulin, thyroid stimulating hormone receptor (TSHR), thyroperoxidase, asioglycoprotein receptor, Cytochrome P450 Family 2 Subfamily D Member 6 (CYP2D6), lactoferrin (LF), tissue trans-glutaminase (TTG), H/K ATP-ase, Factor XIII (F8), beta2-glycoprotein I (Beta2-GPI), erythrocyte I/I, B2 integrin (ITGB2), granulocyte-colony stimulating factor (G-CSF), glycoprotein (GP) IIb/IIa, collagen II (COLII), fibrinogen (FBG) myeloperoxidase (MPO), cardiac myosin (CYO), proteinase 3 (PRTN3), trichohyalin (TCHH), bullous pemphigoid associated (BP), glycoprotein 1 (GP1), laminin-332 (LM332), transglutaminase (TGM), type VII collagen (COLVII), P80 Coilin (COIL), Desmoglein I (DSG1), Desmoglein III (DSG3), SRY-Box 10 (SOX10), small nuclear ribonucleoprotein U1 subunit (70SNRNP70), S-antigen (SAG), and Collagen alpha-3(IV) chain (a3(IV)NC1 collagen); (iii) at least a portion of an antibody selected from the group consisting of: 3F8, 8H9, Abagovomab, Abciximab, Abituzumab, Abrezekimab, Abrilumab, Actoxumab, Adalimumab, Adecatumumab, Atidortoxumab, Aducanumab, Afasevikumab, Afelimomab, Alacizumab pego, Alemtuzumab, Alirocumab, Altumomab pentetate, Amatuximab, Anatumomab mafenatox, Andecaliximab, Anetumab ravtansine, Anifrolumab, Anrukinzumab, Apolizumab, Aprutumab ixadotin, Arcitumomab, Ascrinvacumab, Aselizumab, Atezolizumab, Atinumab, Atorolimumab, Avelumab, Azintuxizumab vedotin, Bapineuzumab, Basiliximab, Bavituximab, BCD-100, Bectumomab, Begelomab, Belantamab mafodotin, Belimumab, Bemarituzumab, Benralizumab, Berlimatoxumab, Bermekimab, Bersanlimab, Bertilimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Biciromab, Bimagrumab, Bimekizumab, Birtamimab, Bivatuzumab mertansine, Bleselumab, Blinatumomab, Blontuvetmab, Blosozumab, Bococizumab, Brazikumab, Brentuximab vedotin, Briakinumab, Brodalumab, Brolucizumab, Brontictuzumab, Burosumab, Cabiralizumab, Camidanlumab tesirine, Camrelizumab, Canakinumab, Cantuzumab mertansine, Cantuzumab ravtansine, Caplacizumab, Capromab pendetide, Carlumab, Carotuximab, Catumaxomab, cBR96-doxorubicin immunoconjugate, Cedelizumab, Cemiplimab, Cergutuzumab amunaleukin, Certolizumab pegol, Cetrelimab, Cetuximab, Cibisatamab, Cirmtuzumab, Citatuzumab bogatox, Cixutumumab, Clazakizumab, Clenoliximab, Clivatuzumab tetraxetan, Codrituzumab, Cofetuzumab pelidotin, Coltuximab ravtansine, Conatumumab, Concizumab, Cosfroviximab, Crenezumab, Crizanlizumab, Crotedumab, CR6261, Cusatuzumab, Dacetuzumab, Daclizumab, Dalotuzumab, Dapirolizumab pegol, Daratumumab, Dectrekumab, Demcizumab, Denintuzumab mafodotin, Denosumab, Depatuxizumab mafodotin, Derlotuximab biotin, Detumomab, Dezamizumab, Dinutuximab, Diridavumab, Domagrozumab, Dorlimomab aritox, Dostarlimab, Drozitumab, DS-8201, Duligotuzumab, Dupilumab, Durvalumab, Dusigitumab, Duvortuxizumab, Ecromeximab, Eculizumab, Edobacomab, Edrecolomab, Efalizumab, Efungumab, Eldelumab, Elezanumab, Elgemtumab, Elotuzumab, Elsilimomab, Emactuzumab, Emapalumab, Emibetuzumab, Emicizumab, Enapotamab vedotin, Enavatuzumab, Enfortumab vedotin, Enlimomab pegol, Enoblituzumab, Enokizumab, Enoticumab, Ensituximab, Epitumomab cituxetan, Epratuzumab, Eptinezumab, Erenumab, Erlizumab, Ertumaxomab, Etaracizumab, Etigilimab, Etrolizumab, Evinacumab, Evolocumab, Exbivirumab, Fanolesomab, Faralimomab, Faricimab, Farletuzumab, Fasinumab, FBTA05, Felvizumab, Fezakinumab, Fibatuzumab, Ficlatuzumab, Figitumumab, Firivumab, Flanvotumab, Fletikumab, Flotetuzumab, Fontolizumab, Foralumab, Foravirumab, Fremanezumab, Fresolimumab, Frovocimab, Frunevetmab, Fulranumab, Futuximab, Galcanezumab, Galiximab, Gancotamab, Ganitumab, Gantenerumab, Gatipotuzumab, Gavilimomab, Gedivumab, Gemtuzumab ozogamicin, Gevokizumab, Gilvetmab, Gimsilumab, Girentuximab, Glembatumumab vedotin, Golimumab, Gomiliximab, Gosuranemab, Guselkumab, Ianalumab, Ibalizumab, IBI308, Ibritumomab tiuxetan, Icrucumab, Idarucizumab, Ifabotuzumab, Igovomab, IIadatuzumab vedotin, IMAB362, Imalumab, Imaprelimab, Imciromab, Imgatuzumab, Inclacumab, Indatuximab ravtansine, Indusatumab vedotin, Inebilizumab, Infliximab, Intetumumab, Inolimomab, Inotuzumab ozogamicin, Ipilimumab, Iomab-B, Iratumumab, Isatuximab, Iscalimab, Istiratumab, Itolizumab, Ixekizumab, Keliximab, Labetuzumab, Lacnotuzumab, Ladiratuzumab vedotin, Lampalizumab, Lanadelumab, Landogrozumab, Laprituximab emtansine, Larcaviximab, Lebrikizumab, Lemalesomab, Lendalizumab, Lenvervimab, Lenzilumab, Lerdelimumab, Leronlimab, Lesofavumab, Letolizumab, Lexatumumab, Libivirumab, Lifastuzumab vedotin, Ligelizumab, Loncastuximab tesirine, Losatuxizumab vedotin, Lilotomab satetraxetan, Lintuzumab, Lirilumab, Lodelcizumab, Lokivetmab, Lorvotuzumab mertansine, Lucatumumab, Lulizumab pegol, Lumiliximab, Lumretuzumab, Lupartumab amadotin, Lutikizumab, Mapatumumab, Margetuximab, Marstacimab, Maslimomab, Mavrilimumab, Matuzumab, Mepolizumab, Metelimumab, Milatuzumab, Minretumomab, Mirikizumab, Mirvetuximab soravtansine, Mitumomab, Modotuximab, Mogamulizumab, Monalizumab, Morolimumab, Mosunetuzumab, Motavizumab, Moxetumomab pasudotox, Muromonab-CD3, Nacolomab tafenatox, Namilumab, Naptumomab estafenatox, Naratuximab emtansine, Narnatumab, Natalizumab, Navicixizumab, Navivumab, Naxitamab, Nebacumab, Necitumumab, Nemolizumab, NEOD001, Nerelimomab, Nesvacumab, Netakimab, Nimotuzumab, Nirsevimab, Nivolumab, Nofetumomab merpentan, Obiltoxaximab, Obinutuzumab, Ocaratuzumab, Ocrelizumab, Odulimomab, Ofatumumab, Olaratumab, Oleclumab, Olendalizumab, Olokizumab, Omalizumab, Omburtamab, OMS721, Onartuzumab, Ontuxizumab, Onvatilimab, Opicinumab, Oportuzumab monatox, Oregovomab, Orticumab, Otelixizumab, Otilimab, Otlertuzumab, Oxelumab, Ozanezumab, Ozoralizumab, Pagibaximab, Palivizumab, Pamrevlumab, Panitumumab, Pankomab, Panobacumab, Parsatuzumab, Pascolizumab, Pasotuxizumab, Pateclizumab, Patritumab, PDR001, Pembrolizumab, Pemtumomab, Perakizumab, Pertuzumab, Pexelizumab, Pidilizumab, Pinatuzumab vedotin, Pintumomab, Placulumab, Plozalizumab, Pogalizumab, Polatuzumab vedotin, Ponezumab, Porgaviximab, Prasinezumab, Prezalizumab, Priliximab, Pritoxaximab, Pritumumab, PRO 140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ralpancizumab, Ramucirumab, Ranevetmab, Ranibizumab, Raxibacumab, Ravagalimab, Ravulizumab, Refanezumab, Regavirumab, Relatlimab, Remtolumab, Reslizumab, Rilotumumab, Rinucumab, Risankizumab, Rituximab, Rivabazumab pegol, Robatumumab, Rmab, Roledumab, Romilkimab, Romosozumab, Rontalizumab, Rosmantuzumab, Rovalpituzumab tesirine, Rovelizumab, Rozanolixizumab, Ruplizumab, SA237, Sacituzumab govitecan, Samalizumab, Samrotamab vedotin, Sarilumab, Satralizumab, Satumomab pendetide, Secukinumab, Selicrelumab, Seribantumab, Setoxaximab, Setrusumab, Sevirumab, Sibrotuzumab, SGN-CD19A, SHP647, Sifalimumab, Siltuximab, Simtuzumab, Siplizumab, Sirtratumab vedotin, Sirukumab, Sofituzumab vedotin, Solanezumab, Solitomab, Sonepcizumab, Sontuzumab, Spartalizumab, Stamulumab, Sulesomab, Suptavumab, Sutimlimab, Suvizumab, Suvratoxumab, Tabalumab, Tacatuzumab tetraxetan, Tadocizumab, Talacotuzumab, Talizumab, Tamtuvetmab, Tanezumab, Taplitumomab paptox, Tarextumab, Tavolimab, Tefibazumab, Telimomab aritox, Telisotuzumab vedotin, Tenatumomab, Teneliximab, Teplizumab, Tepoditamab, Teprotumumab, Tesidolumab, Tetulomab, Tezepelumab, TGN1412, Tibulizumab, Tildrakizumab, Tigatuzumab, Timigutuzumab, Timolumab, Tiragotumab, Tislelizumab, Tisotumab vedotin, TNX-650, Tocilizumab, Tomuzotuximab, Toralizumab, Tosatoxumab, Tositumomab, Tovetumab, Tralokinumab, Trastuzumab, Trastuzumab emtansine, TRBS07, Tregalizumab, Tremelimumab, Trevogrumab, Tucotuzumab celmoleukin, Tuvirumab, Ublituximab, Ulocuplumab, Urelumab, Urtoxazumab, Ustekinumab, Utomilumab, Vadastuximab talirine, Vanalimab, Vandortuzumab vedotin, Vantictumab, Vanucizumab, Vapaliximab, Varisacumab, Varlilumab, Vatelizumab, Vedolizumab, Veltuzumab, Vepalimomab, Vesencumab, Visilizumab, Vobarilizumab, Volociximab, Vonlerolizumab, Vopratelimab, Vorsetuzumab mafodotin, Votumumab, Vunakizumab, Xentuzumab, XMAB-5574, Zalutumumab, Zanolimumab, Zatuximab, Zenocutuzumab, Ziralimumab, Zolbetuximab, Zolimomab aritox; and (iv) a major histocompatibility complex (MHC) class 1 receptor or a major histocompatibility complex (MHC) class 2 receptor, wherein the MHC class 1 receptor is bound to a peptide derived from a tumor antigen, a neoantigen, or an autoantigen or the MHC class 2 receptor is bound to a peptide derived from a tumor antigen, a neoantigen, or an autoantigen.
[0449] 51. A therapeutic delivery system comprising: [0450] (a) an engineered platelet presenting the chimeric platelet receptor of any of embodiments 1-5 or 50, wherein the engineered platelet has been produced through genetic modification of a progenitor megakaryocyte to be non-thrombogenic and non-immunogenic; and [0451] (b) at least one therapeutic agent selected from the group consisting of: a toxin, a protein, a small molecule drug, and a nucleic acid packaged within a vesicle inside the platelet. [0452] i) wherein the therapeutic agent is the nucleic acid or the protein, loading occurs through expression in a progenitor megakaryocyte, or [0453] ii) wherein the therapeutic agent is loaded by incubation of the engineered platelet with the therapeutic agent.