NOVEL CELL LINE

Abstract

The present invention relates to insect cell lines for the production of parvoviral gene therapy vectors. In particular the invention relates to stable insect cell lines with expression constructs for viral replicase proteins integrated into their genomes, which cell lines allow for high-yield, robust, and scalable production of heterologous parvoviral-related proteins and vectors.

Claims

1. An insect cell comprising, integrated into the genome of the cell: (i) a first promoter operably linked to a nucleotide sequence encoding an mRNA, translation of which in the cell produces at least one of parvoviral Rep 78 and 68 proteins; (ii) a second promoter operably linked to a nucleotide sequence encoding an mRNA, translation of which in the cell produces at least one of parvoviral Rep 52 and 40 proteins; and (iii) at least one enhancer element that is operably linked to the first and second promoters, wherein the at least one enhancer element is dependent on a transcriptional transregulator, wherein introduction of the transcriptional transregulator into the cell induces transcription from the first and second promoters.

2. The insect cell according to claim 1, wherein the first and second promoters are baculoviral promoters, the transcriptional transregulator is a baculoviral immediate-early protein (IE1) or its spice variant (1E0) and the transcriptional transregulator-dependent enhancer element is a baculoviral homologous region (hr) enhancer element.

3. The insect cell according to claim 1, wherein the baculovirus is Autographa californica multicapsid nucleopolyhedrovirus.

4. The insect cell according to claim 2, wherein the hr enhancer element is a hr enhancer element other than hr2-0.9, and comprises at least one copy of the hr 28-mer sequence CTTTACGAGTAGAATTCTACGCGTAAAA and/or at least one copy of a sequence of which at least 20 nucleotides are identical to sequence CTTTACGAGTAGAATTCTACGCGTAAAA and which binds to a baculoviral IE1 protein, and wherein the hr enhancer element, when operably linked to an expression cassette comprising a reporter gene operably linked to the polH promoter, a) under non-inducing conditions, the expression cassette with the hr enhancer element produces less reporter transcript than an otherwise identical expression cassette which comprises the hr2-0.9 element, or the cassette with the hr enhancer element produces less than a factor 1.1, 1.2, 1.5, 2, 5 or 10 of the amount reporter transcript produced by an otherwise identical expression cassette which comprises the hr4b element; and, b) under inducing conditions, the expression cassette with the hr enhancer element produces at least 50, 60, 70, 80, 90 or 100% of the amount of reporter transcript produced by an otherwise identical expression cassette which comprises the hr4b or the hr2-0.9 element.

5. The insect cell according to claim 4, wherein the hr enhancer element is selected from the group consisting of hr1, hr3, hr4b and hr5, of which hr4b and hr5.

6. The insect cell according to claim 2, wherein the first and second promoters are distinct, the first promoter is a delayed early baculoviral promoter and the second promoter is a late or very late baculovirus promoter.

7. The insect cell according to claim 6, wherein the first promoter is the 39k promoter and the second promoter is selected from the group consisting of the polH, p10, p6.9 and pSel120 promoters.

8. The insect cell according to claim 1, wherein at least one of the parvoviral Rep 52 and 40 proteins and at least one of parvoviral Rep 78 and 68 proteins have a common amino acid sequence that is at least 90% identical, while the nucleotide sequence encoding the common amino acid sequence in the mRNA for the at least one of parvoviral Rep 52 and 40 proteins has less than 60% sequence identity with the nucleotide sequence encoding the common the amino acid sequence in the mRNA for the at least one of parvoviral Rep 78 and 68 proteins.

9. The insect cell according to claim 8, wherein the codon usage in the nucleotide sequence encoding the common the amino acid sequence in the mRNA for at least one of the parvoviral Rep 52 and 40 proteins, is more adapted to the codon usage bias of the insect cell than codon usage in the nucleotide sequence encoding the common the amino acid sequence in the mRNA for at least one of the parvoviral Rep 78 and 68 proteins.

10. The insect cell according to claim 1, wherein the nucleotide sequence encoding the mRNA for the at least one of parvoviral Rep 78 and 68 proteins comprises a modification that affects a reduced steady state level of the at least one of parvoviral Rep 78 and 68 proteins comprising an open reading frame that starts with a suboptimal translation initiation codon selected from ACG, CTG, TTG, GTG and ATT, of which ACG is most preferred.

11. The insect cell according to claim 1, wherein the first and second promoters are integrated in the cell's genome in opposite directions of transcription and wherein the at least one enhancer element is present in between the first and second promoters, wherein the two enhancer elements are optionally present in between the first and second promoters.

12. The insect cell according to claim 1, wherein the cell further comprises: (a) a nucleotide sequence comprising parvoviral capsid protein coding sequences operably linked to a third promoter for expression in the insect cell; (b) a nucleotide sequence comprising a transgene that is flanked by at least one parvoviral inverted terminal repeat sequence; and, (c) a nucleotide sequence comprising an expression cassette for expression of the transcriptional transregulator.

13. The insect cell according to claim 12, wherein the nucleotide sequences of at least one of (a), (b) and (c) are comprised in the baculoviral vector comprising the expression cassette for expression of the transcriptional transregulator.

14. The insect cell according to claim 8, wherein the first promoter is active before the third promoter.

15. The insect cell according to claim 1, wherein the at least one of parvoviral Rep 78 and 68 proteins, the at least one of parvoviral Rep 52 and 40 proteins, the parvoviral VP1, VP2, and VP3 capsid proteins and the at least one parvoviral inverted terminal repeat sequence are from an adeno associated virus (AAV).

16. The insect cell according to claim 1, comprising cap-coding sequences selected from CAP AAV2/5 (SEQ ID NO. 29) and AAVS (SEQ ID NO. 30).

17. A method for producing a recombinant parvoviral virion, comprising: (a) culturing an insect cell according to claim 1; (b) providing the cell with: (i) a nucleotide sequence comprising parvoviral capsid protein coding sequences operably linked to a third promoter for expression in the insect cell; (ii) a nucleotide sequence comprising a transgene that is flanked by at least one parvoviral inverted terminal repeat sequence; and, (iii) a nucleotide sequence comprising an expression cassette for expression of the transcriptional transregulator, and (c) recovering the recombinant parvoviral virion.

18. The method according to claim 17, wherein recovery of the recombinant parvoviral virion comprises at least one of affinity-purification of the virion using an immobilised anti-parvoviral antibody, and filtration over a filter having a nominal pore size of 30-70 nm.

19. The method according to claim 18, wherein the antibody is a single chain camelid antibody or a fragment thereof.

20. A kit of parts comprising at least an insect cell according to claim 1 and a baculoviral vector and/or (i) a nucleotide sequence comprising parvoviral capsid protein coding sequences operably linked to a third promoter for expression in the insect cell; (ii) a nucleotide sequence comprising a transgene that is flanked by at least one parvoviral inverted terminal repeat sequence; and, (iii) a nucleotide sequence comprising an expression cassette for expression of the transcriptional transregulator.

Description

DESCRIPTION OF THE FIGURES

[0130] FIGS. 1A-1C. (FIG. 1A): Schematic representation of transient transfection and baculovirus transactivation study involving reporter or pCLD expression construct. Luciferase activity was measured for the nano-luciferase reporter study and Western blotting was performed to determine Rep expression from the pCLD construct. GSG-P2A is a self-cleaving peptide (Wang et al., 2015). (FIG. 1B): Expression profiles of AAV Rep proteins from the indicated pCLD harbouring the indicated regulation element under the influence of different baculovirus transactivation at 48 hours post infection. T: Bac Trans. CT: Bac polH Cap Trans. C: Bac polH Cap. (FIG. 1C): The kinetics and intensity of reporter gene expression (nano-luciferase) regulated by the indicated promoter upon the indicated baculovirus transactivation. The relative luciferase units (RLU), a measure of luminescence, was measured out of 30 μl sample volume. Mock (circles): Inoculated by equal volume of fresh media. Bac Trans (squares): recombinant baculovirus harbouring only AAV ITR-transgene-ITR. Bac polH Cap Trans (triangles): recombinant baculovirus harbouring polH regulated AAV Cap gene and ITR-transgene-ITR. Bac polH Cap: recombinant baculovirus harbouring polH regulated AAV2 Cap gene only. Each data point represents an independent experimental replicate.

[0131] FIGS. 2A-2F. (FIG. 2A): Molecular design of the reporter constructs used to compare the enhancer activity of different homologous repeat (hr) elements in insect cells. The polH promoter was selected as the representative promoter. (FIG. 2B): The percentage of nucleotide similarity of all hr sequences in the baculovirus genome. (FIGS. 2C and 2D): The kinetics and intensities of reporter gene expression regulated by the indicated hr enhancer upon the indicated baculovirus transactivation. The relative luciferase unit (RLU) was measured in 30 μl sample volume. Each point represents an independent experimental replicate. (FIG. 2E): Molecular design of pCLD to compare the enhancer activity of different hrs on AAV Rep expression. (FIG. 2F): Expression profiles of the AAV Rep proteins under the influence of different hr enhancers at 48 hours post infection. T: Bac Trans.

[0132] FIGS. 3A-3B. (FIG. 3A): Alternative molecular designs of inducible single-Rep cassette plasmid vectors to minimize cis:trans promoter competition observed upon Bac polH Cap Trans transactivation. (FIG. 3B): Expression profiles of the AAV Rep proteins under the control of the indicated promotors in combination with the less leaky hr4b enhancer and stronger ATG start codon at 48 hours after the indicated baculovirus transactivation. T: Bac Trans. CT: Bac polH Cap Trans.

[0133] FIGS. 4A-4E. (FIG. 4A): The kinetics and intensities of reporter gene expression regulated by alternative baculovirus promoters upon the indicated baculovirus transactivation. (FIG. 4B): Molecular design of reporter constructs used to characterize alternative or suboptimal start codons for the 39k promoter. The hr2.09 enhancer was selected as the representative enhancer. (FIG. 4C): The kinetics and intensities of reporter gene expression with alternative start codons induced by the indicated baculovirus transactivation. (FIG. 4D): Molecular designs of pCLD constructs to observe AAV Rep expression profiles under the regulation of 39k promoter and the ACG start codon or (FIG. 4E): under additional promoter element within the artificial intron. The Western blot of the AAV Rep proteins from the indicated single-Rep cassette pCLD upon the indicated baculovirus transactivation. The relative luciferase unit (RLU) was measured out of 30 μl sample volume. Each data point represents an independent experimental replicate.

[0134] FIGS. 5A-5C. (FIG. 5A): The percentage of nucleotide similarity of codon optimized AAV2 Rep. (FIG. 5B): Molecular designs of inducible split-Rep cassette plasmid vectors harbouring the indicated regulation elements. (FIG. 5C): Expression profiles of AAV Rep proteins from the split-Rep cassette plasmid vectors upon the indicated baculovirus transactivation. ((+) and right arrow): forward orientation. ((−) and left arrow): reverse-complemented orientation. T: Bac Trans. CT: Bac polH Cap Trans.

[0135] FIGS. 6A-6E. (FIG. 6A): Schematic representation of the transient AAV production experimental set up. (FIGS. 6B and 6C): Genome copy titer (GC/m1) of nuclease resistant AAV particles in crude lysate buffer (CLB) harvested at 3 days post transient AAV production using the indicated pCLD transfection and baculovirus transactivation. Bac Cap5 FIX (circles): recombinant baculovirus harbouring polH regulated AAV Cap5 gene and ITR-FIX-ITR. Bac Cap2/5 nano-luciferase (triangles): recombinant baculovirus harbouring polH regulated AAV Cap2/5 (AAV2/5) gene and ITR-secreted-Nano-Luc-ITR. (FIGS. 6D and 6E): AAV Rep kinetics and expression profiles from the transient AAV production experiment. Each symbol represents an independent replicate of an AAV batch production.

[0136] FIGS. 7A-7C. (FIG. 7A): VP1:2:3 profile of AVB purified AAV2/5 nano-luciferase (FIG. 7B): Schematic representation of the AAV potency assay set up in Huh7 cells. The AVB purified AAV2/5 particles produced from the transient AAV production were normalized and used to inoculate Huh7 cells at a dose of 105 or 104 GC per cell. At 3 days post infection (d.p.i), the potency of AAV2/5 particle transduction was determined by quantification of nano-luciferase activity (relative luciferase units/RLU) secreted into the supernatant. luciferase (FIG. 7C): The potency comparison of purified AAV produced from transient AAV production using the indicated inducible Rep plasmid vectors (pCLD). Bac Rep183: BEV derived AAV material. Each symbol represents an independent replicate of an AAV batch production.

[0137] FIGS. 8A-7B. (FIG. 8A): (A) Molecular analysis of AAV DNA vector genomes, extracted from AAV batches produced from the indicated pCLD transient transfection experiment, on a denaturing formaldehyde agarose gel. The whole ITR-transgene-ITR size for the FIX and nano-luciferase vector genomes are 2,5 kb and 2 kb respectively. Black arrow: dimer replicative form of FIX or nano-15 luciferase vector genomes. White arrow: monomer replicative form. m: smart DNA ladder. High/low exp: gel exposure duration. (FIG. 8B): Hypothetical AAV total:full ratio (TF) based on total assembled AAV5 capsids/GC titer method. The number of total assembled capsids was determined by performing ELISA analysis on AVB purified AAV particles. The GC titer was also obtained from the same AVB purified particles.

[0138] FIGS. 9A-9C. (FIG. 9A): Schematic representation of the generation of novel stable iRep expresSf+ cell-lines. (FIG. 9B): Genome copy titer (GC/m1) and productivity (GC/input cell) of nuclease resistant AAV particles in crude lysate buffer (CLB) and harvested at 3 days post transient AAV production using the indicated iRep cell-lines and baculovirus transactivation. Each symbol represents an independent replicate of an AAV batch production. (FIG. 9C): AAV Rep kinetics and expression profiles from the transient AAV production experiment.

[0139] FIGS. 10A-10B. (FIG. 10A): Vp1:2:3 profile of AVB purified AAV2/5 sNano-Luc produced from the iRep cell-lines as indicated. (FIG. 10B): The potency comparison of the purified AAV particles in Huh7 cells. 3-ple Bac: AAV material produced from triple Bac production platform and Bac Rep: AAV material produced from Bac Cap Trans and Bac Rep combination in wild-type ExpresSf+ cells.

[0140] FIGS. 11A-11D. (FIG. 11A): List of AAVS FIX purified materials for particle quality study and the sourcing methodology. The iRep cell-lines replaced the use of wild-type ExpresSf+ cells and Bac Rep to produce the AAV materials. (FIG. 11B): Molecular analysis of AAV DNA vector genomes, extracted from the AAV materials, on a denaturing formaldehyde agarose gel. The whole ITR-transgene-ITR size for FIX vector genomes are 2.5 kb. Black and white arrows: dimer monomer replicative form of FIX. (FIG. 11C): Hypothetical AAV total:full ratio (TF) based on total assembled AAVS capsids/GC titer method. The total assembled capsids were determined by performing HPLC based analysis on the purified AAV particles. The GC titer was also obtained from the same particles. (FIG. 11D): Quantification of residual Bac DNA contamination in the purified AAV materials. The result is shown as ratio of Bac DNA per 1×10.sup.13 AAV GC.

[0141] FIGS. 12A-12F. Physical maps of plasmids used in this study: (FIG. 12A): pCLD 046; (FIG. 12B): pCLD 050; (FIG. 12C): pCLD 051; (FIG. 12D): pCLD 052; (FIG. 12E): pCLD 053; and (FIG. 12F): pCLD 054.

[0142] FIG. 13. The nucleotide alignment and size of all baculovirus hr sequences, including the synthetic hr sequence. The lines show the indicated hr sequences.

[0143] FIGS. 14A-14R. FIGS. 14A-14R: nucleotide alignment of coding sequences of wild-type Rep52, Rep183 Rep52 (as described in WO2009/014445) and an extreme-codon-optimized Rep52 coding sequence (SEQ ID NO: 15).

[0144] FIGS. 15A-15D. (FIG. 15A): Experimental set-up scheme for the validation of the iRep stable cell pool. Yellow indicated the pre-culture passages in 1L shake flask (passage 0-3). Green indicates the seed train production in 2L STR (passage 4-9). Red indicates the AAV production events in 1L shake flasks by transfection with baculovirus Bac CapS FIX passage 5 using the iRep stable cell pool at passage 5, 7, and 9 from the 2L STR. (FIG. 15B): Timeline for the validation of the iRep stable pool. The number in the brackets indicated the generation of the iRep stable pool cells used for transfection. (FIG. 15C): The expression of Rep 78 and Rep 52 in iRep stable pool cells at passage 5,7, and 9 at 48 and 72 hours post-transfection with Bac CapS FIX (P5). (FIG. 15D): The genome copies of transgene FIX in FCLB as a result of 72 hours post-transfection with Bac CapS FIX (P5). MOI indicates the volume ratio of Bac CapS FIX P5 used for the transfection of iRep stable pool cells. The number in the brackets indicated the passage number of the iRep stable pool cells used for transfection.

EXAMPLES

Materials and Methods

Cell Culture

[0145] Huh7 cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) supplemented with 10% (v/v) fetal bovine serum (FBS) at 37° C., 5% CO2. Sf9 and ExpresSf+ cells were maintained in Sf-900 II SFM (Gibco) in shaker flasks at 28° C., 135 rpm. In the case of Sf9 cells, the cultured cells were supplemented with 10% FBS (Gibco).

Inducible Expression Plasmids and Recombinant Baculovirus Construction

[0146] All inducible expression plasmid series (pCLDs) and the nano-luciferase reporter constructs were created using GeneArt gene synthesis services (ThermoFisher). To generate the recombinant baculovirus comprising the ITR-transgene-ITR only (Bac Trans) or AAV Cap expression cassette only (Bac polH Cap2/5; Urabe, M. et al., 2006) or both AAV Cap expression cassette and ITR-transgene-ITR (Bac polH CapS—human Factor IX or Bac polH Cap2/5—secreted Nano-luciferase [nano-luciferase]), Sf9 cells were transfected with either pVD-ITR-transgene-ITR (SEAP transgene) (SEQ ID NO. 01) or pVD-poIH-Cap (polH Cap2) (SEQ ID NO. 02) or pVD-poIH-Cap-ITR-transgene-ITR (polH Cap Trans) (CapS FIX: SEQ ID NO. 03, Cap2/5 nano-luciferase: SEQ ID NO. 29) and linearized baculovirus genome by using Cellfectine II reagent. Then, the positive cell plaques were transferred into adherently cultured Sf9 cells. At 72 h post transfection, the infected supernatant from Sf9 cells was further passaged and amplified in ExpresSf+ cells until reaching passage 4 (P4). After analysing the recombination event and genome stability, the P4 material from the selected recombinant baculovirus was stored in liquid nitrogen as aliquots and only freshly amplified to P5 working seed virus prior to characterization experiments. The baculovirus expressing AAV2 Rep (Bac Rep183) (SEQ ID NO. 04) was generated as explained previously (Urabe, M. et al., 2006). This Bac Rep183 is also referred to a as the split-cassette AAV Rep, or split Rep.

AAV Vector Production

[0147] The AAV variants were generated by infecting the transiently transfected ExpresSF+ insect cells with freshly amplified recombinant baculovirus stocks (P4.fwdarw.P5) comprising the indicated AAV Cap and transgene (Urabe, M. et al., 2002). After 72 h incubation at 28° C., cells were lysed with 1% Triton X-100 for 1 h. Genomic DNA was digested via benzonase (Merck) treatment for 1 h at 37° C., and cell debris was removed by centrifugation for 15 min at 1900×g. The clarified lysate was stored at 4° C. until the start of the purification, and DNase-resistant AAV particle titers were determined using quantitative polymerase chain reaction (qPCR) with primers and probe directed against the promoter region of the indicated transgene (see Table 1). To purify the AAV vector, the clarified lysate was purified using AVB Sepharose (GE Healthcare). The purified virus titers were then determined by qPCR.

TABLE-US-00001 TABLE 1 Primer and probe sequences for qPCR. Primer/Probe for qPCR Sequence CMV Primer for 5′-TTGACGCAAATGGGCGGTA-3′ CMV Primer rev 5′-GATCTGACGGTTCACTAAACGAG-3′ CMV Probe FAM-5′ TATAGACCT-ZEN-CCCACCGTACACGCC-3′- IBFQ FIX Primer for 5′-CAAGTATGGCATCTACACCAAAGTCT-3′ FIX Primer rev 5′-GCAATAGCATCACAAATTTCACAAA-3′ FIX Probe FAM-5′-TGTGAACTGGATCAAGGAGAAGACCAAGC-3′- IBFQ

Transient Transfection and Expression Analysis

[0148] To analyse protein expression, ExpresSf+ cells were adherently seeded and transfected with 1 pg of plasmid DNA encoding either the inducible Nano-luciferase reporter or Rep gene. The Cellfectin II Reagent (Invitrogen) was used for the transfection. One day after transfection, the indicated P5 baculovirus at 1% (v/v) end concentration was inoculated.

SDS-Page and Western Blot

[0149] Western blot analysis was performed with cell lysates from the transfected cells lysed with RIPA buffer (Sigma Aldrich)+protease inhibitor cocktails (Roche) at 48 h post transfection. Cell lysates were loaded into mini-protean precast 4-12% bis-tris polyacrylamide gels (BioRad) in equal volume. The gels were then blotted into ready to use PVDF membranes using trans-blot turbo transfer system (BioRad). The membranes were then incubated with α-AAV2-Rep (Progen, Germany), followed by incubation with secondary antibody coupled to horseradish peroxidase (HRP) (Sigma-Aldrich). Bound antibodies were detected with the ECL detection system (Thermo Pierce) and imaged via Chemidoc imager (BioRad). For VP protein imaging, protein composition of purified AAV particles was determined by electrophoresis on mini-protean stain-free ® precast 4-12% bis-tris polyacrylamide gels (BioRad). The gels were then put into Chemidoc imager and the image was analysed with image lab software (BioRad).

In Vitro Potency

[0150] Huh7 cells were infected with AAV variants expressing secreted Nano-luciferase as the transgene at different MOI's (in GC/cell). Co-infection with wild type Adenovirus (MOI 30) was performed to stimulate second strand synthesis. Forty-eight hours after the start of the infection, secreted Nano-luciferase expression was measured in the supernatant using the assay kit and Glomax luminometer (Promega) with an integration time of 1 s.

Formaldehyde Gel Electrophoresis with Genomic AAV DNA

[0151] Genomic AAV DNA was isolated from purified AAV batches with the PCR purification Nucleospin kit (Machery Nagel). Prior to electrophoresis, 500 ng of AAV genomic DNA was denatured for 10 minutes at 95° C. in formaldehyde loading buffer (1 ml 20× MOPS, 3.6m1 37%

[0152] Formaldehyde, 2 ml 5mg/ml Orange G in 67% sucrose, to 10m1 with MQ) and immediately put on ice. Next, samples were run on a 1% agarose gel made in 1× MOPS buffer (40 mM MOPS, 10 mM NaAc, 1mM EDTA, pH=8.0) supplemented with 6.6% formaldehyde. Samples were then run for 2 hours at 100 volts in 1× MOPS buffer supplemented with 6.6% formaldehyde running buffer. After the run, DNA was stained with SYBR Gold (Thermofisher) and bands were visualized on a Chemidoc touch imager (Biorad).

Hypothetical Total:Full Ratio Measurement

[0153] Hypothetical total to full ratios (T/F) for the productions were calculated by dividing the total amount of assembled capsids with the GC amount (measured by qPCR) of respective AVB purified

[0154] AAV materials. To measure total capsid or total particle, ELISA or HPLC based analysis was performed. AAV Titration ELISA kit (Progen, Germany) was used to quantify full virions and assembled empty capsids of AAVS. The capture-antibody detects a conformational epitope not existing on unassembled or individual capsid VP proteins. The AVB purified AAV materials were diluted 1000-2000 fold in the kit's assay buffer. The experiment was performed according the kit's protocol.

[0155] Size exclusion chromatography was also used to determine the total AAVS particle content. The method uses an HPLC system with a BioBasic SEC-1000 column, which is chosen for its capacity to separate larger particles such as AAV. The AAV particles are detected at an absorbance of 214 nm. A working standard (WS), being an AAVS-based product with a known total particle content (verified against the initial reference standard), was used to generate a calibration curve (total particle concentration versus peak area). The peaks were integrated and quantified using the Chemstation-software. AAVS samples are quantified against this calibration curve.

Residual Baculovirus DNA Quantification

[0156] Residual baculovirus DNA is present as a process-related impurity in AAV Drug Substance-and Drug Product preparations. Residual baculovirus DNA levels are assessed by qPCR using a primer set specific fora representative region in the baculovirus genome (close to the HR3 enhancer region).

Generation of ExpresSf+ Stable Cells with Inducible Expression of AAV2 Rep (iRep Sf+ cells)

[0157] The parental ExpresSf+ cells harboring all cells were passaged 1 day prior to the plasmid DNA transfection. On the day of transfection, the parental cells were diluted with fresh pre-warmed Sf-900 II media into 1.5×10.sup.6 cells/ml density and then returned back into shaker incubator until cell seeding. Transfection mix of DNA (1 pg dna/cell) : liposome (Cellfectine II) complex in 1 ml saline solution was prepared. While waiting for the complex formation, the diluted cells were taken out and distributed as 7.5×10.sup.6 cells in 5 ml volume in each designated 125 ml shake flask. The DNA:liposome complex mix was added by slowly dropping the whole 1 ml complex volume on top of the cells in 125 ml shake flask followed by gently swirling to homogenize the complex and 5 hour incubation in the shaker incubator at 28° C., 135 rpm, and without CO.sub.2. After 5 hours, another 9 ml of fresh Sf-900 II media was added and the transfected cells were further incubated. Three days after, the cells were spun down by centrifugation, the old media was discarded by decantation and replaced with fresh Sf-900 II media to dilute the whole cell pellets into 5×10.sup.5 cells/mi end cell density. The blasticidin antibiotic selection pressure was added into the cell suspension at the end-concentration of 25 μg/ml. After the cell viability has reached above 90% (±in 3 weeks), the stably transfected cells were passaged normally but with the continuous presence of blasticidin.selection pressure. As soon as the cell viability is >95% and the doubling time is ±24-26 hours or lower, cell pool banking is performed with at least 30 cryotubes per-stable cell pool.

iRep Stable Pool Pre-Culture Setting for Sequential Batches Reactors (SBR) Study

[0158] The pre-cultures (PO-P3) of iRep 052 (iRep) stable pool cells were produced as usual in shake flask. A 1.5 L of fresh SF900 It medium (Thermo Fisher Scientific) was added into the 2L STR and was equilibrated the temperature to 28.0° C. The DO sensor and the cell density probe (Incyte Arc, Hamilton) of the bioreactor was re-calibrated with the pre-warm medium. The P4 pre-culture from the shake flasks was pooled and was measured for the viable cell density (VCD) using NucleoCounter NC-100 according to GEN-SOP-0031—Operation of BucleoCounter NC-100. A calculated volume of pooled P3 culture and a calculated volume of additional fresh SF900II medium (Thermo Fisher Scientific) were transferred to the 2L bioreactor (UniVessel® SU, Sartorius) at the final viable cell density of 0.5e6 VC/mL with a final working volume of 2 L. The cultivation was carried out at temperature of 28 ° C. which was maintained by a thermo-mat surrounding the reactor vessel. Compressed air was continuously gassing to the reactor at a flow rate of 5 cubic centimeters per minute (ccm) and with an air overlay of 0.30 liter per minute (lpm). The dissolved oxygen concentration and pH was measured on-line by a built-in electrochemical sensor interfaces. The oxygen supply of the reactor was maintained at 30% saturation of dissolved oxygen by a cascade control of gassing oxygen to the reactor in combination with a cascade control of stirrer (Table 2). The gains of the proportional, integral and derivative (PID) settings of the 2 L bioreactor for the controller of temperature and oxygen indicated on (Table 3). The cell density of the culture was measured on-line by a cell density probe during the cultivation.

[0159] After 48-72 hours cultivation and according to the VCD of P4 preculture, a calculated volume of pre-culture P4 was drained from the bottom of the bioreactor, and a calculated volume of fresh SF900 II medium (Thermo Fisher Scientific) was subsequently added into the bioreactor by the effluent pump until the final viable cell density of 0.5e6 VC/mL at the final working volume of 2L. This filling and drawn cycle of SBR repeated to the cell culture of passage number up to 9.

TABLE-US-00002 TABLE 2 Cascade control setting for 2 L STR at 2 L working volume. Oxygen gasflow at micro Output % sparger (ccm) Stirrer (rpm) 0 0 200 20 0 275 40 0 335 60 0 335 80 35 335 100 75 335

TABLE-US-00003 TABLE 3 PID settings for the controllers of oxygen and temperature on 2 L STR Setting Oxygen controller Temperature controller XP (%) 150 15 TI (sec) 400 999 TD (sec) 0 75 MIN (%) 0 0 MAX (%) 100 40 DEADB (C) 0 0

Results

Example 1: The Use of Alternative Late Baculovirus p10 Promoter in Inducible Plasmid Vectors Ameliorates Cis:Trans Competition Caused by the Incorporation of polH Promoter in Recombinant Baculovirus

[0160] The use of late promoters, especially polH (SEQ ID NO. 25), as a recombinant promoter has become a conservative strategy to regulate the expression of recombinant genes in the BEV system. Therefore, the same strategy is also commonly used and optimized for AAV production using the BEV system (Urabe, M. et al., 2002). A similar strategy has also been implemented in the generation of 1st stable and inducible AAV packaging cells (Aslanidi, G., et al., 2009, supra). To generate these stable cells, both AAV single-cassette Rep and Cap expression plasmids regulated by hr2.09 and late polH promoter were used and stably integrated into the host insect cell genome. Interestingly, Wu et al. (supra) have recently shown the next generation of AAV packaging cells with increased flexibility by letting the AAV Cap expression to be driven by the recombinant baculovirus instead of the packaging host cells (Wu, Y. et al. 2019). Nonetheless, it is unclear if the use of a conservative late promoter, especially polH, within the recombinant baculovirus genome would interact with, or even interfere with, the same promoter in the integrated expression plasmids during transactivation. To elucidate this, an inducible expression plasmid vector (pCLD 002) (SEQ ID NO. 05) was designed with an upstream hr2.09 enhancer combined with full-length AAV2 Rep with attenuated ACG start codon (SEQ ID NO. 18) (Hermens, W. T. J. M. C., et al., 2009). This pCLD 002 was transiently transfected into ExpresSf+ cells (FIG. 1A) followed by transactivation via inoculation of different recombinant baculoviruses. Intriguingly, the expression of AAV2 Rep78 could only be observed when transactivation was done using Bac Trans (FIG. 1B). The other baculoviruses, both Bac polH Cap and Bac polH Cap Trans, could only induce the expression of AAV2 Rep52 suggesting that the expression of Rep78 and Rep52 is regulated differently within the single AAV Rep cassette design. To confirm this finding, nano-luciferase reporter constructs were designed with an upstream hr2.09 enhancer combined with a conservative late promoter (either polH or p10 (SEQ ID NO. 22)) and a similar experiment, as described previously, was performed (FIG. 1A). Using this approach, we elucidated the reporter induction profile upon transactivation by inoculation of different recombinant baculoviruses, either with (Bac polH Cap Trans) or without (Bac Trans) recombinant conservative late promoters (FIG. 1A). To show there was no difference in infectivity between recombinant baculoviruses, native AAV2 promoters (p5, p19, and p40) were also tested. No significant difference was observed in the induction profiles of the three AAV promoters when samples were inoculated with either Bac Trans or Bac polH Cap Trans (FIG. 1C, squares vs triangles) indicating there was similar infectivity between these recombinant baculoviruses. Interestingly, we noted a stronger induction of reporter expression upon Bac Trans transactivation when Nano-luciferase is regulated by polH and p10, as early as 24 hours after infection. At the same time point, the transactivation by Bac polH Cap Trans exhibited ±10 (polH) and ±5-fold (p10) lower reporter gene expression as compared to Bac Trans (FIG. 1C). At later time points, the difference in induction between Bac polH Cap Trans or Bac Trans became less. Furthermore, the p10 promoter reporter showed slightly stronger upregulation (±2-fold) as compared to the polH upon Bac polH Cap Trans transactivation (FIG. 1C). The results from pCLD 002 and reporter construct studies indicate that there is an interaction, or competition, between the polH promoter in the expression plasmid vectors and the recombinant baculovirus during transactivation. Remarkably, insertion of the alternative late p10 promoter in the expression plasmid vectors can ameliorate the transactivation competition.

Example 2: The Use of Alternative Baculovirus Hr Enhancers Reduce Basal Gene Expression and Convey Tight Regulation in Baculovirus Transactivatable Plasmid Vectors

[0161] Various baculovirus hr sequences have been shown to possess transcription enhancer activity (Bleckmann, M. et al. 2016; Rodems, S. M. & Friesen, P. D., 1993; Venkaiah, B., et al., 2004). Together with various baculovirus promoters, this hr function has been exploited to create recombinant expression plasmids in insect cells. Similar strategies have also been used to generate baculovirus transactivatable AAV gene expression plasmid vectors. The use of hr2, or hr2.09 to be more precise, has been shown to strongly enhance both AAV Rep and Cap expression from plasmid vectors upon transactivation with recombinant baculovirus (Aslanidi, G., et al., 2009, supra). A total loss of gene expression was observed in the absence of hr sequence indicating the necessity of its presence for transactivation. It is known that the presence of the IE-1 DNA binding site sequence (CNNGTAGAATTCTACNNG) within the hr is responsible for its enhancer function (Olson, V. A., et al., 2003). In this example, the enhancer capacity of hr2/hr2.09 (having 7× IE-1 DNA binding sites) and others (i.e. hr1 [SEQ ID NO 26], hr3 [SEQ ID NO 27], hr4b [4x IE-1 DNA binding sites, SEQ ID NO. 19] and hr5 [6× IE-1 DNA binding sites, SEQ ID NO. 20]) combined with polH, as reference promoter, was profiled using the nano-luciferase reporter constructs upon transactivation with different recombinant baculoviruses (FIGS. 1A & 2A). These hr enhancers have significant nucleotide differences amongst each other, despite the intermittent presence of the IE-1 DNA binding sites (FIGS. 2B). We could see that all hr sequences, regardless of their directionality, indeed did enhance the promoter activity upon transactivation with baculoviruses, despite differences in degrees of activity (FIG. 2C). Interestingly, the synthetic hr, engineered to have 8 IE-1 DNA binding sites, together with the hr3 failed to enhance the promoter expression beyond the hr2.09 which has only 7 sites. This proves the amount of the binding site does not correlate with the enhancer strength as previously postulated (Aslanidi et al., 2009, supra). Through this experiment, hr2.09 was still observed to exhibit the highest enhancing function, followed by hr4b, which is one the shortest hr sequences with the fewest IE-1 binding element (FIGS. 2B and 13). However, some degree of leaky expression could also be observed from the mock treated hr2.09 sample as compared to the other hr sequences (FIGS. 2C and D). This leaky expression observed for hr2.09 could pose an issue especially when it is used to regulate a very toxic protein, such as AAV Rep. To compare these distinct hr enhancers on AAV Rep expression, several plasmid vectors (pCLDs) were made and tested for regulation of expression upon baculovirus transactivation (FIGS. 1A and 2E). Indeed, from the Western blot results (FIG. 2F), all hr enhancers could be used to enhance the polH function on AAV2 Rep upregulation. Interestingly, distinct expression strength, with hr2.09>hr4b>hr5, could only be observed significantly on the AAV2 Rep78, but not on the smaller Rep52 expression. This could indicate the presence of a distinct regulation system within the single AAV Rep cassette, where the native endogenous AAV p19 promoter is functional in the presence of any hr and inducible regardless of baculovirus addition. The leaky expression of hr2.09, which was observed when measuring luciferase activity, was not observed by Western blot, with the use of the already significantly attenuated ACG-Rep78 version as the sensitivity with this method compared to the nano-luciferase reporter assay could be the main issue to yield the right observational outcome. Thus, the use of alternative hr enhancers, especially relatively weaker hrs such as hr4b and hr5, can be used to overcome the leaky expression issue of the inducible AAV gene expression plasmid vectors using hr2.09.

Example 3: The Use of Non-Leaky hr Enhancers, Late Promotor p10, and a STRONG ATG START CODON Conveys an Optimum Single-Cassette Rep Design Inducible by Baculoviruses Harbouring Recombinant polH Promoter

[0162] As shown by the previous example, the use of the polH promoter in combination with an attenuated ACG start codon can bring a seemingly normal AAV2 Rep expression ratio (low Rep78 and high Rep52) upon transactivation with Bac Trans (Urabe et al., 2006; Hermens et al., 2007). However, when using Bac polH Cap Trans for induction a relatively weaker transactivation profile is observed due to i) the cis:trans promoter competition between the two polH promoters used (for Cap in the Bac polH Cap Trans and for Rep in the expression plasmid) and ii) the adoption of non-leaky but relatively weaker hr such as hr4b. In order to create a non-leaky expression platform that is still compatible with the use of Bac polH Cap Trans, the hr4b enhancer was combined with the p10 promoter to regulate single-cassette AAV2 Rep with a strong wild-type ATG start codon (FIGS. 3A and 9) (SEQ ID NO. 06, SEQ ID NO. 17). To compare and confirm reduction of the cis:trans promoter competition during transactivation by recombinant baculovirus inoculation, a plasmid vector with the conservative polH promoter was created (FIG. 3A, pCLD 047) (SEQ ID NO. 07). These expression plasmids were transfected and transactivated following the previous experimental design (FIG. 1A). As can be seen from pCLD 015 (SEQ ID NO. 08) Western blot results, both the p10 and the endogenous AAV p19 promoter were shown to require the presence of a hr enhancer during its transactivation. The use of these constructs (both pCLD 046 and 047) together with Bac Trans transactivation yielded a suboptimal AAV Rep expression ratio (too high Rep78), presumably due to the adoption of a strong ATG start codon. However, upon Bac polH Cap Trans transactivation, proper expression of Rep78 and whole Rep ratio could be reached using the p10 promoter, but not with the polH. Intriguingly, there was no difference in the expression of Rep52 regardless of the baculovirus used for transactivation confirming the distinct regulation between upstream promoter vs. endogenous AAV p19 promoter within the single-cassette AAV Rep which is in coherence with the previously reported results (FIG. 1B).

Example 4: The Use of a Non-Leaky hr Enhancer in Combination with Alternative Baculovirus Promoters to Inducibly Regulate a Split-Cassette AAV Rep Design

[0163] As shown by the previous example, the use of a recombinant promoter within the baculovirus genome (i.e. Bac polH Cap Trans) elicits a different expression profile of the reporter gene due to cis:trans promoter competition. This would be problematic, especially when adapting the AAV2 split Rep-cassette to an inducible expression plasmid design, as this entails the use of two polH promoters. Within the BEV split-cassette Rep (Bac Rep183), the expression of Rep78 and Rep52 fall under the regulation of a truncated immediate early IE-1 promoter (ΔIE-1) and late polH promoter, respectively (Urabe, M. et al., 2002; Hermens et al., 2007; Hermens et al., 2009). The effort to adopt this design to baculovirus transactivatable plasmid vectors has been previously attempted with unsuccessful outcome, presumably due to the constitutive nature of ΔIE-1 promoter and cis:trans competition of polH promoter in the tested design (Aslanidi, G., et al., 2009). The split-cassette Rep has become the fundamental AAV Rep cassette design in BEV platform because of the superior AAV quality that it can yield (Urabe, M. et al., 2002; Hermens, W. T. J. M. C., 2009). The superiority of split-cassette Rep is also presumably due to the possible expression intensity and temporal control that this design offers. In contrast, the single-cassette Rep design is more rigid and the expression of small Rep52 upon transactivation is known to be biasedly regulated by the endogenous AAV p19 promoter (FIGS. 2E & 3B) restricting its temporal expression to an early time point during infection (FIG. 1C). Moreover, scrutinizing the promoter reporter study (FIG. 1C), the AAV p19 promoter was found to be relatively leaky resulting in constitutive low expression of Rep52 which, in the long run, leads to toxicity for host cells. This would make the single-cassette Rep plasmid vectors less ideal despite the adoption of less leaky hr enhancer.

[0164] In this study, to overcome the challenge of the constitutive expression profile of ΔIE-1 promoter, the delayed early 39k promoter (SEQ ID NO. 21) (Dong, Z. Q. et al., 2018; Lin, C. H. & Jarvis, D. L., 2013) was used as an alternative for regulating Rep78 expression. The expression profile of 39k promoter was observed to be active as early as 3-6 hours post baculovirus transactivation making it an attractive alternative to be used as a ΔIE-1 temporal mimic (FIG. 4A). Nevertheless, as the expression intensity from 39k promoter regulation was relatively higher as compared to the ΔIE-1, especially at later time points (FIG. 4A), we performed another luciferase reporter assay (FIG. 4B) to screen for alternatives such as using a suboptimal start codon for 39k-regulated gene expression to mimic the ΔIE-1-regulated expression level. As can be seen from FIG. 4C, replacing the ATG start codon with the suboptimal ACG codon would tune down the 39k promoter strength to a level relatively similar to ΔIE-1. Using this suboptimal ACG codon, the indicated pCLDs were designed (FIG. 4D) to test the strength and expression profile of the 39k promoter—ACG combination on full-length AAV2 Rep. Upon the indicated baculovirus transactivation (FIG. 4D), the expression of AAV2 Rep78 could only be detected for pCLD 020 (SEQ ID NO. 09) in which the hr2.09 is still present, indicating that the 39k promoter is still an hr enhancer dependent promoter. However, the expression level of Rep78 was still too high and the ratio between Rep78:Rep52 was far from ideal. The incorporation of relatively strong hr2.09 was suspected to have caused the observed results.

[0165] To circumvent this, the expression of the Rep78 was alleviated by changing the enhancer into a relatively weaker, hr4b, while at the same time the Rep52 was enhanced by regulating it with an additional strong late promoter inside of an artificial intron as it has been shown before (Chen, 2008). Several late promoters with the least cis:trans competition with the polH promoter are tested (FIG. 4E). Interestingly, despite the present of a strong hr2.09 enhancer, putting polH as the intronic promoter failed to trigger Rep52 expression when transactivated by the Bac polH Cap Trans. The Rep52 expression could only be restored by replacing the intronic promoter with the p10 or p6.9 (FIG. 4E). This result confirms the present of cis:trans promoter competition among certain Baculovirus promoters and switching promoter could abate this issue. However, the level of Rep52 remains relatively weak as probably caused by the shared use of weaker hr4b enhancer.

[0166] To tackle this, several split-cassette AAV2 Rep constructs (pCLD 050-054, FIG. 12) (SEQ ID NO.s 10-14) were designed and cloned by incorporating the alternative weaker yet non-leaky hr enhancers to further reduce the Rep78 expression. As enhancer activity is known to be bidirectional (FIG. 2C), we tested the capacity of the single hr4b and compared it to the hr4b-hr5 combination (FIG. 5B). Finally, another copy of a codon optimized Rep52 gene (SEQ ID NO. 15) (FIGS. 5A and 11) under the regulation of baculovirus late promoter was added in cis to strengthen the Rep52 expression (FIG. 5B). The expression kinetics and strength of several non-conservative baculovirus late promoters, such as p6.9 (SEQ ID NO. 23), and pSel120 (SEQ ID NO. 24) (Lin, C. H. & Jarvis, D. L., 2013; Martinez-Solis, M., et al., 2016), upon baculovirus transactivation were profiled using the luciferase reporter assay to see their usability as the late promoter regulating the extra copy of Rep52. Interestingly, all these non-conservative baculovirus promoters could be transactivated by the Bac Trans and Bac polH Cap Trans with almost similar potency (FIG. 4A). The maximum difference could only be observed with the Bac polH Cap Trans transactivation of p6.9 promoter at around ±4-fold lower potency at 48 h.p.i., which was still more potent than the earlier p10 promoter (FIGS. 4A and 1C). The transactivation of pSel120 with Bac polH Cap Trans was found to have the highest expression at the very late time point (72 h.p.i). The incorporation of cis:trans-competition-free/-less promoter (p10, p6.9, or pSeI120) would enable several design alternatives of an inducible split-Rep cassette (FIG. 5B). To test these constructs, each of these novel plasmids (pCLD 050-054) were transfected and the AAV2 Rep expression upon the indicated baculovirus transactivation was determined by Western blot (FIG. 5C). As expected, the use of 39k promoter resulted in inducible Rep78 expression regardless of the choice of hr enhancer and/or recombinant baculovirus (FIG. 5C). Although the Rep52 from all these constructs could also be transactivated by any baculovirus, regardless of the late promoters, distinct general expression intensity could be observed between the use of Bac Trans and polH Cap Trans (FIG. 5C), especially for the p10 regulated construct (pCLD 052) which is coherent with the previous results depicted in FIGS. 1B & 3B. The use of alternative late p6.9 and pSeI120 promoters could further ameliorate the cis:trans promoter competition issue upon the Rep52 transactivation by Bac polH Cap Trans. Overall, these results have shown the potential use of alternative baculovirus promoters within inducible AAV split Rep designs for the expression of AAV genes both at the correct timing and intensity. Furthermore, the presented examples offer a possible solution to overcome the cis:trans promoter competition observed during transactivation by recombinant baculovirus harbouring the same promoters as the expression plasmids.

[0167] Example 5: The Novel Inducible Split-Rep Cassette in Combination with Single Inoculation of a Baculovirus Harbouring Recombinant polH Promoter can be Used to Produce High Quality AAV Particles

[0168] To see if the novel inducible plasmid vectors, pCLD 046 and pCLD 050-054, could be used to produce intact AAV particles, small transient AAV production experiments were performed in ExpresSf+ cells (FIG. 6A). Different Bac polH Cap Trans viruses encoding different AAV Cap serotypes and transgenes were used as transactivating agents (indicated in FIG. 6A). As the benchmark, pCLD 011 was made following Aslanidi et al. (supra) design (FIG. 4A, pCLD 011 (SEQ ID NO. 16). This construct has been reported to be compatible with the Bac Cap Trans design, however the leaky but strong hr2.09 enhancer is still present (Wu, Y., et al., 2019). Overall, the transient AAV production using both the inducible single (pCLD 046) and split-cassette Rep (pCLD 050-054) plasmid vectors could consistently yield a significant output of DNase-resistant AAV particles from several production batches with an average genome copy (GC) titer of ±5×1010 GC/ml in crude lysate buffer (CLB). This titer was on par with the titer of the benchmark construct, pCLD 011 (FIGS. 6B and C). Intriguingly, the expression profile of AAV Rep, especially the temporal expression of Rep78, was different between the benchmark pCLD 011 (FIGS. 6D and E).

[0169] To see the quality parameter of the AAV particles, AVB purification using the material from 40 the small production was performed (FIG. 4D) and analysed. Intriguingly, the capsid ratio (VP1:2:3 ratio) from the purified AAV materials were also comparable to each other (FIG. 7A). Finally, the potency of the AAV particles to transduce target cells (Huh7) was compared against the AAV particles produced using BEV with split-cassette AAV Rep (Bac Rep183) following the depicted protocol (FIG. 7B). From the results, it can be observed that there were potency differences among differently sourced AAV particles (FIG. 7C). Intriguingly, the AAV particles produced from the inducible split-cassette Rep plasmid vectors, especially from the pCLD 052 and 053 constructs, showed higher potency than the single-Rep cassette Rep (pCLD 011 and 046) derived materials. The potency could even reach similar levels with the less robust BEV produced material.

[0170] To further study the influence of this novel inducible plasmid vector on AAV particle quality, AAV vector DNA analysis on the AAV particles with the best potency assay results was performed using formaldehyde agarose gel analysis. It is known that BEV derived AAV, particularly produced using the split-Rep cassette, exhibits faster onset and higher potency, probably due to the high packaging rate of multimeric form of the vector DNA (Urabe, M., et al., 2006). This multimeric form would mimic a double-stranded DNA (dsDNA) form circumventing the rate-limiting single-stranded (ssDNA) to dsDNA formation prior to gene expression (McCarty, D. M., 2008). In this study, the expected size of AAVS FIX- and AAV2/5 nano-luciferase vector genomes are 2.5 kb and 2 kb respectively. The majority of pCLD 046 or single-cassette-Rep produced AAV vector genomes are single-stranded monomer as could be seen from the FIG. 8A. However, in addition to the 2 or 2.5-kb single-stranded vector genome, DNA extracted from AAV particles produced using pCLD 052 and 053 contained additional multimeric genomes with cut-off size exactly at the maximum AAV packaging capacity of 4.7 kb (FIG. 8A). These results further prove that the pCLD 052 and 053 could exactly mimic the performance of BEV with split-cassette Rep in packaging the multimeric vector genomes, which correlates to the in vitro potency assay results. Finally, to prove the superiority of split Rep-cassette over the single-Rep cassette, we performed a head to head hypothetical T/F comparison on purified AAV material produced using the indicated pCLD (FIG. 8B). Here, we could see that the split-Rep cassette design indeed has a tendency to produce AAV with lower T/F value, indicating higher content of full particles and the superiority of the design (pCLD 052 and 053).

[0171] In general, the combination of an alternative and non-leaky hr enhancer together with alternative baculovirus promoter with less cis:trans competition (39k, p10, p6.9, and pSe1120) can be implemented to generate novel inducible split-Rep cassette plasmid vectors that can be transactivated by Bac polH Cap Trans. These vectors, especially the pCLD 052 and 053, are very useful to generate next generation stable packaging insect cell lines.

Example 6: The Generation of Novel Stable rAAV packaging Cells

[0172] To see if we can generate stable cell-lines/pools that would require only a single Baculovirus inoculation for producing AAV, we performed stable cell-line generation with the selected inducible AAV-Rep plasmid used in the transient transfection study (pCLD 046, 052, and 053) as could be 40 seen as detailed steps in the Materials and Methods section or in a nutshell in FIG. 9A. The generated novel cell-line would next be called as insect inducible Rep cell-lines or iRep cell-lines (iRep 046, iRep 052, and iRep 053). To investigate whether AAV could be produced from the stable iRep cell-lines, the cells were expanded as usual, similar with the wild-type ExpresSf+ cells, and infected by Bac polH Cap Trans (Bac Cap5 FIX or Bac Cap2/5 sNano-Luc) and the CLB was harvested to measure the DNase-resistant AAV particle GC concentration. As could be observed, the iRep cell-lines, regardless of the inducible Rep design, could yield a relatively abundant AAV particles reaching ±1×10.sup.11 GC/ml titer or higher than 1×10.sup.5 GC productivity per cell depending on the type of the AAV (FIG. 9B). Interesting the AAV Rep expression profile from the stable iRep cell-lines was also in line with the profile seen in the transient transfection results (FIGS. 6E and 9C). To further check on the AAV particle functionality and quality, AVB purification was performed and analyzed. Intriguingly, similar with the transient transfection result, the capsid ratio (VP1:2:3 ratio) from the purified representative AAV2/5 materials were also comparable to each other (FIG. 10A). Finally, the potency of the AAV particles to transduce target cells (Huh7) were compared against the AAV particles produced using BEV with split-cassette AAV Rep (Bac Rep183) following the depicted protocol (FIG. 7B). From the results, it can be observed that there were potency differences among differently sourced AAV particles (FIG. 10B) with similar bias confirming the transient transfection results (FIG. 7C).

[0173] To further analyze the particle quality, the AVB purified materials (BBNE) produced from the novel iRep cell-lines were compared to other methods, including the duo or dual bac inoculation method (FIG. 11A). Similar with the transient transfection outcome (FIG. 8A), the monomeric-dimeric pattern of the packaged AAV DNA could only be seen in the materials produced from the iRep 052 and 053 cell-line but not the iRep 046, regardless of the bac inoculation approach (FIG. 11B). However, further results from the hypothetical T/F and baculovirus genomic DNA contamination analysis showed that only the iRep 052 cell-line with single inoculation of bac harboring the capsid and transgene could produce AAV particles with relatively excellent quality in the most consistent manner (FIG. 11C and D).

Example 7: Sequential Batches Reactors (SBR) Study Using the Selected iRep 052 Cell Lines

[0174] As an intermediate step towards the generation of a new production cell line with integrated Rep genes, it was necessary to generate a polyclonal culture of iRep Express SF+ by transfection of the parental cell line with a DNA plasmid pCLD-052, which carried a AAV Rep cassette. In order to evaluate the stability and the expression of the integrated Rep genes in this stable cell pool, we expanded the cell culture in sequential batches reactors (SBR) and checked the Rep genes expression at different cell passages in 1 L shake flask. SBR is a repetitive batches process where filling and withdrawal take place sequentially in a bioreactor. We used the SBR system over manual daily transfer in shake flask to allow cultivation condition standardization (e.g. oxygen supply) which gives a better reproducibility and more consistent results, and to mimic the conditions that the cells will experience under production conditions.

[0175] We first grew the stable cell pool in 1 L shake flasks (FIG. 15A) from cell thaw (P0) to cell passage 3 (P3) and then passaged the cell pool from cell passage 4 (P4) to passage 9 (P9) in a 2 L bioreactor via SBR system (FIG. 15A). The seed train production took in total 5 weeks (FIG. 15B). We used the stable pool at passages 5, 7, and 9 for AAV production by transfection with baculovirus Bac Cap5 FIX, which harbors an expression cassette for AAV Cap genes and a Factor IX (FIX) transgene flank by AAV-ITRrs (FIG. 15A). The stable pool at passage 5, 7, and 9 are equivalent to the seed train production in 500L, 2000L, and above 10000L process. The purpose of this document is to describe a 2L process to validate the expression and the stability of the integrated Rep genes in the iRep Express Sf+ stable cell pool, wherein we also measured the genome copies of the transgene from the filtered crude lysed bulk (FCLB) at 72 hours post-transfection with Bac Cap5 FIX.

[0176] In order to validate the stability of the iRep stable pool which is a polyclonal culture, we checked the expression of the integrated Rep genes of the culture at passage 5, 7, and 9 by Western blot (FIG. 15C). Since the expression of the integrated Rep genes (Rep78 and Rep52) in the iRep stable pool is regulated by the hr2.09 and the promoter of the baculovirus Bac Cap5 FIX, we transfected the iRep stable pool culture at passage 5, 7 and 9 separately in 1L shake flasks with baculovirus Bac Cap5 FIX (passage 5) to activate the expression of the integrated Rep genes in the iRep stable pool. Cell lysate samples were taken from the shake flasks at 48 and 72 hours of post-transfection with baculovirus Bac Cap5 FIX (P5). As shown in FIG. 15, we confirmed the expression of Rep78 and Rep52 in the iRep stable pool cell at cell passage 5, 7 and 9, wherein distinct protein products Rep78 and Rep 52 were observed from each protein extract sample of the cell lysates (dashed box, FIG. 15C). After 20 generations (passage 9), the expression of the integrated Rep genes remained stable. From all the protein extracts, the intensity of the immunosignal from the protein Rep52 was higher than the protein Rep 72. This expression ratio of Rep78 and Rep52 is commensurate with a normal AAV2 Rep expression (low Rep78 and high Rep52).

[0177] To further confirm the AAV production of the iRep stable pool with single baculovirus transfection (UnoBac platform), We also measured the genome copies (GC) of Factor IX (FIX) in the FCLB from the transfection of baculovirus Bac Cap5 FIX (P5) with the iRep stable pool cell at passage 5, 7 and 9 (FIG. 15D). FIX has been used in the replacement therapy of hemophilia B and was harbored in the recombinant Cap-Trans-cassette of baculovirus Bac Cap5 FIX. The expression of the integrated Rep78 and Rep52 in the iRep stable pool was transactivated by the early and late polH promoters of the Cap-Trans cassette in Bac Cap5 FIX, respectively. With the cascade expression of the Cap and transgenes, in this case FIX, during transfection, iRep stable pool generated AAV2 encapsulated FIX. As shown in FIG. 15D, the average GC titer in all FCLB samples were all above 1e11 GC/mL. The GC titer (FIX) at different passages remained steady, and this confirms the stability of the integrated Rep genes cassette in the iRep stable pool. This also confers the potential of using iRep cell line for up-scaling production of AAV by UnoBac system.

REFERENCES

[0178] Burnett, J. R. & Hooper, A. J. Alipogene tiparvovec, an adeno-associated virus encoding the Ser(447)X variant of the human lipoprotein lipase gene for the treatment of patients with lipoprotein lipase deficiency. Curr Opin Mol Ther 11, 681-691 (2009).

[0179] Yla-Herttuala, S. Endgame: glybera finally recommended for approval as the first gene therapy drug in the European union. Mol Ther 20, 1831-1832, doi:10.1038/mt.2012.194 (2012).

[0180] Cheng, X. H., Hillman, C. C., Zhang, C. X. & Cheng, X. W. Reduction of polyhedrin mRNA and protein expression levels in Sf9 and Hi5 cell lines, but not in Sf21 cells, infected with Autographa californica multiple nucleopolyhedrovirus fp25k mutants. J Gen Virol 94, 166-176, doi:10.1099/vir.0.045583-0 (2013).

[0181] Garretson, T. A., Shang, H., Schulz, A. K., Donohue, B. V. & Cheng, X. W. Expression- and genomic-level changes during passage of four baculoviruses derived from bacmids in permissive insect cell lines. Virus Res 256, 117-124, doi:10.1016/j.virusres.2018.08.009 (2018).

[0182] Aslanidi, G., Lamb, K. & Zolotukhin, S. An inducible system for highly efficient production of recombinant adeno-associated virus (rAAV) vectors in insect Sf9 cells. Proc Natl Acad Sci USA 106, 5059-5064, doi:10.1073/pnas.0810614106 (2009).

[0183] Mietzsch, M. et al. OneBac: platform for scalable and high-titer production of adeno-associated virus serotype 1-12 vectors for gene therapy. Hum Gene Ther 25, 212-222, doi:10.1089/hum.2013.184 (2014).

[0184] Mietzsch, M. et al. OneBac 2.0: Sf9 Cell Lines for Production of AAV1, AAV2, and AAV8 Vectors with Minimal Encapsidation of Foreign DNA. Hum Gene Ther Methods 28, 15-22, doi:10.1089/hgtb.2016.164 (2017).

[0185] Mietzsch, M., Casteleyn, V., Weger, S., Zolotukhin, S. & Heilbronn, R. OneBac 2.0: Sf9 Cell Lines for Production of AAVS Vectors with Enhanced Infectivity and Minimal Encapsidation of Foreign DNA. Hum Gene Ther 26, 688-697, doi:10.1089/hum.2015.050 (2015).

[0186] Wu, Y. et al. Development of Versatile and Flexible Sf9 Packaging Cell Line-Dependent OneBac System for Large-Scale Recombinant Adeno-Associated Virus Production. Hum Gene Ther Methods 30, 172-183, doi:10.1089/hgtb.2019.123 (2019).

[0187] van Oers, M. M., Pijlman, G. P. & Vlak, J. M. Thirty years of baculovirus-insect cell protein expression: from dark horse to mainstream technology. J Gen Virol 96, 6-23, doi:10.1099/vir.0.067108-0 (2015).

[0188] Ghosh, S., Jain, A., Mukherjee, B., Habib, S. & Hasnain, S. E. The host factor polyhedrin promoter binding protein (PPBP) is involved in transcription from the baculovirus polyhedrin gene promoter. J Virol 72, 7484-7493 (1998).

[0189] Dong, Z. Q. et al. Construction and characterization of a synthetic Baculovirus-inducible 39K promoter. J Biol Eng 12, 30, doi:10.1186/s13036-018-0121-8 (2018).

[0190] Lin, C. H. & Jarvis, D. L. Utility of temporally distinct baculovirus promoters for constitutive and baculovirus-inducible transgene expression in transformed insect cells. J Biotechnol 165, 11-17, doi:10.1016/j.jbiotec.2013.02.007 (2013).

[0191] Martinez-Solis, M., Gomez-Sebastian, S., Escribano, J. M., Jakubowska, A. K. & Herrero, S. A novel baculovirus-derived promoter with high activity in the baculovirus expression system. PeerJ 4, e2183, doi:10.7717/peerj.2183 (2016).

[0192] Urabe, M. et al. Scalable generation of high-titer recombinant adeno-associated virus type 5 in insect cells. J Virol 80, 1874-1885, doi:10.1128/JVI.80.4.1874-1885.2006 (2006).

[0193] Urabe, M., Ding, C. & Kotin, R. M. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther 13, 1935-1943, doi:10.1089/10430340260355347 (2002).

[0194] Hermens, W. T. J. M. C., Haast, S.J.P., Biesmans ,D.J., et al. Vectors with modified initiation codon for the translation of AAV-Rep78 useful for production of AAV. W02009/014445 (2009).

[0195] Bleckmann, M. et al. Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells. PLoS One 11, e0149424, doi:10.1371/journal.pone.0149424 (2016).

[0196] Rodems, S. M. & Friesen, P. D. The hr5 transcriptional enhancer stimulates early expression from the Autographa californica nuclear polyhedrosis virus genome but is not required for virus 15 replication. J Virol 67, 5776-5785 (1993).

[0197] Venkaiah, B., Viswanathan, P., Habib, S. & Hasnain, S. E. An additional copy of the homologous region (hr1) sequence in the Autographa californica multinucleocapsid polyhedrosis virus genome promotes hyperexpression of foreign genes. Biochemistry 43, 8143-8151, doi:10.1021/bi049953q (2004).

[0198] Olson, V. A., Wetter, J. A. & Friesen, P. D. The highly conserved basic domain I of baculovirus 1E1 is required for hr enhancer DNA binding and hr-dependent transactivation. J Viro177, 5668-5677, doi:10.1128/jvi.77.10.5668-5677.2003 (2003).

[0199] Hermens, W. T. J. M. C., et al. BACULOVIRAL VECTORS COMPRISING REPEATED CODING SEQUENCES WITH DIFFERENTIAL CODON BIASES. W02009/014445 (2009).

[0200] McCarty, D. M. Self-complementary AAV vectors; advances and applications. Mol Ther 16, 1648-1656, doi:10.1038/mt.2008.171 (2008).

[0201] Chen, H. Intron splicing-mediated expression of AAV Rep and Cap genes and production of AAV vectors in insect cells. Mol Ther 16, 924-930, doi:10.1038/mt.2008.35 (2008).

[0202] Wang, Y., Wang, F., Wang, R., Zhao, P. & Xia, Q. 2A self-cleaving peptide-based multi-gene 30 expression system in the silkworm Bombyx mori. Sci Rep 5, 16273, doi:10.1038/srep16273 (2015).