Treatment of Genetic Dilated Cardiomyopathies

Abstract

The invention relates to the treatment of genetic dilated cardiomyopathies using expressible modulators of the Wnt pathway or TGF-β pathway, preferably using gene transfer.

Claims

1-15. (canceled)

16. A method of treating genetic dilated cardiomyopathies in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of an expressible modulator of the Wnt or TGF-β pathway

17. The method according to claim 16, wherein the modulator modulates the activity of a target protein of the Wnt or TGF-β pathway and is selected from the group consisting of: aptamer, antibody, recombinant target protein, inhibitory peptide, fusion protein, decoy receptor, soluble protein and dominant negative mutant.

18. The method according to claim 16, wherein the modulator modulates the expression of a target gene of the Wnt or TGF-β pathway and is selected from the group consisting of: interfering RNA molecule, ribozyme, genome or epigenome editing enzyme complex, and target transgene.

19. The method according to claim 16, wherein the modulator is an inhibitor or activator of the Wnt pathway or an inhibitor of the TGF-β pathway.

20. The method according to claim 16, wherein the modulator is an activator of CILP-1, CCN5/WISP2, DKK3 or SFRP2, or an inhibitor of LTBP2.

21. The method according to claim 20, wherein the inhibitor of LTBP2 is an interfering RNA which specifically decreases LTBP2 expression.

22. The method according to claim 20, wherein the inhibitor of LTBP2 is a shRNA comprising at least one sequence selected from the group consisting of SEQ ID NO: 11 to 14.

23. The method according to claim 20, wherein the activator is a transgene encoding CILP-1, DKK3, SRFP2, or CCN5/WISP2 protein or a variant thereof.

24. The method according to claim 20, wherein the activator is a CILP-1, DKK3, SRFP2, CCN5/WISP2 protein or a variant thereof comprising a sequence selected from the group consisting of the sequences SEQ ID NO: 2, 4, 6 and 8 and the sequences having at least 85% identity with any one of said sequences.

25. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct comprising a cardiac promoter selected from the group consisting of: human cardiac troponin T promoter (TNNT2), alpha myosin heavy chain promoter (α-MHC), myosin light chain 2v promoter (MLC-2v), myosin light chain 2a promoter (MLC-2a), CARP gene promoter, alpha-cardiac actin promoter, alpha-tropomyosin promoter, cardiac troponin C promoter, cardiac myosin-binding protein C promoter, sarco/endoplasmic reticulum Ca.sup.2+ ATPase (SERCA) promoter, desmin promoter, MH promoter, CK8 promoter and MHCK7 promoter.

26. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct comprising a human cardiac troponin T promoter.

27. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct that is contained in a vector for gene therapy.

28. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct that is contained in a vector for gene therapy which comprises a viral particle.

29. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct that is contained in a vector for gene therapy which comprises an adeno-associated viral (AAV) particle.

30. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct that is contained in a vector for gene therapy, and wherein the vector comprises an adeno-associated viral (AAV) particle comprising capsid protein(s) derived from AAV serotypes selected from the group consisting of: AAV-1, AAV-6, AAV-8, AAV-9 and AAV9.rh74 serotypes.

31. The method according to claim 20, wherein the modulator is inserted into a nucleic acid construct that is contained in a vector for gene therapy, and wherein the vector comprises an adeno-associated viral (AAV) particle comprising capsid protein(s) derived from AAV9.rh74 serotype.

32. The method according to claim 16, wherein the genetic cardiomyopathy is caused by mutation in a gene selected from the group consisting of: laminin, emerin, fukutin, fukutin-related protein, desmocollin, plakoglobin, ryanodine receptor 2, sarcoplasmic reticulum Ca(2+) ATPase 2 isoform alpha, phospholamban, lamin A/C, dystrophin, telethonin, actinin, desmin, cardiac actin, sarcoglycans, titin, cardiac troponin, myosin, RNA binding motif protein 20, BCL2-associated athanogene 3, desmoplakin, tafazzin and sodium channels.

33. The method according to claim 16, wherein the genetic cardiomyopathy is caused by mutation in the dystrophin or titin gene.

Description

FIGURE LEGENDS

[0205] FIG. 1: qPCR analysis of several deregulated genes in the RNAseq (n=4 per group. Student test).

[0206] FIG. 2: Expression of transgenes

[0207] A) Relative RT-qPCR abundance of the hCILP transgene in DeltaMex5 mice injected or not injected with the AAV9-hTnnt2-hCILP vector. B) Relative RT-qPCR abundance of the GFP transgene in DeltaMex5 mice injected or not injected by the vector AAV9-4in1shRNA-mLTBP2-GFP. Student test and GFP. n=4. Student's test.

[0208] FIG. 3: Morphological analysis.

[0209] A) Total mass of mice. B) Measurement of cardiac hypertrophy: heart mass/total mouse mass (%)

[0210] FIG. 4: Histological characterization of the heart after treatment with AAV9-hTnnt2-hCILP or AAV-shLTBP2 in DeltaMex5 mice and controls injected with PBS. A) HPS staining of the heart. B) Sirius red staining of the heart. Scale, 500 μm. C) Quantification of the proportion of fibrosis types compared to healthy tissue. Student's test.

[0211] FIG. 5: Comparison of DCM marker (Left ventricle mass) measured in ultrasound between C57BL/6 mice, DeltaMex5 mice and DeltaMex5 mice injected with the CILP and shLBTP2 vectors. Student test.

[0212] FIG. 6: RT-qPCR measurement of different RNA markers of cardiac involvement. Measurements expressed as a ratio to the C57BL/6 mouse. Student's test.

[0213] FIG. 7: RT-qPCR measurement of various RNA markers of cardiac fibrosis. Measurements expressed as a ratio to the C57BL/6 mouse. Student's test.

[0214] FIG. 8: Expression of WISP2, DKK3 and SFRP2 transgenes.

[0215] Relative RT-qPCR abundance of the transgenes hWISP2, hDKK3, hSFRP2 in DeltaMex5 mice injected or not injected by the vectors AAV9-hTnnt2-hWISP2, AAV9-hTnnt2-hDKK3 and AAV9-hTnnt2-hSFRP2 respectively. Measurements expressed as a ratio to C57BL/6 mice. n=4. Student's test.

[0216] FIG. 9: Histological characterization of the heart after treatment with AAV9-hTnnt2-hWISP2, DKK3 or SFRP2 in DeltaMex5 mice. Quantification of the proportion of fibrosis types compared to healthy tissue. Student's test.

[0217] FIG. 10: RT-qPCR measurement of different RNA markers of cardiac and fibrotic involvement in the WNT study.

[0218] Measurements expressed as a ratio to the C57BL/6 mouse. Student's test.

EXAMPLES

1. Material and Methods

1.1 Mouse Models

[0219] The mice used in this study were male titin.sup.Mex5−/Mex5− (DeltaMex5) and DBA/2J-mdx (DBA2mdx) strains, and their respective controls, strains C57BL/6 and DBA/2. DeltaMex5 mice have the deletion of the penultimate exon (Mex5) of the titin gene (titin.sup.Mex5−/Mex5−; Charton et al., Human molecular genetics, 2016, 25, 4518-4532). DBA2mdx mice are a model of Duchenne muscular dystrophy due to a point mutation on exon 23 of the dystrophin gene. DBA2mdx mice are on a DBA/J background which has a mutation on the LTBP4 gene, a protein that regulates the activity of the TGF signaling pathway-O (Fukada, et al. 2010. Am J Pathol 176, 2414-2424). All the mice are handled in accordance with the European directives for the care and use of laboratory animals by humans, and the animal experimentation has been approved by the Ethics Committee for Animal Experimentation C2AE-51 of Evry under the numbers of Project Authorisation Application 2015-003-A and 2018-024-B.

1.2 Muscle Sampling and Freezing

[0220] The muscles of interest are collected, weighed and frozen in liquid nitrogen (samples for molecular biology analysis) or in cooled isopentane (samples for histology), after being placed transversely or longitudinally on a piece of cork coated with gum arabic. The hearts are frozen in diastole before being frozen with a diluted butanedione solution (5 mM) in tyrode. The samples are then stored at −80° C. until use. For the Sirius Red Fibrosis observation protocol on the whole heart, the hearts are included whole in paraffin and stored at room temperature. For the transparency protocols, the sampled hearts are stored whole in 4% para formaldehyde and kept at +4° C.

1.3 RNA Extraction and Quantification

[0221] Frozen isopentane muscle is cut into 30 μm thick slices on a cryostat (LEICA CM 3050) at −20° C., separated into eppendorf tubes of about 10-15 slices and stored at −80° C. The TRIzol® method for the extraction of total RNA, based on the solvency properties of nucleic acids in organic solvents, is used. The muscle recovery tubes are resupplied with 0.8 mL of TRIzol® (ThermoFisher) supplemented with glycogen (Roche) at a rate of 0.5 μL/mL of TRIzol®. The tubes are placed in the FastPrep-24 (Millipore) homogenizer for a 20s, 4 m.s. cycle. To recover nucleic acids, after a 5-minute incubation on ice, 0.2 mL of chloroform (Prolabo) is added and mixed with TRIzol®. After a 3-minute incubation at room temperature, the two phases, aqueous and organic, are separated by centrifugation at 12000 g for 15 minutes at 4° C. The aqueous phase, containing the nucleic acids, is removed and placed in a new tube. The RNAs are then precipitated by the addition of 0.5 mL isopropanol (Prolabo) followed by a 10-minute incubation at room temperature and centrifugation for 15 minutes at 12000 g at 4° C. The nucleic acid pellet is washed with 0.5 mL 75% ethanol (Prolabo) and again centrifuged for 10 minutes at 12000 g at 4° C. and then air-dried. The nucleic acids are taken up in 50 μL of nuclease free water, 20 μL are set aside for viral DNA analysis, 30 μL are added to RNAs in (Promega) diluted at 1/50 to preserve the RNAs from degradation. The RNAs are then treated with TURBO Dnase (Ambion) to remove residual DNA. A double Dnase treatment is performed for samples intended for sequencing.

[0222] For transcriptome analysis specific to signaling pathways, RT2 Profiler PCR Array (Qiagen) plates are used. The screening plates require the use of a compatible RNA extraction kit, the RNeasy Mini Kit (Qiagen) which extracts the RNA on columns, the kit is used following the supplier's instructions, and the RNAs are then processed by Free DNAse RNAse (Qiagen).

[0223] An OD reading is then taken on the ND-8000 spectrophotometer (Nanodrop), from 2 μL of RNA to determine their concentration. RNA is stored at −80° C. and DNA at −20° C.

1.4 Measurement of RNA Quality

[0224] In the case of RNAs prepared for sequencing, the quality of the RNAs is measured on the Bioanalyzer 2100 (Agilent) which performs capillary electrophoresis of nucleic acids and then their analysis. The quality is visualized by the retention rate and the concentration of the sample in the form of electrophoregrams. A quality score expressed in RIN (for RNA Integrity Number) is calculated for each sample, on a scale of 0 to 10. The RNA Nano chip (Agilent) is used according to the supplier's instructions. A size marker (RNA 6000 Nano Ladder, Agilent) is passed first, to allow evaluation of RNA size in the samples. A marker is added to each sample, emerging at a defined size. For each sample, 1 μL of RNA is deposited on the chip. On the RNA electrophoregram, the ribosomal RNA peaks are observed: 28S (around 4000 nt), 18S (around 2000 nt) and 5S (around 100 nt). The internal marker emerges at the 25 nt position. The INR is calculated as a function of the height and position of the 18S and 28S peaks, the ratio between the 5S, 18S and 28S peaks, and the signal-to-noise ratio. For RNA-seq, the required quality requires an INR of at least 7.

1.5 Real-Time Quantitative PCR

[0225] Genomic and viral DNA are quantified by qPCR and gene expression by Real-time quantitative PCR. Reverse transcription step is performed on the entire messenger RNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo-Fisher). Two types of oligonucleotides: so-called “random” hexamers, containing random sequences, and “dT” oligonucleotides, deoxy-thymine polymers, which hybridize to the polyA sequences, making it possible to generate cDNAs in their entirety. The mix used is shown in Table 1.

TABLE-US-00001 TABLE 1 Reaction mixture for reverse transcription. Product Quantity RNA 1 μg Random hexameres + 1/10 50 ng OligodT Reaction buffer 5X 1/5 dNTP 500 μM of each Ribolock Rnase Inhibitor 40 U/μl 0.25 U RevertAid H-Minus 200 U/μL 200 U Water qsp 20 μL

[0226] The mixture is placed in a thermal cycler for the following cycle: 10 min at 25° C., then 1h15 at 42° C., temperature of action of the enzyme, then the enzyme is inactivated 10 min at 70° C. The cDNAs are stored at +4° C. in the short term or at −20° C. in the long term.

[0227] Real-time quantitative PCR is performed either on genomic or viral DNA for vector titration and measurement of vector copy number in tissues, or on cDNA obtained from RNA for quantification of transcripts. It is performed on the LightCycler 480® (Roche) 384-well plate. The nuclease activity of the Thermo-Start DNA Polymerase enzyme contained in ABsolute QPCR ROX Mix (ThermoFisher) allows the detection of PCR products at each amplification cycle by release of a fluorescent reporter. This fluorescent reporter is a fluorophore (FAM, for 6-carboxyfluorescein or VIC, for 2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein) is located 5′ from the nucleotide probe which is also labelled with a quencher (TAMRA, for tetramethylrhodamine) in 3′. Separation of the reporter and the quencher results in the fluorescence of the reporter, which is measured by the apparatus. The mixtures for each gene of interest are composed of the two oligos F (forward, sense) and R (reverse, antisense) at 0.2 mM and the corresponding 0.1 mM probe. Commercial mixtures of 20× Taqman Gene Expression Assay (ThermoFisher) primers corresponding to the mRNAs to be quantified bearing the FAM reporter are used (Erreur !Source du renvoi introuvable.). The ribophosphoprotein acid gene RPLPO coding for a ribosomal protein, invariant under the different conditions, was chosen as the normalizing gene using the VIC reporter. The primers and Taqman probe used for amplification of RPLPO are as follows: m181PO.F (5′-CTCCAAGCAGATGCAGCAGA-3′; SEQ ID NO: 15), m267PO.R (5′-ACCATGATGATGCG CAAGGCCAT-3′; SEQ ID NO: 16) and m225PO.P (5′-CCGTGGTGCTGATGGGGGGCAAGA A-3′; SEQ ID NO: 17). DNA samples are either cDNA samples obtained after reverse transcription or viral DNA. The PCR reaction takes place in 384-well plates, each well is duplicated in the quantities shown in the Table 2.

TABLE-US-00002 TABLE 2 Reaction mixture for quantitative PCR. Product Quantity DNA 50 ng Thermo Scientific Absolute qPCR ROX   1X Mix TaqMan Gene Expression 20X FAM 0.5X Standardizer RPLP0 20X VIC 0.5X Water qsp 10 μL

[0228] The following PCR program is applied: pre-incubation 15 minutes at 95° C., then 45 amplification cycles of 15 seconds at 95° C. followed by 1 minute at 60° C. using the LightCycler480 (Roche).

TABLE-US-00003 TABLE 3 List of Taqman Gene Expression primers used. Gene Reference Gene Reference miR 142-3p hsa-miR-142-3p Tgfb1 Mm01178820_m1 miR 21 hsa-miR-21 Ctnnb1 Mm004893039_m1 miR 31 mmu-miR-31 mCilp Mm00557687_m1 Col1a1 Mm00801666_g1 hCilp Hs01548460_m1 Myh8 Mm01329494_m1 GFP Mr 03989638 Tmem8c Mm00481256_m1 mLtbp2 Mm01307379_m1 Nppa Mm01255747_g1 hLtbp2 Hs00166367_m1 Myh7 Mm0060555_m1 mWisp2 Mm00497471_m1 Myh6 Mm00440359 m1 hWisp2 Hs1031984_m1 Fn Mm01256744_m1 mDkk3 Mm00443800_m1 Vim Mm01333430_m1 hDkk3 Hs00247429_m1 Col1a1 Mm00801666_g1 mSfrp2 Mm01213947_m1 Col3a1 Mm00802300_m1 hSfrp2 Hs00293258_m1 Timp1 Mm01341361_m1

[0229] The cycle quantification is calculated with the LightCycler® 480 SW 1.5.1 software (Roche) using the maximum second derivative method. Quantitative PCR results are expressed in terms of “Cq”, the number of cycles after which a threshold fluorescence value is reached. This value is then normalized to the value obtained for the reference gene RPLPO.

[0230] Mitochondrial PCR kits (PAMM-087Z) and WNT (PAMM-243Z) and TGF-B (PAMM-235Z) target screening are used according to the manufacturer's instructions (RT2 Profiler PCR Arrays, Qiagen). RNA extraction is performed from frozen tissue using the RNasy® Micraoarray tissue kit (Qiagen) and processed with the RNase-Free DNase set (Qiagen). The cDNA is obtained from 500 ng RNA using the RT2 first strand kit (Qiagen) and is used as a template for PCR. The qRT-PCR is performed using the LightCycler480 (Roche, Basel, Switzerland).

1.6 RNA Sequencing

1.6.1 RNAseq

[0231] The samples used for sequencing are total RNA extracted with TRIzol, treated twice with DNAse and having an INR quality >7. 7. Samples of 2pg RNA at 100ng/μL were sent for sequencing to Karolinka Institute. The sequencing library used was prepared with the TruSeq Stranded Total RNA Library Prep Kit (Illumina) and sequencing was performed according to the Illumina protocol. The reads are associated using Fastq-pair and aligned to the mouse genome (mm10) using STAR align. The number of reads is proportional to the abundance of corresponding RNAs in the sample. The sequencing platform then provides several files per sample, containing the alignment files in bam format, the list of genes identified with the number of reads for each sample compared and the list of genes accompanied by a normalized numerical count value expressed in fragments per kb per million reads (FPKM).

1.6.2 Analysis

[0232] Once the files containing the lists of sequenced transcripts were received, the first step in comparing the samples with each other was to merge the files of the different samples. The goal is to obtain a single table containing, for each transcript identified in the study, its number of reads in each sample. Then, an analysis under the R software was performed with the DESeq2 package: from the number of reads, the samples are normalized, and the differential gene expression for each sample is calculated with respect to its control. The expression difference values (or fold change) are expressed in binary logarithm (log 2.FC), they are associated with their adjusted Pvalue padj. Then, a sorting step was performed to remove: genes containing less than 10 reads under all conditions, genes with no significant pad, genes with a log 2.FC between −0.5 and 0.5 for all conditions. The final table was used to identify genes expressed significantly differentially between the different conditions.

1.6.3 Graphic Representation

[0233] The alignment of the reads on the mouse genome (mm10) can be observed by viewing the bam files with the Integrative Genomic Viewer (IGV) software. Different R packages are used for the graphical representation of RNAseq results. For Venn diagrams, the VennDiagram package is used. For Volcano Plots, the ggplot2 package is used. The Ingenuity Pathway Analysis software (IPA, Qiagen) and the gene ontology classification system PANTHER are used to visualize the deregulated signaling pathways in the dataset.

1.7 Histology

[0234] Frozen isopentane muscle is cut into 8 μm thick slices on a cryostat (LEICA CM 3050) at −20° C. The slices are placed on a blade and stored at −80° C.

1.7.1 Haematoxylin-Phloxine-Safran Staining

[0235] The Hematoxylin-Phloxine-Safran (HPS) marking allows the general appearance of the muscle to be observed and the different tissue and cell structures to be highlighted. Haematoxylin colours nucleic acids dark blue, phloxine colours the cytoplasm pink, saffron colours collagen red-orange.

[0236] Cross sections are stained with Harris hematoxylin (Sigma) for 5 min. After washing with water for 2 min, the slides are immersed in a 0.2% (v/v) hydrochloric alcohol solution for 10 s to remove excess stain. After being washed again with water for 1 min, the tissues are blued in a Scott water bath (0.5 g/l sodium bicarbonate and 20 g/l magnesium sulphate solution) for 1 min before being rinsed again with water for 1 min and stained with phloxine 1% (w/v) (Sigma) for 30 s. After rinsing with water for 1 min 30 s, the cuts are dehydrated with 700 ethanol for 1 min and then rinsed in absolute ethanol for 30 s. The tissues are then stained with saffron 1% (v/v in absolute ethanol) for 3 min and rinsed in absolute ethanol. Finally, the cuts are thinned in a Xylene bath for 2 min and then mounted with a slide in the Eukitt medium. Image acquisition is performed with objective 10 on a Zeiss AxioScan white light microscope coupled to a computer and a motorized stage.

[0237] From HPS coloured sections, the centronucleation index is calculated by the ratio of the number of centronucleated fibres to the area of the section in mm2.

1.7.2 Sirius Red Coloration

[0238] This staining allows the collagen fibres to be coloured red and to highlight the presence of fibrotic tissue. Cytoplasms are stained yellow.

[0239] Cross sections are dehydrated with acetone for 1 hour for frozen cuts or dewaxed with heat and toluene baths. They are then fixed with 4% formaldehyde for 5 min then 10 min in a Bouin solution. After two washes with water, the slides are immersed in Sirius Red solution (0.1 g Sirius Red per 100 mL picric acid solution) for 1 h for staining. After rinsing with water for 1 min 30 s, the slices are dehydrated in successive ethanol baths: 700 ethanol for 1 min, 950 ethanol for 1 min, absolute ethanol for 1 min and then a second absolute ethanol bath for 2 min. Finally, the slices are thinned in two Xylene baths for 1 min and then mounted with a lamella in the Eukitt medium. Image acquisition is carried out with objective 10 on a Zeiss AxioScan white light microscope coupled to a computer and a motorized stage.

[0240] The polarized light images were acquired using a modified right LEICA microscope with a polarizer placed before the sample (Polarizer), along the path of the light; and another polarizer placed after the sample (Anlayzer), which can be rotated by hand, giving the possibility to observe both transmitted and polarized light at the same time. The main axes of the polarizers are oriented at 90 degrees to each other. Polarized light maps have been acquired using a Retiga 2000 CCD sensor (QImaging) coupled to the Cartograph software (Microvision, France). In summary, the light passes through the first polarizer before reaching the sample, the collagen being birefringent the light that passes through it is separated into two rays, which once passed through the second polarizer will allow the differential observation of the two types of Sirius Red and the rest of the cardiac tissue.

1.7.3 Quantification of Sirius Red

1.7.3.1 Sirius Quant

[0241] Sirius Quant is an internally developed ImageJ pluggin (Schneider et al., Nature methods, 2012, 9, 671-675). It is a thresholding macro that allows to isolate and quantify the pixels of the image that are colored red. It works in 3 steps: the first one is to convert the image to black and white. The images resulting from the Red Sirius colorations are very contrasted, so a simple black and white conversion is enough to keep all the useful information. The second one is a very rough thresholding in order to keep only the colored pixels of the image, in other words the pixels belonging to the whole cut. Using the Analyze Particles function with an adapted object size allows automatic detection of the outline of the slice, which is then stored. The third step is a manual thresholding by the user which allows to keep only the pixels colored in red, those associated with the marking. A manual correction tool makes it possible either to remove areas that would have been detected and that are not marking (dust, cut fold, etc.), or to add areas that would not have been taken into account. Once the thresholded image is satisfactory, the number of thresholded pixels and the total number of pixels in the entire section are then measured. A ratio between these two numbers finally gives the fibrosis index in the slice.

1.7.3.2 Weka

[0242] The images were processed using an artificial intelligence algorithm via the WEKA plugin (ImageJ). The WEKA classifier pluggin was implemented using a training data set containing 17 images representative of the different conditions to be classified. The classes were assigned to healthy tissue (yellow), to both types of staining and to slice rupture (white). The original mappings are mosaic images with a size of approximately 225 megapixels (15k×15k), which were divided into 400 frames (20 rows, 20 columns), each frame measuring approximately 750×750 pixels. Each frame is classified independently and the complete image is then reconstructed. The number of pixels in each class is measured. The total number of pixels belonging to the heart is calculated as the sum of the healthy tissue and the two types of dye uptake. The ratio of each class is then calculated by dividing the number of pixels in the class by the total number of pixels in the heart.

1.7.3.3 Whole-Heart Reconstruction and Quantification

[0243] Sections of a whole heart colored by Sirius Red were scanned with a scanner (Axioscan ZI, Zeiss) with a 10× lens. A total of 483 images were obtained. They were aligned using ImageJ's pluggin: Linear Stack Alignment with SIFT (Lowe et al., International Journal of Computer Vision, 2004, 60, 91-110). Some images were manually aligned when the software did not allow a satisfactory alignment. The image was loaded into Imaris (BitPlane, USA) for reconstruction and 3D visualization. Once the images were aligned, the Sirius Quant pluggin in fully automatic mode using Otsu thresholding (Otsu N, Cybernetics, 1979, 9, 62-66) resulted in 483 fibrosis ratio values corresponding to each image. These values were filtered using the sliding average method, which is a method of reducing noise in a signal to avoid the errors inherent in automating an algorithm. The use of the moving average allows to limit these errors by replacing each fibrosis ratio of an image by the average of itself, the ratio of the image preceding it and the ratio of the image following it.

1.7.4 Fluorescence Immuno-Histo Labeling

[0244] The slides are taken out of the freezer and allowed to dry at room temperature for 10 minutes, after which the cuts are wrapped with DAKOpen. The slices are then rehydrated for 5 min in PBS 1×. If the protein of interest is located in the nucleus, the slices are permeabilised for 15 min in a 0.3% triton solution in PBS 1×, then washed 3 times in PBS for 5 min. The slices are then saturated with 10% goat serum, 10% fetal calf serum, PBS 1× for 30 min at room temperature in a humidity chamber. The saturation medium is replaced by the primary antibody solution diluted in PBS 1×+10% blocking solution overnight at 4° C. in a wet chamber. Four successive washes in 1×PBS for 5 minutes are performed before hybridizing with the secondary antibody solution coupled with an Alexa 488 or 594 (1/1000) fluorochrome coupled fluorochrome in 1×PBS+10% blocking solution for 1 h at room temperature in a light-protected wet chamber. A final series of four 5-minute washes in PBS 1× is performed and a fluoromount slide assembly containing DAPI is performed. The sections are then visualized using a fluorescence microscope (Zeiss AxioScan or Leica TCS-SP8 confocal microscope).

TABLE-US-00004 TABLE 4 List of antibodies used in immunohistology. Antibody Species Supplier Reference Dilution Collagen I Mouse Abcam ab6308 1/100 Collagen III Rabbit Abcam ab7778 1/100 Fibronectin Mouse Sigma F7387 1/200 Vimentine Mouse Chemicon MAB3400 1/100 Vinculine Mouse Sigma V9131 1/100 Actin F Mouse Abcam ab205 1/100 Titine N2B Rabbit Myomedix #6678 1/75 Titanium M8M9 Rabbit Myomedix #3375 1/75 Titanium IS7-1 Rabbit Genescript LVEEPPPREVVLKTSC 1/2 M10-1 Titanium Rabbit Genescript IEALPSDISIDEGKV 1/75 α-synemin Rabbit SantaCruz sc-68849 1/25 Obscurine Rabbit Atlas Antibody HPA040066 1/50 Myosprin Rabbit Abcam ab75351 1/25 Cilp Rabbit biorbyt orb182643 1/100

1.8 Ultrasound Analysis of Cardiac Function

[0245] The mice are anaesthetized by inhalation of isoflurane and placed on a heating platform (VisualSonics). Temperature and heart rate are continuously monitored. The image is taken by a Vevo 770 high-frequency echocardiograph (VisualSonics) with 707B probe. Ultrasound measurements in 2D mode and M mode (motion) are taken along the large and small parasternal axis at the widest level of the left ventricle. Quantitative and qualitative measurements are performed using the Vevo 770 software. The mass of the left ventricle is estimated using the following formula:

Mass of the left ventricle (g)=0.85(1.04(((diameter of the left ventricle at the end of diastole+thickness of the intraventricular septum at the end of diastole+thickness of the posterior wall at the end of diastole).sup.3−diameter of the ventricle at the end of diastole3)))+0.6.

[0246] For each ultrasound of a mouse heart, about 5 measurement points are taken. The measuring point corresponding to the maximum size of the left ventricle in diastole is then used, as it represents the maximum dilatation that the mouse heart can reach.

1.9. Construction of AAV Transfer Plasmids

[0247] AAV plasmid vectors comprising an expression cassette for expressing whole candidate human proteins (CILP, DKK3, SFRP2 and CCN5/WISP2) flanked by two AAV2 ITRs were ordered from Genewiz. The expression cassette comprises the coding sequence preceded by a chimeric intron under control of human cardiac troponin T promoter (hTNNT2) and SV40 polyadenylation signal. Coding sequence for hCILP is the nucleotide sequence GenBank/NCBI accession number NM_003613.4 as accessed on 25 Apr. 2020 or SEQ ID NO: 1 coding for hCILP protein of SEQ ID NO: 2). Coding sequence for hDKK3 is the nucleotide sequence GenBank/NCBI accession number NM_015881.5 as accessed on 27 Apr. 2020 or SEQ ID NO: 3 coding for hDKK3 protein of SEQ ID NO: 4. Coding sequence for hSFRP2 is the nucleotide sequence GenBank/NCBI accession number NM_003013.3 as accessed on 31 May 2020 or SEQ ID NO: 5 coding for hSFRP2 protein of SEQ ID NO: 6. Coding sequence for CCN5/WISP2 is the nucleotide sequence GenBank/NCBI accession number NM_003881.3 as accessed on 3 May 2020 or SEQ ID NO: 7 coding for hCCN5WISP2 protein of SEQ ID NO: 8. AAV transfer vectors were constructed by inserting the different expression cassettes between two AAV2 ITRs.

[0248] The shRNA plasmid construct for LTBP2 gene inhibition has been ordered from Vigene Bioscience. The construct comprises 4 individual shRNA sequences targeting different sequences of human LTBP2 transcript expressed from two sets of H1 and hU6 promoters in opposite orientation and the GFP reporter gene under the control of the CMV promoter. The shRNA plasmid construct is flanked by 2 AAV2 ITRs. The sequences selected for LTBP2 gene are described in Table 5.

TABLE-US-00005 TABLE 5 shRNA sequences shRNA sequences SEQ ID NO GGAAGTCTAGTGACCAGAATA 11 GCTGGTGAAGGTGCAAATTCA 12 GCTTCTATGTGGCGCCAAATG 13 GCACCAACCACTGTATCAAAC 14

1.10. Production of Plasmids

[0249] Plasmids are produced by transforming 45 μL of DH10B bacteria with 2 μL of plasmid. Thermal shock is achieved by alternating 5 minutes in ice, 30 seconds at 42° C. and cooling on ice. Then, 250 μL of SOC (super optimal broth) medium is added before incubation at 37° C. for 1 h under agitation. The bacteria thus transformed are isolated by a 50 μL culture over night at 37° C. on a box of LB (lysogeny broth) containing ampicillin in order to select the bacteria having integrated the plasmid. A clone is transplanted the next day for a pre-culture of a few hours at 37° C. in 3 mL of LB medium containing antibiotic. Samples are kept for freezing in 50% glycerol. An overnight culture is then performed in 2 L Erlenmeyer containing 500 mL of antibiotic-containing medium and 1 mL of the preculture at 37° C. A NucleoBond PC 2000 EF (Macherey Nagel) kit is then used according to the supplier's instructions to purify the plasmids which are then sterilized by filtration at 0.22 μm and assayed with Nanodrop.

[0250] An enzymatic digestion is performed to check the plasmid with the restriction enzymes SMA1 and NHE1. A mixture containing 1 μg of DNA, 2 μL of buffer fast digest green 10×, 1 μl of each enzyme in sterile water for a total amount of 20 μl is stirred for 20 min at 37° C. A 1% agarose gel in TAE (Tris, Acetate, EDTA) containing SYBR™ Safe DNA Gel Stain (Invitrogen) is poured before depositing the digest products and the size marker O'GeneRuler™ DNA Ladder mix.

1.11 Viral Vector Production

[0251] The tri-transfection method is used to prepare recombinant viruses. HEK293 cells are used as packaging cells to produce the virus particles. Three plasmids are required: the vector plasmid, which provides the gene of interest, the helper plasmid pAAV2-9_Genethon_Kana (Rep2Cap9), which provides the Rep and Cap viral genes, and plasmid pXX6, which contains adenoviral genes and replaces the co-infection by an adenovirus, necessary for AAV replication. The cells are then lysed and the viral particles are purified. Vectors are produced in suspension.

[0252] Cell inoculation (day 1): Use of HEK293T clone 17 cells at confluence, inoculated in 1 L agitation flasks: 2E5 cells/mL in 400 mL of F17 medium (Thermo Fisher scientific). Incubation under agitation (100 rpm) at 37° C.-5% CO.sub.2-humid atmosphere.

[0253] Cell Transfection (Day 3): Cells are counted and cell viability is measured on Vi-CELL after 72 h of culture. The transfection mix is prepared in Hepes buffer at 10 mg/mL for each plasmid according to its concentration, size and the amount of cells in the flask, the ratio of each plasmid is 1. Incubation 30 minutes at RT after the addition of transfection agent and homogenization of the solution. The transfection mixture and 3979 μL of culture medium (F17 GNT Modified) are transferred to shaker flasks containing 400 mL of culture which are incubated under agitation (130 rpm) at 37° C.-5% CO2-wet atmosphere. After 48 h, treatment of the cells with benzonase: dilution of Benzonase (25 U/mL final) and MgCl2 (2 mM final) in F17 medium, addition of 4 mL per flask.

[0254] Viral vector harvest (day 6): Cells are counted and cell viability is measured on Vi-CELL, then 2 mL of triton X-100 (Sigma, 1/200th dilution) are added before incubating 2.5 hours at 37° C. with agitation. The erlenmeyers are transferred to Corning 500 mL and centrifuged at 2000 g for 15 minutes at 4° C. Supernatants are transferred to new Corning 500 mL before adding 100 mL of PEG 40%+NaCl and incubating 4 h at 4° C. The suspension is centrifuged at 3500 g for 30 minutes at 4° C. The pellets are resuspended in 20 mL TMS at pH 8 (Tris HCl at 50 mM, NaCl at 150 mM and MgCl2 at 2 mM, diluted in water) and transferred to Eppendorf 50 mL before the addition of 8 μL benzonase. After 30 min incubation at 37° C., the tubes are centrifuged at 10,000 g for 15 min at 4° C.

[0255] Cesium Chloride Gradient Purification: To achieve the gradient, 10 mL of cesium chloride at a density of 1.3 grams/mL is deposited in ultracentrifuge tubes. A volume of 5 mL of cesium chloride at a density of 1.5 grams/mL is then placed underneath. The supernatant is gently deposited on top of the cesium chloride and the tubes are ultracentrifuged at 28,000 RPM for 24 hours at 20° C. Two bands are observed: the upper band contains the empty capsids and the lower band corresponds to the full capsids. Both strips are collected avoiding the removal of impurities. The sample is mixed with cesium chloride at a density of 1.379 g/mL in a new ultracentrifuge tube and then ultracentrifuged at 38,000 RPM for 72 hours at 20° C. The solid capsid strip is removed.

[0256] Concentration and filtration: The removal of cesium chloride from the viral preparation and the concentration are carried out on Amicon® (Merck) filters. On Amicon® (Merck) filters, the vectors are concentrated by ultrafiltration with a cut-off of 100 kDa. Amicon membranes are first hydrated with 14 mL 20% ethanol, centrifuged 2 min at 3000 g, then equilibrated with 14 mL PBS, centrifuged 2 min at 3000 g, and then with 14 mL 1,379 ClCs. The collected solid capsid strip is placed on the filters and centrifuged 4 min at 3000 g. 15 mL PBS 1×+F68 formulation buffer is added, before further filtration 2 min at 1500 g. The three previous steps are repeated 6 more times before recovering the last concentrate. The samples are then filtered at 0.22 μm.

[0257] Titration: The vector is then assayed by quantitative PCR.

1.12 Mice Treatment

[0258] 1-month-old mice (DeltaMex5) and DBA/2J-mdx (DBA2mdx) strains, and their respective controls, strains C57BL/6 and DBA/2) were injected intravenously at a dose of .sup.2e11 vg/mouse (equivalent to a dose of 1e13 vg/kg for a mouse of approximately 20 g) of AAV vector or by PBS. After 3 months of vector expression, the hearts of the mice were ultrasonographed prior to collection. The overall, histological and functional consequences on the heart were then studied. The mice used in this study were male titin.sup.Mex5−/Mex5−

1.13 Statistics

[0259] In all statistical analyses, the differences are considered significant at P<0.05 (*), moderately significant at P<0.01 (**) and highly significant at P<0.001 (***), with P=probability. Bar graphs are shown as means+SEM standard deviations. The graphs are made using the GraphPad software.

[0260] Analysis of the distribution of fibrosis over the whole heart: In order to ensure that the fibrosis is homogeneous in the heart (H0 hypothesis), we randomly drew 20 values from the 483 fibrosis ratio values. These values were compared 10 to 10 with a Wilcoxon test (Software R) to obtain a p-value. This operation was repeated 1000 times, resulting in 1000 p-values. Among these values some are below 0.05 showing that in some cases our hypothesis of fibrosis invariance is not valid. Out of the 1000 statistical tests, we counted how many gave a value below 0.05. We repeated the entire process 100 times to obtain an average of the percentage for which our H0 hypothesis is false. This average is 4%. This means that our hypothesis is valid 96% of the time, and therefore corresponds to an overall p-value of 0.04, which is statistically acceptable.

[0261] Ultrasound analysis: In order to determine the relationships between the parameters and which parameters are of interest for the study, the statistical software R is used. The scatterplotMatrix function was used to visualize the correlations between the measurements at different ages and to select the parameters to be studied. The statistical analyses are performed with Rcmdr and the graphs with the GraphPad software.

2. Results

[0262] The inventors wanted to determine whether there were common gene expression modifications between two cardiomyopathy models: the DeltaMex5 model and the DBA/2-mdx model as well as the age at which these deregulations are established and their specificity. To do so, the inventors conducted a comparative study of transcriptome at different ages.

2.1 RNAseq Analysis of the Two Models of Cardiomyopathy

[0263] Total RNAseq (RNAseq) sequencing analysis was performed on heart samples from DeltaMex5 and DBA/2-mdx mice and their controls at early and late age of cardiac involvement. For DeltaMex5 mice, ages of 1 and 4 months were chosen, and for DBA/2-mdx mice, ages of 1 and 6 months. The main aim here was to identify genes present when the pathology is established that would be common to both cardiomyopathy models.

[0264] The sequencing was done according to the Illumina protocol. The differential expression of genes for each sample is calculated in relation to its control from their read number (>10). The expression difference values (or fold change) are expressed in binary logarithm (log 2.FC) and are associated with their adjusted Pvalue padj. Genes expressed significantly differentially between different conditions are determined by a log 2.FC>10.51 and a padj<0.05.

[0265] The volcano plot of the RNAseq data allows visualization for each condition of the distribution of genes and the extent of gene deregulation in the heart, as well as the extent of gene expression. The list of the 30 most deregulated (overexpressed) genes at 4 months in the heart of DeltaMex5 model is presented in the Table 6.

TABLE-US-00006 TABLE 6 Top 30 most deregulated (overexpressed) genes in the heart of the DeltaMex5 model at 4 months. Average Average Gene log2FC padj DeltaMex5 C57BL/6 Spp1 6.60 5.28E−128 2162.74 6.65 Gm42793 4.82 3.66E−46  212.55 0.00 Cilp 4.77 4.70E−278 3357.31 109.77 Ltbp2 4.74 2.97E−174 2206.18 68.03 Gpnmb 4.68 1.57E−97  764.57 19.98 Sprr1a 4.33 1.41E−36  222.75 1.39 Tnc 4.28 2.99E−33  4363.96 38.66 Gm6166 4.24 5.99E−39  171.45 2.01 8030451A03Rik 4.22 4.64E−35  206.04 1.72 D030025P21Rik 4.02 5.44E−36  153.86 2.87 Timp1 3.98 5.70E−52  625.54 24.25 Col12a1 3.82 2.14E−60  989.43 50.08 Col8a2 3.74 3.28E−40  247.08 10.59 Sfrp2 3.62 2.08E−55  501.17 30.20 Thbs4 3.61 3.79E−121 919.77 66.85 Ptn 3.40 1.25E−35  290.91 17.60 Postn 3.35 1.65E−21  12040.11 414.51 Mfap4 3.31 3.99E−57  428.05 35.05 Piezo2 3.27 2.87E−31  209.01 13.45 Gm26771 3.26 9.27E−27  132.29 7.36 Col3a1 3.22 1.72E−61  40685.43 3682.59 Col14a1 3.20 9.47E−116 2081.22 207.54 Ctss 3.19 3.04E−59  1773.00 162.81 Trem2 3.16 2.89E−28  259.21 17.93 Atp6v0d2 3.15 2.67E−17  58.07 0.67 Apol7d 3.15 5.17E−32  541.35 41.67 AC125167.1 3.12 3.11E−46  1533.67 141.84 Lgals3 3.10 6.97E−19  747.38 35.14 Mpeg1 3.09 8.80E−23  2205.83 143.04 Dkk3 3.01 2.78E−32  299.63 27.12 Underlined = model specific
For the DBA/2-mdx model, the list of the 30 most deregulated (overexpressed) genes in the heart at 6 months is presented in the Table 7.

TABLE-US-00007 TABLE 7 Top 30 most deregulated (overexpressed) genes in the heart of the DBA/2-mdx model at 6 months. Average Average Gene log2FC padj DBA/2-mdx DBA/2 Ighg2c 3.99 2.34E−40 127.71 0.00 Tnc 3.76  1.89E−111 1637.90 96.86 Cilp 3.27 4.59E−70 760.53 62.18 Sprr1a 3.02 7.35E−22 75.33 1.37 Mt2 2.98 3.69E−44 425.98 39.53 Timp1 2.83 1.53E−19 735.88 34.09 8030451A03Rik 2.65 5.15E−18 77.45 4.44 Serpina3n 2.60 9.78E−18 2728.99 200.98 Chile1 2.54 1.01E−18 173.35 15.73 Hamp2 −2.51 2.58E−38 61.43 427.96 Lrp8 2.47 1.81E−16 132.79 11.37 Saa3 2.41 6.08E−13 46.74 0.65 Fam46b 2.36 5.00E−34 511.91 83.18 Per2 2.35 8.14E−32 292.28 47.22 Fgl2 2.34 4.46E−65 3216.00 585.39 Lox 2.32 7.38E−52 919.81 166.22 Crlf1 2.30 1.98E−19 172.27 24.17 Postn 2.28 6.18E−21 9086.68 1378.81 Ereg 2.27 3.18E−12 58.87 3.76 Cfb 2.27 4.86E−41 632.26 115.30 Nxpe5 2.27 4.06E−28 215.52 36.33 Gm20547 2.27 6.53E−48 712.93 133.02 Ccl6 2.26 1.05E−64 1020.70 197.87 Ccl9 2.24 4.79E−43 492.52 93.30 Pak3 2.20 3.81E−15 117.72 15.86 Mmp3 2.17 7.28E−35 967.23 187.88 Srpx 2.17 9.38E−31 366.18 70.08 Clec4d 2.16 1.12E−12 66.61 7.53 Ccl7 2.16 2.68E−18 140.95 22.98 He33 2.15 2.60E−32 353.56 69.27 Underlined = model specific

[0266] The Top 30 most increased genes in the heart of the DeltaMex5 model at 4 months include genes of the WNT and TGF-β signaling pathways. In particular, two genes that belong directly to the WNT signaling pathway are overexpressed: SFRP2, coding for Secreted Frizzled-Related Protein-2 (log 2FC=3.62, P=2.08E-55) and DKK3 coding for Dickkopf related protein-3 (log 2FC=3.01, P=2.78E-32). Two genes that belong directly to the TGF-β WNT signaling pathway are also overexpressed: the CILP gene, coding for Cartilage Intermediate Layer Protein (log 2FC=4.77, P=4.70E-278), a negative regulator of the TGF-β pathway (Shindo et al. Int. Journal of Gerontology, 2017, 11, 67-74) and LTBP2 (log 2FC=4.74, P=2.97E-174) coding for the Latent-Transforming growth factor Beta-binding Protein 2, a modulator of the TGF-β pathway (Sinha et al., Cardiovascular Research, 2002, 53, 971-983). In the DBA/2-mdx model at 6 months, the inventors find in the first 5 positions CILP gene as one of the most deregulated gene. At 1 month, the number of deregulated genes is much smaller and the deregulated genes are deregulated to a lesser extent with a maximum log 2FC of 1.

[0267] The Venn diagram representation of RNAseq results allows the visualization of the numbers of common or specific deregulated genes in a model or a stage of disease progression. Of the 46,717 genes included in the RNAseq analysis, 4,850 genes were found to be significantly deregulated (Ilog2FCI>0.5 and pvalue<0.05) in either model at early or late age of cardiac involvement compared to control. At an early age, the heart of DeltaMex5 mice has only 44 deregulated genes, whereas the heart of DBA/2-mdx mice already has 2,186, with only 4 genes in common in both models. At a later age, the DeltaMex5 heart has 2,621 deregulated genes and the DBA/2-mdx heart has 2,202, of which 1,175 are common to both models, of which 708 genes are specific for the advanced age of cardiomyopathy. Only 9 genes are specific for the DeltaMex5 model, while 232 are specific for the DBA/2-mdx model. Of all the deregulated genes, a greater proportion of the genes are over-expressed rather than under-expressed. The majority of the most over-expressed genes are common between the two models. However, genes deregulated in the hearts of DeltaMex5 mice at 4 months are more strongly deregulated than genes deregulated in the hearts of DBA/2-mdx mice at 6 months (log 2FC maximum of 4 versus 6.6). It was also observed that, although the cardiac involvement between the two models was different, the transcriptional deregulations associated with them mostly involved the same genes and signaling pathways at a late stage.

[0268] To complete this analysis, the Ingenuity Pathway Analysis (IPA, Qiagen) software, which uses a repository of biological interactions and functional annotations to help interpret the data into biological mechanisms was used. At one month of age, no increase in signaling pathways was identified in the hearts of DeltaMex5 and DBA/2-mdx mice. Analysis by IPA allowed to highlight the biological functions whose genes are most represented in the deregulated genes in an advanced phase. In first position in both models, more than 150 genes involved in cardiovascular disease were found in the RNAseq analysis. In second position, more than 150 deregulated genes are categorized in the family of lesions and abnormalities on an organ. Finally, in third position, nearly 200 genes related to the function and development of the cardiovascular system were found.

[0269] The inventors also used another function of the IPA software to determine the toxicity associated with the observed changes in gene expression, and this only in the advanced phases. Many deregulated genes were identified: 86 genes associated with cardiac enlargement in the DeltaMex5 model and 85 in the DBA/2-mdx model, 45/48 genes that could lead to cardiac dysfunction, 38/36 genes in cardiac dilatation, 27/28 genes in cardiac fibrosis and 35/37 in cardiac necrosis.

[0270] The PANTHER gene ontology classification system was also used to determine the most deregulated signalling pathways in the late-stage models. In both models, the perturbations appear to be very similar as seen in the analysis of the Venn Diagrams. In the late-stage models, the WNT signaling pathway is found in 4.sup.th position of the most deregulated signaling pathways in the heart of DeltaMex5 mice and in 3.sup.rd position in the heart of DBA/2-mdx mice. A total of 40 genes belonging to this pathway are deregulated (overexpressed), including SFRP2 and DKK3. The TGF-β pathway, is found in 22.sup.nd and 19′ position in the heart of DeltaMex5 and DBA/2-mdx, with more than 15 deregulated genes, to which CILP and LTBP2, two of the most over-expressed genes, belong.

2.2 Validation of Deregulated Genes

[0271] The deregulation of CILP-1, DKK3, SFRP2, LTBP2 some of the most deregulated genes was evaluated under different conditions. WISP2 from the Wnt pathway was also selected.

[0272] None of these genes are overexpressed in the DeltaMex5 model at 1 month, while DKK33 is already overexpressed in the DBA2-mdx model. All genes are over-expressed in the later age of the disease (Table 8).

TABLE-US-00008 TABLE 8 Deregulation of the genes of interest in the models C2orf40 CILP COMP DIO2 DKK3 LTBP2 DeltaMex5 log2FC 0.12 0.16 0.09 0.22 0.11 0.11 1 month padj 0.00E+00 0.00E+00 0.00E+00 8.97E−01 0.00E+00 0.00E+00 Average 18 560 106 60 180 388 DeltaMex5 Average 7 136 41 33 49 91 C57BL/6 DeltaMex5 log2FC 1.60 4.77 2.94 2.03 3.01 4.74 4 months Padj 4.08E−05 4.70E−278 4.48E−15 1.08E−13 2.80E−32 3.00E−174 Average 32 3357 990 130 300 2206 DeltaMex5 Average 6 110 37 25 27 68 C57BL/6 DBA/2-mdx log2FC 1.28 0.63 0.73 0.58 1.06 0.79 1 month padj 0.01 2.30E−01 1.37E−01 2.64E−01 2.10E−02 9.00E−02 Average 80 417 211 68 936 1559 DBA/2-mdx Average DBA/2 10 111 35 38 53 160 DBA/2-mdx log2FC 1.19 3.27 1.59 1.49 1.37 1.94 6 months padj 1.14E−03 4.60E−70 7.35E−06 9.85E−08 1.60E−04 1.00E−10 Average 47 761 558 123 542 1688 DBA/2-mdx Average DBA/2 12 62 49 33 75 266

[0273] Validation of RNAseq data was then performed on hearts of the DeltaMex5 model at different ages (2, 4 and 6 months) by an individual qPCR to confirm their overexpression and assess their modification over time. All genes are significantly overexpressed from 2 months in the model, except DKK3 and gene overexpression increases progressively with age (FIG. 1).

[0274] The RNAseq analysis shows that Wnt and TGF-β pathways are both impaired and their genes, in particular CILP-1, DKK3, SFRP2 and LTBP2 are overexpressed in two models of genetically-induced dilated cardiomyopathies, Duchenne muscular dystrophies (DBA2mdx mice) and titinopathies (DeltaMex5 mice). Overexpression of the selected genes (CILP-1, DKK3, SFRP2, LTBP2 and WISP2) was validated by qPCR analysis. These results prompted the inventors to assess the effect of the modulation of the Wnt and TGF-β pathways, on the cardiac phenotype of the model, in particular by modulating the expression of the CILP-1, DKK3, SFRP2 and LTBP2 genes using a gene transfer approach.

2.3 Modulation of WNT and TGF-β Pathways by Gene Transfer Approach

[0275] The inventors, then wanted to assess the impact of modulation of the WNT and TGF-β pathways on the cardiac phenotype of the model. They chose to study the modulation of several genes belonging to the WNT and TGF-β pathways, either by overexpression or by inhibition using gene transfer strategies.

[0276] For the gene transfer approaches, several candidates were selected from the most deregulated genes: CILP and LTBP2 which belong to the TGF-β pathway, and WISP2/CCN5, DKK3 and SFRP2 which belong to the WNT pathway. AAV serotype 9 was chosen since it is described as having a significant cardiac tropism (Zincarelli et al., Molecular Therapy, 2008, 16, 1073-1080). For transgene expression, the chosen promoter is the human cardiac troponin Tnnt2 (cTnT) promoter, a cardiomyocyte-specific promoter (Wei et al., Gene, 2016, 582, 1-13). The AAV9 vector construct was validated using GFP-luciferase reporter.

[0277] Based on this GFP-luciferase construction, the inventors replaced the region coding for GFP and luciferase by the transgene of their choice preceded by a chimeric intron. The coding sequences chosen are the following human sequences: CILP (NCBI/GenBank accession number NM_003613.4) for the TGF-β pathway and DKK3 (NCBI/GenBank accession number NM_015881.5), SFRP2 (NCBI/GenBank accession number NM_003013.3) and WISP2 (NCBI/GenBank accession number NM_003881.3) for the WNT pathway.

[0278] The strategy chosen for inhibiting LTBP2 gene expression is that using shRNAs. These are small RNAs with a hairpin structure, their action is based on the principle of interfering RNA, neutralizing the messenger RNA of the target. The inventors have chosen 4-in-1 shRNAs for enhanced efficiency of transgene neutralization: four individual sh sequences are grouped together in a plasmid. The shRNAs were selected using Thermofisher's RNAi Designer tool. The 4 shRNAs with the best specific recovery score for the gene of interest were selected. They were then ordered from Vigene Bioscience, under the control of H1 and U6 ubiquitous promoters.

[0279] After in vitro and in vivo validation of the vector under consideration, an evaluation of the consequences of in vivo gene transfer on fibrotic status and cardiac function was performed on the DeltaMex5 model (the more severe model of the two). The effect of vectors expressing the human CILP genes for the TGF-β pathway and WISP2, SFRP2 and DKK3, for the WNT pathway was tested as well as shRNA inhibition vector for LTBP2. The approaches that have shown an interest in the DeltaMex5 model are currently being applied to the DBA/2-mdx model.

2.3.1 Modulation of the TGF-β Pathway Genes (CILP and LTBP2)

[0280] The modulation of the TGF-β pathway was tested by overexpression of CILP (vector AAV9-hTnnt2-hCILP) and inhibition of LTBP2 (AAV9-4inlshRNA-mLTBP2-GFP). 1-month-old mice were injected intravenously at a dose of .sup.2e11 vg/mouse (equivalent to a dose of 1e13 vg/kg for a mouse of approximately 20 g) of AAV vector or by PBS. After 3 months of vector expression, the hearts of the mice were ultrasonographed prior to collection. The overall, histological and functional consequences on the heart were then studied.

[0281] Vector expression in the heart was verified in mice injected with AAV9-hTnnt2-hCILP by assaying the relative abundance of hCILP in RT-qPCR. Since the transgene is a human transgene, it was detected only in mice injected with the vector but not in mice injected with PBS (FIG. 2A). Expression of the vector AAV9-4inlshRNA-mLTBP2-GFP is detected using the GFP reporter gene which is present only in mice injected by the vector (FIG. 2B). These RT-qPCR assays confirm the presence of the transgenes 3 months after vector injection.

2.3.1.1 Morphological Evaluation

[0282] Mouse mass was significantly decreased in mice treated with the AAV9-hTnnt2-hCILP vector after 3 months (29.38±1.29 g, n=4, versus 34.9±1.3 g, n=8, P=0.024). The mass of mice treated with the AAV9-4inlshRNA-mLTBP2-GFP vector remains similar (32.13±1.76, P>0.05). The values are no longer significantly different from the mean mass of C57BL/6 mice (28.81±0.72, n=11) (FIG. 3A). Heart hypertrophy, as measured by the ratio of heart mass to total mouse mass, in mice treated with the AAV9-hTnnt2-hCILP vector remains close to DeltaMex5 mice (0.68±0.04, n=4 versus 0.63±0.02%, n=8, P>0.05), but becomes significantly increased compared to C57BL/6 mice (0.57±0.02%, n=7, P=0.027). In contrast, it was significantly decreased in mice treated with the AAV9-4inlshRNA-mLTBP2-GFP vector (0.53±0.048, P=0.03) compared to untreated DeltaMex5 mice and became comparable to C57BL/6 mice (FIG. 3B).

[0283] Histological analyses were then performed on the hearts of the mice. HPS staining revealed persistence of the damaged tissue in mice treated with the different vectors (FIG. 4A). Sirius Red staining still showed the presence of fibrotic tissue in the hearts of mice treated with the two vectors, but in smaller quantities compared to DeltaMex5 control mice (FIG. 4B). The quantification of fibrosis by WEKA in tissues by collagen staining with Sirius Red confirms that the overall fibrosis rate is decreased in the hearts of DeltaMex5 mice treated with AAV9-hTnnt2-hCILP compared to the hearts of DeltaMex5-PBS mice (17.59±1.27% versus 33.31±4.65%, P=0.017, n=4), although it is still higher than the fibrosis heart rate in C57BL/6 mice (7.11±0.77%, P=0.0004, n=4). Looking at the different types of fibrosis, it is observed that installed fibrosis varies little (4.14±0.45% versus 4.95±1.95%, P>0.05), but recent fibrosis is significantly less present in DeltaMex5 mice given AAV9-hTnnt2-hCILP (12.64±2.04% versus 29.17±4.24, P=0.0126) (FIG. 4C). Quantification on AAV-treated samples with shRNA has not yet been performed but observation of the slices indicates that it is decreased.

2.3.1.2 Functional Evaluation

[0284] Ultrasound analyses of cardiac function were performed at 4 months, after 3 months of vector expression (FIG. 5). Among the parameters evaluated (estimated left ventricle mass and volume, ejection fraction), there was a significant variation in the estimated left ventricular mass in mice injected with AAV9-4inlshRNA-mLTBP2-GFP with a decrease of almost 40% compared to DeltaMex5 controls (133±4.74 mg, n=4, P=0.01). (127±11.05 mg,

2.3.1.3 Molecular Evaluation

[0285] Tissue RNA markers of cardiac involvement (Nppa, Myh7, Myh6, Timp1, Tgf-β1) were measured by RT-qPCR (FIG. 6). Only Tgf-β1 was significantly decreased in mice injected with the AAV9-hTnnt2-hCILP vector compared to DeltaMex5-PBS mice with a ratio close to 1 (1.25±0.25 versus 2.13±0.14, P=0.02). Only Timp1 was significantly decreased in injected mice compared to DeltaMex5-PBS mice (31.67±6.98, P=0.001). In mice injected with the AAV9-4inlshRNA-mLTBP2-GFP vector, Myh6 and P-catenin are increased relative to uninjected mice (0.77±0.035, P=0.0001 and 0.99±0.008, P=0.008) and are normalized to C57BL/6 mice with a ratio close to 1. Conversely, TIMP1 and TGF-β3 are decreased (12.31±3.49, P=0.0001 and 1.24±0.11, P=0.002), and TGF-β is normalized with respect to C57BL/6 mice.

[0286] Fibrosis RNA tissue markers (Fibronectin, Vimentin, Collagen 1a1 and Collagen 3al) were also measured by RT-qPCR (FIG. 7). In mice injected with AAV9-hTnnt2-hCILP, the 3 main markers of fibrosis were significantly reduced compared to mice injected with PBS:fibronectin (7.72±2.95 versus 15.67±1.4, P=0.05), vimentin (1.77±0.43 versus 3.45±0.27, P=0.016) and collagen 1a1 (3.95±1.13 versus 6.92±0.41, P=0.049). Collagen 3al has a non-significant decreasing trend (5.72±1.68 versus 9.35±0.49, P=0.08). These results are related to the previous results: there was no improvement in cardiac function in the treated mice, but there was an improvement in fibrosis. Interestingly, for all markers, the mouse showing the best normalization of results compared to C57BL/6 mice was the mouse with the highest hCILP level. In mice injected with AAV9-4inlshRNA-mLTBP2-GFP both fibronectin and vimentin are decreased (4.68±1.91, P=0.0035 and 1.25±0.10, P=0.0003). Vimentin was normalized to C57BL/6 mice.

2.3.2 Modulation of the WNT Pathway Genes (WISP2, DKK3, SFRP2)

[0287] The modulation of the WNT pathway was tested by overexpression of WISP2, DKK3 and SFRP2. The 1-month-old mice were injected intravenously at a dose of 2e11 vg/mouse or by PBS. After 3 months of vector expression, the hearts of the mice were ultrasonographed prior to sampling.

[0288] Vector expression in the heart was tested in mice injected with AAV9-hTnnt2-hWISP2, AAV9-hTnnt2-hDKK3 and AAV9-hTnnt2-hSFRP2 by RT-qPCR assay of the relative abundance of hWISP2, hDKK3 and hSFRP2 respectively (FIG. 8).

2.3.2.1 Morphological Evaluation

[0289] The mass of mice treated with the three vectors remains similar to that of untreated DeltaMex5 mice (WISP2: 35.7±1.106; DKK3: 32.58±1.31 g; SFRP2: 32.8±1.45 g), as well as the heart hypertrophy measured by the heart mass as a proportion of the total mass of the mouse (WISP2: 0.55±0.02%; DKK3: 0.68±0.05%; SFRP2: 0.64±0.06%).

[0290] Histologically, the HPS stain reveals persistence of the damaged tissue in mice treated with the three vectors. Sirius Red staining still shows the presence of fibrotic tissue in the hearts of treated mice, but appears weaker for the AAV9-hTnnt2-DKK3 and SFRP2 vectors. The quantification of fibrosis by WEKA in tissues by Sirius Red collagen staining shows that for the AAV9-hTnnt2-hDKK3 and SFRP2 vectors, the overall fibrosis rates are decreased (DKK3: 17.31±4.79%; SFRP2: 18.38±3.69% versus 33.31±4.65%, P=0.01 and P=0.046 n=4), and that this is due to a decrease in recent fibrosis only (DKK3: 11.5±1.01%; SFRP2: 12.18±4.66% versus 29.17±4.24%, P=0.007 and P>0.035 n=4) (FIG. 9).

2.3.2.2 Functional Evaluation

[0291] Ultrasound analyses of cardiac function and ventricular dilatation showed no change in parameters in mice injected with AAV9-hTnnt2-hWISP2, DKK3 and SFRP2 compared to mice injected with PBS. Only the left ventricular mass was significantly decreased by 30% in mice injected with the AAV9-hTnnt2-DKK3 vector (133.34±8.44 mg, n=4, versus 190±12.77 mg, n=8, P=0.01).

2.3.2.3 Molecular Evaluation

[0292] The markers of cardiac damage and fibrosis evaluated in RT-qPCR for the hearts of mice injected with AAV9-hTnnt2-hWISP2 are modified only for TGF-β and collagen 1a1 which are decreased compared to mice injected with PBS (1.64±0.94, P=0.03 and 4.49±0.83, P=0.04) (FIG. 10), the other markers are not modified (FIG. 10).

[0293] It is interesting to observe that for all markers, the mouse showing the best restoration of ratios relative to C57BL/6 mice is the mouse with the highest hWIPS2 level. No markers were significantly altered in the hearts of mice injected with AAV9-hTnnt2-DKK3. In the hearts of mice injected with AAV9-hTnnt2-hSFRP2, the only differences observed were a decrease in collagen 1a1 and 3al in the hearts of (4.70±0.77, P=0.043 and 6.76± to 0.77, P=0.048). Again it is observed that for all markers, the mouse showing the best restoration of ratios compared to C57BL/6 mice is the mouse with the highest transgene level.

CONCLUSION

[0294] The modulation of the WNT or TGF-β pathway by surexpression of the WNT pathway genes WISP2, DKK3, SFRP2 and the TGF-β pathway gene CILP-1 or inhibition of expression of the TGF-β pathway LTBP2 gene improve tissue fibrosis after 3 months of treatment. There was no improvement in cardiac function in the treated mice, but there was an improvement in fibrosis.