GENERATION OF DIVERSE VIRAL LIBRARIES

Abstract

This invention relates to a process for producing a library of viruses, comprising first and second culturing steps. These steps aim to promote intra-species and inter-species recombination, respectively, between double-stranded DNA viruses of the same virus family.

Claims

1. A process for producing a library of viruses, the process comprising: (a) a first culturing step, comprising culturing together, on one or more cell lines, viruses of at least two different serotypes from a first species of double-stranded DNA virus, and (b) combining (i) viruses obtained from Step (a), with (ii) viruses of at least two different serotypes of the same species from each of one or more further species of double-stranded DNA viruses,  wherein the first species of double-stranded DNA virus and each further species of double-stranded DNA virus are all different species in the same family or same genus of double-stranded DNA viruses; to produce a library of viruses; and optionally (c) a second culturing step, wherein the viruses which are combined in Step (b) are cultured together on one or more cell lines; and (d) combining viruses or portions thereof obtained after Step (c), and/or isolating a plurality of viruses therefrom, to produce a library of viruses.

2. A process as claimed in claim 1, wherein in Step (a), the viruses of at least two different serotypes from a first species of double-stranded DNA virus are cultured together: (i) on a single cell line; (ii) on a plurality of cell lines, wherein the plurality of cell lines are cultured separately; or (iii) on a plurality of cell lines, wherein the plurality of cell lines are cultured together.

3. A process as claimed in claim 1, wherein, in Step (b)(ii), for each species of the one or more further species of double-stranded DNA virus, the viruses of different serotypes from that species are ones that have previously been cultured together, wherein viruses of different species were previously cultured independently.

4. A process as claimed in claim 1, wherein Steps (a) and (b) comprise: (a) a first culturing step, comprising (i) culturing together, on one or more cell lines, viruses of at least two different serotypes from a first species of double-stranded DNA virus; and (ii) culturing, on one or more cell lines, viruses of at least two different serotypes of the same species from each of one or more further species of double-stranded DNA viruses, wherein, for each species of double-stranded DNA virus, viruses of different serotypes of the same species are cultured together, and viruses of different species are cultured independently; and (b) combining (i) viruses from Step (a)(i), and (ii) viruses from Step (a)(ii).

5. A process as claimed in claim 1, wherein: Step (b) additionally comprises combining viruses from (i) and (ii) with viruses from: (iii) the first species of double-stranded DNA virus; (iv) one or more wild-type viruses of the same family, genus or species as the first species of double-stranded DNA virus; (v) one or more of the further species of double-stranded DNA viruses; and/or (vi) one or more wild-type viruses of the same family, genus or species as one of the further species of double-stranded DNA virus.

6. A process as claimed in claim 1, wherein in Step (c), the viruses of the first species and each further species are cultured together: (i) on a single cell line; (ii) on a plurality of cell lines, wherein the plurality of cell lines are cultured separately; or (iii) on a plurality of cell lines, wherein the plurality of cell lines are cultured together.

7. A process as claimed in claim 1, wherein Step (d) additionally comprises combining viruses or portions thereof obtained after Step (c) with viruses from: (i) the first species of double-stranded DNA virus; (ii) one or more of the further species of double-stranded DNA viruses; (iii) one or more viruses obtained after culturing Step (a); (iv) one or more wild-type viruses from the same family, genus or species as the first species of double-stranded DNA virus; and/or (v) one or more wild-type viruses from the same family, genus or species as one of the further species of double-stranded DNA viruses.

8. A process as claimed in claim 1, wherein the viruses are subjected to mutagenesis before, during or after one or more of Steps (a), (b) and/or (c).

9. A process as claimed in claim 1, wherein the double-stranded DNA virus is selected from Adenoviridae, Herpesviridae, and Poxviridae families.

10. A process as claimed in claim 9, wherein the Adenoviridae are species of human adenovirus selected from the group consisting of AdB, AdC, AdD, AdE, AdF and AdG.

11. A process as claimed in claim 10, wherein; (i) a species is AdB and the serotypes are selected from the group consisting of Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad50 and Ad55; (ii) a species is AdC and the serotypes are selected from the group consisting of Ad1, Ad2, Ad5, Ad6 and Ad57; (iii) a species is AdD and the serotypes are selected from the group consisting of Ad8, Ad9, Ad10, Ad13, Ad15, Ad 17, Ad19, Ad20, Ad22, Ad23, Ad24, Ad25, Ad26, Ad27, Ad28, Ad29, Ad30, Ad32, Ad33, Ad36, Ad37, Ad38, Ad39, Ad42, Ad43, Ad44, Ad45, Ad46, Ad47, Ad48, Ad49, Ad51, Ad53, Ad54 and Ad56; and/or (iv) a species is AdF and the serotypes are selected from the group consisting of Ad40 and Ad41.

12. A process as claimed in claim 1, wherein the family of double-stranded DNA virus is selected from Herpesviridae and Poxviridae.

13. A process as claimed in claim 1, wherein at least 3, 4, 5, 6, 7, 8, 9, 10 or more different serotypes from a first species are cultured together in Step (a); and/or at least 3, 4, 5, 6, 7, 8, 9, 10 or more different serotypes from one or more further species are combined in Step (b).

14. A process as claimed in claim 1, wherein the number of the one or more further species of double-stranded DNA viruses is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more further species.

15. A process as claimed in claim 1, wherein the one or more cell lines are cancer cell lines, or are selected from the group consisting of A549, HT29, HEK293, HCT116, MM1S, SKOV3, MMR, JJN3, RPMI-8226 and U266 cell lines.

16. A process as claimed in claim 15, wherein: (i) a species is AdB and the cell line is A549 or HCT116; (ii) a species is AdC and the cell line is MM1S, HEK293 or A549; and/or (iii) a species is AdD and the cell line is HT29 or A549.

17. A process as claimed in claim 1, wherein the viruses are passaged 4-6 times, each after 3-7 days, in the first and/or second culturing step.

18. A process as claimed in claim 1, wherein the viruses are passaged 2-6 times, each after 2-6 days, in the first and/or second culturing step.

19. A library which is obtained by or obtainable by a process as claimed in claim 1.

20. A chimeric virus, or a chimeric adenovirus, obtained by or obtainable by a process as claimed in claim 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0139] FIG. 1.1. Virus genome replication measured by QPCR (n=4) at 0, 1, 3, 6 days post-infection of A549, HT29, HEK293, HCT116, SKOV3 and MM1S cells with 200 vp/cell of AdB, AdC or AdD virus libraries.

[0140] FIG. 1.2. Shifting proportions of Ad species across multiple passages demonstrates a collapse of virus diversity when Ad species are passaged together in A549 cells.

[0141] FIG. 1.3. Pooling cell lines may aid diversification.

[0142] FIG. 2.1. Virus genomes from three rounds of infection were quantified by QPCR. HT29 cells were infected with 200 vp/cell of AdC and AdD virus libraries, or co-infected with 200 vp/cell AdC or AdD virus libraries for 3 rounds of infection.

[0143] FIG. 2.2. Viral competition in different cell lines results in unique species distributions.

[0144] FIG. 2.3. Prior art methods to create virus libraries results in a loss of diversity.

[0145] FIG. 3.1. A higher rate of inter-species chimeras are detected following the Step-wise Diversification Process (Stage 1) than Single Stage diversification (prior art). Stage 1 of the Step-wise Diversification process is the sum of all Ad-B, C, D chimeric viruses from the output of each cell line combined. % chimeric reads is the percentage of all next generation sequencing (NGS, Illumina) reads that evince a recombination breakpoint.

[0146] FIG. 3.2. The Step-wise Diversification Process promotes broad participation of adenovirus chimera parent pairs compared to Single Stage Diversification (prior art).

[0147] FIG. 3.3. The Step-wise Diversification Process creates chimeras with recombination sites spanning the genome. The positions of AdC chimera recombination sites span the genome for the Step-Wise Diversification Process, whereas none were detected for Single Stage Diversification (Prior art).

[0148] FIG. 3.4. Quantity of sequencing reads demonstrating AdB chimera recombination sites across the adenovirus genome. Analysis of two representative Ad-B serotypes (denoted as AdB.1 and AdB.2 in figure below) and their chimeras highlights the levels of diversity created using each approach. Evidence of different rates and types of AdB.1/AdB.2 recombination events occurring across the virus genome during Stage 1 and 2 of the diversification process is demonstrated. Ad genomic deletions were detected to a greater extent during Stage 1 than Stage 2. (i) Data was generated using synthetic long read sequencing approaches (reconstruction of IIlumina reads from the same virus genome informed by barcode tagging). (ii) Data was generated using short Illumina reads.

[0149] FIG. 4.1. Plot of AdD chimera rates detected following passaging the AdD libraries in HT29 cells or HCT116 cells. Chimeras were detected using synthetic long read sequencing.

[0150] FIG. 4.2. Plot of AdB and AdC chimera rates detected following passaging the AdB/C libraries in A549 cells or HCT116 cells. Chimeras were detected using short read sequencing.

[0151] FIG. 4.3. Quantity of sequencing reads demonstrating AdB chimera breakpoints across the adenovirus genome following infection of Ad-B libraries in A549 and HCT116 cells.

[0152] FIG. 5.1. Sequence similarity between Ad serotypes across the genome.

[0153] FIG. 5.2. Sequence similarities between HSV1 isolates. Horizontal dashed line represents 0.5% sequence divergence (0.25% along each branch from their common ancestor) and boxes indicate isolates assigned to the same virus strain.

[0154] FIG. 5.3. Sequence similarities across the genome compared to HSV-1 strain 17.

[0155] FIG. 5.4. Sequence similarities between Vaccinia strains and other Orthopoxvirus species. Horizontal dashed line represents 0.5% sequence divergence (0.25% along each branch from their common ancestor) and boxes indicate clones assigned to the same virus strain. (WR=Western Reserve, Cop=Copenhagen).

[0156] FIG. 5.5. Sequence similarities across the genome compared to Vaccinia Western Reserve.

EXAMPLES

[0157] The present invention is further illustrated by the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

Example 1: Preferential Growth of Viruses in Different Cell Lines

[0158] Virus Preparations

[0159] Wild-type human adenovirus (Ad) serotypes from Ad species B (AdB), AdC, AdD, AdE, AdF and AdG were included in this study (Robinson C M et al., Molecular evolution of human adenoviruses. Sci. Rep. 2013; 3:1812). Each Ad serotype was plaque-purified and single isolates were verified by whole genome sequencing, or Sanger sequencing over a 1 kb E2B region and found to align correctly to the corresponding Genbank ID entry. Viruses were amplified and titred by TCID50 on HEK293 cells. Equal infectious particles of each serotype were pooled according to their Ad species (e.g. Ad1, Ad2, Ad5, Ad6=AdC virus library) and purified by double-banding using CsCl gradients to generate species specific Ad libraries (e.g. AdB, AdC, AdD libraries).

[0160] Understanding Viral Replication Kinetics

[0161] Time-course infections were performed with AdB, AdC and AdD virus libraries in a panel of human cancer cell lines (A549, HT29, HEK293, HCT116, SKOV3 and MM1S cells, obtained from the ATCC). A549, HT29, SKOV3 and HEK293 cells were cultured in DMEM with 10% FBS at 37° C., 5% CO.sub.2. HCT116 and MM1S cells were cultured in RPMI-1640 with 10% FBS at 37° C., 5% CO.sub.2. Cells were seeded 24 hrs prior to infection with AdB, AdC or AdD virus libraries and incubated at 37° C., 5% CO.sub.2. Samples (virally-infected cells and supernatant combined) were harvested for virus genome replication studies at 0, 1, 3, 6-7 days post infection. Virus genomes were quantified by qPCR using Ad species-specific primers (Life Technologies):

TABLE-US-00001   AdB Forward (SEQ ID NO: 1) GAGTTGGCTTTAAGTTTAATGAGC, AdB Reverse (SEQ ID NO: 2) TGAGGCCTGATAAACAGTAT, AdC Forward (SEQ ID NO: 3) GCTTAATGACCAGACACCGT, AdC Reverse (SEQ ID NO: 4) GGTATATGCAAAGGTGGCA, AdD Forward (SEQ ID NO: 5) GGGATGATGACCGAGCTG, AdD Reverse (SEQ ID NO: 6) CAGACATGCCTGCTACAT;
and data represented as total virus genomes per Ad species over time (FIG. 1).

[0162] The data in FIG. 1.1 demonstrates that adenoviruses from different species (for example AdB, C, D) tend to show preferable infection and/or replication efficiencies in different cell lines. For example, AdC viruses replicated much more rapidly in MM1S and HEK293 cells than AdD viruses. AdC viruses reached maximal genomes at 3 days, while AdD viruses remained >10 fold lower, indicating dramatically reduced opportunities for AdD recombination events in these cell lines, in this time frame, compared to AdC viruses.

[0163] Of the cell lines tested, HEK293 cells preferentially support AdC>AdB>AdD replication; MM1S support AdC>AdD>AdB; A549 support AdC/B>AdD; HCT116 support AdB>AdC>AdD; SKOV3 support AdB>AdC/D; HT29 support AdD>AdB/C replication at 6 days. Overall A549 had the highest levels for viral replication and HT29/SKOV3 cells supported the lowest levels.

[0164] An input virus library consisting of a pool of wild-type (WT) adenoviruses from three species was assessed for species distribution across multiple passages. An equal titre of each WT adenovirus was added to the input library (more Ad-D viruses than Ad-B/C exist in nature) hence the species distribution in FIG. 1.2. This library was infected at a high MOI in A549 cells and passaged up to 4 times, each time on a fresh cell monolayer at a high MOI. At each stage, outputs were analysed via qPCR for titres of AdB, AdC & AdD species, with the relative proportion of each species versus the total titre of the three species plotted for each passage. Despite spiking in the input WT virus library at each passage, the distribution of adenovirus species shifted dramatically towards AdB by the second passage.

[0165] To address the dominance of a single Ad species and collapse of viral diversity observed in FIG. 1.3. multiple different cell lines were seeded into the same culture vessel and infected with the AdB, AdC and AdD WT pool. Following a single passage, the species distribution of viruses released into the supernatant was analysed via qPCR and plotted for each experimental condition. Unlike in A549 cells, the pooled cell output had relatively equal distribution across the number of component species indicating the importance of using the outputs of different cell lines to create virus diversity.

Example 2: Viral Competition in HT29 Cell Lines

[0166] HT29 cells were seeded at 70% confluence in T25 flasks in 10% media and incubated at 37° C., 5% CO.sub.2. The next day cells were infected with 200 vp/cell of AdC or AdD virus libraries, or co-infected with 200 vp/cell AdC and AdD virus libraries. Infected cells and supernatants were harvested at signs of CPE post infection, exposed to 1 freeze-thaw cycle and then used as the inoculum for the next round of infection on HT29 cells. This process was repeated three times. Virus genomes in the supernatants from the third round of infection were quantified by qPCR using Ad species specific primers:

TABLE-US-00002   AdC Forward (SEQ ID NO: 3) GCTTAATGACCAGACACCGT, AdC Reverse (SEQ ID NO: 4) GGTATATGCAAAGGTGGCA, AdD Forward (SEQ ID NO: 5) GGGATGATGACCGAGCTG;, AdD Reverse (SEQ ID NO: 6) CAGACATGCCTGCTACAT.

[0167] The data is shown in FIG. 2, and demonstrates when cells are co-infected with different Ad species, one virus species will outgrow the other over repeated rounds of infection; and virus genomes in the independently-infected cells will be in significantly higher quantities than when cells are co-infected with AdC and AdD libraries i.e. more AdC viruses were recovered from each round in the absence of other species. Because only those viruses entering cells or replicating at the same time will have a chance of recombining, in order to generate a diverse library, with representatives from as many serotypes and species as possible, the data in FIGS. 1 and 2 demonstrates that each adenovirus species should be grown separately on its preferred cell line (i.e. a cell line which permits maximum viral genome amplification for a given Ad species). The virus species amplified in this way can then be pooled to provide a library containing all wild-types, recombinants and variations thereof.

[0168] To explore the transcription and viral release kinetics of the AdB, AdC and AdD species, a time course was set up with three cell lines (A549, HCT and HT29). Cells were seeded and infected at a high MOI with a viral pool formed from the AdB, AdC and AdD WT species weighted by equal serotype termed the WT pool input (similar to FIG. 1.2). Infections were set up at an appropriate vg/cell for the cell line infected. Wells of each cell line were harvested at multiple timepoints post infection (14 hrs, 24 hrs, 38 hrs, 48 hrs, 96 hrs and 144 hrs) as well as a sample of the original infection material to use as a 0 hr control. At each timepoint titres of each species were determined within the harvested supernatant by qPCR which is displayed in FIG. 2.2.

[0169] The top row of FIG. 2.2 shows supernatant titers following a pooled infection comprising AdB, AdC and AdD virus libraries, weighted by equal serotype. Top row, A, B and C represent virus titres following infections in A549, HCT116 and HT29 cells respectively. Data supports the use of multiple cell lines to promote recombination events in different Ad species due to differences in infection and replication efficiency between the species across different cell lines. Bottom row displays species distribution, calculated by proportion of each AdB, AdC or AdD total genomes relative to the total genomes across all three species. Data supports use of different cell lines due to stark differences in relative proportions between the cell lines.

[0170] As a comparison to the prior art method for generating virus libraries by recombination, our input pool of WT viruses (a combination of AdB, C & D libraries) were passaged according to the methods detailed in the prior art (Kuhn et al., 2008, supra). In brief, HT29 cells were infected with a pool of viruses at 200 vg/cell. Output viruses were titred via qPCR and a second round of infection established with the same conditions. Mapping of the Ad species distribution at input, passage 1 and passage 2 reveals an almost total collapse of AdC abundance, removing this group from the pool of available recombination targets. Therefore the use of multiple cell lines in which AdC is able to compete is required to provide the most targets for recombination and therefore maximum diversity.

Example 3: Comparison of Single-Stage Viral Diversification and Stepwise Viral Diversification Techniques

[0171] Single Stage Viral Diversification

[0172] 3 serotypes from AdB and 1 each from AdC, AdD, AdE and AdF (i.e. using a similar method to Kuhn et al., 2008, supra, to act as comparator)) were pooled and passaged on sub-confluent cultures of HT29 cells in T175 flasks. Cells were infected with 200 vp/cell of the pooled Ads in 2% culture media at 37° C., 5% CO.sub.2. Viral lysates were harvested from these infected cultures at 48-96 hours post-infection, then frozen at −80° C. Virally-infected cells underwent 3 freeze-thaw cycles and the released viruses were used as the infectious inoculum for a subsequent passage on sub-confluent cultures. The viral lysates were harvested at 48-72 hours post-infection from these cultures and underwent 3 freeze-thaw cycles before purification on CsCl density gradients. The purified viruses were deemed the output ‘diversified library’ from this approach.

[0173] Stepwise Viral Diversification

[0174] Stage 1—To Promote More Intra-Species Recombination Events.

[0175] Viral group libraries of AdB (>6×AdB serotypes), AdC (4×AdC) or AdD (>29×10 AdD serotypes) were passaged independently on sub-confluent cultures of cancer cell lines (A549, HT29, HCT116) in 10% culture media at 37° C., 5% CO.sub.2. Cells were seeded 24 hours prior to infection at 60-70% confluence in T25 culture flasks. Cells were infected with a suitable vp/cell of AdB, AdC, or AdD libraries. Upon cytopathic effect (CPE), the released virus for the particular Ad species were harvested. Following one freeze-thaw cycle, clarified supernatants from the first round of virus infection were added to a sub-confluent layer of cancer cells in T75 flasks in 10% culture media; again each Ad species was passaged independently. The volume of supernatant chosen was that which produced signs of CPE in the following round of infection between 2-5 days.

[0176] This cycle of infection on T75 flasks was repeated up to 5 times to introduce recombination events within the Ad species. Output virus genomes for each round of infection were quantified by qPCR using species-specific primers. The output from each cell line was pooled on an Ad species-specific basis and where appropriate purified by CsCl density gradients. Together the purified viruses were deemed to be the output ‘diversified library’ from stage 1.

[0177] Stage 2—To Provide Opportunity for Novel Intra-Species and Inter-Species Recombination Events.

[0178] Equal virus genomes from Stage 1 (i.e. AdB, AdC, AdD wild-types and variants thereof) were pooled. Viral species libraries were passaged together on sub-confluent cultures of cancer cell lines (A549, HT29, HCT116) in 10% culture media. Cells were split 24 hours prior to infection at 60-70% confluence in T75 culture flasks. Cells were infected with a suitable vp/cell of the pooled Stage 1 virus libraries. Upon CPE, the released virus was harvested. Following one freeze-thaw cycle, clarified supernatant from the first round of viral infection was added to a subconfluent layer of cancer cells in T75 flasks in 10% culture media. The volume of supernatant chosen was that which produced signs of CPE in the following round of infection between 2-5 days. This cycle of infection on T75 flasks was repeated up to 5 times to promote intra and inter-Ad species recombination events. The output from each cell line was pooled and where appropriate purified by CsCl density gradients. The purified virus pool was deemed the output ‘diversified library’ from stage 2.

[0179] In the virus pool used in the ‘Single step viral diversification’, there were 3 serotypes from AdB and 1 each from AdC, AdD, AdE and AdF. In the ‘Stepwise library diversification’ there were multiple serotypes from AdB, AdC and AdD.

[0180] Diversity of a virus library with respect to virus recombination was determined by high throughput next-generation sequencing (NGS) of the virus genomes in that library. Sequences are aligned against a reference set comprising sequences for each known WT virus. Reads mapping to multiple references were confirmed as chimeric using blast searches.

[0181] The Step-wise Diversification Process was found to be superior to the prior art method, both in expanding the number and type of virus variants, enabling more variants to participate and preventing dominance of a particular virus group (FIGS. 3.1 and 3.2).

[0182] Intra-species Ad chimeras were detected at a higher rate (higher total % chimeric sequence reads, hence higher rate of recombination) following the Diversification Process Stage 1 than were detected using the prior art process or matched Ad-B, Ad-C or Ad-D WT pool inputs (no diversification process applied) (FIG. 3.1). Diversification Process Stage 1 entails passaging of Ad species in different cell lines independently, prior to combining all outputs (i.e. in this case the sum of AdB, C, D chimeras generated in A549, HCT116, HT29). This increases the number of recombinants within each Ad species by co-infections using viruses with larger stretches of sequence homology and similar infection kinetics (i.e. Ads within each species) in their preferred cell type to synchronise infections, prior to combining the outputs with the Stage 2 process and the WT pool input. The approach also enables more Ad serotypes to contribute to recombination events, and thus increases overall library diversity. This is in contrast to the prior art methods in which different Ad species were pooled and used to infect one cell line, resulting in dominance of the Ad-B viruses and collapse of virus diversity (FIGS. 3.1 and 3.2). It should be noted that the percentage of chimeric sequence reads shown, particularly for AdD, is likely to underestimate the total % due to limitations with short read sequencing analysis approaches in homologous viruses.

[0183] The Stepwise Diversification Process was found to be superior to the prior art method, enabling virus recombination events distributed across the genome.

[0184] The Stepwise Diversification Process (Stage 1) includes at least two different adenovirus serotypes from each species, thereby providing viruses with larger stretches of sequence homology and similar infection kinetics (i.e. Ads within each species) in their preferred cell type to synchronise infections, prior to combining the outputs with the Stage 2 process and the WT pool input. This approach creates recombination sites spanning across the whole virus genome ensuring diverse functional variants (FIG. 3.3). By opening up more of the virus genome in this way, previously unexplored functional virus traits may be revealed which increase the search space to identify the best therapeutic viruses. In contrast, if only using one adenovirus serotype from each species, as is the case of all Ad species aside from Ad-B in the prior art, there are very few chances for recombination events to occur; consequently, no Ad-C chimeras were detected using the prior art approach.

[0185] Different types of virus recombination events and adenovirus variants may be produced during Stage 1 and Stage 2 of the Step-wise Diversification Process. Therefore combining the outputs of both Stages 1 and 2 with the input viruses can further enhance virus library diversity.

Example 4: Some Cell Types have an Increased Propensity for Allowing Viral Recombination Events

[0186] Viral output from up to 5 serial passaging of AdB/C/D libraries in HCT116 and HT29 cells were prepared similarly to Stepwise Diversification Stage 1 methods. Sequencing- and bioinformatics-led viral recombinant analysis was performed to analyse new recombinants and the percentage of virus reads demonstrating recombination events. FIG. 4.1 and FIG. 4.2 demonstrates significantly more virus recombinants being produced from HT29 cells for AdD species, whilst A549 cells produce more AdB and AdC recombinants than HCT116 cells. This data highlights the importance of incorporating multiple cell types as part of the virus diversification process, as different Ad species will have a preferred cell line and recombination rates appear to correlate with rates of virus genome amplification.

Example 5: Application of the Stepwise Diversification Method to Other Double Stranded DNA Viruses

[0187] Recombination is observed frequently within adenovirus species, but less commonly between serotypes and species with different infection kinetics and lower levels of homology (FIG. 5.1). FIG. 5.1 shows serotypes in Ad-B1 species to share >98% overall homology with other viruses in AdB-1, 80-90% homology with AdB2, 50-70% with AdC and AdD. Significant levels of homologous recombination is observed within species, including AdB1 and AdB2, but less so between species, indicating that sequence similarity >80% is advantageous for recombinant adenoviruses to be efficiently produced. Hence the process described above (Step-wise Diversification), co-infecting cells with at least two viruses from the same species in their preferred cell line to maximise recombination events prior to combining with more genetically distinct viruses and different species, creates more virus diversity than prior art methods.

[0188] Other double stranded DNA viruses are also reported to recombine via co-infection and homologous recombination events (Ricordel et al., “Vaccinia Virus Shuffling: deVV5, a Novel Chimeric Poxvirus with Improved Oncolytic Potency”, 2018, Cancers (Basel); 10(7):231). By combining such viruses in a similar stepwise fashion to adenoviruses, i.e. initially recombining at least two viruses from the same species in their preferred cell lines, prior to combining with viruses from other species, the number and diversity of recombinant viruses are increased. Similarly to adenoviruses, Herpes Simplex Viruses (HSV) or Vaccinia Viruses (VV) of the same species share large stretches of homologous DNA regions (FIGS. 5.2 and 5.3) and similar infection kinetics and tropisms.

[0189] Different HSV and VV species become more divergent at the DNA level (FIGS. 5.2 and 5.4), with less shared sequence homology and differing cellular tropisms or infection kinetics (Gerber et al., Differences in the Role of Glycoprotein C of HSV-1 and HSV-2 in Viral Binding May Contribute to Serotype Differences in Cell Tropism”, Virology, 214, 29-39 (1995); Herold et al., “Differences in the susceptibility of herpes simplex virus types 1 and 2 to modified heparin compounds suggest serotype differences in viral entry”, Journal of Virology, Vol. 70, No. 6, 1996; McClain et al., “Cell-Specific Kinetics and Efficiency of Herpes Simplex Virus Type 1 Entry Are Determined by Two Distinct Phases of Attachment”, Virology, Volume 198, Issue 2, 1 Feb. 1994, Pages 690-702; Gates et al., “Development of a High-Content Orthopoxvirus Infectivity and Neutralization Assays”, PLoS ONE 10(10): e0138836, 2015). Consequently, HSV and VV serotypes/strains from the same species are much more likely to recombine, and therefore a Stepwise Diversification process, co-infecting viruses from the same species on their preferred cell line prior to combining with other species, will increase the opportunity for recombination events and overall virus diversity, enabling more virus types to participate in recombination and enhancing the diversity of virus libraries.

[0190] This stepwise diversification process is applied to generate diverse libraries of HSV and VV. The resulting diverse HSV and VV libraries is used to identify therapeutic agents for cancer, vaccine or gene therapy applications.

[0191] Herpes Simplex Virus

[0192] DNA sequence similarity within the HSV1 species is high (FIG. 5.2), with significant stretches of DNA homology (FIG. 5.3 comparing HSV1 strain 17 to H12), indicating ample opportunity for recombination events to occur, similarly to those observed within adenovirus species in the Examples 1-4. FIGS. 5.2 and 5.3 demonstrate sequence similarity between distinct HSV species is significantly lower than within species, suggesting fewer opportunities for recombination to occur.

[0193] Stepwise Viral Diversification with HSV

[0194] Wldtype HSV strains from HSV-1 and HSV-2 species are obtained from the ATCC or other commercial suppliers, and single viral plaques are purified and propagated as described previously (e.g. by Grosche et al., Herpes Simplex Virus Type 1 Propagation, Titration and Single-step Growth Curves, Bio Protoc. 2019 Dec. 5; 9(23): e3441.), Each single isolate is verified by whole genome sequencing and correct alignment to the corresponding Genbank ID entry.

[0195] Stage 1—To Promote More Intra-Species Recombination Events

[0196] Viral libraries of HSV-1 strains (including KOS, E06, F, H129, McKrae, HF10 name HSV1 strains; FIG. 5.2) or HSV2 strains (including Seattle, HG52, 186, UL39, UL29) are passaged independently on immortalised cell lines (BHK (baby hamster kidney), VERO cells (African green monkey kidney), HeLa (human cervical cancer) or preferred cell line) in culture media with 10% FCS. Cells are seeded 24 hours prior to infection to achieve confluency of 70 to 90% on inoculation. Cells are inoculated with the HSV-1 strain library or the HSV-2 strain library independently at high MOI in RPM11640 with 20 mM HEPES for 1 hr at room temperature before replacing culture medium and incubating at 37° C. 5% CO.sub.2. Viruses are harvested upon signs of CPE. Following one freeze-thaw cycle, clarified supernatants from the first round of virus infection were added to a sub-confluent layer of cells in T75 flasks in culture media; again each HSV species is passaged independently. The volume of supernatant chosen is that which produced signs of CPE in the following round of infection between <2-5 days.

[0197] This cycle of infection on T75 flasks is repeated up to 5 times to introduce recombination events within the HSV species. The output of the final round of infection is deemed the output ‘diversified library’ from Stage 1.

[0198] Stage 2—To Provide Opportunity for Novel Intra-Species and Inter-Species Recombination Events

[0199] HSV-1 output diversified libraries from Stage 1 is pooled with wild-type HSV-1 strains, a library of HSV-2 strains, and/or the HSV-2 output diversified libraries from stage 1 and passaged together on BHK-21 cells, VERO cells, HELA cells and preferred cell lines. Cells are seeded 24 hours prior to infection to achieve confluency of 70 to 95% on inoculation. Cells are inoculated with the HSV-1 and HSV-2 pooled libraries at high MOI in RPM11640 with 20 mM HEPES for 1 hr at room temperature before replacing culture medium and incubating at 37° C. 5% CO.sub.2. Viruses are harvested upon CPE. Following one freeze-thaw cycle, clarified supernatants from the first round of virus infection are added to a sub-confluent layer of cells in T75 flasks in culture media. The volume of supernatant chosen is that which produces CPE (CPE) in the following round of infection between 2-5 days. This cycle of infection on T75 flasks is repeated up to 5 times to introduce recombination events within the HSV species.

[0200] Diversity of a virus library with respect to virus recombination is determined by high throughput next-generation sequencing (NGS) of the virus genomes in that library. Sequences are aligned against a reference set comprising sequences for each known WT virus. Reads mapping to multiple references are confirmed as chimeric using BLAST searches.

[0201] Vaccinia Virus

[0202] DNA sequence similarity within Vaccinia species is high (FIG. 5.4), with significant stretches of DNA homology (FIG. 5.5 comparing Vaccinia Western Reserve to Dryvax), indicating ample opportunity for recombination events to occur, similarly to those observed within adenovirus species in the Examples above. Sequence similarity between distinct Orthopoxvirus species is lower, suggesting less efficient recombination events occurring.

[0203] Stepwise Viral Diversification with Vaccinia Virus

[0204] Orthopoxvirus, including vaccinia strains, are obtained from the ATCC, and single viral plaques are purified and propagated as described (e.g. in Cotter et al., “Preparation of Cell Cultures and Vaccinia Virus Stocks”, Curr. Protoc. Microbiol. 2015 Nov. 3; 39: 14A.3.1-14A.3.18 3). Each isolate is verified by Whole Genome Sequencing and correct alignment to the corresponding Genbank ID entry.

[0205] Stage 1—To Promote More Intra-Species Recombination Events

[0206] Viral libraries of Vaccinia strains (FIG. 5.4) or strains from other Orthopoxvirus species (FIGS. 5.4 and 5.5.) are passaged independently on multiple immortalised cell lines (e.g. BS-C-1 cells, HeLa cells, LoVo cells or preferred cell line) in culture media with 10% FCS. Cells are inoculated with Vaccinia strain or other Orthopoxvirus libraries at high MOI in culture medium with 2.5% FBS for 2 hrs at 37° C. 5% CO.sub.2. Upon signs of CPE, virus is harvested by three freeze thaw cycles to lyse cells. Virus harvested from the first round of infection is sonicated on ice and used to inoculate HeLa cells in a second round of infection at an MOI that would produce signs of CPE in ˜3 days. The volume of supernatant chosen is that which produces CPE in the following round of infection in <3 days. This cycle of infection in culture flasks is repeated up to 5 times to introduce recombination events within the Vaccinia and other Orthopoxvirus species.

[0207] Stage 2—To Provide Opportunity for Novel Intra-Species and Inter-Species Recombination Events

[0208] Vaccinia output diversified libraries from Stage 1 is pooled with wild-type vaccinia strains, a library of other Orthopoxvirus strains, and/or the Orthopoxvirus output diversified libraries from stage 1 at equal genomes and passaged together on multiple cell lines.

[0209] Upon signs of CPE, virus is harvested by three freeze thaw cycles to lyse cells. Virus harvested from the first round of infection is sonicated on ice and used to inoculate cells in a second round of infection at an MOI that would produce CPE in ˜3 days. The volume of supernatant chosen is that which produces signs of CPE in the following round of infection between <3 days.

[0210] This cycle of infection in culture flasks is repeated up to 5 times to introduce recombination events within and between Vaccinia and other Orthopoxvirus species.

[0211] Diversity of a virus library with respect to virus recombination is determined by high throughput next-generation sequencing (NGS) of the virus genomes in that library. Sequences are aligned against a reference set comprising sequences for each known WT virus. Reads mapping to multiple references are confirmed as chimeric using BLAST searches.

SEQUENCE LISTING FREE TEXT

[0212] <210> 1 [0213] <223> AdB Forward Primer [0214] <210> 2 [0215] <223> AdB Reverse Primer [0216] <210> 3 [0217] 20<223> AdC Forward Primer [0218] <210> 4 [0219] <223> AdC Reverse Primer [0220] <210> 5 [0221] <223> AdD Forward Primer [0222] <210> 6 [0223] <223> AdD Reverse Primer