BRAIN ORGANOID MANUFACTURING METHOD

Abstract

The present invention provides a method of producing brain organoids.

Claims

1. A method of producing brain organoids, the method comprising: i) culturing somatic cells; ii) preparing a hydrogel-free 3D cell culture plate for producing induced pluripotent stem cells; iii) producing induced pluripotent stem cells by reprogramming the cultured somatic cells into the induced pluripotent stem cells in the hydrogel-free 3D cell culture plate; iv) isolating the induced pluripotent stem cells from the 3D cell culture plate of step iii); v) preparing a 3D cell culture plate which is not coated with a hydrogel for forming brain organoids; and vi) forming brain organoids by culturing the isolated induced pluripotent stem cells in a hydrogel-free 3D cell culture plate, wherein the 3D cell culture plate comprises: a well plate comprising a plurality of main wells and a plurality of sub wells formed at lower portions of the main wells to be injected with a cell culture solution and comprising recessed parts on a bottom surface thereof; and a connector for large-capacity and high-speed high content screening (HCS), which supports the well plate, and the connector for high content screening (HCS) comprises a base equipped with a fixing means so as to be attached to and detached from a lower end of the well plate and a cover positioned on an upper portion of the well plate to be coupled to the base, the main well has a step formed so as to be tapered at a predetermined site, and the step has an inclination angle (θ) ranging from 10 to 60° with respect to a wall of the main well.

2. The method of claim 1, wherein the forming of the brain organoids comprises, after making the induced pluripotent stem cells into an embryonic body, inducing neuroepithelial cells by adding a neuroepithelial induction medium to the aggregated induced pluripotent stem cells; differentiating the neuroepithelial cells into a neuroectodermal tissue by adding a neuroectodermal differentiation medium thereto; proliferating a neuroepithelial bud by adding a neuroepithelial bud induction medium to the neuroectodermal tissue; and forming a brain tissue by adding a brain tissue induction medium to the proliferated neuroepithelial bud.

3. The method of claim 1, wherein the hydrogel is an extracellular matrix-based hydrogel.

4. The method of claim 3, wherein the extracellular matrix-based hydrogel is Matrigel.

5. The method of claim 1, wherein the brain organoid has a size of 0.8 to 1.3 mm.

6. The method of claim 1, wherein the brain organoid has a size of 1 mm or less.

7. The method of claim 1, wherein the sub well has an inclined surface formed so as to taper toward the recessed part, the sub wells have an upper end diameter ranging from 3.0 to 4.5 mm, the recessed parts have an upper end diameter ranging from 0.45 to 1.5 mm, an inclined surface (θ.sub.2) between the sub well and the recessed part ranges from 40 to 50°, and a length ratio of the diameter of the sub wells to the diameter of the recessed parts ranges from 1:0.1 to 0.5.

8. The method of claim 1, wherein the main well has an individual volume ranging from 100 to 300 μl the recessed part has an individual volume ranging from 20 to 50 μl, and an individual volume ratio of the main well to the recessed part is 1:0.1 to 0.5 on average.

9. The method of claim 1, wherein the main well comprises a space part between the step and the sub well, the space part has a height (a.sub.h) ranging from 2.0 to 3.0 mm on average, the sub well has a height (b.sub.h) ranging from 1.0 to 2.0 mm on average, and a height ratio (a.sub.h:b.sub.h) of the space part to the sub well ranges from 1:0.3 to 1.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0094] FIG. 1A is a front view of a cell culture plate according to an exemplary embodiment of the present invention, and FIG. 1B is a cross-sectional view of the cell culture plate according to an exemplary embodiment of the present invention.

[0095] FIG. 2 is a view illustrating, in detail, a main well formed in the cell culture plate according to an exemplary embodiment of the present invention.

[0096] FIG. 3 is a view illustrating a well plate, a base, and a cover of the cell culture plate according to an exemplary embodiment of the present invention ((A) a cover, (B) a base, and (C) a fixing means of a microplate and a base).

[0097] FIG. 4A schematically illustrates processes of producing induced pluripotent stem cells according to an exemplary embodiment of the present invention and a comparative example, and FIG. 4B is a set of images illustrating the generation of induced pluripotent stem cells according to an exemplary embodiment of the present invention and a comparative example (In all of the drawings below FIG. 4, for convenience of description, the 3D cell culture plate of the present invention is not accurately displayed, but is displayed in a U shape for convenience.)

[0098] FIG. 5 is a set of images of an exemplary embodiment (3D iPSC) of the present invention and a comparative example (2D iPSC).

[0099] FIG. 6 is an alkaline phosphatase (AP) stained image of an exemplary embodiment (3D sph-iPSC) of the present invention and a comparative example (2D Matrigel).

[0100] FIG. 7A is an AP image (D4, D9, D15, D21) over time, FIG. 7B compares the number of colonies, FIG. 7C is an E-cadherin expression result, and FIG. 7D illustrates the process of forming a spheroid of iPSCs.

[0101] FIG. 8A is a result of showing the size distribution of spheroids (colonies) as a result of 3D culture in the related art and culture according to an exemplary embodiment of the present invention, and FIG. 8B is the expression result of a reprogramming factor (pluripotency marker).

[0102] FIG. 9 illustrates the expression results of pluripotency markers of iPSCs according to an exemplary embodiment of the present invention.

[0103] FIG. 10 schematically illustrates a step of mass proliferating induced pluripotent stem cell spheroids obtained in the step of reprogramming induced pluripotent stem cells and inducing cell differentiation.

[0104] FIG. 11 schematically illustrates the process of forming the brain organoid according to an exemplary embodiment of the present invention.

[0105] FIG. 12A is a set of brain organoid images over time, which are produced according to an exemplary embodiment of the present invention, FIG. 12B illustrates a set of images of brain organoids cultured at a uniform size while being mass-cultured in one cell culture plate according to an exemplary embodiment of the present invention, and FIG. 12C is a graph illustrating changes in size of a brain organoid over time.

[0106] FIG. 13 is a set of images of brain organoids formed in the absence of Matrigel according to an exemplary embodiment of the present invention.

[0107] FIG. 14A is a stained image of brain organoids produced by the method of Non-Patent Document 3, and FIG. 14B is a stained image of brain organoids formed by an exemplary embodiment of the present invention.

[0108] FIG. 15A illustrates the results of brain organoid immunostaining analysis, and FIG. 15B illustrates the results of brain organoid gene expression analysis.

MODES OF THE INVENTION

[0109] Since the present invention may be modified into various forms and include various exemplary embodiments, specific exemplary embodiments will be illustrated in the drawings and described in detail in the Detailed Description. However, the description is not intended to limit the present invention to the specific exemplary embodiments, and it is to be understood that all the changes, equivalents, and substitutions belonging to the spirit and technical scope of the present invention are included in the present invention. When it is determined that the detailed description of the related publicly known art in describing the present invention may obscure the gist of the present invention, the detailed description thereof will be omitted.

EXAMPLES

Example 1

Experimental Methods

[0110] 1-1: Culture of Fibroblasts and Production of Induced Pluripotent Stem Cells

[0111] The German federal authorities/RKI: AZ 1710-79-1-4-41 E01 (F134), which is a human fibroblast line, was cultured in a DMEM containing 10% FBS (fetal bovine serum, Invitrogen, USA) and 1 mM L-glutamine (Invitrogen, USA) in a 35 mm or 100 mm Petri dish. The cultured fibroblasts were reprogrammed by being transfected (Neon™ transfection system) with an episomal iPSC reprogramming vector (EP5TM kit: Cat. No. A16960. Invitrogen, Carlsbad, Calif., USA) by electroporation. The electroporation was performed under the conditions of 1,650 V, 10 ms, and 3 pulses.

[0112] As illustrated in FIG. 4A, the transfected fibroblasts were inoculated in a 3D cell culture plate of the present invention (without Matrigel, the Example), a 2D 12-well plate (coated with Matrigel, Comparative Example 1) and a commercialized product Addgene (Comparative Example 2, coated with Matrigel, not illustrated in FIG. 4A), and cultured in an N2B27 medium (containing bFGF). After the fibroblasts were cultured for 15 days, the medium was replaced with an Essential 8™ medium. After 15 days, the number of colonies in the Example and the Comparative Examples were confirmed by plating 3D iPSCs of the Example (3D cell culture plate) on a 12-well plate which is a 2D plate.

[0113] 1-2: Reprogramming Efficiency Analysis of Fibroblasts

[0114] According to the alkaline phosphatase staining kit manual (System Biosciences, USA), reprogrammed cells were washed twice with PBS, fixed with 4% paraformaldehyde, then stained with a Blue-color AP solution, washed twice with PBS, and then it was observed under an optical microscope whether the colonies were stained. The number of stained colonies was counted and quantified.

[0115] Images of the cultured cells in the Example and the Comparative Examples were captured, and the sizes of cell spheres were compared. Spheroids were subjected to imaging by an automated plate device, and in this case, the device was allowed to perform imaging by automatically focusing. Image size analysis was performed using a macro program of a program called ImageJ (related to FIGS. 5, 6 and 7).

[0116] 1-3: Optimization of 3D Culture Method of Induced Pluripotent Stem Cells

[0117] Images of the 3D induced pluripotent stem cells cultured in the Example and the Comparative Examples were captured, and accordingly, the sizes of the cell spheres were compared and measured (FIG. 8A). An external inspection company (Cell Bio CEFO, Korea) was commissioned to test the results of the images, and this test was performed as a blind test.

[0118] 1-4: Immunostaining

[0119] Reprogrammed cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. After the fixed cells were reacted with PBS containing 1% BSA and 0.5% Triton X-100 at room temperature for 1 hour, the cells were treated with each of primary antibodies Oct4 (1:100, Santa Cruz, Calif., USA), Sox2 (1:100, Cell Signaling, Danvers, Mass., USA), Nanog (1:200, Cosmo Bio, Koto-Ku, Japan), and E-cadherin (1:200, Abcam), and reacted with FITC-conjugated goat anti-rabbit IgG or anti-mouse IgG (1:100, Invitrogen, Carlsbad, Calif.) as a secondary antibody. Fluorescent images were analyzed under a fluorescence microscope (Olympus, Shinjuku, Tokyo, Japan). DAPI was used as a nuclear staining solution.

[0120] 1-5: qPCR

[0121] Total RNA was extracted from fibroblasts and reprogrammed cells using an RNA minikit (Qiagen, Inc.), and then converted to cDNA using the Accupower RT mix reagent (Bioneer Corp., Seoul, Korea). qPCR was performed using Real-time PCR FastStart Essential DNA Green Master Mix (Roche, Indianapolis, Ind., USA). The primer sequences used in the present invention are as follows in Table 1.

TABLE-US-00001 TABLE 1 Genes Primer sequences (5′-3′) hCOL1A1 forward ATGACTATGAGTATGGGGAAGCA reverse TGGGTCCCTCTGTTACACTTT hOCT4 forward AATTTGTTCCTGCAGTGCCC reverse AGACCCAGCAGCCTCAAAAT hNANOG forward GGATCCAGCTTGTCCCCAAA reverse TGCGACACTCTTCTCTGCAG hSOX2 forward CGGAAAACCAAGACGCTCAT reverse GTTCATGTGCGCGTAACTGT hLIN28 forward TTCGGCTTCCTGTCCATGAC reverse CCGCCTCTCACTCCCAATAC

[0122] 1-6: Production and Analysis of Brain Organoids

[0123] 3D brain organoids were produced using reprogrammed iPSC cells. Brain organoids were cultured by initially seeding 9000 iPSC cells per well on a cell culture plate according to the present invention having a diameter of 3 mm and adjusting the composition of the culture solution. The composition of the culture solution in each culturing step followed the paper of M. A. Lancaster (Non-Patent Document 1), but the brain organoids were cultured without using Matrigel (see FIG. 11).

[0124] The characteristics of the produced brain organoids were analyzed by the immunostaining method and gene expression analysis. Organoids of 1 mm or more were fixed using 4% PFA for immunostaining, and then sufficiently immersed in 15% and 30% sucrose. And then, a block was manufactured by transferring the brain organoids to an O.C.T compound and then quick-freezing the O.C.T compound. Organoids were cut to a thickness of about 10 to 15 um using a cryotome, and then stained using an existing 2D immunostaining method. (FOXG1 (1:500, Abcam), MAP2 (1:500, Abcam)).

[0125] RNA was extracted from cultured brain organoids using an RNA extraction kit (RNEasy plus kit, Qiagen), and cDNA was synthesized (High-capacity RNA-to-cDNA kit, Stepone plus). A gene expression level of the corresponding gene was analyzed by RT-PCR using the primers designed as shown in Table 2.

TABLE-US-00002 TABLE 2 Genes Primer sequences (5′-3′) hOCT4 Forward GCCACACGTAGGTTCTTGAA Reverse ATCGGCCTGTGTATATCCCA hTBR1 Forward CCAATCTCTTCTCCCAGGGA Reverse CTAGAACCTGAACACTCGCC hCtip2 Forward CCACTTGGCATTAGAGGGTC Reverse TTGCAGGGCTGAGTTACAAG

Example 2

Confirmation of Stem Cell Reprogramming Efficiency

[0126] Referring to FIG. 4B, it can be seen that in the case of 2D culture, a small amount of colonies begin to be formed only at D15. After iPSC reprogramming was induced up to D15, 3D iPSCs were plated on a 2D plate, and the number of colonies in Comparative Example 1 and Example 1 was compared, and as a result, the difference in the number of colonies formed was large. It can be seen that the iPSC reprogramming yield of the Example is high because the cells that are well differentiated into iPSCs form a colony. Referring to FIGS. 5 and 7B, it can be seen that the difference in the number of colonies is very large between the 2D culture (Comparative Example 1) and the 3D culture (the Example). Referring to FIG. 6, it can be seen that as a result of alkaline phosphatase (AP) staining, the reprogramming efficiency is very high in 3D iPSC spheroids (the Example, 3D sph-iPCSs). Further, referring to FIGS. 6 and 7A, when 2D Matrigel (Comparative Example 1) and 3D iPSC spheroids (the Example, 3D sph-iPCSs) are compared with each other, the images appear uniform and clear, showing that the 3D cell culture plate of the present invention is capable of large-scale image analysis.

[0127] Referring to FIG. 7C, it can be seen that the reprogramming efficiency in the 3D cell culture plate is very good. In addition, referring to FIG. 7D, it can be seen that since the present invention does not use Matrigel, a large number of single cells reprogrammed into iPCSs gather to form a spheroid, which is a spherical cell aggregate, and these spheroids can be easily separated from the 3D cell culture plate and re-plated. That is, reprogramming efficiency is very high.

[0128] FIG. 8 compares the 3D culture in the related art of Comparative Example 2 with the 3D culture of the Example of the present invention (SpheroidFilm in FIG. 8B). The 3D culture in the related art is not uniform in size and has a relatively low expression level of oct4. However, the present invention is very uniform in size (99.45%) and has a very high reprogramming factor expression level. That is, the present invention is effective in stem cell culture even when compared to the 3D culture in the related art, and can increase the efficiency of reprogramming somatic cells into induced pluripotent stem cells. Furthermore, a uniform size means that standardized induced pluripotent stem cells and stem cells can be three-dimensionally mass-produced in the form of a spheroid.

Example 3

Analysis of Characteristics of Stem Cells

[0129] Referring to FIG. 9, it can be seen that the iPSCs produced according to the present invention have very high expression of pluripotency markers.

Example 4

Production and Characteristic Analysis of Brain Organoids 4-1: Production of Brain Organoids

[0130] Referring to FIG. 10, it can be seen that when the iPSCs produced by the present invention are subcultured, the iPSCs can be mass-proliferated. FIG. 10 also shows that the iPSCs thus produced can be used for the production of brain organoids.

[0131] Referring to FIG. 11, the method of producing brain organoids in each step is described. The method is divided into a step of making stem cells into an embryonic body, a step of inducing neuroectodermal cells, a step of differentiating the neuroectodermal cells into a neuroectodermal tissue, a step of enhancing a neuroectodermal bud, and a final step of differentiating into brain organoids from the neuroectodermal bud. After the process of the brain organoids produced in this manner, the brain organoids are subjected to a process of being cultured in a differentiation medium.

[0132] 4-2: Characteristic Analysis of Brain Organoids

[0133] Referring to FIG. 12, it can be seen that the brain organoid produced by the present invention is produced while having a uniform size. FIG. 12B is a photograph supporting the high-speed, large-capacity imaging of the cell culture plate of the present invention. The organoid production method according to the present invention is economical because Matrigel is not used, and has an advantage of not taking up a large space because the organoid is a mini-brain organoid.

[0134] FIG. 13 is a photograph of a brain organoid culture, and it can be confirmed that various organs are randomly mixed and thus do not appear. Within 2 days after the seeding of initial cells, it was confirmed that a uniformly sized embryonic body having a diameter of about 500 mm was formed, and that a transparent neuroepithelium was formed on the outside of the organoid as nerve differentiation progressed (Day 12 of culture). As a result of confirming the cross section of the brain organoid cultured for about 40 days by H&E staining, neural rosette structures could be found on the outside thereof.

[0135] Referring to FIG. 14A, it can be seen that a cortical plate and a neuron position are different, and that the neuron grows randomly even within one organoid. However, referring to FIG. 14B, it can be confirmed that the cortical plate and the neuron position are uniform, and that there is a uniform ventricular zone in one organoid and multiple organoids, respectively.

[0136] FIG. 15 illustrates the results of analyzing brain organoids for 40 days in the absence of Matrigel according to an exemplary embodiment of the present invention. As a result of immunostaining analysis (A), it was confirmed that Foxg1 was expressed in Forebrain. As a result of gene expression analysis (B), it was confirmed that the expression of Oct4, which is a pluripotency marker of iPSCs, decreases with differentiation, and that the expression of TBR1 and Ctip2, which are neural markers expressed in a deep layer, increases.

[0137] Although a specific part of the present invention has been described in detail, it will be obvious to those skilled in the art that such a specific description is just a preferred embodiment and the scope of the present invention is not limited thereby. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

DESCRIPTION OF REFERENCE NUMERALS AND SYMBOLS

[0138] 100: Well plate

[0139] 101: Step

[0140] 110: Main well

[0141] 120: Sub well

[0142] 121: Recessed part

[0143] 130: Space part

[0144] 140: Concave part

[0145] 200: Connector for large-capacity and high-speed HCS

[0146] 210: Base

[0147] 220: Cover

[0148] 240: Convex part