APPLICATION OF CANNABIDIOL IN TREATMENT OF CORONAVIRUS INFECTIONS

Abstract

The present application relates to use of cannabidiol in the preparation of a drug for treating coronavirus infections. The present invention specifically relates to cannabidiol, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or use of a pharmaceutical composition comprising any one or more of the above components in the preparation of a drug for preventing and/or treating diseases or infections caused by a coronavirus.

Claims

1.-10. (canceled)

11. A method for the prevention and/or treatment of a disease or infection caused by a coronavirus, comprising a step of administering to a subject in need thereof an effective amount of the compound of Formula I, or geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components, ##STR00013##

12. The method according to claim 11, wherein the disease or infection is a respiratory disease or infection.

13. The method according to claim 11, wherein the disease or infection is COVID-19.

14. A method for inhibiting the replication and/or reproduction of a coronavirus in a cell, comprising a step of contacting the cell with an effective amount of the compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above-mentioned components, ##STR00014##

15. The method according to claim 14, wherein the cell is a mammalian cell.

16. The method according to claim 11, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

17. The method according to of claim 11, wherein the compound of Formula I, or geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof in the pharmaceutical composition is the only pharmaceutically active ingredient.

18. The method according to claim 11, wherein the coronavirus is selected from the group consisting of HCoV-229E, HCoV-0C43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV and SARS-CoV-2.

19. The method according to claim 11, wherein the coronavirus is SARS-CoV-2.

20. The method according to claim 11, wherein, the disease or infection is a simple infection, pneumonia, acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock or severe acute respiratory syndrome (SARS).

21. The method according to claim 20, wherein, the simple infection is fever, cough or sore throat.

22. The method according to claim 15, wherein, the mammal is selected from the group consisting of bovine, equine, ovine, porcine, canine, feline, rodent and primate.

23. The method according to claim 15, wherein, the mammal is a human, cat, pig or dog.

24. The method according to claim 11, wherein, the pharmaceutical composition is a solid preparation or a liquid preparation.

25. The method according to claim 11, wherein, the pharmaceutical composition is a tablet, an injection or a spray.

26. The method according to claim 11, wherein, the pharmaceutical composition further comprises an additional antiviral active ingredient.

27. The method according to claim 26, wherein, the compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or the pharmaceutical composition is administered in combination with the additional antiviral active ingredient by simultaneous, separate or sequential administration.

28. The method according to claim 26, wherein, the additional antiviral active ingredient is one or more selected from the group consisting of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet sodium, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir dipivoxil, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin and interferon.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The description of the drawings herein is provided for further explanation of the present invention, and constitutes part of the present application. The exemplary embodiments and description are meant to explain the present invention, and should not be understood as any inappropriate limitation to the present invention. In the drawings:

[0055] FIG. 1 shows the effect of cannabidiol on viral nucleic acid load on SARS-CoV-2-infected vero E6 cells; cannabidiol was able to inhibit viral RNA load on cells 48 h after the cells were infected with SARS-CoV-2, and the inhibitory activity was dose-dependent. Wherein, the left ordinate represents the percentage inhibition rate calculated based on the number of copies of viral RNA in the sample (corresponding to the dots and fitting line thereof in the FIGURE), the right ordinate represents the percentage toxicity calculated based on cell viability (corresponding to the squares and fitting line thereof in the FIGURE), and the abscissa represents the drug concentration.

SPECIFIC MODELS FOR CARRYING OUT THE INVENTION

[0056] The technic solutions of the embodiments of the present invention is further illustrated clearly and completely in the following examples and the drawings. Obviously, they are merely part, and not all of the examples. At least one of the following examples are illustrative and should not be understood as any limitation to the present invention, as well as its application and use. And other embodiments made by a person skilled in the art without creative work in light of the present invention all fall within the protection scope of the present invention.

Example 1: Experiment of Cannabidiol in Reduction of Viral Nucleic Acid Load of Cells Infected by SARS-CoV-2

(1) Drug Treatment of Virus-Infected Cells

[0057] Vero E6 cells (purchased from ATCC, Catalog No. 1586) were placed into a 24-well plate and incubated for 24 hours, then virus infection was carried out, specifically, SARS-CoV-2 (2019-nCoV) virus (nCoV-2019BetaCoV/Wuhan/WIV04/2019 strain, provided by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted with 2% cell maintenance solution (formulation: FBS (purchased from Gibco, Catalog No.: 16000044) was added to MEM (purchased from Gibco, Article No: 10370021) by a volume ratio of 2%, thereby obtaining the 2% cell maintenance solution) to corresponding concentration, and then added to the 24-well plate so that each well contained a viral load of 100TCID.sub.50. Next, cannabidiol (purchased from Selleck Chemicals, Article No.: S7975) was diluted with 2% cell maintenance solution to the corresponding concentrations and added to corresponding wells, so that the final drug concentrations were 100 μM, 33 μM, 11 μM, 3.7 μM, 1.23 μM, 0.41 μM, 0.14 μM, respectively, then the plate was put in 37° C., 5% CO.sub.2 incubator and continuously cultured for 48 h, and the cell vehicle control group was added with only 2% cell maintenance solution without any test drug.

[0058] (2) RNA Extraction

[0059] The RNA extraction kit was purchased from Qiagen, Article No.: 74106. The consumptive materials (spin column, RNase-free 2 ml collection tube, etc.) and reagents (RLT, RW1, RPE, RNase-free water, etc.) involved in the following RNA extraction steps were all parts of the kit. The following extraction steps were all recommended by the kit instructions.

[0060] 1) 100 μL of the supernatant was taken from the test plate, added to a nuclease-free EP tube, then added with 350 μL of Buffer RLT, mixed by a transfer liquid gun to make it fully lysed, and centrifuged to take the supernatant;

[0061] 2) the supernatant obtained in step 1) was added with an equal volume of 70% ethanol and mixed well;

[0062] 3) the mixed solution obtained in step 2) above was transferred to a RNase-free spin column, centrifuged at 12000 rpm for 15 s, and the waste liquid was discarded;

[0063] 4) 700 μL of Buffer RW1 was added to the spin column, then centrifugation was carried out at 12000 rpm for 15 s to clean the spin column, and the waste liquid was discarded;

[0064] 5) 500 μL of Buffer RPE was added to the spin column, then centrifugation was carried out at 12000 rpm for 15 s to clean the spin column, and the waste liquid was discarded;

[0065] 6) 500 μL of Buffer RPE was added to the spin column, then centrifugation was carried out at 12000 rpm for 2 min to clean the spin column, and the waste liquid was discarded;

[0066] 7) the spin column was placed in a new RNase-free 2 ml collection tube, and centrifugation was carried out at 12000 rpm for 1 min to dry the spin column, and then the entire spin column was transferred to the 1.5 ml collection tube of step 8);

[0067] 8) the spin column dried in step 7) was placed in a new 1.5 ml collection tube, added with 30 μl of RNase-free water, and centrifuged at 12000 rpm for 2 min, the obtained eluent contained the corresponding RNA, and was added with RNase inhibitor (purchased from NEB, Article No.: M0314L), and detected with Nano Drop (purchased from Thermo scientific, Nano Drop One) to determine each RNA concentration.

[0068] (3) RNA Reverse Transcription

[0069] In the experiment, the reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, Catalog No. RR047Q) produced by TaKaRa Company was used for RNA reverse transcription. The steps were as follows.

[0070] 1) gDNA removal: RNA samples from each experimental group were collected, and 1 μg thereof was taken and subjected to reverse transcription. First, 2 μl of 5×gDNA Eraser Buffer was added to the RNA sample of each experimental group, the reaction system was supplemented with RNase Free water to 10 μl, mixed well, and subjected to 42° C. water bath for 2 min to remove the gDNA that might exist in the sample;

[0071] 2) Reverse transcription: the sample obtained in 1) was added with appropriate amounts of enzyme, primer Mix and reaction buffer, supplemented with RNase Free water to an volume of 20 μl, reacted under 37° C. water bath for 15 min, then put in 85° C. water bath for 5 sec, thereby obtaining cDNA via transcription.

[0072] (4) Real-Time PCR

[0073] Fluorescence quantitative PCR was used to detect the copy number per ml of the original virus solution.

[0074] The reaction system was mixed using TB Green Premix (Takara, Cat #RR820A), and the amplification reaction and reading were carried out with StepOne Plus Real-time PCR instrument (brand: ABI). The copy number contained in per ml of the original virus solution was calculated. The steps were as follows:

[0075] 1) Establishment of standards: the plasmid pMT-RBD (the plasmid was provided by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to 5×10.sup.8 copies/μL, 5×10.sup.7 copies/μL, 5×10.sup.6 copies/μL, 5×10.sup.5 copies/μL, 5×10.sup.4 copies/μL, 5×10.sup.3 copies/μL, 5×10.sup.2 copies/μL. 2 μL standard or cDNA template was taken for qPCR reaction.

[0076] 2) The sequences of primers used in the experiment were as follows (all indicated in 5′-3′ direction):

TABLE-US-00001 RBD-qF: CAATGGTTTAACAGGCACAGG RBD-qR: CTCAAGTGTCTGTGGATCACG

[0077] 3) The reaction procedure was as follows:

[0078] Pre-denaturation: 95° C. for 5 minutes;

[0079] Cycle parameters: 95° C. for 15 seconds, 54° C. for 15 seconds, 72° C. for 30 seconds, for a total of 40 cycles.

[0080] (5) Cytotoxicity Test of Drug

[0081] The detection of the drug cytotoxicity was performed using CCK-8 kit (Beoytime). Specific steps were as follows:

[0082] 1) 1×10.sup.4 Vero E6 (ATCC) cells were placed in a 96-well plate and incubated at 37° C. for 8 hours.

[0083] 2) The drug was diluted with DMSO to an appropriate concentration of mother liquor, and then diluted with MEM medium (purchased from Gibco, Catalog No. 10370021) containing 2% FBS (purchased from Gibco, Catalog No. 16000044) to the same concentration as that for the drug treatment. The original medium in the 96-well plate was discarded, 100 μL of drug-containing MEM medium was added to the cells, and three replicate wells were prepared for each concentration. Negative control (vehicle group, DMSO and medium were added to the cell wells, without adding drug) and blank control (DMSO and medium were added to the wells, without cells) were set up. After the drug was added, the cells were cultured at 37° C. for 48 hours.

[0084] 3) 20 μL of CCK-8 solution (Beoytime) was added to the well to be tested, mixed gently, without generating bubbles, and continuously incubated at 37° C. for 2 hours. OD.sub.450 was read on a microplate reader (purchased from Molecular Devices, Model: SpectraMax M5), and cell viability was calculated:

Cell activity (%)=(A.sub.(drug treatment group)−A.sub.(blank control))/(A.sub.(vehicle control)−A.sub.(blank control))=100%

[0085] wherein A was the reading of the microplate reader.

[0086] (6) Experimental Results

[0087] The results of the virus proliferation inhibition experiment showed that the test compound at concentrations of 10 μM, 3.3 μM, 1.1 μM and 0.37 μM could effectively inhibit the replication of the SARS-CoV-2 virus genome in the infected supernatant (Table 1 and FIG. 1).

TABLE-US-00002 TABLE 1 Antiviral experiments of test compound (cannabidiol) Concentration Viral genome copy number (μM) (MOI = 0.05) 10 532013 ± 16451 3.33 668555500 ± 83251338 1.11  877127896 ± 122398434 0.37 1224296104 ± 183149682 0.12 1860569042 ± 365350110 0.04 1853011000 ± 279114748 Vehicle 2215912896 ± 388319129

[0088] The cytotoxicity results showed that the treatment by the test compound (cannabidiol) did not change the cell viability at concentrations of 1.56 μM and 0.78 μM, that was, the test compound had no toxic effect on the cells at all concentrations (Table 2 and FIG. 1).

TABLE-US-00003 TABLE 2 Cytotoxicity assay of test compound of (cannabidiol) Concentration Cell viability (μM) (%) 100  8.87 ± 3.59 50  22.85 ± 18.47 25 38.39 ± 5.70 12.5 50.01 ± 8.40 6.25 60.07 ± 6.01 3.13 58.45 ± 5.30 1.56  74.22 ± 13.42 0.78 73.45 ± 7.48 Vehicle .sup. 100 ± 3.21

[0089] In addition to those described herein, according to the above descriptions, various modifications of the invention will be obvious for a person skilled in the art. Such modifications also fall within the scope of the appended claims. Each of the references (including all patents, patent applications, journal articles, books, and any other publications) cited in this application is hereby incorporated by reference in its entirety.