REDUCTION OF FATTY ACID RETINYL ESTER FORMATION

Abstract

The present invention is related to a novel process for production of retinyl acetate in a host cell, particularly oleaginous yeast such as e.g. Yarrowia, growing on triglyceride oils, such as e.g. vegetable oil, wherein the host cell exhibits modified lipase activity in such a way that conversion of retinol into fatty acid retinyl esters (FAREs) is reduced or abolished. Such process is especially useful in a biotechnological process for production of vitamin A.

Claims

1. A retinoid-producing host cell capable of retinyl acetate formation, particularly retinyl acetate-producing host cell, such as a fungal host cell, preferably oleaginous yeast cell such as e.g. Yarrowia, comprising: (1) one or more genetic modification(s), such as reduction or abolishment, preferably abolishment, of endogenous genes encoding enzymes involved in pre-digestion of vegetable oil into glycerol and fatty acids, preferably endogenous enzymes belonging to EC class 3.1.1.-, more preferably genes encoding endogenous enzymes with esterase or lipase activity; and (2) addition of a heterologous enzyme with lipase activity, preferably enzymes belonging to EC class 3.1.1.-, particularly enzymes with fungal lipase activity, more preferably lipase activity from Candida species, most preferably Candida rugosa lipase activity.

2. The host cell according to claim 1, wherein the expression of endogenous genes is reduced or abolished, preferably abolished, said genes encoding enzymes with activities corresponding to enzyme activities selected from the group consisting of Yarrowia LIP2, LIP3, LIP8, LIP4, and combinations thereof.

3. The host cell according to claim 1, comprising a modification in a polypeptide obtainable from Yarrowia lipolytica with at least about 50%, such as 60, 70, 80, 90, 95, 98, or 100% identity to a polypeptide selected from the group consisting of SEQ ID NO:1, 3, 5, 7, and combinations thereof.

4. The host cell according to claim 1, wherein the endogenous enzyme corresponding to Yarrowia LIP8 is reduced or abolished, preferably abolished.

5. The host cell according to claim 1, wherein the endogenous enzymes corresponding to Yarrowia LIP2, LIP3 and LIP8 is reduced or abolished, preferably abolished.

6. The host cell according to claim 1, comprising addition of a heterologous enzyme with at least about 75% identity, such as 80, 85, 90, 95, 98 or 100% identity to SEQ ID NO:9.

7. The host cell according to claim 1, comprising addition of heterologous Candida rugosa lipase 1 (CrLIP1).

8. The host cell according to claim 1, furthermore comprising one or more amino acid substitution(s) in a sequence with at least about 75%, such as 80, 85, 90, 95, 98 or 100% identity to SEQ ID NO:9, wherein the one or more amino acid substitution(s) are located at position(s) corresponding to amino acid residue(s) selected from 296, 344, 345, 448 and combinations thereof in the polypeptide according to SEQ ID NO:9 and wherein the substitute amino acid corresponding to position 296 being alanine, valine, isoleucine, serine, asparagine or glutamine, and/or wherein the substitute amino acid corresponding to position 344 being isoleucine or tryptophan, and/or wherein the substitute amino acid corresponding to position 345 being leucine, and/or wherein the substitute amino acid corresponding to position 448 being histidine, alanine or tryptophan.

9. A process for production of retinyl acetate comprising growing the host cell according to claim 1 on triglycerides, preferably vegetable oil, wherein the formation of FARE is reduced by at least about 50 to 80% compared to a process using the respective non-modified host cell.

10. A process for the reduction of conversion of retinol into FARE comprising fermentation of a host cell according to claim 1, wherein the host cell is grown on triglycerides, preferably vegetable oil, preferably wherein FARE formation is reduced by at least about 50 to 80% compared to fermentation of the respective non-modified host cell.

Description

EXAMPLES

Example 1: General Methods and Strains

[0067] All basic molecular biology and DNA manipulation procedures described herein are generally performed according to Sambrook et al. (eds.), Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: New York (1989) or Ausubel et al. (eds). Current Protocols in Molecular Biology. Wiley: New York (1998).

[0068] Shake plate assay. Typically, 200 μl of 0.25% yeast extract, 0.5% peptone (0.25×YP) is inoculated with 10 μl of freshly grown Yarrowia and overlaid with 200 μl of mineral oil (Drakeol 5, Penreco, Karns City, Pa., USA). Lipases resuspended in PBS were added to the growth media. The carbon source was 2% corn oil in mineral oil. Transformants were purified by steaking to single colonies, grown in 24 well plates in a shaking incubator (Infors Multitron, 30° C., 800 RPM) in media described above for 4 days at 30° C. The second phase (Drakeol 5) fraction was removed from the shake plate wells and analyzed by UPLC on a normal phase column and/or C4 HPLC, with a photo-diode array detector (see details below).

[0069] DNA transformation. Strains were transformed by overnight growth on YPD plate media; 50 μl of cells were scraped from a plate and transformed by incubation in 500 μl with 1 μg transforming DNA, typically linear DNA for integrative transformation, 40% PEG 3550 MW, 100 mM lithium acetate, 50 mM Dithiothreitol, 5 mM Tris-Cl pH 8.0, 0.5 mM EDTA for 30 minutes at 40° C. and plated directly to selective media or in the case of dominant antibiotic marker selection the cells were out grown on YPD liquid media for 4 hours at 30° C. before plating on the selective media. URA3 marker recycling was performed using 5-fluoroorotic acid (FOA). Episomal hygromycin resistance marker (Hyg) plasmids were cured by passage on non-selective media, with identification of Hyg-sensitive colonies by replica plating colonies from non-selective media to hygromycin containing media (100 μg/mL). Selection of the nourseothricin-resistance marker (Nat) was performed on YPD media containing nourseothricin (100 μg/mL).

[0070] DNA molecular biology. Plasmids MB9523 containing expression systems for DrBCO, LmATF-S480Q_G409A_V407I_H69A_I484 L, and FfRDH (SEQ ID NO:14) and MB9721 (SEQ ID NO:15) for the expression of a chimeric YlLIP2pre-CrLIP1 protein (SEQ ID NO:16) were synthesized at Genscript (Piscataway, N.J., USA). Both plasmids MB9523 and MB9721 contain the ‘URA3’ for marker selection in Yarrowia lipolytica transformations. For clean gene insertion by random nonhomologous end joining of the gene and marker HindIII/Xbal (MB9721) or Sfil (MB9523), plasmid fragments of interest were purified by gel electrophoresis and Qiagen gel purification column. Clones were verified by sequencing. Typically, genes are synthesized by a synthetic biology at GenScript (Piscataway, N.J.). Plasmids MB9287 and MB9953, containing a Cas9, and guide RNA expression systems to target LIP2, LIP3, and LIP8 in the case of MB9287, and LIP4 in the case of MB9953, were synthesized at Genscript (Piscataway, N.J., USA).

[0071] Plasmid list. Plasmid, strains, nucleotide and amino acid sequences that were used are listed in Table 1, 2, 3 and the sequence listing. In general, all non-modified sequences referred to herein are the same as the accession sequence in the database for reference strain CLIB122 (Dujon B, et al, Nature. 2004 Jul. 1; 430(6995):35-44).

TABLE-US-00001 TABLE 1 list of plasmids used for construction of the strains for overexpression or deletion of the respective genes indicated as “insert”. “LmATF1-mut” refers to Lachancea mirantina (LmATF1; SEQ ID NO: 13 in WO2019/058001) carrying aa substitutions S480Q_G409A_V407I_H69A_I484L. “DrBCO” refers to BCO originated from Danio rerio (see SEQ ID NO: 18 in WO2020/141168); “FfRDH” refers to RDH originated from Fusarium fujikuroi (see SEQ ID NO: 22 in WO2020/141168). For more explanation, see text. Plasmid Insert Marker SEQ ID NO: MB7452 Cas9 Nat 14 MB9523 DrBCO; LmATF1-mut; FfRDH URA3 15 MB9721 YlLIP2pre-CrLIP1 chimera URA3 16 MB9287 Cas9; LIP2, LIP3 and LIP8 Hyg 17 targeting guide RNAs MB9953 Cas9; LIP4 targeting guide RNA Hyg 18

TABLE-US-00002 TABLE 2 list of Yarrowia lipolytica strains used. Construction of ML17544 is described in Table 2 of WO2020/141168. For more details, see text. Strain Description ML18812 ML17544 transformed with MB9523 ML18743 ML18812 with MB9287 lip8, lip2, lip3 deletion ML18743-lip4 ML18743 with MB9953 lip4 deletion ML18756 ML18743 cured of URA3 by FOA ML18870 ML18756 transformed with MB9721

TABLE-US-00003 TABLE 3 DNA sequences targeted using Cas9 CRISPR for mutation of lipase genes. “Lip gene” means the respective lipase gene from Yarrowia lipolytica. “CRISPR targeting sequence” is the seed sequence used for Cas9 CRISPR targeting. The respective guide RNA expression plasmid for LIP8, LIP2 and LIP3 constructs is MB9287, for LIP4 it is MB9953. For more details, see text. CRISPR targeting SEQ ID Lip gene sequence NO: LIP8 ACAGCAGGCTGAACGAGGAT 19 LIP2 TGGAGGCATGATCAACAGCG 20 LIP3 TCACTCCTCAGCCTCCCAAG 21 LIP4 GGTGGCCTGGATTCGAGTGG 22 LIP4 TTACACCCACTCTATCGGAG 23

[0072] Retinoid quantification. Analysis of retinoids were carried out with a C4 reverse phase retinoid method (see below) and C18 as described elsewhere (WO2020/141168). The addition of all added intermediates gives the total amount of retinoids.

[0073] C4 reverse phase chromatography. For exact determination of discrete retinoids the long run reverse phase system was used. We separated analytes at 230 nm and 325 nm through the Agilent 1290 instrument with YMC Pro C4, 150×3.0 mm 3 μm column (YMC America, Allentown Pa.) stationary phase, and a 5 μl injection loop volume and column and sample tray controlled at 23° C. with gradients described in Table 4B. Analytes were detected at 230 nm and 325 nm and the peaks identity verified with LCMS. The analytes separated as discrete peaks that were assigned according to Table 4A.

TABLE-US-00004 TABLE 4A list of analytes using C4-reverse phase method. The addition of all added intermediates gives the total amount retinoids. “RT” means retention time. For more details, see text. Intermediates RT [min] λ max [nm] trans-retinol 20.21 325 cis-retinol 20.32 325 dihydro-retinol 20.75 290 trans-retinal 20.89 380 cis-retinal 21.02 380 trans-retinyl-acetate 22.15 325 cis-retinyl-acetate 22.35 325 dihydro-retinyl acetate 22.60 290 retinyl esters 26.30 325

TABLE-US-00005 TABLE 4B UPLC Method Gradient with solvent A: acetonitrile; solvent B: water; solvent C: water/acetonitrile/methanesulfonic acid 1000:25:1. For more details, see text. Time Flow [min] % A % B % C [ml/min] 0 5 85 10 0.5 20 98 0 2 0.5 35 98 0 2 0.5 35.1 5 85 10 0.5 40 5 85 10 0.5

[0074] Method Calibration. Method is calibrated using high purity retinyl acetate received from DSM Nutritional Products, Kaiseraugst, C H. Retinols and retinal are quantitated against retinyl acetate. Dilutions described in Table 4C are prepared as follows. 40 mg of retinyl acetate is weighed into a 100 mL volumetric flask, and dissolved in ethanol, yielding a 400 μg/mL solution. This solution is sonicated as required to ensure dissolution. 5 mL of this 400 μg/mL solution is diluted into 50 mL (1/10 dilution, final concentration 40 μg/mL), 5 mL into 100 mL (1/20 dilution, final concentration 20 μg/mL), 5 mL of 40 μg/mL into 50 mL (1/10 dilution, final concentration 4 μg/mL), 5 mL of 20 μg/mL into 50 mL (1/10 dilution, 2 μg/mL), using 50/50 methanol/methyl tert-butyl ether(MTBE) as the diluent. All dilutions are done in volumetric flasks. Purity of retinyl acetate is determined by further diluting the 400 μg/mL stock solution 100-fold (using a 2 mL volumetric pipet and a 200 mL volumetric flask) in ethanol. Absorbance of this solution at 325 nm using ethanol is taken as the blank, with adjustment of the initial concentration using the equation (Abs*dilution (100)*molecular weight (328.5)/51180=concentration in mg/mL). Because of quick out-maximization of UV absorbance of retinyl acetate, lower concentrations are better.

TABLE-US-00006 TABLE 4C preparation of calibration standards. For more explanation, see text. Stock [RA], dilution Final concentration  20 μg/mL, 1/10  2 μg/mL  40 μg/mL, 1/10  4 μg/mL 400 μg/mL, 1/20 20 μg/mL 400 μg/ml, 1/10 40 μg/mL

[0075] Sample preparation. Top second phase layer samples from each strain were diluted at a 25-fold dilution or higher into tetrahydrofuran (THF). Fermentation whole broth was prepared using a 2 mL Precellys (Bertin Corp, Rockville, Md.) tube, add 25 μl of well mixed broth and 975 μl of THF. Precellys 3×15×7500 rpm for two cycles with a freeze at −80° C. for 10 minutes between cycles. Cell debris was spun down via centrifugation for 1 minute at 13000 rpm. These samples were diluted 10-fold in THF.

Example 2: Deletion of Lipase Genes in Yarrowia lipolytica

[0076] Lipase genes (LIP2, LIP3, & LIP8) were disabled in strain ML18812 using modern CRISPR Cas9 methods, using the CRISPR sites indicated in Table 3, to generate strain ML18743. Briefly, strain ML18812 was transformed with MB7452 (SEQ ID NO:14), which contains an expression module for Cas9 and the nourseothricin selection marker. Nourseothricin resistant transformants (selected on YPD with 200 μg/mL nourseothricin) were subsequently transformed with plasmid MB9287, which contains expression sequences for Cas9, and guide RNAs with seed sequences targeting LIP2, LIP3, and LIP8 (shown in Table 3), and the hygromycin resistance marker. Transformants (selected on YPD with 200 μg/mL hygromycin) were screened for mutation by Sanger sequencing with primers flanking the targeted region. Strain ML18743 was found to have inactivating mutations in LIP2, LIP3, and LIP8. Whereas formation of FARE using such strain growing on corn oil could be more or less abolished, the growth rate of such lip deletion strains was very low compared to strain ML18812 (see Table 6).

Example 3: Addition of Heterologous Lipases in Growth-Deficient LIP2-3-8-Deletion Strains of Yarrowia lipolytica

[0077] To correct for the defect of low growth rates (see Ex. 2), commercially available lipases from Candida rugosa (CrLIP Sigma), Candida cylindracea (CcLIP, Creative Enzymes), Rhizopus niveus (Rn LIP, Sigma), and Rhizopus oryzae (RoLIP, Creative enzymes) as well as lipases from DSM (CrLIP1, CrLIP2, CrLIP3, CrLIP4, and CrLIP5) were added to strain ML18743 (comprising lip2-3-8 deletion) inoculated to 0.25xYEP medium with 2% corn oil as the sole carbon source (Table 5).

[0078] Commercially produced Cc and Cr lipase preparations (Creative Enzymes and Sigma Aldrich) are typically a mixture of several lipases natively expressed by Candida rugosa/Candida cylindracea. Lipases from DSM were produced by the protocol according to Example 1 in WO2017/115322.

TABLE-US-00007 TABLE 5 heterologous lipases added to the fermentation medium. Either the catalog number or SEQ ID NO: (for lipases from DSM) are given. For more explanation, see text. Catalog number/ Lipase Manufacturer SEQ ID NO: CrLIP Sigma Aldrich L1754 CcLIP Creative Enzymes DIS-1027 RnLIP Sigma Aldrich 62310 RoLIP Creative Enzymes DIS-1026 Lipozyme TL Novozymes 06-3155 Novacor Novozymes 06-3100 Palatase Novozymes 06-3118 Resinase Novozymes 06-3125 CrLIP1 DSM 9 CrLIP2 DSM 10 CrLIP3 DSM 11 CrLIP4 DSM 12 CrLIP5 DSM 13

[0079] While all enzymes were able to break down triglycerides in corn oil to permit growth, only CrLip, CcLip, RnLIP, RoLIP, CrLIP1, CrLIP2, and CrLIP5 were able to do so with minimal FARE production in the lip2 lip3 lip8 retinyl acetate producing strain ML18743. Results are depicted in Table 6.

TABLE-US-00008 TABLE 6 retinoid production in strain ML18743 (deletion of LIP2-3-8) compared to wild- type strain ML18812 (“LIP+”) as control with or without addition of the respective lipase according to Table 5. “% FARE” is based on total retinoids produced with addition of each individual lipase. “Total retinoids (% of LIP+)” is the percentage of retinoids produced compared to total retinoids in the control without addition of lipases, wherein the total retinoids obtained with the control are set to 100%. For growth on corn oil,“+++” indicates growth in the upper quartile, while “+” indicates growth in the lower quartile. For more explanation, see text. Total retinoids Growth on Lipase Units Strain Lipase (% of LIP+) % FARE corn oil added/well ML18812 none 100 88.54 +++ 0 ML18743 none 4 0.00 + 0 ML18743 CrLIP 51.18 5.86 +++ 0.28 ML18743 CcLIP 192.65 15.13 +++ 0.08 ML18743 RnLIP 56.50 0.00 +++ 0.06 ML18743 RoLIP 53.47 3.49 +++ 0.2 ML18743 Lipozyme TL 225.32 91.74 +++ 0.4 ML18743 Novacor 166.64 80.83 +++ 0.24 ML18743 Palatase 172.10 95.70 +++ 0.8 ML18743 Resinase 166.22 95.46 +++ 0.2 ML18743 CrLIP1 33.29 15.41 +++ 0.1376 ML18743 CrLIP2 7.66 7.69 + 0.7 ML18743 CrLIP3 31.56 74.34 +++ 0.0428 ML18743 CrLIP4 66.28 70.35 +++ 0.08 ML18743 CrLIP5 4.26 0.00 + 0.04

[0080] From this data, we conclude CrLip1 was able to simultaneously enable growth/retinoid production while minimizing production of FAREs, and most reflected the observed behavior of commercially available lipases, e.g., CrLIP, CcLIP, RoLIP or RnLIP (see Table 6).

Example 4: Addition of CrLIP1 Mutants in Growth-Deficient LIP2-3-8-Deletion Strains of Yarrowia lipolytica

[0081] Several mutant CrLIP1 proteins were produced (for a full description to produce these mutants in Pichia pastoris, see Example 1 and 2 in WO2017/211930), including double mutants and tested in our shake plate assay. Results are shown in Table 7. Several of these CrLIP1 mutants had reduced FARE compared to WT CrLIP1, while not severely diminishing total retinoid production.

TABLE-US-00009 TABLE 7 retinoid production in strain ML18743 (deletion of LIP2-3-8) compared to wild-type strain ML18812 (“LIP+”) as control with or without addition of the respective mutants of CrLIP1 as indicated. “% FARE” is based on total retinoids produced with addition of each individual lipase. “Total retinoids (% of LIP+)” is the percentage of retinoids produced compared to total retinoids in the control without addition of lipases, wherein the total retinoids obtained with the control are set to 100%. For more explanation, see text. Total retinoids Strain Lipase (% of LIP+) % FARE ML18812 none 100 88.54 ML18743 none 4 0.00 ML18743 CrLIP1 33.29 15.41 ML18743 CrLIP1_F296A 22.06 0.00 ML18743 CrLIP1_F296V 38.78 1.61 ML18743 CrLIP1_F296I 13.03 0.00 ML18743 CrLIP1_F296S 14.63 0.00 ML18743 CrLIP1_F296N 8.34 0.00 ML18743 CrLIP1_F296Q 9.82 0.00 ML18743 CrLIP1_296A_F344W 5.80 0.00 ML18743 CrLIP1_F345L 3.34 0.00 ML18743 CrLIP1_F344I 124.67 91.32 ML18743 CrLIP1_F448H 26.84 6.42 ML18743 CrLIP1_F448A 53.70 7.66 ML18743 CrLIP1_F448W 21.82 2.85

Example 5: Addition of Heterologous CrLIP Chimeras in Growth-Deficient LIP2-3-8-Deletion Strains of Yarrowia lipolytica

[0082] To determine if expression of CrLIP1 would complement the corn oil utilization defect of strain ML18756, we transformed it with MB9721 (SEQ ID NO:16), which encodes a chimeric fusion protein (SEQ ID NO:24) consisting of the Yarrowia lipolytica LIP2 secretion signal with the Candida rugosa LIP1 (CrLIP1) enzyme. This strain was called ML18870. Transformants were able to grow on corn oil, and produce retinoids as indicated in Table 8. Strain ML18870 was able to improve total retinoid production in the absence of added lipase, while maintaining reduced FARE as seen in ML18812.

TABLE-US-00010 TABLE 8 expression of YlLIP2(pre)-CrLIP1 chimera (strain ML18870) growing on corn oil compared to addition of purified Cr lipase 1 (CrLIP1) and compared to wild-type strain ML18812 (“LIP+”) as control. “% FARE” is based on total retinoids produced with addition of the respective lipase as indicated. “Total retinoids (% of CrLIP1)” is the percentage of retinoids produced compared to total retinoids with addition of Cr lipase 1, wherein the total retinoids obtained with CrLIP1 are set to 100%. For more explanation, see text. Relevant Total retinoids Strain lipase genotype Lipase (% of CrLIP1) % FARE ML18812 LIP+ none 300.3 88.54 ML18756 lip2 lip3 lip8 none 8.76 0.00 ML18756 lip2 lip3 lip8 CrLIP1 100.00 4.42 ML18870 lip2 lip3 lip8 + none 45.74 5.76 YlLip2(pre)-CrLIP1