HIGH-COMPATIBILITY PCR-FREE LIBRARY CONSTRUCTION AND SEQUENCING METHOD

20230265500 · 2023-08-24

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a PCR-free library construction and sequencing method. A PCR-free high-throughput sequencing method is provided, including the following steps: obtaining a DNA fragment of target size by performing or not performing, based on a size of a nucleic acid sample, fragmentation on the nucleic acid sample; performing end repair and an A-tailing reaction; ligating an adapter containing a barcode; obtaining DNA nanoballs by performing single-strand cyclization and rolling circle replication; and loading and sequencing.

Claims

1. A PCR-free high-throughput sequencing method, comprising the following steps: (A1) obtaining a DNA fragment of target size by performing fragmentation on a nucleic acid sample based on a size of the nucleic acid sample, and performing end repair and an A-tailing reaction; (A2) ligating an adapter to the product of step (A1); (A3) obtaining DNA nanoballs by performing single-strand cyclization on the product of step (A2) and rolling circle replication; and (A4) loading and sequencing.

2. The method according to claim 1, wherein in step (A1), the fragmentation is performed by digesting the nucleic acid sample with fragmentmase.

3. The method according to claim 1, wherein step (A1) is performed in two sub-steps: (A1-1) performing fragmentation on the nucleic acid sample based on the size of the nucleic acid sample to obtain a DNA fragment of target size; and (A1-2) performing the end repair and the A-tailing reaction on the DNA fragment of target size obtained in sub-step (A1-1).

4. The method according to claim 1, wherein the adapter each comprises two barcodes.

5. The method according to claim 4, wherein: the adapter is formed by annealing two partially complementary single-stranded nucleic acids; and the two barcodes are located in a non-complementary region of the two single-stranded nucleic acids.

6. The method according to claim 1, wherein in step (A1), the nucleic acid sample is DNA or RNA.

7. The method according to claim 6, wherein the DNA is genomic DNA, a naturally occurring small-molecule DNA, or an amplified DNA product.

8. The method according to claim 6, wherein, when the nucleic acid sample is RNA, the RNA is subjected to reverse transcription to obtain DNA; and the fragmentation is performed on the RNA or the DNA obtained by the reverse transcription of the RNA.

9. The method according to claim 1, wherein in step (A1), the fragmentation, the end repair, and the A-tailing reaction are performed in one step by mixing and reacting a fragmentation-end repair-A-tailing reaction solution with the nucleic acid sample, to obtain the product of step (A1); and the fragmentation-end repair-A-tailing reaction solution contains fragmentmase, a fragmentmase reaction buffer, adenylate deoxyribonucleic acids, a mixed deoxyribonucleic acid solution, T4 DNA polymerases, Taq DNA polymerases, and a TE buffer.

10. The method according to claim 1, wherein: in step (A2), the adapter is formed by annealing a B strand and a T strand; a 3′-end of the B strand is complementary with a 5′-end of the T strand, and the remaining region of the B strand is non-complementary with the remaining region of the T stand; the 3′-end of the B strand has a protruding dT; the non-complementary region of the B strand and/or the non-complementary region of the T strand contain a barcode for identifying different samples.

11. the method according to claim 10, wherein: a 5′-end of the B strand and the 5′-end of the T strand are each modified with a phosphate group or ligated with a single-stranded oligonucleotide fragment having a U-base at 3′-end.

12. The method according to claim 1, wherein: in step (A2), the adapter is ligated to the product of step (A1) by mixing and reacting the adapter and the product of step (A1) with a ligation reaction solution, to obtain the product of step (A2); and the ligation reaction solution contains a T4 polynucleotide kinase buffer, adenylate ribonucleic acids, PEG8000, T4 DNA ligases, and enzyme-free water.

13. The method according to claim 12, wherein: in step (A2), the adapter, the product of step (A2), and the ligation reaction solution are mixed by mixing an adapter solution containing the adapter and the product of step (A2) with the ligation reaction solution in a volume ratio of (1 to 5):50:(25 to 29); and a concentration of the adapter in the adapter solution is 6 μM or 1 μM.

14. The method according to claim 12, wherein: in step (A2), the adapter, the product of step (A1) and the ligation reaction solution, after being mixed, react at 25° C. for 10 min to 30 min and are kept at 4° C.

15. A method for constructing a DNA library applicable to PCR-free high-throughput sequencing, comprising: (A1) obtaining a DNA fragment of target size by performing fragmentation on a nucleic acid sample based on a size of the nucleic acid sample, and performing end repair and an A-tailing reaction; (A2) ligating an adapter to the product of step (A1); and (A3) obtaining DNA nanoballs by performing single-strand cyclization on the product of step (A2) and rolling circle replication.

16. A DNA library constructed by the method according to claim 15.

17. An adapter, being the adapter as defined in the method according to claim 10.

18. A kit, comprising: the adapter according to claim 16; a fragmentation-end repair-A-tailing reaction solution containing fragmentmase, a fragmentmase reaction buffer, adenylate deoxyribonucleic acids, a mixed deoxyribonucleic acid solution, T4 DNA polymerases, Taq DNA polymerases, and a TE buffer; a ligation reaction solution containing a T4 polynucleotide kinase buffer, adenylate ribonucleic acids, PEG8000, T4 DNA ligases, and enzyme-free water; a single-strand cyclization reaction solution 1 containing a TA buffer, adenylate ribonucleic acids, mediation fragments, T4 DNA ligases, and enzyme-free water, or a single-strand cyclization reaction solution 2 containing a TA buffer, adenylate ribonucleic acids, and T4 DNA ligases; and a digestion reaction solution containing a TA buffer, fragmentmase, and enzyme-free water.

19. A system, comprising: the kit according to claim 18; and a DNBSEQ sequencing reagent and/or device.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0134] FIG. 1 is a schematic diagram illustrating a combination of barcodes at both ends of a library when a dual-barcode adapter is used.

[0135] FIG. 2 is a schematic diagram illustrating a ligation reaction between dual-barcode adapters and nucleic acids to be sequenced.

[0136] FIG. 3 shows results of two interrupted human whole genome gDNA samples in Example 1, where lane 1 and lane 2 represent two parallel digestion interruption products of 1 μg of NA12878 gDNA.

[0137] FIG. 4 shows results of a 6% TBU gel detection of a single-stranded circular library in Example 1, where lane 1 and lane 2 represent two parallel digestion products of ssCircular DNA.

[0138] FIG. 5 shows PCR results of a ligation product in Example 2, where lane 1 and lane 2 represent two parallel PCR products of the ligation product.

[0139] FIG. 6a, FIG. 6b, and FIG. 6c shows analysis results by taking 5 MB and 30 MB of sequencing data in Example 2, respectively, where FIG. 6a illustrates effective alignment rates;

[0140] FIG. 6b illustrates repetition rates; and FIG. 6c illustrates GC contents.

DESCRIPTION OF EMBODIMENTS

[0141] The following examples are only for a better understanding of, rather than limiting, the present disclosure. Unless otherwise indicated, experimental methods in the following examples are conventional methods. Unless otherwise indicated, test materials used in the following examples are purchased from conventional biochemical reagent stores. Quantitative tests in the following examples are all repeated three times and test results are averaged.

Example 1 Construction of a Human Whole Genome Library with a Self-Developed Platform PCR-Free Library Construction Kit (Based on Digestion Interruption), and Sequencing Thereof

[0142] Experimental objective: constructing a whole genome library from a human gDNA sample by using an MGI PCR-free kit in combination with an NEB digestion interruption kit.

[0143] Sources of experimental samples: NA12878 standard DNA (catalog number: NA12878, manufacturer: CORIELL INSTITUTE).

[0144] 1. Interruption of DNA Sample with the NEB Digestion Interruption Kit

[0145] 1 μg of standard DNA (dissolved in TE) was placed into each tube and subjected to digestion interruption with NEBNext® Ultra™ II FS DNA Module (NEB), and the volume of an interruption system was 35 μL. NEBNext Ultra II FS Reaction Buffer was thawed in advance and vortex-mixed, NEBNext Ultra II FS Enzyme Mix was uniformly mixed in an upside-down manner and placed on ice. A reaction system shown in Table 1 was prepared on ice.

TABLE-US-00006 TABLE 1 NEB digestion interruption reaction system for the DNA sample Component Amount NEBNext Ultra II FS Reaction Buffer 7 μL gDNA (dissolved in TE) X μL TE 26 − X μL Total volume 33 μL

[0146] After NEBNext Ultra II FS Enzyme Mix was uniformly pipetted, 2 μL of NEBNext Ultra II FS Enzyme Mix was added to the sample, the mixture was gently and uniformly pipetted 6-8 times (vortex-mixing was prohibited), subjected to transient centrifugation, and immediately placed in a thermocycler for reaction, the reaction conditions were as follows: 4° C. forever; 37° C. for 10 min; 65° C. for 30 min; and 4° C. forever; the heated lid of the PCR instrument was set to 70° C. After the reaction was completed, the sample was collected and placed on ice, and TE was added to make up the volume of the sample to 65 μL.

[0147] 2. Selection of DNA Fragment

[0148] (1) 100 μL of interrupted sample was taken and transferred into a new 1.5 mL non-stick tube, 60 μL of XP magnetic beads was added to and uniformly mixed with the sample by shaking, and allowed to bind to DNA at the room temperature for 10 min. The tube was placed onto a magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear), and the supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube (the supernate was reserved at this step). 15 μL of XP magnetic beads was added to and uniformly mixed with the supernate by shaking, and allowed to bind to DNA at the room temperature for 10 min, the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear), and the supernate was removed by suction.

[0149] (2) 500 μL of 75% ethanol was placed into the non-stick tube on the magnetic rack, the tube cap was closed, the mixture in the tube was uniformly mixed, and the supernate was removed. After washing with 500 μL of 75% ethanol again, residual ethanol was removed as much as possible by using a pipette with a small measurement range, and the magnetic beads were air-dried at the room temperature.

[0150] (3) The magnetic beads were resuspended in and uniformly mixed with 42 μL of TE by shaking, and allowed to bind to DNA at the room temperature for 10 min; the tube was placed onto the magnetic rack; the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and 40 μL of supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube for next reaction, or it stored in a refrigerator at −20° C.

[0151] 3. Quantitation and Normalization of the Sample

[0152] 2 μL of purified DNA was taken and subjected to Qubit dsDNA HS quantitation. The selected DNA fragment was normalized according to the concentration determined by Qubit quantitation. The mass of the DNA fragment was adjusted to 150 ng, and 1×TE was added to make up the total volume of 40 μL. If necessary, the normalized samples can be stored in a refrigerator at −20° C.

[0153] The size of the obtained DNA fragment was 300 bp to 500 bp.

[0154] 4. End Repair and A-Tailing

[0155] First, an end repair-A-tailing reaction solution was prepared according to Table 2.

TABLE-US-00007 TABLE 2 Composition of an end repair-A-tailing reaction solution Component Amount T4 10× PNK buffer (Enzymatics) 5 μL dATP (100 mM) (Enzymatics) 0.5 μL dNTPs (each 25 mM) (Enzymatics) 0.5 μL T4 DNA polymerase (3 U/μL) (Enzymatics) 2 μL T4 PNK (10 U/μL) (Enzymatics) 1 μL rTaq (5 U/μL) (Enzymatics) 1 μL Total volume 10 μL

[0156] 10 μL of prepared end repair-A-tailing reaction solution was added to and uniformly vortex-mixed with 40 μL of product of step 3, the mixture was subjected to transient centrifugation, and the total volume of the mixture was made up to 50 μL. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 14° C. for 15 min; 37° C. for 25 min; 65° C. for 15 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C.

[0157] 5. Ligation of an Adapter

[0158] An adapter sequence used in the present protocol is as follows (in the present example, the 5′-end of the sequence is on the left side, the 3′-end of the sequence is on the right side, “//” represents a modifying group, “phos” represents phosphorylation, and the underlined bases represent a barcode of 10 bases).

TABLE-US-00008 Phosphorylated adapter B strand: (SEQ ID NO: 1) /Phos/GAACGACATGGCTACGATCCGACTT;  and phosphorylated adapter T strand: (SEQ ID NO: 2) /Phos/AGTCGGAGGCCAAGCGGTCTTAGGAA GACAANNNNNNNNNNCAACTCCTTGGCTCACA,
where N may be A, T, C or G.

[0159] Preparation of adapter: 20 μL of adapter B strands (100 μM), 20 μL of adapter T strands (100 μM), and 40 μL of 2×adapter buffer (components: 50 mM Tris-HCl (pH=8.0), 0.1 mM EDTA, and 50 mM NaCl) were mixed to prepare adapters A (25 μM). The adapters A were placed at the room temperature for more than half an hour and then diluted to a use concentration or stored at −20° C. Before use, the adapters A (25 μM) were diluted with TE prepare adapters B (6 μM).

[0160] 5 μL of prepared adapters B (6 μM) was added to and thoroughly mixed with the product of step 4.

[0161] A ligation reaction solution was prepared according to Table 3.

TABLE-US-00009 TABLE 3 Composition of a ligation reaction solution Component Amount 10 × T4 PNK buffer (Enzymatics)   3 μL 0.1M ATP (Thermo) 0.8 μL 50% PEG8000 (Rigaku)  16 μL T4 DNA ligase (600 U/μL) (Enzymatics)   5 μL Enzyme-free water (Sigma) 0.2 μL Total volume  25 μL

[0162] The prepared ligation reaction solution was uniformly vortex-mixed with the mixture of the adapters B and the product of step 4, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction; the reaction conditions were as follows: 25° C. for 30 min; and 4° C. hold; and the heated lid of the PCR instrument was set to 30° C. After the reaction was completed, 20 μL of TE buffer was added, 50 μL of XP magnetic beads was added for purification, and the collected product was dissolved in 50 μL of TE buffer.

[0163] 6. Single-Strand Cyclization

[0164] 48 μL of purified product was incubated at 95° C. for 3 min and at 4° C. for 10 min.

[0165] A single-strand cyclization reaction solution was prepared according to Table 4.

TABLE-US-00010 TABLE 4 Composition of a single-strand cyclization reaction solution Component Amount 10 × TA buffer (Epicentre)   6 μL 100 mM ATP (Thermo) 0.6 μL 20 μM mediation fragments 2.5 μL T4 DNA ligase (600 U/μL) (Enzymatics)   1 μL Enzyme-free water (Sigma) 1.9 μL Total volume  12 μL

[0166] 12 μL of the prepared single-strand cyclization reaction solution was uniformly vortex-mixed with 48 μL of thermal denaturation product, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 37° C. for 60 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 42° C.

[0167] 20 μM fragments for mediation have a corresponding complementary sequence to be ligated to both ends of the single strand. The corresponding complementary sequence is (in the present example, the 5′-end of the sequence is on the left side, and the 3′-end of the sequence is on the right side): GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 8).

[0168] 7. Digestion of a Linear Single Strand

[0169] A digestion reaction solution was prepared according to Table 5.

TABLE-US-00011 TABLE 5 Composition of a digestion reaction solution Component Amount 10 × TA buffer (Epicentre) 0.4 μL ExoI (20 U/μL) (Enzymatics)   2 μL ExoIII (10 U/μL) (Enzymatics)   1 μL Enzyme-free water 0.6 μL Total volume   4 μL

[0170] 4 μL of prepared digestion reaction solution was added to and uniformly mixed with 60 μL of reaction product of the previous step. The mixture was incubated at 37° C. for 30 min, and added and uniformly mixed with 3 μL of EDTA (500 mM, Ambion). A product was purified and collected with 120 μL of XP magnetic beads, and dissolved in 30 μL of TE buffer.

[0171] 8. Quantitation of a Single-Stranded Circle

[0172] The single-stranded cyclization product obtained through the digestion of the linear single strand in the previous step was quantitated by using a Qubit ssDNA Assay Kit.

[0173] 9. Sequencing

[0174] DNA nanoballs were prepared with the constructed single-stranded circular DNA library and sequenced on MGISEQ-2000 PE150. The sequencing and data analysis followed the standard operating process of MGISEQ-2000 PE150.

[0175] 10. Library Construction and Sequencing Results of the Present Example

[0176] FIG. 3 shows interruption results of two human whole genome gDNA samples (parallel repetitive library construction results of NA12878 standard DNA). FIG. 4 shows a 6% TBU gel detection result of a single-stranded circular library. It can be seen from FIG. 3 and FIG. 4 that the digestion interruption and library construction results are normal, indicating that the library construction system is compatible with digestion interruption.

[0177] Table 6 illustrates the sequencing quality of the human sample WGS PCR-free library (based on NEB digestion interruption) obtained by the library construction and sequencing method of the present example. Table 6 indicates that the human sample WGS PCR-free library (based on NEB digestion interruption) has relatively high sequencing quality on the high-throughput sequencing platform MGISEQ-2000RS PE150, which is self-developed by MGI.

TABLE-US-00012 TABLE 6 Sequencing quality of the human sample WGS PCR-free library (based on NEB digestion interruption) NEB digestion Covaris Acceptance interruption interruption level (PE150) (PE100) Insert size of main band (bp) 419 405 Clean read1 Q30 (%) 86.91 89.71 Clean read2 Q30 (%) >80 81.46 87.57 Clean Q20 (%) 94.63 96.645 Clean Q30 (%) 84.185 88.64 GC content (%) 39-42 40.88 41.05 read_1 (AT) <0.5% 0.33 0.06 read_1 (CG) 0.38 0.36 read_2 (AT)   <1% 0.85 0.58 read_2 (CG)   <1% 0.58 0.54 Mapping rate (%) >98 98.84 99.17 Unique rate (%) >93 98.97 98.82 Duplicate rate (%) <3 1.03 1.18 Average seq depth (X) 30 30.19 30.33 Coverage (%) >99 99.07 99.09 Coverage at least 20X (%) >90 93.38 94.21 Chimerical rate (%) 0.88 0.99 Coverage bias Low Dropout 0.0490 0.0419 Coverage bias High Dropout 0.0449 0.0364 Note: Covaris interruption (PE100) serves as a comparative PCR-free example, using the same library construction system, indicating that the library construction based on digestion interruption has the same effects as the library construction based on physical interruption.

[0178] Table 7 shows SNP and Indel variation detection and analysis results of the NA12878 WGS PCR-free library obtained by the library construction and sequencing method of the present example. Table 7 indicates that the PCR-free library (based on NEB digestion interruption) of the present disclosure is significantly superior to the PCR library in terms of Indel calling, and its overall performance is similar to NovaSeq PCR-free PE150 on the Illumina platform.

TABLE-US-00013 TABLE 7 SNP and Indel variation detection and analysis results of the NA12878 WGS PCR-free library (based on NEB digestion interruption) NEB digestion Covaris BGISEQ-500 Acceptance interruption interruption physical PCR NovaSeq PCR free level (PE150) (PE100) (PE100) (PE150) snp_True-pos-call 3190000 3E+06 3E+06 3E+06 snp_False-pos 4340 6650 5464 2045 snp_False-neg 19000 17600 28154 8809 snp_Precision >0.995 0.9986 0.9979 0.9983 0.9994 snp_Sensitivity >0.99 0.9941 0.9945 0.9912 0.9973 snp_F-measure 0.9963 0.9962 0.9947 0.9983 indel_True-pos-call 469000 470000 457664 473679 indel_False-pos 5920 5200 24056 4732 indel_False-neg 11900 11700 23603 7588 indel_Precision >0.98 0.9876 0.9891 0.9501 0.9901 indel_Sensitivity >0.97 0.9753 0.9757 0.951 0.9842 indel_F-measure 0.9814 0.9823 0.9505 0.9872 Note: Covaris interruption (PE100) serves as a comparative PCR-free example, using the same library construction system, indicating that the library construction based on digestion interruption has the same effects as the library construction based on physical interruption. BGISEQ-500 physical PCR (PE100) serves as a PCR-based comparative example.

Example 2 Construction and Sequencing of 20 cfDNA Libraries

[0179] Experimental objective: a plasma sample library was constructed by using an MGI PCR-free kit.

[0180] Sources of experimental samples: 20 plasma samples, including 2 abnormal chromosome samples.

[0181] 1. Sample Collection and Treatment [0182] 2 mL of vein blood was collected and centrifuged at 1,600 g and 4° C. for 10 min to separate blood cells from plasma, and the plasma was centrifuged at 16,000 g and 4° C. for 10 min to further remove residual white blood cells. DNA was extracted from 200 μL of plasma and dissolved in 40 μL of TE solution.

[0183] 2. End Repair and Addition of Adenylate Deoxyribonucleic Acid

[0184] An end repair-A-tailing reaction solution was prepared according to Table 8.

TABLE-US-00014 TABLE 8 Composition of an end repair-A-tailing reaction solution 10 × T4 polynucleotide kinase buffer (Enzematics)   5 μL T4 polynucleotide kinase (10 U/μL) (Enzematics)   1 μL Mixed desoxyribonucleic acid solution (25 mM each) (Enzematics) 0.5 μL Taq DNA polymerase (5 U/μL) (Takara) 0.4 μL Adenylate deoxyribonucleic acid (100 mM) (Enzematics) 0.5 μL T4 DNA polymerase (3 U/μL) (Enzymatics)   2 μL Enzyme-free water (Sigma) 0.6 μL Total volume  10 μL

[0185] 10 μL of prepared end repair-A-tailing reaction solution was added to and uniformly mixed with 40 μL of DNA, and the mixture was incubated at 37° C. for 10 min and at 72° C. for 15 min, and cooled to 4° C. at a rate of 0.1 s.

[0186] 3. Ligation of an Adapter

[0187] An adapter sequence used in the present protocol is as follows (in the present example, the 5′-end of the sequence is on the left side, the 3′-end of the sequence is on the right side, “//” represents a modifying group, “phos” represents phosphorylation, and the underlined bases represent a barcode of 10 bases).

TABLE-US-00015 Phosphorylated adapter B strand: (SEQ ID NO: 1) /Phos/GAACGACATGGCTACGATCCGACTT; and phosphorylated adapter T strand: (SEQ ID NO: 2) /Phos/AGTCGGAGGCCAAGCGGTCTTAGGAA GACAANNNNNNNNNNCAACTCCTTGGCTCACA, where N may be A, T, C or G.

[0188] Preparation of adapter: 20 μL of adapter B strands (100 μM), 20 μL of adapter strands (100 μM), and 40 μL of 2×adapter buffer (components: 50 mM Tris-HCl (pH=8.0), 0.1 mM EDTA, and 50 mM NaCl) were mixed to prepare adapters A (25 μM). The adapters A were placed at the room temperature for more than half an hour and diluted to a use concentration or stored at −20° C. Before use, the adapters A (25 μM) were diluted with TE to prepare adapters B (1 μM).

[0189] 1 μL of prepared adapters B (1 μM) was added to and thoroughly mixed with the product of step 3.

[0190] A ligation reaction solution was prepared according to Table 9.

TABLE-US-00016 TABLE 9 Composition of a ligation reaction solution Component Amount 10× T4 PNK buffer (Enzymatics) 3 μL 0.1M ATP (Thermo) 0.8 μL 50% PEG8000 (Rigaku) 16 μL T4 DNA ligase (600 U/μL) (Enzymatics) 5 μL Enzyme-free water (Sigma) 4.2 μL Total volume 29 μL

[0191] The prepared ligation reaction solution was uniformly vortex-mixed with the mixture of the adapters B and the product of step 4, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 25° C. for 30 min and 4° C. hold, and the heated lid of the PCR instrument was set to 30° C. After the reaction was completed, 20 μL of TE buffer was added, 50 μL of XP magnetic beads (Beckman Coulter) was added for purification, and the collected product was dissolved in 22 μL of TE buffer. 15 μL of the respective samples was taken, multiple samples of the same volume were mixed and purified by adding XP magnetic beads (Beckman Coulter) in twice the volume of the sample mixture, and the collected product was dissolved in 22 μL of TE buffer.

[0192] 4. Sequencing

[0193] A DNA nanoball can be prepared by multiple methods.

[0194] Method 1: referring to steps 6 to 9 of the whole genome library construction and sequencing of Example 1, single-strand cyclization of a sample, digestion of a linear single strand, preparation of DNA nanoballs, and sequencing on BGISEQ-500SE50+10 are performed. The sequencing and data analysis follow the standard operating process of BGISEQ-500 SE50+10.

[0195] Method 2: the constructed ligation product is taken and subjected to one-step preparation of DNA nanoballs and sequencing on BGISEQ-500SE50+10. The sequencing and data analysis follow the standard operating process of BGISEQ-500 SE50+10. In the present example, the method 2 was adopted.

[0196] 5. Library Construction and Sequencing Results of the Present Example

[0197] 1 μL of ligation product was taken and subjected to PCR, and the size of an adapter-ligated fragment was verified. Results are shown in FIG. 5. It can be seen that, the size of the adapter-ligated PCR product is about 250 bp, which is in line with the theoretical value. The theoretical value is calculated in such a manner that the size of the cfDNA fragment is 160 bp, the overall length of the adapter is about 84 bp, and the overall length of the adapter-ligated fragment is about 260 bp.

[0198] Concentration detection results of the products in the respective steps are shown in Table 10. It can be seen that this method can be used to prepare a library from this type of sample.

TABLE-US-00017 TABLE 10 Concentration detection results of the products in the respective steps Concentration of the ligation product 0.32 ng/μL Total mass of the ligation product 12.8 ng Concentration of the DNA nanoball 12.3 ng/μL

[0199] FIG. 6a, FIG. 6b, and FIG. 6c show analysis and statistical results of 5 MB and 30 MB of sequencing data. It can be seen that: in diagram a, effective alignment rates of all samples satisfy the requirements of the MGI prenatal test kit; in diagram b, repetition rates of all samples meet the requirements of the MGI prenatal test kit; and in diagram C, GC contents of all samples meet the requirements of the MGI prenatal test kit.

Example 3 Construction of a Human Whole Genome Library with a Self-Developed Platform PCR-Free Library Construction Kit (Based on Digestion Interruption)

[0200] Experimental objective: a whole genome library was prepared from a human gDNA sample by using an MGI PCR-free kit in combination with an NEB digestion interruption kit.

[0201] Sources of experimental samples: NA12878 standard DNA (catalog number: NA12878, manufacturer: CORIELL INSTITUTE).

[0202] 1. Digestion Interruption, End Repair, and A-Tailing of the DNA Sample

[0203] 1 μg of standard DNA (dissolved in TE) was placed into each tube, interrupted with dsDNA Fragmentase, and subjected to end repair and A-tailing, and the volume of an interruption system was 50 μL. A corresponding reagent was thawed in advance and uniformly mixed, an enzyme reagent was uniformly mixed in an upside-down manner and placed on ice. A reaction system was prepared according to Table 11 on ice.

TABLE-US-00018 TABLE 11 Interruption and end repair and A-tailing reaction system for DNA sample Component Amount 10× Fragmentase Reaction Buffer (NEB, M0348S) 5 μL Fragmentase (NEB, M0348S) 3 μL dATP (100 mM) (Enzymatics) 1.7 μL dNTPs (each 25 mM) (Enzymatics) 2.3 μL T4 DNA polymerase (3 U/μL) (Enzymatics) 1 μL rTaq (5 U/μL) (Enzymatics) 1 μL gDNA (dissolved in TE) X μL TE Y μL Total volume 50 μL

[0204] The DNA sample was added to and uniformly mixed with the prepared reaction system by pipetting or vortex-mixing; the mixture was subjected to transient centrifugation and immediately placed into the thermocycler for reaction, the reaction conditions were as followings: 4° C. forever; 37° C. for 20 min; 65° C. for 30 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C. After the reaction was completed, the sample was collected and placed on ice immediately, and TE was added to make up the volume of the sample to 50 μL.

[0205] 2. Selection of a DNA Fragment

[0206] (1) 100 μL of interrupted sample was taken and transferred into a new 1.5 mL non-stick tube; 60 μL of XP magnetic beads was added to and uniformly mixed with the sample by shaking, and allowed to bind to DNA at the room temperature for 10 min; the tube was placed onto the magnetic rack; the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and the supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube (the supernate was reserved at this step). 15 μL of XP magnetic beads was added to and uniformly mixed with the supernate by shaking, and allowed to bind to DNA at the room temperature for 10 min; the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and the supernate was removed by suction.

[0207] (2) 500 μL of 75% ethanol was placed into the non-stick tube on the magnetic rack, the tube cap was closed, the mixture in the tube was uniformly mixed, and the supernate was removed. After washing with 500 μL of 75% ethanol again, residual ethanol was removed as much as possible by using a pipette with a small measurement range, and the magnetic beads were air-dried at the room temperature.

[0208] (3) The magnetic beads were resuspended and uniformly mixed with 42 μL of TE by shaking, and allowed to bind to DNAs at the room temperature for 10 min; the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNAs for 2 min (until the liquid became clear); and 40 μL of supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube for next reaction, or it stored in a refrigerator at −20° C.

[0209] 3. Quantitation and Normalization of the Sample

[0210] 2 μL of purified DNA was taken and subjected to Qubit dsDNA HS quantitation. The selected DNA fragments were normalized according to the concentration determined by Qubit quantitation; the mass of the DNA fragment was adjusted to 150 ng; and 1×TE was added to make up the total volume of 40 μL. If necessary, the normalized samples can be stored in a refrigerator at −20° C.

[0211] The size of the obtained DNA fragment was 300 bp to 500 bp.

[0212] 5. Ligation of Adapter

[0213] An adapter sequence used in the present protocol is as follows (in the present example, the 5′-end of the sequence is on the left side, the 3′-end of the sequence is on the right side, “//” represents a modifying group, “phos” represents phosphorylation, and the underlined bases represent a barcode of 10 bases).

TABLE-US-00019 Phosphorylated adapter B strand: (SEQ ID NO: 1) /Phos/GAACGACATGGCTACGATCCGACTT; and phosphorylated adapter T strand: (SEQ ID NO: 2) /Phos/AGTCGGAGGCCAAGCGGTCTTAGGAA GACAANNNNNNNNNNCAACTCCTTGGCTCACA, where N may be A, T, C or G.

[0214] Preparation of the adapter: 20 μL of adapter B strands (100 μM), 20 μL of adapter T strands (100 μM), and 40 μL of 2×adapter buffer (components: 50 mM Tris-HCl (pH=8.0), 0.1 mM EDTA, and 50 mM NaCl) were mixed to prepare adapters A (25 μM); and the adapters A were placed at the room temperature for more than half an hour and then diluted to a use concentration or stored at −20° C. Before use, the adapters A (25 μM) were diluted with TE to prepare adapters B (6 μM).

[0215] 5 μL of the prepared adapters B (6 μM) was added to and thoroughly mixed with the product of step 4.

[0216] A ligation reaction solution was prepared according to Table 12.

TABLE-US-00020 TABLE 12 Composition of a ligation reaction solution Component Amount 10× T4 PNK buffer (Enzymatics) 3 μL 0.1M ATP (Thermo) 0.8 μL 50% PEG8000 (Rigaku) 16 μL T4 DNA ligase (600 U/μL) (Enzymatics) 5 μL Enzyme-free water (Sigma) 0.2 μL Total volume 25 μL

[0217] The prepared ligation reaction solution was uniformly vortex-mixed with the mixture of the adapters B and the product of step 4, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 25° C. for 30 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 30° C. After the reaction was completed, 20 μL of TE buffer was added, 50 μL of XP magnetic beads was added for purification, and the collected product was dissolved in 50 μL of TE buffer.

[0218] 6. Single-Strand Cyclization

[0219] 48 μL of purified product was incubated at 95° C. for 3 min and at 4° C. for 10 min.

[0220] A single-strand cyclization reaction solution was prepared according to Table 13.

TABLE-US-00021 TABLE 13 Composition of a single-strand cyclization reaction solution Component Amount 10× TA buffer (Epicentre) 6 μL 100 mM ATP (Thermo) 0.6 μL 20 μM mediation fragments 2.5 μL T4 DNA ligase (600 U/μL) (Enzymatics) 1 μL Enzyme-free water (Sigma) 1.9 μL Total volume 12 μL

[0221] 12 μL of the prepared single-strand cyclization reaction solution was uniformly vortex-mixed with 48 μL of thermal denaturation product, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 37° C. for 60 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 42° C.

[0222] 20 μM fragments for mediation have a corresponding complementary sequence to be ligated to both ends of the single strand. The corresponding complementary sequence is (in the present example, the 5′-end of the sequence is on the left side, and the 3′-end of the sequence is on the right side): GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 8).

[0223] 7. Digestion of a Linear Single Strand

[0224] A digestion reaction solution was prepared according to Table 14.

TABLE-US-00022 TABLE 14 Composition of a digestion reaction solution Component Amount 10× TA buffer (Epicentre) 0.4 μL ExoI (20 U/μL) (Enzymatics) 2 μL ExoIII (10 U/μL) (Enzymatics) 1 μL Enzyme-free water 0.6 μL Total volume 4 μL

[0225] 4 μL of prepared digestion reaction solution was added to and uniformly mixed with 60 μL of reaction product of the previous step. The mixture was incubated at 37° C. for 30 min, and added and uniformly mixed with 3 μL of EDTA (500 mM, Ambion). A product was purified and collected with 120 μL of XP magnetic beads, and dissolved in 30 μL of TE buffer.

[0226] 8. Quantitation of a Single-Stranded Circle

[0227] The single-stranded cyclization product obtained through the digestion of the linear single strand in the previous step was quantitated by using a Qubit ssDNA Assay Kit.

[0228] Concentration detection results of the products in the respective steps are shown in Table 15. It can be seen that, the integration of the interruption, end repair, and A-tailing in one step is also suitable for the PCR-free library construction.

TABLE-US-00023 TABLE 15 Concentration detections results of the products in the respective steps Concentration of the selected fragment 2.6 ng/μL Total mass of the selected fragment 130 ng Concentration of the single-stranded circle 2.16 ng/μL

Example 4 Construction of a Human Whole Genome Library with a Self-Developed Platform PCR-Free Library Construction Kit (Based on Digestion Interruption)

[0229] Experimental objective: a whole genome library was prepared from a human gDNA sample by using an MGI PCR-free kit in combination with an NEB digestion interruption kit.

[0230] Sources of experimental samples: NA12878 standard DNA (catalog number: NA12878, manufacturer: CORIELL INSTITUTE).

[0231] 1. Digestion Interruption and End Repair of the DNA Sample

[0232] 1 μg of standard DNA (dissolved in TE) was placed into each tube, interrupted with dsDNA Fragmentase (catalog number: M0348, NEB), and subjected to end repair, and the volume of the system was 50 μL. 10× Fragmentase Reaction Buffer v2 was thawed in advance and uniformly vortex-mixed, dsDNA Fragmentase was uniformly vortex-mixed and placed on ice. A reaction system was prepared according to Table 16 on ice.

TABLE-US-00024 TABLE 16 Digestion interruption and end repair reaction system for the DNA sample Component Amount 10× Fragmentase Reaction Buffer v2 (NEB) 5 μL dsDNA Fragmentase (NEB) 3 μL dNTPs (each 25 mM) (Enzymatics) 3 μL DNA polymerase I (10 U/μL) (NEB) 2 μL 1M MgCl.sub.2 (Sigma) 0.3 μL Enzyme-free water (Sigma) 6.7 μL Total volume 20 μL

[0233] The above reaction system was uniformly pipetted, 20 μL of gDNA sample (total mass was 1 ug) was added to and uniformly mixed with the reaction system by gently pipetting 6-8 times or vortex-mixing; the mixture was subjected to transient centrifugation and immediately placed into the thermocycler for reaction; the reaction conditions were as follows: 37° C. for 30 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C. After the reaction was completed, the sample was collected and placed on ice immediately, and TE was added to make up the volume of the sample to 30 μL.

[0234] 2. Selection of a DNA Fragment

[0235] (1) 100 μL of interrupted sample was taken and transferred into a new 1.5 mL non-stick tube; 52 μL of XP magnetic beads was added to and uniformly mixed with the sample by shaking, and allowed to bind to DNA at the room temperature for 10 min; after transient centrifugation, the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and the supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube (the supernate was reserved at this step). 15 μL of XP magnetic beads was added to and uniformly mixed with the supernate by shaking, and allowed to bind to DNA at the room temperature for 10 min; the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and the supernate was removed by suction.

[0236] (2) 500 μL of 75% ethanol was placed into the non-stick tube on the magnetic rack, the tube cap was closed, the mixture in the tube was uniformly mixed, and the supernate was removed. After washing with 500 μL of 75% ethanol again, residual ethanol was removed as much as possible by using a pipette with a small measurement range, and the magnetic beads were air-dried at the room temperature.

[0237] (3) The magnetic beads were resuspended in and uniformly mixed with 42 μL of TE by shaking, and allowed to bind to DNA at the room temperature for 10 min; after transient centrifugation, the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and 40 μL of supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube for the next reaction, or it was stored in a refrigerator at −20° C.

[0238] 3. Quantitation and Normalization of the Sample

[0239] 2 μL of purified DNA was taken and subjected to Qubit dsDNA HS quantitation. The selected DNA fragment was normalized according to the concentration determined by Qubit quantitation; the mass of the DNA fragment was adjusted to 150 ng; and 1×TE was added to make up the total volume of 40 μL. If necessary, the normalized samples can be stored in a refrigerator at −20° C.

[0240] The size of the obtained DNA fragment was 300 bp to 500 bp.

[0241] 4. A-tailing

[0242] First, an A-tailing reaction solution was prepared according to Table 17.

TABLE-US-00025 TABLE 17 Composition of an A-tailing reaction solution Component Amount T4 10× PNK buffer (Enzymatics) 5 μL dATP (100 mM) (Enzymatics) 0.5 μL dNTPs (each 25 mM) (Enzymatics) 0.35 μL rTaq (5 U/μL) (Enzymatics) 0.2 μL Enzyme-free water (Sigma) 1 μL

[0243] 10 μL of prepared A-tailing reaction solution was added to and vortex-mixed with 40 μL of product of step 3; the mixture was subjected to transient centrifugation; and the total volume of the mixture was made up to 50 μL. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 65° C. for 30 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C.

[0244] 5. Ligation of Adapter

[0245] An adapter sequence used in the present protocol is as follows (in the present example, the 5′-end of the sequence is on the left side, the 3′-end of the sequence is on the right side, “//” represents a modifying group, “phos” represents phosphorylation, and the underlined bases represent a barcode of 10 bases).

TABLE-US-00026 Phosphorylated adapter B strand: (SEQ ID NO: 1) /Phos/GAACGACATGGCTACGATCCGACTT; and phosphorylated adapter T strand: (SEQ ID NO: 2) /Phos/AGTCGGAGGCCAAGCGGTCTTAGGAA GACAANNNNNNNNNNCAACTCCTTGGCTCACA, where N may be A, T, C or G.

[0246] Preparation of the adapter: 20 μL of adapter B strands (100 μM), 20 μL of adapter T strands (100 μM), and 40 μL of 2× adapter buffer (components: 50 mM Tris-HCl (pH=8.0), 0.1 mM EDTA, and 50 mM NaCl) were mixed to prepare adapters A (25 μM); and the adapters A were placed at the room temperature for more than half an hour and then diluted to a use concentration or stored at −20° C. Before use, the adapters A (25 μM) were diluted with TE to prepare adapters B (6 μM).

[0247] 5 μL of prepared adapters B (6 μM) was added to and thoroughly mixed with the product of step 4.

[0248] A ligation reaction solution was prepared according to Table 18.

TABLE-US-00027 TABLE 18 Composition of a ligation reaction solution Component Amount 10× T4 PNK buffer (Enzymatics) 3 μL 0.1M ATP (Thermo) 0.8 μL 50% PEG8000 (Rigaku) 16 μL T4 DNA ligase (600 U/μL) (Enzymatics) 5 μL Enzyme-free water (Sigma) 0.2 μL Total volume 25 μL

[0249] The prepared ligation reaction solution was uniformly vortex-mixed with the mixture of the adapters B and the product of step 4, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 25° C. for 30 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 30° C. After the reaction was completed, 20 μL of TE buffer was added, 50 μL of XP magnetic beads was added for purification, and the collected product was dissolved in 50 μL of TE buffer.

[0250] 6. Single-Strand Cyclization

[0251] 5 μL of fragments (20 μM) for mediation and 2.5 μL of NaOH (2 M, Sigma) were added to and uniformly vortex-mixed with 48 μL of purified product, and the mixture was placed at the room temperature for 5 min. 5 μL of Tris-HCl (1 M, pH=6.8) was added to and uniformly vortex-mixed with the mixture, and a single-strand cyclization reaction solution shown in Table 19 was added.

TABLE-US-00028 TABLE 19 Composition of a single-strand cyclization reaction solution Component Amount 10× TA buffer (Epicentre) 6 μL 100 mM ATP (Thermo) 0.6 μL T4 DNA ligase (600 U/μL) (Enzymatics) 0.4 μL Total volume 7 μL

[0252] The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 37° C. for 30 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 42° C.

[0253] 20 μM fragments for mediation have a corresponding complementary sequence to be ligated to both ends of the single strand. The corresponding complementary sequence is (in the present example, the 5′-end of the sequence is on the left side, and the 3′-end of the sequence is on the right side): GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 8).

[0254] 7. Digestion of a Linear Single Strand

[0255] A digestion reaction solution was prepared according to Table 20.

TABLE-US-00029 TABLE 20 Composition of a digestion reaction solution Component Amount 10× TA buffer (Epicentre) 0.4 μL ExoI (20 U/μL) (Enzymatics) 2 μL ExoIII (10 U/μL) (Enzymatics) 1 μL Enzyme-free water 0.6 μL Total volume 4 μL

[0256] 4 μL of prepared digestion reaction solution was added to and uniformly mixed with 67.5 μL of reaction product of the previous step. The mixture was incubated at 37° C. for 30 min, and added and uniformly mixed with 3 μL of EDTA (500 mM, Ambion). A product was purified and collected with 120 μL of XP magnetic beads, and dissolved in 30 μL of TE buffer.

[0257] 8. Quantitation of a Single-Stranded Circle

[0258] The single-stranded cyclization product obtained through the digestion of the linear single strand in the previous step was quantitated by using a Qubit ssDNA Assay Kit.

[0259] Concentration detection results of the products in the respective steps are shown in Table 21. It can be seen that, the integration of the interruption, end repair, and A-tailing in one step is also suitable for PCR-free library construction.

TABLE-US-00030 TABLE 21 Concentration detection results of the products in the respective steps Concentration of the selected fragment 4.6 ng/μL Total mass of the selected fragment 184 ng Concentration of the single-stranded circle 2.2 ng/μL

Example 5 Construction of a Human Whole Genome Library with a Self-Developed PCR-Free Library Construction Kit (Based on Digestion Interruption) in Combination with a Dual-Barcode Adapter, and Sequencing Thereof

[0260] Experimental objective: a whole genome library was prepared from a human gDNA sample by using an MGI PCR-free kit in combination with a dual-barcode adapter and an NEB digestion interruption kit.

[0261] Sources of experimental samples: NA12878 standard DNA (catalog number: NA12878, manufacturer: CORIELL INSTITUTE).

[0262] 1. Digestion Interruption of the DNA Sample

[0263] 1 μg of standard DNA (dissolved in TE) was placed into each tube and interrupted with dsDNA Fragmentase (catalog number: M0348, NEB), the volume of an interruption system was 50 μL. 10×Fragmentase Reaction Buffer v2 was thawed in advance and uniformly vortex-mixed, and dsDNA Fragmentase was uniformly vortex-mixed and placed on ice. A reaction system was prepared according to Table 22 on ice.

TABLE-US-00031 TABLE 22 Digestion interruption reaction system for DNA sample Component Amount 10× Fragmentase Reaction Buffer v2 (NEB) 3 μL gDNA (dissolved in TE) X μL TE 27 − X μL Total volume 27 μL

[0264] The sample, after being pipetted, was added with and gently uniformly mixed with 3 μL of dsDNA Fragmentase by pipetting 6-8 times or vortex-mixing. After transient centrifugation, the mixture was immediately placed into the thermocycler for reaction, the reaction conditions were as follows: 37° C. for 25 min; 65° C. for 15 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C. After the reaction was completed, the sample was collected and placed on ice immediately, and TE was added to make up the total volume of the sample to 70 μL.

[0265] 2. Selection of a DNA Fragment

[0266] (1) 100 μL of interrupted sample was taken and transferred into a new 1.5 mL non-stick tube; 60 μL of XP magnetic beads was added to and uniformly mixed with the sample by shaking, and allowed to bind to DNA at the room temperature for 10 min; after transient centrifugation, the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and the supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube (the supernate was reserved at this step). 15 μL of XP magnetic beads was added to and uniformly mixed with the supernate by shaking, and allowed to bind to DNA at the room temperature for 10 min. The tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear), and the supernate was removed by suction.

[0267] (2) 500 μL of 75% ethanol was placed into the non-stick tube on the magnetic rack, the tube cap was closed, the mixture in the tube was uniformly mixed. The supernate was removed. After washing with 500 μL of 75% ethanol again, residual ethanol was removed as much as possible by using a pipette with a small measurement range, and the magnetic beads were air-dried at the room temperature.

[0268] (3) The magnetic beads were resuspended in and uniformly mixed with 42 μL of TE by shaking, and allowed to bind to DNA at the room temperature for 10 min; after transient centrifugation, the tube was placed onto the magnetic rack, the magnetic beads were allowed to bind to DNA for 2 min (until the liquid became clear); and 40 μL of supernate was carefully taken by suction and transferred into a new 1.5 mL EP tube for next reaction, or it was stored in a refrigerator at −20° C.

[0269] 3. Quantitation and Normalization of the Sample

[0270] 2 μL of purified DNA was taken and subjected to Qubit dsDNA HS quantitation. The selected DNA fragment was normalized according to the concentration determined by Qubit quantitation, the mass of the DNA fragment was adjusted to 150 ng, and 1×TE was added to make up the total volume of 40 μL. If necessary, the normalized samples can be stored in a refrigerator at −20° C.

[0271] The size of the obtained DNA fragment was 300 bp to 500 bp.

[0272] 4. End Repair and A-Tailing

[0273] First, an end repair-A-tailing reaction solution was prepared according to Table 23.

TABLE-US-00032 TABLE 23 Composition of an end repair-A-tailing reaction solution Component Amount T4 10× PNK buffer (Enzymatics) 5 μL dATP (100 mM) (Enzymatics) 0.5 μL dNTPs (each 25 mM) (Enzymatics) 0.5 μL T4 DNA polymerase (3 U/μL) (Enzymatics) 2 μL T4 PNK (10 U/μL) (Enzymatics) 1 μL rTaq (5 U/μL) (Enzymatics) 1 μL Enzyme-free water (Sigma) 1 μL

[0274] 10 μL of prepared end repair-A-tailing reaction solution was added to and uniformly vortex-mixed with 40 μL of product of step 3; the mixture was subjected to transient centrifugation; and the total volume of the mixture was made up to 50 μL. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 14° C. for 15 min; 37° C. for 25 min; 65° C. for 15 min; and 4° C. forever, and the heated lid of the PCR instrument was set to 70° C.

[0275] 5. Ligation of an Adapter

[0276] An adapter sequence used in the present protocol is as follows (in the present example, the 5′-end of the sequence is on the left side, the 3′-end of the sequence is on the right side, “//” represents a modifying group, “phos” represents phosphorylation, and the underlined bases represent a barcode of 10 bases).

TABLE-US-00033 Phosphorylated adapter B strand: (SEQ ID NO: 7) /Phos/TCTCAGTACGTCAGCAGTTNNNNNNN NNNCAACTCCTTGGCTCACAGAACGACATGGC TACGATCCGACTT; and phosphorylated adapter T strand: (SEQ ID NO: 6) /Phos/AGTCGGAGGCCAAGCGGTCTTAGGAA GACAANNNNNNNNNNCTGATAAGGTCGCCATG CC, where N may be A, T, C or G.

[0277] Preparation of the adapter: 20 μL of adapter B strands (100 μM), 20 μL of adapter T strands (100 μM), and 40 μL of 2×adapter buffer (components: 50 mM Tris-HCl (pH=8.0), 0.1 mM EDTA, and 50 mM NaCl) were mixed to prepare adapters A (25 μM); and the adapters A were placed at the room temperature for more than half an hour and then diluted to a use concentration or stored at −20° C. Before use, the adapters A (25 μM) were diluted with TE to prepare adapters B (6 μM).

[0278] 5 μL of the prepared adapters B (6 μM) was added to and thoroughly mixed with the product of step 4.

[0279] A ligation reaction solution was prepared according to Table 24.

TABLE-US-00034 TABLE 24 Composition of a ligation reaction solution Component Amount 10× T4 PNK buffer (Enzymatics) 3 μL 0.1M ATP (Thermo) 0.8 μL 50% PEG8000 (Rigaku) 16 μL T4 DNA ligase (600 U/μL) (Enzymatics) 5 μL Enzyme-free water (Sigma) 0.2 μL Total volume 25 μL

[0280] The prepared ligation reaction solution was uniformly vortex-mixed with the mixture of the adapters B and the product of step 4, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 25° C. for 30 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 30° C. After the reaction was completed, 20 μL of TE buffer was added, 50 μL XP magnetic beads was added for purification, and the collected product was dissolved in 50 μL of TE buffer.

[0281] 6. Single-Strand Cyclization

[0282] 48 μL of purified product was incubated at 95° C. for 3 min and at 4° C. for 10 min.

[0283] A single-strand cyclization reaction solution was prepared according to Table 25.

TABLE-US-00035 TABLE 25 Composition of a single-strand cyclization reaction solution Component Amount 10× TA buffer (Epicenter) 6 μL 100 mM ATP (Thermo) 0.6 μL 20 μM mediation fragments 2.5 μL T4 DNA ligase (600 U/μL) (Enzymatics) 1 μL Enzyme-free water (Sigma) 1.9 μL Total volume 12 μL

[0284] 12 μL of the prepared single-strand cyclization reaction solution was uniformly vortex-mixed with 48 μL of thermal denaturation product, and the mixture was subjected to transient centrifugation. The reaction sample was placed into the PCR instrument for reaction, the reaction conditions were as follows: 37° C. for 60 min; and 4° C. hold, and the heated lid of the PCR instrument was set to 42° C.

[0285] 20 μM fragments for mediation have a corresponding complementary sequence to be ligated to both ends of the single strand. The corresponding complementary sequence is (in the present example, the 5′-end of the sequence is on the left side, and the 3′-end of the sequence is on the right side): TGCTGACGTACTGAGAGGCATGGCGACCT (SEQ ID NO: 8).

[0286] 7. Digestion of a Linear Single Strand

[0287] A digestion reaction solution was prepared according to Table 26.

TABLE-US-00036 TABLE 26 Composition of a digestion reaction solution Component Amount 10× TA buffer (Epicenter) 0.4 μL ExoI (20 U/μL) (Enzymatics) 2 μL ExoIII (10 U/μL) (Enzymatics) 1 μL Enzyme-free water 0.6 μL Total volume 4 μL

[0288] 4 μL of prepared digestion reaction solution was added to and uniformly mixed with 60 μL of reaction product of the previous step. The mixture was incubated at 37° C. for 30 min, and added and uniformly mixed with 3 μL of EDTA (500 mM, Ambion). A product was purified and collected with 120 μL of XP magnetic beads, and dissolved in 30 μL of TE buffer.

[0289] 8. Quantitation of a Single-Stranded Circle

[0290] The single-stranded cyclization product obtained through the digestion of the linear single strand in the previous step was quantitated by using a Qubit ssDNA Assay Kit.

[0291] 9. Sequencing

[0292] DNA nanoballs were prepared with the constructed single-stranded circular DNA library and sequenced on MGISEQ-2000 PE15. The sequencing and data analysis followed the standard operating process of MGISEQ-2000 PE150.

[0293] 10. Library Construction and Sequencing Results Ofthe Present Example

[0294] Concentration detection results ofthe products in the respective steps are shown in Table 27. Table 28 shows the sequencing quality of the human sample WGS PCR-free library (based on digestion interruption) obtained by the library construction and sequencing method of the present example. Table 28 indicates that the human sample WGS PCR-free library (based on digestion interruption) has relatively high sequencing quality on the high-throughput sequencing platform MGISEQ-2000RS PE150, self-developed by MGI.

TABLE-US-00037 TABLE 27 Concentrations detection results of the products in the respective steps Concentration of the selected fragment 3.35 ng/μL Total mass of the selected fragment 150.75 ng Concentration of the single-stranded circle 1.25 ng/μL

TABLE-US-00038 TABLE 28 Sequencing quality of the human sample WGS PCR-free library (based on digestion interruption) obtained by the library construction and sequencing method of the present example Digestion interruption + Covaris dual-barcode interrup- Acceptance adapter tion level (PE150) (PE100) Insert size of the main 424 405 band (bp) Clean read1 Q30 (%) 97.4 89.71 Clean read2 Q30 (%) >80 97.63 87.57 Clean Q20 (%) 93.37 96.645 Clean Q30 (%) 93.33 88.64 GC content (%) 39-42 41.08 41.05 read_1 (AT) <0.5%   0.22 0.06 read_1 (CG) — 0.17 0.36 read_2 (AT) <1% 0.42 0.58 read_2 (CG) <1% 0.38 0.54 Mapping rate (%) >98 99.98 99.17 Unique rate (%) >93 99.41 98.82 Duplicate rate (%)  <3 0.59 1.18 Average seq depth (X)  30 31 30.33 Coverage (%) >99 99.16 99.09 Coverage at least 20X (%) >90 93.73 94.21 Chimerical rate (%) 1.62 0.99 Coverage bias Low Dropout 0.0438 0.0419 Coverage bias High Dropout 0.0408 0.0364 Note: Covaris interruption (PE100) serves as a comparative PCR-free example, and using the same library construction system, indicating that library construction based on digestion interruption combined with a dual-barcode adapter has the same effect as the library construction based on physical interruption.

[0295] Table 29 shows SNP and Indel variation detection and analysis results of the NA12878 PCR-free library (based on NEB digestion interruption) obtained by the library construction and sequencing method of the present example. Table 29 indicates that the PCR-free library (based on digestion interruption) of the present disclosure is significantly superior to the PCR library in terms of Indel calling, and its overall performance is similar to that of NovaSeq PCR-free PE150 on the Illumina platform.

TABLE-US-00039 TABLE 29 SNP and Indel variation detection and analysis results of the NA12878 WGS PCR-free library (based on digestion interruption) Digestion interruption + Covaris Accep- dual-barcode interrup- NovaSeq tance adapter tion PCR free level (PE150) (PE100) (PE150) snp_True-pos-call 3.19E+06 3.19E+06 3E+06 snp_False-pos 1.87E+03 6.65E+03 2045 snp_False-neg 1.94E+04 1.76E+04 8809 snp_Precision >0.995 0.9994 0.9979 0.9994 snp_Sensitivity >0.99 0.9939 0.9945 0.9973 snp_F-measure 0.9967 0.9962 0.9983 indel_True-pos-call 4.74E+05 4.70E+05 473679 indel_False-pos 3.81E+03 5.20E+03 4732 indel_False-neg 6.86E+03 1.17E+04 7588 indel_Precision >0.98 0.992  0.9891 0.9901 indel_Sensitivity >0.97 0.9857 0.9757 0.9842 indel_F-measure 0.9889 0.9823 0.9872 Note: Covaris interruption (PE100) serves as a comparative PCR-free example, using the same library construction system, indicating that the library construction based on digestion interruption has the same effects as the library construction based on physical interruption.

INDUSTRIAL APPLICATION

[0296] The PCR-free construction solutions provided by the present disclosure overcomes the problems such as base pairing mistake, data bias, and repetitive sequences, which may be introduced by PCR during library construction. Furthermore, these solutions are compatible with library construction based on different interruption methods and small inputs. In combination with the nanoball preparation method based on rolling circle replication, the PCR-free library construction method of the present disclosure achieves true PCR-free library construction and sequencing for samples, thereby achieving whole PCR-free process. In the present disclosure, by adopting an optimized system for end repair and adapter ligation and the one-step reaction of single-strand cyclization and rolling circle replication, the library construction efficiency of the self-developed platform PCR-free library construction kit is improved, and required DNA inputs are reduced. The library construction system of the present disclosure is compatible with different types of starting samples, which include, but are not limited to, genomic DNA, interrupted DNA, DNA or an interrupted DNA product obtained by whole genome amplification, amplicon DNA, cfDNA, and DNA obtained by reverse transcription of RNA. Specifically, compared to the prior art, the present disclosure has the following advantages. 1) Wide applicability: the present disclosure is applicable to all species having known or unknown reference sequences; it can be adopted by general molecular biology laboratories; and it is compatible with library construction based on physical interruption and digestion interruption, compatible with different types of samples, which include, but are not limited to, genomic DNA, interrupted DNA, DNA or an interrupted DNA product obtained by whole genome amplification, amplicon DNA, cfDNA, and DNA obtained by reverse transcription of RNA. 2) Simple operation and shorter time for library construction: according to the present disclosure, the end repair and the A-tailing reaction are performed in the same tube; the magnetic bead purification is omitted to directly perform the adapter ligation; and the conventional PCR amplification and purification are omitted, thereby greatly shortening the time for library construction. Furthermore, according to the library construction method, the cyclization and the rolling circle replication are performed simultaneously, thereby further shortening the time for library construction. 3) High library construction efficiency: according to the library construction method, by adopting the optimized system for end repair and A-tailing, the optimized system for adapter ligation, and the one-step of cyclization and rolling circle replication reaction, a pooling library construction and sequencing with small inputs of starting samples as well as the PCR-free library construction using 200 μL of plasma DNA can be achieved. 4) Enhanced accuracy of sequencing data on the self-developed platform: the methods of the present disclosure achieve the true PCR-free library construction and sequencing, which can improve the accuracy and sensitivity of SNP and InDel detection, and the methods of the present disclosure especially have excellent performance in term of InDel detection over other platforms from business competitors, for example, Illumina.