COMPOSITION FOR PREVENTING OR TREATING OSTEOARTHRITIS, COMPRISING MESENCHYMAL STEM CELL EXPRESSING TUMOR NECROSIS FACTOR-INDUCIBLE GENE 6

Abstract

The present application relates to a use for cartilage regeneration and/or use for osteoarthritis treatment of a mesenchymal stem cell expressing TSG-6 protein. The present application provides a composition for cartilage regeneration and a pharmaceutical composition for osteoarthritis treatment, comprising a mesenchymal stem cell expressing TSG-6 protein as an active ingredient. The composition for cartilage regeneration and/or the pharmaceutical composition for osteoarthritis treatment provided by the present application can increase collagen expression of cartilage cells, reduce inflammation, and restore the cartilage structure.

Claims

1. A method for regenerating cartilage, comprising administering to a subject in need thereof a pharmaceutically effective amount of a mesenchymal stem cell expressing a TSG-6.

2. The method for regenerating cartilage according to claim 1, wherein the mesenchymal stem cell expressing TSG-6 protein is a recombinant mesenchymal stem cell comprising one or more selected from the group consisting of a gene encoding TSG-6 protein and a recombinant vector comprising the gene encoding TSG-6 protein.

3. The method for regenerating cartilage according to claim 1, wherein an expression level of the TSG-6 protein is 10 to 200 ng/100,000 cells/24 hours, an expression level of the TSG-6 protein is 10 to 50,000 ng/mL/24 hours, or both.

4. The method for regenerating cartilage according to claim 1, wherein an expression level of collagen II protein in at least one selected from the group consisting of a chondrocyte and cartilage tissue administered with the mesenchymal stem cell expressing TSG-6 protein, is increased compared to a non-administered control group.

5. The method for regenerating cartilage according to claim 1, wherein an expression level of an inflammatory index in at least one selected from the group consisting of a chondrocyte, cartilage tissue, a synoviocyte and synovial tissue administered with the mesenchymal stem cell expressing TSG-6 protein, is reduced compared to a non-administered control group, and the inflammatory index is at least one selected from the group consisting of TGF-b1, TNF-a, IFN-r, and IL-6.

6. A method for prevention or treatment of osteoarthritis, comprising administering to a subject in need thereof a pharmaceutically effective amount of a mesenchymal stem cell expressing a TSG-6 protein.

7. The method for prevention or treatment of osteoarthritis according to claim 6, wherein the mesenchymal stem cell expressing TSG-6 protein is a recombinant mesenchymal stem cell comprising one or more selected from the group consisting of a gene encoding TSG-6 protein and a recombinant vector comprising the gene encoding TSG-6 protein.

8. The method for prevention or treatment of osteoarthritis according to claim 7, wherein an expression level of the TSG-6 protein is 10 to 200 ng/100,000 cells/24 hours, an expression level of the TSG-6 protein is 10 to 50,000 ng/mL/24 hours, or both.

9. The method for prevention or treatment of osteoarthritis according to claim 7, wherein the method increases an expression level of collagen II protein in at least one selected from the group consisting of a chondrocyte and cartilage tissue compared to a non-administered control group, decreases of an expression level of at least one inflammatory index selected from the group consisting of TGF-b1, TNF-a, IFN-r, and IL-6 in one or more selected from the group consisting of a chondrocyte, cartilage tissue, a synoviocyte and synovial tissue, compared to a non-administered control group, or both.

10. The method for prevention or treatment of osteoarthritis according to claim 6, wherein the mesenchymal stem cell is administered intra-articularly.

11. The method for prevention or treatment of osteoarthritis according to claim 6, wherein the mesenchymal stem cell is administered by injection.

12. A method for expressing collagen II protein, comprising administering to a subject in need thereof a pharmaceutically effective amount of a mesenchymal stem cell expressing a TSG-6 protein.

13. The method for expressing collagen II protein according to claim 12, wherein the mesenchymal stem cell expressing TSG-6 protein is a recombinant mesenchymal stem cell comprising one or more selected from the group consisting of a gene encoding TSG-6 protein and a recombinant vector comprising the gene encoding TSG-6 protein.

14. The method for expressing collagen II protein according to claim 12, wherein an expression level of the TSG-6 protein is 10 to 200 ng/100,000 cells/24 hours, an expression level of the TSG-6 protein is 10 to 50,000 ng/mL/24 hours, or both.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIG. 1 is a graph of the result of performing ELISA to measure the expression level in selected two kinds of TSG-6 MSC and control group (TSG-6 non-transduced group).

[0055] FIG. 2a is a schematic diagram of co-culture experiment design to confirm the collagen expression level for chondrocytes in vitro.

[0056] FIG. 2b is a graph showing the quantified values (collagen II protein expression level/GAPDH expression level) of the western blot result confirming the expression level of collagen II and the control group (GADPH) in each group.

[0057] FIG. 3a is a microscope photograph confirming the degree of recovering the cartilage tissue by each group in an osteoarthritis rabbit model through safranine O staining (scale bar: 160 um, arrows in -B-: mark clones).

[0058] FIG. 3b is graphs of measuring the cartilage thickness by each group in the direction of femur and tibia, respectively, in an osteoarthritis rabbit model and the result showing the statistical significance. n.s.: not significant; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001 (hereinafter, same).

[0059] FIG. 4a is a photograph of the IHC staining result for TGF-b1 according to each group in the cartilage of the osteoarthritis rabbit model.

[0060] FIG. 4b is graphs of measuring the immunoreactivity of TGF-b1 by each group in an osteoarthritis rabbit model and the result showing the statistical significance.

[0061] FIG. 5a is a photograph of the IHC staining result for TNF-a according to each group in the cartilage of the osteoarthritis rabbit model.

[0062] FIG. 5b is graphs of measuring the immunoreactivity of TNF-a by each group in an osteoarthritis rabbit model and the result showing the statistical significance.

[0063] FIG. 6a is a photograph of the IHC staining result for IFN-r according to each group in the cartilage of the osteoarthritis rabbit model.

[0064] FIG. 6b is graphs of measuring the immunoreactivity of IFN-r by each group in an osteoarthritis rabbit model and the result showing the statistical significance.

[0065] FIG. 7a is photographs of the IHC staining result for IL-6 according to each group in the cartilage of the osteoarthritis rabbit model.

[0066] FIG. 7b is graphs of measuring the immunoreactivity of IL-6 by each group in an osteoarthritis rabbit model and the result showing the statistical significance.

[0067] FIG. 8a is photographs of the result of performing H&E staining for each group in the synovial membrane of the osteoarthritis rabbit model.

[0068] FIG. 8b is graphs showing the thickness of the synovial epithelial cells and the number of inflammatory cells as the result of H&E staining for each group in the synovial membrane of the osteoarthritis rabbit model and statistical significance thereof.

[0069] FIG. 9a is microscope photographs of the result of performing IHC staining for TGF-b1 and TNF-a for each group in the synovial membrane of the osteoarthritis rabbit model.

[0070] FIG. 9b is graphs of the result of measuring the immunoreactivity for TGF-b1 and TNF-a for each group in the synovial membrane of the osteoarthritis rabbit model and statistical significance thereof.

[0071] FIG. 10a is microscope photographs of the result of performing IHC staining for IFN-r and IL-6 for each group in the synovial membrane of the osteoarthritis rabbit model.

[0072] FIG. 10b is graphs of the result of measuring the immunoreactivity for IFN-r and IL-6 for each group in the synovial membrane of the osteoarthritis rabbit model and statistical significance thereof.

[0073] FIG. 11a is a graph showing the TSG-6 mRNA expression level of naïve MSC and TNF-a treated MSC and TSG-6 expression vector transduced MSC.

[0074] FIG. 11b is a graph showing the TSG-6 protein expression level of naïve MSC and TNF-a treated MSC and TSG-6 expression vector transduced MSC.

[0075] FIG. 11c is a graph showing the Col II mRNA expression level of chondrocyte co-cultured with naïve MSC and TNF-a treated MSC, or TSG-6 expression vector transduced MSC.

MODE FOR INVENTION

[0076] Hereinafter, the present disclosure will be described in more detail by examples. However, the following examples are intended to illustrate the present disclosure only, but the scope of the present disclosure is not limited by the following examples.

[0077] Unless otherwise mentioned herein, “AC” is an abbreviation of articular surface lining cartilage, and “OA” is an abbreviation of osteoarthritis.

Example 1. Production of TSG-6 Gene Transduced Mesenchymal Stem Cell

[0078] 1-1. Preparation of Lentivirus

[0079] After preforming codon optimization for TSG-6 cDNA sequence (Genbank accession no. NM 007115; SEQ ID NO: 3), a lentivirus vector comprising cDNA sequence (SEQ ID NO: 4) completing the codon optimization by requesting to SIRION-Biotech was prepared.

[0080] 1-2. TSG-6 Gene Transduction to Mesenchymal Stem Cell

[0081] As a mesenchymal stem cell (MSC), cord blood-derived mesenchymal stem cells were cultured in a medium for MSC culture under the conditions of 5% (v/v) CO.sub.2, 37 degrees Celsius. To the cultured MSC 50,000 cells or 100,000 cells, a lentivirus in which the TSG-6 cDNA was transduced was added and they were cultured under the conditions of 5% (v/v) CO.sub.2, 37 degrees Celsius for 24 hours again. The MSC in which the cDNA sequence of TSG-6 gene (TSG-6 MSC) was selected by ELISA.

Example 2. Confirmation of TSG-6 Protein Secretion Level in TSG-6 MSC

[0082] For confirmation of the TSG-6 protein secretion level in TSG-6 MSC prepared in Example 1, the TSG-6 protein secretion level was confirmed by performing ELISA. Specifically, as a control group, MSCs uninfected with a lentivirus comprising TSG-6 cDNA were used, and each MSC was cultured in a serum-free medium under the culture conditions of 5% CO.sub.2, 37° C. for 24 hours to measure the total amount of TSG-6 protein expressed for 24 hours.

[0083] In FIG. 1, a graph of the result of measuring the TSG-6 expression level in the TSG-6 MSC and control group was shown. As the result of measurement, it was confirmed that the TSG-6 transduced mesenchymal stem cell secreted about 10 to 100 ng/100,000 cells/24 hours of TSG-6 protein.

Example 3. Confirmation of Effect of Treating Osteoarthritis of TSG-6 MSC in Cartilage-Synoviocyte Co-Culture Model

[0084] To confirm the therapeutic effect for osteoarthritis of TSG-6 MSC at an in vitro level, the expression level of collagen II depending on addition of the TSG-6 MSC prepared in Example 1 under the cartilage-synoviocyte co-culture condition was confirmed.

[0085] In FIG. 2a, a schematic diagram of the experimental design was shown. Specifically, chondrocytes were inoculated in a U-bottom 96 well plate alone and cultured in a cartilage differentiation medium at 5% (v/v) CO.sub.2, 37° C. for 3 weeks (21 days) to form a cartilage aggregate, and this cartilage aggregate was co-cultured with synoviocytes at 5% CO.sub.2, 37° C. for 2 days, and then inflammation was induced by adding TNF-alpha (TNF-a) 10 ng/ml and interleukin 1-beta (IL1b) 10 ng/mL.

[0086] After 2 days of co-culture (inflammation induction), purified TSG-6 protein 200 ng/mL was added and cultured for 1 day, and then the synoviocytes were removed and the purified TSG-6 protein of 200 ng/mL was added as same as the concentration added in advance and cultured for 7 days again. For the experimental group to confirm the therapeutic effect for osteoarthritis of TSG-6 MSC, synoviocytes were removed after 3 days of co-culture and to express TSG-6 protein at a level of 10 ng/mL/24 hours or to express TSG-6 protein at a level of 30 ng/mL/24 hours, they were co-cultured for 7 days again at different amounts of TSG-6 MSC.

[0087] As a normal group, an inflammation non-induced group (No inflammation control, NIC) and as a negative control group, a group without addition of TSG-6 after inducing inflammation (Inflammation control, IC) were used. After that, using western blot, the expression level of collagen II protein by each group was measured, and as a control group, the expression level of GAPDH protein was confirmed.

[0088] In Table 1 below, each group was arranged and shown.

TABLE-US-00001 TABLE 1 Num- Inflam- ber Name mation TSG-6 MSC purified TSG-6 1 NIC X X X 2 IC ◯ X X 3 TSG6 ◯ X TSG-6 concentration 200 200 ng/mL 4 MSC ◯ TSG-6 expression level X 10 10 ng/mL/24 hr (5 × 10.sup.4 TSG-6 transduced MSCs) 5 MSC ◯ TSG-6 expression level X 30 30 ng/mL/24 hr (1.5 × 10.sup.5 TSG-6 transduced MSCs)

[0089] In FIG. 2b, the values (collagen II protein expression level/GAPDH expression level) of quantifying the western blot result by each group were shown.

[0090] As shown in FIG. 2b, collagen II protein was hardly produced in the inflammation-induced chondrocytes (column 2), but when added in a form in which TSG-6 protein was expressed in purified protein or TSG-6 MSC, the expression level of collagen II protein was increased in both. In addition, in both cases that the TSG-6 protein was added in a form of purified protein and it was added in a MSC form in which the TSG-6 expression vector was transduced, the expression level of collagen II protein increased depending on the TSG-6 protein concentration, but in particular, when the TSG-6 protein was added in a MSC form in which the TSG-6 expression vector (namely, a form that the TSG-6 protein was expressed in MSC) was transduced, compared to the case that the purified TSG-6 protein was added, the expression level of collagen II protein was higher, and when co-cultured with TSG-6 MSC expressing TSG-6 protein at a level of 30 ng/mL/24 hours, the expression level of collagen II protein at a similar level to NIC group was shown.

[0091] In other words, it was confirmed that the expression level of collagen II protein increased depending on the TSG-6 protein concentration, and the TSG-6 MSC expressing TSG-6 protein provided by the present disclosure had an effect of recovery of collagen II protein at a similar or more excellent level than purified TSG-6.

[0092] Through the corresponding result, it can be confirmed that the TSG-6 MSC provided by the present disclosure has an effect of cartilage regeneration and/or recovery, and thereby, it can be seen that it may be advantageously used for treatment of arthritis.

Example 4. Confirmation of Therapeutic Effect of TSG-6 MSC in Degenerative Osteoarthritis Rabbit Model

[0093] In order to confirm the therapeutic effect of TSG-6 MSC at an in vivo level, an experiment was performed in a degenerative osteoarthritis rabbit model.

[0094] Specifically, as the degenerative osteoarthritis rabbit model, female SPF New Zealand White rabbits (Kangda) (about 10 months old) were used, and during administration of TSG-6 MSC, and the like, the body weight was about 3.9 kg. The rabbit model was divided into 6 groups in total. Brief description for each group was represented in Table 2 below.

TABLE-US-00002 TABLE 2 Number Name OA Description A Intact X Normal group B OA ◯ Negative control group (administering only an excipient) C TSG-6 I ◯ TSG-6 MSC 6.9 × 10.sup.5 cells administration group (TSG-6 concentration 200 ng/24 h) D TSG-6 II ◯ TSG-6 MSC 6.9 × 10.sup.6 cells administration group (TSG-6 concentration 2000 ng/24 h) E Naive I ◯ TSG-6 non-expressing MSC 6.9 × 10.sup.5 cells administration group F Naive II ◯ TSG-6 non-expressing MSC 6.9 × 10.sup.6 cells administration group

[0095] To C to F groups among 6 groups represented in the Table 2, the corresponding MSC was injected using a syringe, respectively. In 16 weeks after injection, a knee joint was harvested from each rabbit and the cartilage tissue was subjected to hematoxylin-eosin (H&E) staining, IHC staining or safranin O staining, and microscope observation and each immunoreactivity, measurement of epithelial thickness or analysis of the number of inflammatory cells was performed.

[0096] 4-1. Cartilage Structure Index Confirmation (Safranin O Staining)

[0097] The photograph of the result of safranin O staining was shown in FIG. 3a, and the graph of the result of measuring the thickness of the articular surface lining cartilage (AC) by each group on the side of femur and tibia, respectively, and the statistical significance were shown in FIG. 3b.

[0098] The average values of the measured AC thickness were shown, respectively, in Table 3 below. Femur means the AC thickness measured on the side of femur, and Tibia means the AC thickness measured on the side of tibia.

TABLE-US-00003 TABLE 3 Group Femur(um) Tibia(um) Intact 518.65 728.36 OA 218.19 114.10 TSG-6 I 345.64 417.73 TSG-6 II 481.00 480.91 Naive I 275.51 304.28 Naive II 331.45 328.84

[0099] All in the osteoarthritis (OA) groups, compared to the normal group, the cartilage thickness was significantly reduced, and in TSG-6 I and TSG-6 II groups, the cartilage thickness was significantly recovered, respectively, and in particular, as the concentration of TSG-6 protein increased, the increase in cartilage thickness tended to increase. This concentration dependence was more remarkably shown in the cartilage on the side of femur. In TSG-6 II group, in particular, the improvement of the cartilage structure was confirmed to the extent that there was no significant difference (n.s.: not significant) from the normal group. On the other hand, in Naïve groups, a significant difference was not observed between Naive I and Naive II groups.

[0100] 4-2. Inflammatory Index Confirmation Through Cartilage IHC Staining

[0101] In the cartilage tissue of each group of Table 2, immunohistochemistry staining (IHC staining) was performed for TGF-b1, TNF-a, IFN-r, and IL-6, respectively, to confirm the expression level of each inflammatory index, respectively.

[0102] The IHC staining result and immunoreactivity of each index measured on the side of femur and tibia were shown in FIG. 4a to FIG. 4b for TGF-b1, in FIG. 5a to FIG. 5b for TNF-a, in FIG. 6a to FIG. 6b for IFN-r and in FIG. 7a to FIG. 7b for IL-6, and the measurement values of each immunoreactivity were shown in Table 4 below. In Table 4 below, the numerical unit (%/mm.sup.2) of each inflammatory index expression level was omitted.

TABLE-US-00004 TABLE 4 Inflammatory index TGF-b1 TNF-a IFN-r IL-6 Region Femur Tibia Femur Tibia Femur Tibia Femur Tibia Intact 9.82 8.61 2.72 4.82 13.73 10.03 26.22 24.10 OA 53.62 65.11 51.73 63.68 50.06 63.15 66.16 66.89 TSG-6 I 27.63 24.06 29.29 20.26 23.44 21.49 43.28 38.11 TSG-6 II 14.07 20.08 20.94 19.26 15.14 20.17 32.99 30.19 Naive I 34.88 32.47 35.13 29.68 28.04 32.16 44.92 42.94 Naive II 30.68 27.84 29.12 21.69 26.60 22.18 42.34 38.76

[0103] In the OA group, the immunoreactivity of TGF-b1, TNF-a, IFN-r, and IL-6 was shown very high, but in all the TSG-6 MSC treatment groups, compared to the OA group, low immunoreactivity was shown. In particular, for TGF-b1, IFN-r, and IL-6, the immunoreactivity was reduced to the extent similar to the normal group (n.s.), and therefore, it was confirmed that the TSG-6 MSC provided by the present disclosure showed an excellent anti-inflammatory effect.

[0104] In addition, in the TSG-6 MSC treatment groups of the present disclosure, as the treatment dose increased, all of the numerical values of the immunoreactivity of the inflammatory index decreased, compared to the Naive groups showing a similar inflammatory index numerical value regardless of the administration dose, and thus it was confirmed that the anti-inflammatory activity was excellent.

[0105] 4-3. Inflammatory Index Confirmation Through Synovial H&E Staining

[0106] The synovial membrane of each group of Table 2 was isolated and H&E staining was performed, and the result was shown in FIG. 8a to FIG. 8b. FIG. 8a is a graph showing the synovial membrane epithelial thickness and a table showing its statistical significance and FIG. 8b is a graph showing the number of inflammatory cells per unit area and a table showing its statistical significance. In Table 5 below, the epithelial thickness measured in the synovial membrane and the number of inflammatory cells (IF cell) were shown, respectively.

TABLE-US-00005 TABLE 5 Synovial membrane Number of inflammatory Group epithelial thickness (um) cells (cells/mm.sup.2) Intact 9.15 34.00 OA 35.43 171.00 TSG-6 I 16.51 62.75 TSG-6 II 11.00 54.29 Naive I 17.39 75.71 Naive II 19.33 69.00

[0107] As could be confirmed in FIG. 8b, the synovial membrane epithelial thickness was reduced to the extent similar to Intact group from TSG-6 II group, and the number of inflammatory cells was also reduced to the extent similar to Intact group.

[0108] 4-4. Inflammatory Index Confirmation Through Synovial IHC Staining

[0109] In the synovial tissue of each group of Table 2, immunohistochemistry staining (IHC staining) was performed for TGF-b1, TNF-a, IFN-r, and IL-6, respectively, to confirm the expression level of each inflammatory index, respectively.

[0110] The IHC staining result for TGF-b1 and TNF-a by each group was shown in FIG. 9a, and the result of measuring the immunoreactivity of TGF-b1 and TNF-a by each group and the statistical significance were shown in FIG. 9b, and a graph of the result of measuring the immunoreactivity of IFN-r and IL-6 by each group and the statistical significance were shown in FIG. 10b. In Table 6 below, the result of measuring the expression level of inflammatory indexes by each group was shown.

TABLE-US-00006 TABLE 6 Group TGF-b1 TNF-a IFN-r IL-6 Intact 34.33 17.17 25.33 54.67 OA 297.67 203.67 279.00 285.00 TSG-6 I 122.75 77.50 117.75 127.00 TSG-6 II 87.14 68.71 94.00 93.43 Naive I 155.43 124.86 156.00 180.29 Naive II 146.00 97.75 146.00 141.50

[0111] As the result of IHC staining for synovial cells, in the OA group, each inflammatory index was greatly increased, compared to Intact group, but in TSG-6 MSC administration groups (TSG-6 I, and TSG-6 II), all the inflammatory indexes were reduced. In particular, in TSG-6 II group, the immunoreactivity for TGF-b1, IFN-r, and IL-6 was reduced to the extent similar to the normal group, and thus it was confirmed that the anti-inflammatory activity of TSG-6 MSC was excellent.

Example 5. Comparison of Expression Vector of TSG-6 Gene Transduced MSC and TNF-a Treated MSC

[0112] 5-1. Preparation of TNF-a Treated MSC

[0113] Cord blood-derived MSCs were activated with TNF-a. Briefly, the cord blood-derived MSCs were plated in an amount of 1×10.sup.5 cells in a 6-well plate including 2 ml Advanced MEM (Thermofisher, MA, US) medium comprising 10% (v/v) FBS per each well and cultured for 24 hours. Then, the medium was replaced with Advanced MEM medium including 1% (v/v) FBS and 10 ng/ml TNF-α (Peptrotech, NY, USA) and cultured for 24 hours. The cells were treated with 0.25% (w/v) trypsin together with 1 mM EDTA (Gibco) at 37° C. for 2 minutes for trypsinization. The collected cells were used for the following example.

[0114] 5-2. Comparison of TSG-6 mRNA Level (Reverse Transcription Quantitative Real-Time PCR: RT-qPCR)

[0115] The TSG-6 expression level (mRNA level) of a naive cord blood-derived MSC (or less, ‘MSC’; control group), the TSG-6 expression vector transduced cord blood-derived MSC prepared in Example 1.2 (or less, ‘TSG-6 transduced MSC’; test group) and the cord blood-derived MSC activated with TNF-α prepared in Example 5-1 (or less, ‘TNF-α treated MSC’; comparative group) for 24 hours was measured by RT-qPCR. According to the manufacturer's instructions using RNeasy Mini Kit (QIAGEN), the total RNA was extracted from the cells, and after synthesizing cDNA using SuperScript™ III First-Strand Synthesis System (Thermofisher), RT-qPCR was performed on QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystem) using Fast SYBR™ Green Master Mix (Thermofisher). As an endogenous control gene, GAPDH was used. The used primers were arranged in Table 7 below.

TABLE-US-00007 TABLE 7 Forward sequence SEQ ID Reverse sequence SEQ ID Gene (5′ to 3′) NO: (5′ to 3′) NO: TSG-6 TGGATGGCTAAGGGCAGAG 5 GCGTGTGGGTTGTAGCA 6 GAPDH GTCTCCTCTGACTTCAACAGCG 7 ACCACCCTGTTGCTGTAGCCAA 8

[0116] The obtained result was calculated as relative Ct values (TSG-6/GAPDH) and shown in FIG. 11a. The relative expression level was calculated using 2.sup.−ΔΔCt method. As shown in FIG. 11a, the relative TSG-6 expression level (mRNA level) of TNF-α treated MSC (comparative group) did not show a big difference from the control group MSC (3.47 times compared to the control group), whereas the relative TSG-6 expression level (mRNA level) of TSG-6 transduced MSC (test group) was significantly higher than the comparative group as well as the control group (about 1248 times compared to the control group, about 360 times compared to the comparative group).

[0117] 5-3. Comparison of TSG-6 Protein Level (ELISA)

[0118] The TSG-6 protein level expressed (secreted in a medium) in a naive cord blood-derived MSC (or less, ‘MSC’; control group), the TSG-6 expression vector transduced cord blood-derived MSC prepared in Example 1.2 (or less, ‘TSG-6 transduced MSC’; test group) and the cord blood-derived MSC activated with TNF-α prepared in Example 5-1 (or less, ‘TNF-α treated MSC’; comparative group) for 24 hours was measured using TSG-6 ELISA kit (Raybiotech, GA, US) according to the manufacturer's instructions.

[0119] The obtained result (ng/10.sup.5 cells/24 hours) was shown in FIG. 11b. As shown in FIG. 11b, the control group MSC and the comparative group TNF-α treated MSC had too low level of the TSG-6 protein secretion level to be measured, while the TSG-6 transduced MSC secreted TSG-6 protein at a significantly high level (about 70 ng/10.sup.5 cells/24 hours) compared to the control group MSC and the comparative group TNF-α treated MSC.

[0120] 5-4. Comparison of Collagen II mRNA Level (RT-qPCR)

[0121] A naive cord blood-derived MSC (or less, ‘MSC’; control group), the TSG-6 expression vector transduced cord blood-derived MSC (or less, ‘TSG-6 transduced MSC’; test group; See Example 1.2) and the cord blood-derived MSC activated with TNF-α (or less, ‘TNF-α treated MSC’; comparative group; See Example 5-1) were prepared, respectively. Each cord blood-derived MSC prepared as such was plated in an amount of 1×10.sup.5 cells in a 6-well transwell (Corning, Mass., US) including 2 ml Advanced MEM medium comprising 10% (v/v) FBS per each well and cultured for 24 hours. Then, the medium was replaced with Advanced MEM medium including 1% (v/v) FBS and 10 ng/ml TNF-a and cultured for 24 hours to induce the activated MSC.

[0122] Chondrocytes (derived from costal cartilage; See Example 3) were plated in an amount of 1×10.sup.5 cells in a 6-well plate including 2 ml Advanced MEM medium comprising 10% (v/v) FBS per each well and cultured for 24 hours. Then, the medium was replaced with Advanced MEM medium including 1% (v/v) FBS and 75 ng/ml IL-1b (Peptrotech, NY, US) and cultured for 24 hours to induce inflammation. They were co-cultured with the MSC activated in the 6-well transwell for 24 hours. The chondrocytes were treated with 0.25% (w/v) trypsin together with 1 mM EDTA (Gibco) at 37° C. for 2 minutes for trypsinization. The collected cells were used for the following comparison of the collagen II mRNA level (RT-qPCR).

[0123] The collagen II expression level (mRNA level) in chondrocytes co-cultured with the naive cord blood-derived MSC (MSC; control group), the TSG-6 expression vector transduced cord blood-derived MSC (TSG-6 transduced MSC; test group) or the cord blood-derived MSC activated with TNF-α (TNF-α treated MSC; comparative group) for 24 hours was measured by RT-qPCR. According to the manufacturer's instructions using RNeasy Mini Kit (QIAGEN), the total RNA was extracted from the cells, and after synthesizing cDNA using SuperScript™ III First-Strand Synthesis System (Thermofisher), RT-qPCR was performed on QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystem) using Fast SYBR™ Green Master Mix (Thermofisher). As an endogenous control gene, GAPDH was used. The used primers were arranged in the Table 8.

TABLE-US-00008 TABLE 8 Forward sequence SEQ ID Reverse sequence SEQ ID Gene (5′ to 3′) NO: (5′ to 3′) NO: collagen II CTCAAGTCGCTGAACAACCA 9 GTCTCCGCTCTTCCACTCTG 10 GAPDH GTCTCCTCTGACTTCAACAGCG 7 ACCACCCTGTTGCTGTAGCCAA  8

[0124] The obtained result was calculated as relative Ct values (Collagen II/GAPDH) and shown in FIG. 11c. The relative expression level was calculated using 2.sup.−ΔΔCt method. As shown in FIG. 11c, the relative collagen II expression level (mRNA level) of TNF-α treated MSC (comparative group) did not show a big difference from the control group MSC (1.03 times compared to the control group), whereas the relative collagen II expression level (mRNA level) of TSG-6 transduced MSC (test group) was significantly higher than the comparative group as well as the control group (about 1.93 times compared to the control group, about 1.87 times compared to the comparative group). This result confirmed that the TSG-6 expression vector transduced MSC had a significantly excellent collagen II expression effect in chondrocytes, compared to the naive MSC as well as the TNF-α activated (inducible) MSC, and this result demonstrates the excellent cartilage regeneration effect and/or osteoarthritis treatment effect of the TSG-6 expression vector transduced MSC.