METHOD FOR PREPARING 3-HYDROXYPROPIONIC ACID THROUGH TWO STEPS

Abstract

The present invention relates to a method for preparing 3-hydroxypropionic acid (3-HP) and/or a method for improving the productivity of 3-HP, the methods comprising the steps of: performing high-concentration cell culturing of a 3-HP-producing strain; and (2) isolating high-concentration-cultured cells to inoculate a medium for 3-HP production with same, thereby producing 3-HP, and thus the present invention can improve the productivity and yield of 3-HP.

Claims

1. A method for manufacturing of 3-hydroxypropionic acid (3-HP), comprising; (1) performing high concentration cell culture of a 3-hydroxypropionic acid (3-HP) producing strain; and (2) producing 3-hydroxypropionic acid by separating the high concentration cells cultured and inoculating the high concentration cells separated to a medium for producing 3-hydroxypropionic acid, wherein in the step (2), cell proliferation does not occur.

2. The method according to claim 1, wherein the step (1) is performed by a fed-batch culture method, and the step (2) is performed by fermentation.

3. The method according to claim 1, wherein the step (1) is performed in a medium comprising glucose as a carbon source.

4. The method according to claim 1, wherein the step (1) is performed in a medium not comprising glycerol as a carbon source.

5. The method according to claim 1, wherein the step (2) is performed in a medium comprising glycerol as a carbon source.

6. The method according to claim 1, wherein the step (2) is performed in a medium not comprising glucose as a carbon source.

7. The method according to claim 1, wherein the 3-HP producing strain comprises a gene encoding one or more proteins selected from the group consisting of glycerol dehydratase and aldehyde dehydrogenase.

8. The method according to claim 1, wherein 3-hydroxypropionic acid yield is 80% or higher.

9. The method according to claim 1, wherein 3-hydroxypropionic acid productivity is 2 g/L/h or more.

10. The method according to claim 1, wherein the 3-hydroxypropionic acid is produced in 41 g/L or more upon performing the step (2) for 29 hours.

11. A culture solution of a 3-hydroxypropionic acid producing strain comprising 3-hydroxypropionic acid at a concentration of 45 g/L or more.

12. The culture solution according to claim 11, wherein a concentration of a by-product is 0.1% (w/v) or less and the by-product is selected from the group consisting of acetate and lactate.

13. A composition for manufacturing 3-hydroxypropionic acid comprising the culture solution of claim 11.

14. A composition for manufacturing 3-hydroxypropionic acid comprising the culture solution of claim 12.

15. The method according to claim 1, wherein the cell concentration upon completion of the step (1) is 10 to 100 g/L based on cell dry weight (g) per 1 L of medium.

16. The method according to claim 1, wherein OD.sub.600 at 20 hour after the start of the step (1) is 10 to 500.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0057] FIG. 1 is a graph showing the OD change according to the change of time as the result of performing high concentration cell culture of a 3-HP producing strain according to one example of the present invention.

[0058] FIG. 2 is a graph showing the result of measuring the concentration of 3-HP (3HP), glycerol, acetate and lactate over time, after inoculating the 3-HP producing strain cultured at a high concentration according to one example of the present invention in a medium for producing 3-HP (0h).

MODE FOR INVENTION

[0059] Hereinafter, the present invention will be described in more detail by examples. However, the following examples are intended to illustrate the contents of the present invention only, but the scope of the present invention is not limited by the following examples.

[0060] Unless otherwise mentioned herein, all temperatures are based on degrees Celsius, and nucleic acid sequences are described from the 5′ end to the 3′ end unless there is a particular circumstance.

Example 1. High Concentration Cell Culture of 3-HP Producing Strain

1-1. Manufacturing of 3-HP Producing Strain

[0061] A recombinant vector in which a gene encoding glycerol dehydratase and aldehyde dehydrogenase known to produce 3-hydroxypropionic acid (3-HP) using glycerol as a substrate is introduced was manufactured. A 3-HP producing strain was produced by introducing the manufactured recombinant vector into E. coli W3110 strain.

[0062] Specifically, a recombinant vector for producing 3HP (pCDF_J23101_dhaB_gdrAB_J23100_aldH) was produced by cloning a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH) and a gene encoding glycerol dehydratase reactivase (gdrAB) in a plasmid pCDF.

[0063] The pCDFDuetJ23 vector used for production of the recombinant vector is a vector in which the promoter portion of the pCDFDuet-1 vector was substituted with J23101 and J23100 promoters. The dhaB (U30903.1; about 2.7 kb; comprising dhaB1, dhaB2 and dhaB3) and gdrAB gene (about 2.2 kb; gdrA, gdrB) inserted into the vector were amplified using the primers of Table 1 below in the chromosome of Klebsiella pneumonia (ATCC 25955). Since the dhaB123 and gdrA genes were located side by side on the chromosome of Klebsiella pneumonia, they were amplified together, and as gdrB was located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately.

[0064] The aldH gene was amplified and isolated from the genome of E. coli K12 MG1655 strain using the promoter pair consisting of the nucleic acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 of Table 1 below. In Table 1 below, the nucleic acid sequences of primers used for amplification of each gene were shown, and among names, ‘-F’ means a forward promoter, and ‘-R-’ means a reverse promoter.

TABLE-US-00001 TABLE 1 SEQ ID Nucleic acid NO: Name sequence (5′>3′) 1 dhaB- GAATTCATGAAAAGATCAAAACGATT gdrA-F TGCAGTCCT 2 dhaB- AAGCTTGATCTCCCACTGACCAAAGCTGG gdrA-R 3 gdrB-F AAGCTTAGAGGGGGCCGTCATGTCGCTT TCACCGCCAG 4 gdrB-R CTTAAGTCAGTTTCTCTCACTTAACGGC 5 aldH-F ggtaccatgaattttcatcatctggc 6 aldH-R catatgtcaggcctccaggcttat

[0065] After amplification of each gene, dhaB123 and gdrA genes using restriction enzymes EcoRI and HindIII, and gdrB gene using restriction enzymes HindIII and AfIII were cloned in the downstream of J23101 promoter of the pCDFDuetaJ23 vector. aldH was cloned on the bottom of J23108 promoter using restriction enzymes KpnI and NdeI. The cloning method of each gene was performed by a method known in the art.

[0066] The plasmid was introduced into E. coli W3110 (KCCM 40219) by electroporation, to prepare a 3HP producing strain.

1-2. High Concentration Culture of Cells

[0067] The prepared 3-HP producing strain was subjected to high concentration cell culture in a 5 L fermenter (Working volume 2 L) using the fed-batch culture method.

[0068] Specifically, MR medium (KH.sub.2PO.sub.4 6.67 g, (NH.sub.4).sub.2HPO.sub.4 4 g, MgSO4.7H.sub.2O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL per 1 L; herein, Trace metal solution is 5M HCl 5 mL, FeSO.sub.4.7H.sub.2O 10 g, CaCl.sub.2 2 g, ZnSO.sub.4.7H.sub.2O 2.2 g, MnSO.sub.4.4H.sub.2O 0.5 g, CuSO.sub.4.5H.sub.2O 1 g, (NH.sub.4).sub.6Mo.sub.7O.sub.2.4H.sub.2O 0.1 g, and Na.sub.2B.sub.4O.sub.2.10H.sub.2O 0.02 g per 1 L) was used as a cell culture medium by adding glucose 20 g/L and antibiotics (streptomycin) 25 mg/L, and the temperature of 35 degrees Celsius was maintained. pH was maintained at 6.95 using ammonia water, and the amount of dissolved oxygen (DO) was maintained at 20% while increasing the stirring rate stepwise up to 900 rpm, and the aeration was maintained at 1 vvm.

[0069] For the fed-batch culture, the pH-stat feeding method was used, and glucose was added at 3 g/L.

[0070] As the culture time elapsed, the cell concentration was measured by measuring the absorbance (Optical Density, OD) using a UV-Spectrometer. In FIG. 1, a graph of changes of OD.sub.600 values over time was shown. At 20 hours after the start of the culture, OD.sub.600 was shown as about 120 (dry cell weight 30 g/L).

[0071] After completing the high concentration cell culture for 20 hours, the cells were collected by centrifuging the cell culture solution at 6,000 rpm at 4 degrees Celsius for 10 minutes. The collected cells were suspended with PBS (phosphate-buffered saline) and used for the following step.

Example 2. 3-HP Production Step

[0072] A medium for producing 3-HP was prepared by adding glycerol 70 g/L and vitamin B.sub.12 50 uM to M9 medium without glucose. The cell suspension prepared in Example 1-2 was inoculated to the medium for producing 3-HP so that the cell inoculum amount was 5 g/L (based on dry cell weight), and the 3-HP production step was performed in a 5 L fermenter (Working volume 2 L).

[0073] The culture condition for 3-HP production was maintained as the temperature of 35° C. Celsius, the stirring rate of 300 rpm and the aeration of 1 vvm, and the pH was maintained at 7.0 using Ca(OH).sub.2.

[0074] The concentration of 3-HP, glycerol, acetate and lactate was measured by high pressure lipid chromatography (HPLC) over time in the 3-HP production process, and the result was shown in Table 2 and FIG. 2 below. Table 2 is the result of measuring the concentration (g/L) of 3-HP, glycerol, acetate and lactate according to the fermentation time after inoculation in the culture step for producing 3-HP (two-step culture).

TABLE-US-00002 TABLE 2 3-HP Glycerol Acetate Lactate Concentration before inoculation 0 71.68 0.47 0.31 (g/L) Concentration after fermentation 53.34 15.93 0 0 for 29 hours (g/L) 3-HP yield (%) 95.7 — — — 3-HP productivity (g/L/h) 2.94 — — —

[0075] As confirmed in FIG. 2, the 3-HP concentration was shown as 50.0 g/L or more over 17 hours after inoculating the strain into the medium for producing 3-HP, and the productivity was confirmed as 2.94 g/L/h, and thus the highest 3-HP productivity among values reported in documents to date was confirmed.

[0076] When 29 hours elapsed after inoculation, the final 3-HP concentration was confirmed as 53.3 g/L, and the yield was about 95.7%, and the very excellent yield and 3-HP productivity were shown, while lactate and acetate, by-products of 3-HP production were hardly produced by 29 hours elapsed.

Comparative Example 1. Comparison to 1-step 3-HP Production Method

[0077] To compare the 3-HP productivity of the two-step production method using a medium for producing 3-HP without glucose provided in the present application to the conventional one-step production method, the 3-HP producing strain prepared in Example 1-1 was cultured by a fed-batch culture method, and the cell growth and 3-HP production were simultaneously progressed by adding glucose required for cell growth and glycerol as a substrate to the culture medium (one-step production method).

[0078] The one-step production process performed for the comparison was specifically described as follows: the culture medium was used by adding glucose 20 g/L and antibiotics for selection (streptomycin) 25 mg/L to the MR medium of Example 1-2, and the temperature of 35 degrees Celsius was maintained. The pH was maintained as 6.95 using ammonia water, and the amount of dissolved oxygen (DO) was maintained as 20% by increasing the stirring rate stepwise by 900 rpm, and the aeration was maintained as 1 vvm.

[0079] When the glucose initially added in the culture medium was consumed, 3 g/L of glucose was added in a continuous feeding method, and glycerol was added at 70 g/L after 20 hours of culture. The subsequent process was performed in the same manner as Example 2.

[0080] The yield and productivity of 3-HP prepared by the 3-HP production process were measured by high pressure liquid chromatography (HPLC). The result of the 3-HP yield and productivity obtained in this way was shown in Table 3 below by comparing to the 3-HP yield and productivity by the two-step 3-HP production process conducted in Examples 1 and 2.

TABLE-US-00003 TABLE 3 1-step 2-step production method production method 3-HP yield (%) 85 95.7 3-HP productivity (g/L/h) 1.5 2.94 By-products Acetate 3 g/L — Lactate 2 g/L

[0081] As confirmed in Table 3 above, the two-step 3-HP production method had the excellent 3-HP yield and productivity, compared to the conventional one-step production method. In addition, the excellence of the two-step production method of 3-HP was confirmed as the by-products, acetate and lactate were not produced in the two-step 3-HP production method, different from the one-step production method.