GENE THERAPY VECTOR WITH MINIMIZING RECOMBINATION, RECOMBINANT RETROVIRUS COMPRISING THE VECTOR, AND PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE RECOMBINANT RETROVIRUS
20230265458 · 2023-08-24
Inventors
Cpc classification
A61K31/522
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
C12N9/78
CHEMISTRY; METALLURGY
C07K14/70596
CHEMISTRY; METALLURGY
C07K14/535
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12N2740/13043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
C07K14/535
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
A61K31/522
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
Abstract
Disclosed is a gene therapy vector in which the occurrence of recombination is minimized. In order to minimize the occurrence of recombination, which is a major problem in the production and infection of a retroviral vector virus that continuously expresses a therapeutic gene during virus replication, a cleaved MCMV promoter was prepared by cutting the MCMV promoter on the basis of a repeat sequence, and the cleaved MCMV promoter was introduced to prepare a vector. It was confirmed that the vector having the cleaved MCMV promoter incorporated therein does not cause recombinations even after being incubated multiple times, and shows a continuous expression of the therapeutic protein, and in cells transfected with the virus containing the vector, cell death effectively occurs when a prodrug is administered thereto. Accordingly, the vector with minimized recombination occurrence of the present invention can be advantageously used for the treatment of cancer.
Claims
1. A replicating-retrovirus vector with minimized recombination occurrence, comprising a first recombinant expression vector containing a Gag-Pol gene, a sEF1α (short elongation factor 1α) promoter or a MCMV (murine cytomegalovirus) promoter, and a first therapeutic gene; and a second recombinant expression vector containing an Env gene of a virus, an MCMV promoter and a second therapeutic gene, wherein the MCMV promoter is a cleaved MCMV promoter selected from the group consisting of polynucleotides having the nucleotide sequences represented by SEQ. ID. NO: 4, NO: 5, NO: 6 and NO: 7.
2. The replicating-retrovirus vector with minimized recombination occurrence according to claim 1, wherein the Gag-Pol gene is a Gag-Pol gene of Gibbon ape Leukemia virus (GaLV) or amphotropic murine leukemia virus (MuLV).
3. The replicating-retrovirus vector with minimized recombination occurrence according to claim 1, wherein the MCMV promoter is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 3.
4. The replicating-retrovirus vector with minimized recombination occurrence according to claim 1, wherein the sEF1α promoter is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 18.
5. The replicating-retrovirus vector with minimized recombination occurrence according to claim 1, wherein the virus Env gene is any one derived from the group consisting of Gibbon ape Leukemia virus (GaLV), amphotropic murine leukemia virus (MuLV), xenotropic murine leukemia virus (xenotropic MuLV), feline endogenous retrovirus (RD114), vesicular stomatitis virus (VSV) and measles virus (MV) Env genes.
6. The replicating-retrovirus vector with minimized recombination occurrence according to claim 1, wherein the first therapeutic gene or the second therapeutic gene is any one selected from the group consisting of a suicide gene, a cytokine gene, and a cancer antigen gene.
7. The replicating-retrovirus vector with minimized recombination occurrence according to claim 6, wherein the suicide gene is a thymidine kinase (TK) gene or a yeast cytosine deaminase (yCD) gene.
8. The replicating-retrovirus vector with minimized recombination occurrence according to claim 6, wherein the cytokine gene is a granulocyte macrophage colony-stimulating factor (GM-CSF).
9. The replicating-retrovirus vector with minimized recombination occurrence according to claim 6, wherein the cancer antigen gene is human CD19 (Cluster of Differentiation 19), CEA (Carcinoembryonic Antigen), or HER2 (human epidermal growth factor receptor 2).
10. The replicating-retrovirus vector with minimized recombination occurrence according to claim 9, wherein the human CD19 gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 43.
11. The replicating-retrovirus vector with minimized recombination occurrence according to claim 9, wherein the truncated human CD19 gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 53.
12. The replicating-retrovirus vector with minimized recombination occurrence according to claim 7, wherein the thymidine kinase or yeast cytosine deaminase gene activates a precursor drug.
13. The replicating-retrovirus vector with minimized recombination occurrence according to claim 12, wherein the precursor drug is at least one selected from the group consisting of ganciclovir (GCV) and 5-fluorocytosine (5-FC).
14. A recombinant retrovirus comprising the vector of claim 1.
15. A cell transfected or transduced with the recombinant retrovirus of claim 14.
16. A pharmaceutical composition for preventing or treating cancer comprising the recombinant retrovirus of claim 14 as an active ingredient.
17. A pharmaceutical composition for preventing or treating cancer comprising the cell transfected or transduced with the recombinant retrovirus of claim 15.
18. The pharmaceutical composition for preventing or treating cancer according to claim 16, wherein the cancer is selected from the group consisting of mucinous cell carcinoma, round cell carcinoma, locally advanced tumor, metastatic cancer, Ewing's sarcoma, cancer metastasis, lymphoid metastasis, squamous cell carcinoma, esophageal squamous cell carcinoma, oral carcinoma, multiple myeloma, acute lymphocytic leukemia, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, hairy cell leukemia, effluent lymphoma (celiac lymphoma), thymic lymphoma lung cancer, small cell lung carcinoma, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, adrenocortical cancer, ACTH-producing tumor, non-small cell lung cancer, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyps associated with colorectal neoplasia, pancreatic cancer, liver cancer, bladder cancer, primary superficial bladder tumor, invasive metastatic cell bladder carcinoma of the bladder, muscle invasive bladder cancer, prostate cancer, colorectal cancer, kidney cancer, liver cancer, esophageal cancer, ovarian carcinoma, cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneal epithelial neoplasia, cervical carcinoma, vaginal cancer, vulvar cancer, uterine cancer, follicular solid tumor, testicular cancer, penile cancer, renal cell carcinoma, brain cancer, head and neck cancer, neuroblastoma, brainstem glioma, glioma, metastatic tumor cell infiltration in the central nervous system, osteoma, osteosarcoma, malignant melanoma, tumor progression of human skin keratinocytes, squamous cell carcinoma, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilms' tumor, gallbladder cancer, trophoblastic tumor, hemangiopericytoma and Kaposi's sarcoma.
19. A gene delivery composition for treating cancer comprising the recombinant retrovirus of claim 14.
20. A method for preparing a replicating-retrovirus vector with minimized recombination occurrence comprising the following steps: 1) a step of preparing a first recombinant expression vector containing a Gag-Pol gene of MuLV (Murine Leukemia virus), a sEF1α promoter or an MCMV promoter, and a first therapeutic gene; and 2) a step of preparing a second recombinant expression vector containing an Env gene of a virus, an MCMV promoter, and a second therapeutic gene, wherein the MCMV promoter is selected from the group consisting of polynucleotides having the nucleotide sequences represented by SEQ. ID. NO: 4, NO: 5, NO: 6 and NO: 7.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0072] Hereinafter, the present invention is described in detail.
[0073] The present invention provides a replicating-retrovirus vector with minimized recombination occurrence, comprising a first recombinant expression vector containing a Gag-Pol gene of MuLV (Murine Leukemia virus), a sEF1α promoter or a MCMV promoter, and a first therapeutic gene; and a second recombinant expression vector containing an Env gene of a virus, an MCMV promoter and a second therapeutic gene.
[0074] The MCMV promoter is a 646 bp polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 3.
[0075] The MCMV promoter is a murine cytomegalovirus promoter, and it has been known that it induces several to several dozen times higher expression in specific cells than the promoter of the human cytomegalovirus (HCMV) IE gene (Lafemina R et al, J Gen Virol., 69, 355-374 (1988)), and induces uniformly stable expression in various cells (Aiba-Masago S et al., Am J Pathol. 154, 735-743 (1999)). In particular, it has been reported that the MCMV promoter in which a region upstream of a major immediate-early promoter (MIEP) site is removed induces very strong expression in primate and mouse cells (Kim and Risser, J. Virol. 67, 239-248 (1993); and Kim, Biochem. Biophys. Res. Comm., 203, 1152-1159 (1994)).
[0076] However, due to the repetitive nucleotide sequences in the MCMV promoter at 4 locations, the virus vector nucleotide sequences at other sites starting from the MCMV promoter are lost or some of the nucleotide sequences are lost within the promoter, resulting in recombination, which causes the therapeutic gene to be lost and causes a major problem in the production and infection of retroviral vector virus that continuously express the therapeutic gene.
[0077] Therefore, in order to minimize the occurrence of recombination, the MCMV promoter is characterized in that it is a cleaved MCMV promoter.
[0078] The cleaved MCMV promoter can be any one selected from the group consisting of polynucleotides having the nucleotide sequences represented by SEQ. ID. NO: 4, NO: 5, NO: 6 and NO: 7, preferably any one selected from the group consisting of polynucleotides having the nucleotide sequences represented by SEQ. ID. NO: 5, NO: 6 and NO: 7 SEQ, more preferably can be a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 6 or NO: 7, and most preferably can be a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 7.
[0079] In a specific embodiment of the present invention, it was confirmed that gene recombination occurred due to the repetitive nucleotide sequences in the MCMV promoter in the vector (spRRVe-yCD) containing MCMV promoter full-length sequence, GaLV env and the gene encoding yeast cytosine deaminase protein and the vector (sRRVgp-TK) containing a MCMV promoter full-length sequence, a gag-pol gene and the gene encoding thymidine kinase (TK) protein (
[0080] The sEF1α (short elongation factor 1α) promoter is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 18.
[0081] The virus Env gene is any one derived from the group consisting of Gibbon ape Leukemia virus (GaLV), amphotropic MuLV, xenotropic MuLV, feline endogenous retrovirus (RD114), vesicular stomatitis virus (VSV) and measles virus (MV) Env genes. The polynucleotide can include a variant having the above-described characteristics.
[0082] The GaLV Env gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 19.
[0083] The MuLV Env gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 20.
[0084] The first therapeutic gene or the second therapeutic gene can be any one selected from the group consisting of a suicide gene inducing suicide of cancer cells by administration of prodrugs, a cytokine gene such as interleukin-12 or GM-CSF promoting immune responses, and a tumor-specific cancer antigen gene such as CD19, CEA or HER2.
[0085] The suicide gene can be a thymidine kinase (TK) gene or a yeast cytosine deaminase (yCD) gene.
[0086] The first therapeutic gene and the second therapeutic gene are at least one selected from the group consisting of a thymidine kinase (TK) gene, a yeast cytosine deaminase (yCD) gene and a human CD19 gene.
[0087] The thymidine kinase gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 21. The polynucleotide can include not only a polynucleotide sequence encoding the amino acid sequence of a thymidine kinase protein, but also a polynucleotide having the nucleotide sequence substantially identical to that of the polynucleotide, and a fragment thereof. The polynucleotide having the substantially identical nucleotide sequence can have 80% or more, specifically 90% or more, more specifically 95% or more homology with the polynucleotide of the present invention. As described above, the polynucleotide of the present invention can include a variant in which one or more nucleotide sequences are substituted, deleted, or inserted, as long as it encodes a protein having an activity equivalent thereto.
[0088] The yeast cytosine deaminase (yCD) gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 22.
[0089] The cytosine deaminase gene may be a gene optimized with human codons.
[0090] The term “optimized with human codons” used in this specification means that when DNA is transcribed and translated into proteins in host cells, there are preferred codons depending on the host between the codons designating amino acids, which are replaced with human codons to increase the expression efficiency of amino acids or proteins encoded by the nucleic acids.
[0091] The thymidine kinase gene or the yeast cytosine deaminase gene activates a precursor drug. The precursor drug is at least one selected from the group consisting of ganciclovir (GCV) and 5-fluorocytosine (5-FC). In one embodiment of the present invention, the thymidine kinase gene can activate ganciclovir, and the yeast cytosine deaminase gene can activate 5-fluorocytosine.
[0092] The granulocyte macrophage colony stimulating factor (GM-CSF) may be one optimized with human codons.
[0093] The term “optimized with human codons” used in this specification means that when DNA is transcribed and translated into proteins in host cells, there are preferred codons depending on the host between the codons designating amino acids, which are replaced with human codons to increase the expression efficiency of amino acids or proteins encoded by the nucleic acids.
[0094] The human CD19 (Cluster of Differentiation 19) gene can be a truncated human CD19 gene in which amino acids in the cytoplasmic domain are removed, and 233 amino acids in the cytoplasmic domain may be removed.
[0095] The human CD19 gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 43 or NO: 53.
[0096] The gag gene can be a polynucleotide encoding four types of proteins constituting the retrovirus core. Meanwhile, the pol gene is a polynucleotide encoding retrovirus reverse transcriptase, and the env gene is a polynucleotide encoding retrovirus envelope glycoprotein.
[0097] The MuLV-Gag gene is a Gag gene of murine leukemia virus and may be a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 23. The MuLV-Pol gene is a Pol gene of murine leukemia virus and may be a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 24. The MuLV Gag-Pol gene may be a polynucleotide composed of a nucleotide sequence in which the nucleotide sequences represented by SEQ. ID. NO: 23 and 24 are fused.
[0098] The term “replicable” used in this specification means that a virus vector can replicate itself in cells in which a viral genome containing a specific gene is transduced or infected with a virus vector containing animal cells or a specific gene.
[0099] As used herein, the term “replicating-retrovirus vector” is a vector that produces a non-lytic virus, and since it enters into the nucleus through a crack in the nuclear membrane, it can specifically infect dividing cells, that is, cancer cells, and thus the inserted gene can be prevented from being expressed in other normal cells. Therefore, the vector can safely deliver genes to cancer cells, and can increase gene delivery efficiency because it can replicate viruses.
[0100] In a specific embodiment of the present invention, four cleaved MCMV promoters having the sizes of 470 bp, 337 bp, 237 bp, and 160 bp, respectively, were prepared by removing repetitive nucleotide sequences in the MCMV promoter to minimize recombination (Table 2). In addition, GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK and spRRVe-F4-TK) and MuLV-based vectors (sRRVe-TK, sRRVe-F1-TK, sRRVe-F2-TK, sRRVe-F3-TK and sRRVe-F4-TK) into which the cleaved MCMV promoter was introduced were constructed, and a sRRVe-sEF1α-hopt-yCD vector composed of gag-pol-sEF1α-hopt-yCD expressing yeast cytosine deaminase protein was constructed as a vector introduced together with the vector expressing thymidine kinase protein (
[0101] Therefore, the occurrence of recombination in the vector of the present invention is minimized, and thus it can be usefully used to stably express a therapeutic gene without loss.
[0102] The present invention also provides a recombinant retrovirus comprising the vector. Meanwhile, the first recombinant expression vector containing a Gag-Pol gene of MuLV, a sEF1α promoter or a MCMV promoter, and a first therapeutic gene; and the second recombinant expression vector containing an Env gene of a virus, an MCMV promoter and a second therapeutic gene can be included in the recombinant retrovirus, respectively or together.
[0103] In a specific embodiment of the present invention, four cleaved MCMV promoters having the sizes of 470 bp, 337 bp, 237 bp, and 160 bp, respectively, were prepared by removing repetitive nucleotide sequences in the MCMV promoter to minimize recombination (Table 2). In addition, GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK and spRRVe-F4-TK) and MuLV-based vectors (sRRVe-TK, sRRVe-F1-TK, sRRVe-F2-TK, sRRVe-F3-TK and sRRVe-F4-TK) into which the cleaved MCMV promoter was introduced were constructed, and a sRRVe-sEF1α-hopt-yCD vector composed of gag-pol-sEF1α-hopt-yCD expressing yeast cytosine deaminase protein was constructed as a vector introduced together with the vector expressing thymidine kinase protein (
[0104] Therefore, the occurrence of recombination in the vector of the present invention is minimized, and thus it can be usefully used to stably express a therapeutic gene without loss.
[0105] The present invention also provides a host cell transfected with the recombinant retrovirus.
[0106] The host cell can be NS/O myeloma cell, human 293T cell, Chinese hamster ovary cell (CHO cell), HeLa cell, CapT cell (human amniotic fluid-derived cell), COS cell, canine D17 cell, mouse NIH/3T3 cell, retrovirus packaging cell, human mesenchymal stem cell, or feline PG4 cell.
[0107] Transfection is performed by infecting the cells above with the recombinant viruses produced in cells transduced with the recombinant retrovirus vector plasmid.
[0108] The transfection can be performed according to the method known in the art. For example, the transfection can be performed by one or more methods selected from the group consisting of lipofectamine method, microinjection method, calcium phosphate precipitation method, electroporation method, liposome-mediated transfection method, DEAE-dextran treatment method and gene bombardment method. In one embodiment of the present invention, the transfection can be performed by lipofectamine method.
[0109] The transfected cells can be cultured using a medium commonly used for culturing animal cells. For example, the medium can be at least one selected from the group consisting of Eagles's MEM, a-MEM, Iscove's MEM, medium 199, CMRL 1066, RPMI 1640, F12, F10, DMEM, a mixed medium of DMEM and F12, Way-mouth's MB752/1, McCoy's 5A and MCDB series media. In one embodiment of the present invention, the medium can be DMEM.
[0110] The present invention also provides a pharmaceutical composition and methods for preventing or treating cancer comprising the recombinant retrovirus as an active ingredient.
[0111] On the other hand, the first recombinant expression vector containing a Gag-Pol gene of MuLV (Murine Leukemia virus), a sEF1α promoter and a yeast cytosine deaminase (yCD) gene; and the second recombinant expression vector containing an Env gene of a virus, an MCMV promoter and a thymidine kinase gene can be included in the recombinant retrovirus, respectively or together.
[0112] The retrovirus can target any dividing cell, and specifically, the cell may be a cancer cell. The cancer cell may include the cell derived from cancers such as mucinous cell carcinoma, round cell carcinoma, locally advanced tumor, metastatic cancer, Ewing's sarcoma, cancer metastasis, lymphoid metastasis, squamous cell carcinoma, esophageal squamous cell carcinoma, oral carcinoma, multiple myeloma, acute lymphocytic leukemia, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, hairy cell leukemia, effluent lymphoma (celiac lymphoma), thymic lymphoma lung cancer, small cell lung carcinoma, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, adrenocortical cancer, ACTH-producing tumor, non-small cell lung cancer, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyps associated with colorectal neoplasia, pancreatic cancer, liver cancer, bladder cancer, primary superficial bladder tumor, invasive metastatic cell bladder carcinoma of the bladder, muscle invasive bladder cancer, prostate cancer, colorectal cancer, kidney cancer, liver cancer, esophageal cancer, ovarian carcinoma, cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneal epithelial neoplasia, cervical carcinoma, vaginal cancer, vulvar cancer, uterine cancer, follicular solid tumor, testicular cancer, penile cancer, renal cell carcinoma, brain cancer, head and neck cancer, neuroblastoma, brainstem glioma, glioma, metastatic tumor cell infiltration in the central nervous system, osteoma, osteosarcoma, malignant melanoma, tumor progression of human skin keratinocytes, squamous cell carcinoma, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilms' tumor, gallbladder cancer, trophoblastic tumor, hemangiopericytoma, or Kaposi's sarcoma.
[0113] In a specific embodiment of the present invention, it was confirmed that thymidine kinase and yeast cytosine deaminase used as therapeutic genes were stably expressed in the GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK, and spRRVe-F4-TK) and the MuLV-based vectors (sRRVe-TK, sRRVe-F1-TK, sRRVe-F2-TK, sRRVe-F3-TK, and sRRVe-F4-TK), and that the therapeutic genes could kill cells by acting on the prodrugs GCV and 5-FC.
[0114] Therefore, the recombinant retrovirus containing the vector according to the present invention can be effectively used for preventing or treating cancer.
[0115] The pharmaceutical composition of the present invention can be formulated as a parenteral preparation. Formulations for parenteral administration can include injections such as sterilized aqueous solutions, water-insoluble excipients, suspensions and emulsions.
[0116] Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate can be used as water insoluble excipients and suspensions.
[0117] Parenteral administration can be performed by a method selected from the group consisting of external skin application, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, and intrathoracic injection.
[0118] The composition of the present invention can be administered by the pharmaceutically effective amount. The effective amount can be determined according to the type of disease, the severity, the activity of the drug, the patient's sensitivity to the drug, the time of administration, the route of administration, the duration of treatment, the drugs being used simultaneously, and the like. The composition of the present invention can be administered alone or in combination with other therapeutic agents. In combination administration, the administration can be sequential or simultaneous.
[0119] The effective dose of the composition is 10.sup.11 to 10.sup.13 virus particles (10.sup.8 to 10.sup.10 IU)/kg per 1 kg of body weight in the case of recombinant viruses and 103 to 10.sup.6 cells/kg in the case of cells, and the administration is carried out as a single administration.
[0120] The pharmaceutical composition according to the present invention can contain the replicating-retrovirus vector with minimized recombination occurrence by 10 to 95 weight % as an active ingredient based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention can further include at least one active ingredient exhibiting the same or similar function in addition to the above active ingredient.
[0121] The present invention also provides a gene delivery composition and method of gene delivery for treating cancer comprising the recombinant retrovirus.
[0122] Meanwhile, the first recombinant expression vector containing a Gag-Pol gene of MuLV (Murine Leukemia virus), a sEF1α promoter or a MCMV promoter, and a first therapeutic gene; and the second recombinant expression vector containing an Env gene of a virus, an MCMV promoter and a second therapeutic gene can be included in the recombinant retrovirus, respectively or together.
[0123] The cancer may include cancer as described above.
[0124] The term “gene delivery composition” used in this specification refers to a composition capable of transferring a gene into a target cell.
[0125] In a specific embodiment of the present invention, it was confirmed that thymidine kinase and yeast cytosine deaminase used as therapeutic genes were stably expressed in the GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK, and spRRVe-F4-TK) and the MuLV-based vectors (sRRVe-TK, sRRVe-F1-TK, sRRVe-F2-TK, sRRVe-F3-TK, and sRRVe-F4-TK), and that the therapeutic genes could kill cells by acting on the prodrugs GCV and 5-FC.
[0126] Therefore, the recombinant retrovirus containing the vector according to the present invention can be effectively used for the delivery of genes for cancer treatment.
[0127] In addition, the present invention provides a method for preparing a replicating-retrovirus vector with minimized recombination occurrence, comprising the following steps: [0128] 1) a step of preparing a first recombinant expression vector containing a Gag-Pol gene of MuLV (Murine Leukemia virus), a sEF1α promoter or a MCMV promoter, and a first therapeutic gene; and [0129] 2) a step of preparing a second recombinant expression vector containing Env gene of a virus, an MCMV promoter and a second therapeutic gene.
[0130] The vector has the characteristics described above. For example, the MCMV promoter is selected from the group consisting of polynucleotides having the nucleotide sequences represented by SEQ. ID. NO: 3, NO: 4, NO: 5, NO: 6 and NO: 7, the sEF1α promoter is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 18, and the Env gene of a virus is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 19 or NO: 20.
[0131] In addition, the first therapeutic gene and the second therapeutic gene are at least one selected from the group consisting of a thymidine kinase (TK) gene, a yeast cytosine deaminase (yCD) gene and a human CD19 gene.
[0132] The thymidine kinase gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 21, the yeast cytosine deaminase (yCD) gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 22, and the human CD19 gene is a polynucleotide having the nucleotide sequence represented by SEQ. ID. NO: 43.
[0133] The thymidine kinase gene can activate the precursor drug ganciclovir, and the cytosine deaminase gene can activate the precursor drug 5-fluorocytosine.
[0134] In a specific embodiment of the present invention, four cleaved MCMV promoters having the sizes of 470 bp, 337 bp, 237 bp, and 160 bp, respectively, were prepared by removing repetitive nucleotide sequences in the MCMV promoter to minimize recombination (Table 2). In addition, GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK and spRRVe-F4-TK) and MuLV-based vectors (sRRVe-TK, sRRVe-F1-TK, sRRVe-F2-TK, sRRVe-F3-TK and sRRVe-F4-TK) into which the cleaved MCMV promoter was introduced were constructed, and a sRRVe-sEF1α-hopt-yCD vector composed of gag-pol-sEF1α-hopt-yCD expressing yeast cytosine deaminase protein was constructed as a vector introduced together with the vector expressing thymidine kinase protein (
[0135] Therefore, the occurrence of recombination in the vector prepared by the production method of the present invention is minimized, and thus it can be usefully used to stably express a therapeutic gene without loss.
[0136] Hereinafter, the present invention will be described in detail by the following examples.
[0137] However, the following examples are only for illustrating the present invention, and the contents of the present invention are not limited thereto.
<Example 1> Construction of Replicating-Retrovirus Vector
[0138] <1-1> Preparation of Virus Vector
[0139] If a foreign gene larger than 1.3 kb is inserted into a conventional RRV vector in which gag, pol and env genes are synthesized into a single genome, the genome size increases, making the vector structure unstable, so the virus vector in intact form cannot be multiplied. Therefore, two vectors were constructed so that the gag-pol gene and the env genes were expressed in independent vectors, respectively. At this time, the env was replaced with the env gene of MuLV (murine leukemia virus), which is friendly to mammalian infection, or the env gene of GaLV (Gibbon ape Leukemia virus), which is friendly to primate infection. As a therapeutic gene, HSV-TK (herpes simplex virus thymidine kinase) gene was cloned into the gag-pol vector and yCD (yeast cytosine deaminase) gene was cloned into the GaLV-env vector, respectively, and then vectors were constructed using a murine cytomegalovirus (MCMV) promoter as the promoter for gene expression control.
[0140] Specifically, virus vectors were constructed as follows.
[0141] 1. spRRVe-yCD env vector (SEQ. ID. NO: 25): (
[0142] PmeI existing in MCS (multi-cloning site) of the previously constructed spRRVeMCMV-MCS (GaLVEnv-MCMV-MCS-3′-LTR) vector was cut and treated with CIAP to prepare both ends of the truncated vector in a blunt form. The pcDNA-yCD vector into which yCD was inserted was digested with XhoI-HindIII to recover the yCD gene, and then treated with T4 DNA polymerase to prepare both ends of the vector in a blunt form. Then, the spRRVeMCMV (PmeI, CIAP) vector and yCD (XhoI-HindIII, T4 DNA polymerase) were ligated using T4 DNA ligase to prepare spRRVe-yCD.
[0143] 2. sRRVgp-TK:gag-pol vector (SEQ. ID. NO: 26): (
[0144] A promoter and transgene-free sRRVgp (vector with retrovirus gag-pol) vector was constructed. Then, MCMV-TK was introduced into the EcoRI site between gag-pol and 3′-LTR. Since sRRVgp-TK could not be completed in one cloning process, MCMV was first cloned, and then TK was introduced under MCMV to complete sRRVgp-TK, the final product. The method is as follows.
[0145] To clone MCMV into the EcoRI site between the gag-pol and 3′-LTR of sRRVgp, the MCMV promoter was amplified by PCR.
[0146] MCMV-F-EcoRI: 5′-cgGAATTCAACAGGAAAGTCCCATTGGA-3′ (SEQ. ID. NO: 47)
[0147] MCMV—R-PmeI-EcoRI: 5′-cgGAATTCGTTTAAACCTGCGTTCTACGGTGGTCAGA-3′ (SEQ. ID. NO: 48) The amplified MCMV promoter product was digested with EcoRI, and the sRRVgp vector was recovered by treatment with EcoRI and CIAP, and then ligated with T4 DNA ligase to complete sRRVgpMCMV. Then, in order to clone the TK gene into the PmeI site of the sRRVgpMCMV vector, the TK gene was amplified by PCR to include PmeI.
[0148] TK—F-PmeI: 5′-cgGTTTAAACATGGCTTCGTACCCCTGCCATC-3′ (SEQ. ID. NO: 49)
[0149] TK—R-PmeI: 5′-CGGTTTAAACTCAGTTAGCCTCCCCCATCTCC-3′ (SEQ. ID. NO: 50) By treating with PmeI and CIAP, sRRVgpMCMV was recovered and the TK gene was digested with PmeI and recovered, and then ligated with T4 DNA ligase to construct the final product, sRRVgp-TK.
[0150] <1-2> Virus Production
[0151] In order to confirm the infectivity and recombination type of the replicating-retrovirus vector in which the therapeutic gene is expressed under the control of the MCMV promoter, viruses were produced using the vector constructed in Example <1-1> according to the procedure shown in the schematic diagram of
[0152] Specifically, viruses were produced by transient transduction of the vector prepared in Example <1-1> into 293T cells, and the brain tumor cell line U87MG was infected with the virus of 2E7 gc (genome copies). After 3 days of initial infection, the cultured supernatant was taken and re-infected to new U87MG, and the infected U87MG cell line was recovered and genomic DNA was isolated.
[0153] <1-3> Confirmation of Recombination of spRRVe-yCD:env Vector
[0154] The replicating-retrovirus vector for gene therapy is highly likely to cause recombination because the size of genomic RNA is increased by the introduced foreign gene and non-homologous sequences are added. Therefore, in order to construct an efficient and stable replicating-retrovirus vector for gene therapy, it is very important to confirm the presence and degree of recombination at the development stage. To confirm whether the virus proliferation and infection progressed and whether the recombination occurred during the amplification process after the virus infection, polymerase chain reaction (PCR) was performed using the genomic DNA extracted from the virus produced in Example <1-2>.
[0155] Specifically, polymerase chain reaction was performed using the primers listed in Table 1 below capable of specifically amplifying the env vector. As shown in . Then, After PCR was performed under the conditions shown in Table 1 below, the amplified DNA was loaded on a 1% agarose gel to confirm the PCR amplification product, thereby confirming the infectivity of the virus and whether the recombination occurred.
TABLE-US-00001 TABLE 1 SEQ. ID. Sequence (5′.fwdarw.3′) NO: GaLV 1624F GACTCAGTCAGCAAGTTAGAG 1 MFGSacIR CAATCGGAGGACTGGCGCCCCGAGTGA 2
[0156] As a result, as shown in
[0157] <1-4> Analysis of Recombination Type of spRRVe-yCD:env Vector
[0158] Since retroviruses are synthesized through the process of reverse transcription, instability of the genome sequence during this process can create various types of recombination. Therefore, after the PCR reaction using the genomic DNA of the spRRVe-yCD:env vector in Example <1-3>, the PCR products of p2 and p3 stage recombination bands (bands indicated by red boxes in
[0159] As a result, as shown in
<Example 2> Construction of Replicating-Retrovirus Vector with Minimized Recombination Occurrence
[0160] <2-1> Preparation of Truncated Form of MCMV Promoter for Construction of Vector with Minimized Recombination Occurrence
[0161] In order to overcome recombination of the replicating-retrovirus vector caused by the repetitive sequences within the MCMV promoter, a cleaved MCMV promoter was constructed by removing the repetitive sequences within the MCMV promoter.
[0162] Specifically, 4 types of cleaved MCMV promoters were prepared by cutting the initially used MCMV promoter of about 646 bp based on the repetitive sequences (Table 2). Then, MCMV F1 (470 bp), F2 (337 bp), F3 (237 bp), and F4 (160 bp) were introduced into the 646 bp MCMV promoter sites of the sRRVe-TK and spRRVe-TK previously constructed in this laboratory. The cleaved MCMV promoters were obtained through PCR using the amplification primers containing the restriction enzyme sites described in Table 3 below.
TABLE-US-00002 TABLE 2 MCMV promoter (5′.fwdarw.3′) MCMV AACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGAC (SEQ. TTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGC ID. CAATGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGA NO: CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAAT 3, CAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGA 646 CTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAG bp) TCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGG GTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTA CTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGT GACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACC GTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGGCAGCCAAA ACGTAACACCGCCCCGGTTTTCCCTGGAAATTCCATATTGGCACGC ATTCTATTGGCTGAGCTGCGTTCACGTGGGTATAAGAGGCGCGACC AGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGTAGAACGCA GA MCMV GGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTC F1 AATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAG (SEQ. GGGGTGAGTCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGT ID. CAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAAAC NO: GCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAA 4, TGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGG 470 AAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGG bp) CAGCCAAAACGTAACACCGCCCCGGTTTTCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCACGTGGGTATAAGAG GCGCGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGT AGAACGCAGA MCMV AAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATT F2 AAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAA (SEQ. ACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTA ID. ATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGA NO: AAGGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCTGGAAATTC 5, CATATTGGCACGCATTCTATTGGCTGAGCTGCGTTCACGTGGGTAT 337 AAGAGGCGCGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACC bp) ACCGTAGAACGCAGA MCMV AACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAA F3 GTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGGCAG (SEQ. CCAAAACGTAACACCGCCCCGGTTTTCCCTGGAAATTCCATATTGG ID. CACGCATTCTATTGGCTGAGCTGCGTTCACGTGGGTATAAGAGGCG NO: CGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGTAGA 6, ACGCAGA 237 bp) MCMV GGAAGTGAAAGGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCT F4 GGAAATTCCATATTGGCACGCATTCTATTGGCTGAGCTGCGTTCAC (SEQ. GTGGGTATAAGAGGCGCGACCAGCGTCGGTACCGTCGCAGTCTTCG ID. GTCTGACCACCGTAGAACGCAGA NO: 7, 161 bp)
TABLE-US-00003 TABLE 3 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO SRRVe MCMV cggtttaaacGGGTGAATC 8 (MuLV)- F1-PmeI AACAGGAAAGTCCC based TK MCMV cggtttaaacAAGGTCAAT 9 F2-PmeI AGGGGTGAGTCAT MCMV cggtttaaacAACGTGACC 10 F3-PmeI TTTAAACGGTACT MCMV cggtttaaacGGAAGTGAA 11 F4-PmeI AGGGCAGCCAAA MCMV-R- cggcggccgcTCTGCGTTC 12 NotI TACGGTGGTCAGACC MCMV cggtttaaacGGGTGAATC 8 F1-PmeI AACAGGAAAGTCCC MCMV cggtttaaacAAGGTCAAT 9 F2-PmeI AGGGGTGAGTCAT MCMV cggtttaaacAACGTGACC 10 F3-PmeI TTTAAACGGTACT MCMV cggtttaaacGGAAGTGAA 11 F4-PmeI AGGGCAGCCAAA MCMV-R- cgggatccTCTGCGTTCTA 13 BamHI CGGTGGTCAGACC
[0163] <2-2> Construction of Replicating-Retrovirus Vector with Minimized Recombination Occurrence (spRRVe(GaLV)-TK/sRRVgp-sEF1α-Hopt-yCD)
[0164] The cleaved MCMV promoter digested with PmeI-BamHI was cloned into the promoter site of spRRVe(GaLV)-TK to complete spRRVe-TK (SEQ. ID. NO: 27), spRRVe-F1-TK (SEQ. ID. NO: 28), spRRVe-F2-TK (SEQ. ID. NO: 29), spRRVe-F3-TK (SEQ. ID. NO: 30), and spRRVe-F4-TK (SEQ. ID. NO: 31) vectors (
[0165] <2-3> Construction of Replicating-Retrovirus Vector with Minimized Recombination Occurrence (sRRVe (MuLV)-TK/sRRVgp-sEF1α-hopt-yCD)
[0166] The cleaved MCMV promoter digested with PmeI-NotI was cloned into the promoter site of sRRVe(MuLV)-TK to complete sRRVe-TK (SEQ. ID. NO: 33), sRRVe-F1-TK (SEQ. ID. NO: 34), sRRVe-F2-TK (SEQ. ID. NO: 35), sRRVe-F3-TK (SEQ. ID. NO: 36), and sRRVe-F4-TK (SEQ. ID. NO: 37) vectors (
<Example 3> Confirmation of Recombination Type of Replicating-Retrovirus Vector with Minimized Recombination Occurrence (spRRVe (GaLV)-TK/sRRVgp-sEF1α-hopt-yCD)
[0167] The recombination type of the vector constructed in Example <2-2> was confirmed in the same manner as in Example <1-3>.
[0168] Specifically, the constructed GaLV env-based vectors (spRRVe-TK, spRRVe-F1-TK, spRRVe-F2-TK, spRRVe-F3-TK, and spRRVe-F4-TK) were used in combination with the sRRVgp-sEF1α-hopt-yCD vector to synthesize viruses in 293T cells, and then the recombination type was analyzed in the same manner as in Example <1-3>. GaLV1932F and MFGSacIR primers shown in Table 4 were used for env vector-specific amplification, and pol7130F and MFGSacIR primers were used for gag-pol vector-specific amplification.
[0169] As a result, as shown in
TABLE-US-00004 TABLE 4 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: GaLV 1624F GACTCAGTCAGCAAGTTAGAG 1 GaLV 1932F GTTGCTCATCCTCGGGCCATG 14 Am1801F ATCATTGACCCTGGCCCTTC 15 po17130F CGGCCCGGCACTCATTGGGAG 16 MuLV4194F AGCAAGCTATTGGCCACTG 17 MFGSacIR CAATCGGAGGACTGGCGC 2 CCCGAGTGA
<Example 4> Expression Levels of Thymidine Kinase (TK) and Yeast Cytosine Deaminase (yCD) Proteins in Cells Transfected with Viruses Containing Replicating-Retrovirus Vector with Minimized Recombination Occurrence (spRRVe (GaLV)-TK/sRRVgp-sEF1α-Hopt-yCD)
[0170] Thereafter, the protein expression levels of thymidine kinase (HSV1-TK) and yeast cytosine deaminase (yCD) in the U87MG cells obtained in the recombination test step were confirmed by Western blotting with.
[0171] Specifically, as shown in of T-PER tissue extraction agent (PIERCE, 78510)+1× proteinase inhibitor. Thereafter, the cells were broken by freezing-thawing three times, and the cytoplasmic supernatant was recovered by centrifugation at 13,000 rpm for 10 minutes. After quantifying the protein amount using BCA, 20 μg of cell lysate was taken and mixed with SDS sample loading dye to 1%. After reacting for 5 minutes in a 100° C. heat block, the reaction mixture was moved to ice and reacted for 2 minutes. Then, the reactant was loaded on 10% (TK) or 13.5% (yCD) SDS-PAGE gel, followed by electrophoresis. Upon completion of the electrophoresis, the protein was transferred to a NC (nitrocellulose) membrane at 90 V for 2 hours, and then put into a blocking solution (5% skim milk in 1X TBS-T), followed by reaction at room temperature for 1 hour. Then, the membrane was added to 1% skim milk/1X TBS-T containing the primary antibody (anti-rabbit-TK: Santa Cruze sc-28038, 1:500 dilution, anti-sheep yCD: Thermo Fisher Scientific PA1-85365, 1:500, anti-mouse b-actin: Sigma A2228, 1:1000), followed by reaction in a refrigerator at 4° C. overnight. Thereafter, the membrane was washed 4 times with 1× TBS-T at room temperature for 10 minutes, and then reacted with the horseradish peroxidase (HRP)-conjugated secondary antibody for 1 hour at room temperature. Then, the membrane was washed 4 times with 1× TBS-T at room temperature for 10 minutes, reacted in an ECL (enhanced chemiluminescence, Bio-rad Cat No. 170-5062) solution, and then analyzed in a chemiluminescence imaging system (ChemiDoc, Biorad CA).
[0172] As a result, as shown in
<Example 5> Confirmation of Cell Death Upon Administration of Prodrugs of Thymidine Kinase and Yeast Cytosine Deaminase
[0173] The drug sensitivity of the spRRVe(GaLV)-TK/sRRVgp-sEF1α-hopt-yCD virus produced in Example <2-2> to ganciclovir (GCV) and 5-fluorocytosine (5-FC) was confirmed.
[0174] Specifically, the spRRVe-TK/sRRVgp-sEF1α-hopt-yCD virus was co-transfected into the 293T cell line using PLUS reagent (Invitrogen) and lipofectamine (Invitrogen). After 2 days, the supernatant of the virus was recovered, and U-87MG cells passaged in a 6-well plate at the density of 1.5×10.sup.5 cells/well the previous day were infected with the virus and polybran at a concentration of 8 μg/ for 8 hours. Five days after infection (postinfection 5d), the cell supernatant was taken and re-infected to U-87MG cells passaged in a 6-well plate at the density of 1.5×10.sup.5 cells/well the previous day (p1), and then sequentially infected up to p4 in the same way. Cells at each stage of infection were treated with trypsin-EDTA to make single cells, and passaged in a 12-well plate at the density of 1.5×10.sup.5 cells/well, and from the next day after the passage, 30 μg/
of GCV and 1 mM 5-FC were treated for or 8 days, respectively, to confirm cell death.
[0175] As a result, as shown in of ganciclovir (GCV) and 1 mM 5-fluorocytocin (5-FC), the pro-drugs.
<Example 6> Confirmation of Recombination Type of MuLV Env-Based Vector Containing Cleaved MCMV Promoter
[0176] In the analysis test of the recombination occurrence of the spRVe-sEF1α-TK/sRRVgp-sEF1α-hopt-yCD combination, it was confirmed that recombination did not occur well in the gag-pol vector, but confirmed that the complete hopt-yCD of the gag-pol vector was reciprocally recombined and inserted into the TK site of the env vector. This is a phenomenon caused by homologous recombination between promoters when the promoters used in the gag-pol vector and the env vector are the same, and does not affect the expression of a therapeutic gene. On the other hand, in the case of the sRRVgp-sEF1α-hopt-yCD/spRRVe-F4-TK combination, non-homologous recombination occurs between promoters, which affects the expression of an effective therapeutic gene. To minimize the occurrence of such recombination, sRRVgp-F4-hopt-yCD was constructed by introducing F4 promoter into the sEF1α site of sRRVgp-sEF1α-hopt-yCD, and then the recombination type of the sRRVgp-F4-hopt-yCD/sRRV3 sRRVe-F4-TK vector was confirmed in the same manner as in Example <1-3>.
[0177] Specifically, the sRRVgp-sEF1α-TK vector was treated with EcoRI to produce sEF1α-TK, and PCR was performed using spRVe-TK as a template with MCMV(F4)-EcoRI-F and MCMV-NotI-M1uI-EcoRI-R primers shown in Table 5 below containing restriction enzyme recognition sequences for cloning other therapeutic genes to clone MCMVF4. Thereafter, the sRRVgp-sEF1α-TK and MCMV F4 PCR products were digested with EcoRI and cloned to construct a sRRVgp-MCMV F4 vector. Then, the hopet-yCD-NotI-F and hopet-yCD-NotI-R primers shown in Table 5 were constructed using hopet-yCD, and PCR was performed using the sRRVgp-sEF1α-hopt-yCD vector as a template.
TABLE-US-00005 TABLE 5 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: MCMV(F4)- cggaattcGGAAGTGA 38 ECORI-F AAGGGCAGCCAAA MCMV-NotI- cggaattcacgcgtg 39 MluI-EcoRI- cgcggccgcTCTGCGT R TCTACGGTGGTCAGACC hopt-yCD- cggcggccgcATGGTTAC 40 NotI-F TGGGGGAATGGC hopt-yCD- acgcgtTTATTCCCCGAT 41 MluI-R GTCTTCGAA
[0178] Thereafter, the sRRVgp-MCMV F4 vector and the hopt-yCD PCR product were recovered by treatment with NotI-MluI and cloned to complete a sRRVgp-F4-hopt-yCD vector. The constructed MuLV env-based sRRVe-F4-TK vector was used in combination with the sRRVgp-F4-hopt-yCD vector to synthesize viruses in 293T cells, and then the recombination type analysis test was performed in the same manner as in Example <1-3>. Am1801F and MFGSacIR primers shown in Table 4 were used for env vector-specific amplification, and pol7130F and MFGSacIR primers were used for gag-pol vector-specific amplification.
[0179] As a result, as shown in
[0180] That is, in the MuLV env-based RRV vector, recombination frequency decreased as the size of the MCMV promoter decreased, and recombination did not occur in the sRRVe-F4-TK vector in which most of the repetitive sequences of the MCMV promoter were removed. Therefore, it was confirmed that the replicating-retrovirus vector containing the cleaved MCMV promoter did not undergo recombination and thus the therapeutic gene could be delivered to target cells without loss.
<Example 7> Expression Level of Thymidine Kinase (TK) in Cells Transfected with Viruses Containing Replicating-Retrovirus Vector with Minimized Recombination Occurrence (sRRVe (MuLV)-TK/sRRVgp-sEF1α-hopt-yCD)
[0181] Then, the TK protein expression level in U87MG cells obtained in the recombination test step after sRRVe-F4-TK was confirmed by Western blotting under the same method and conditions as described in Example 4 above. It was confirmed that yCD protein was stably expressed because recombination did not occur in the gag-pol vector, and thus only the expression level of TK protein was confirmed.
[0182] As a result, as shown in
<Example 8> Confirmation of Cell Death Upon Administration of Prodrugs of Thymidine Kinase (TK) and Yeast Cytosine Deaminase (yCD)
[0183] The drug sensitivity of the virus containing the sRRVe(MuLV)-TK/sRRVgp-F4-hopt-yCD vector produced in Example 6 to ganciclovir (GCV) and 5-fluorocytosine (5-FC) was confirmed.
[0184] Specifically, the virus containing spRRVe-F4-hopt-yCD/sRRVgp-TK, spRRVe-F4-hopt-yCD/sRRVgp-F1-TK, spRRVe-F4-hopt-yCD/sRRVgp-F2-TK, spRRVe-F4-hopt-yCD/sRRVgp-F3-TK and spRRVe-F4-hopt-yCD/sRRVgp-F4-TK was co-transfected into the 293T cell line using PLUS reagent (Invitrogen) and lipofectamine (Invitrogen). After 2 days, the supernatant of the virus was recovered, and U-87MG cells passaged in a 6-well plate at the density of 1.5×10.sup.5 cells/well the previous day were infected with the virus and polybran at a concentration of 8 μg/ for 8 hours. Five days after infection (postinfection 5d), the cell supernatant was taken and re-infected to U-87MG cells passaged in a 6-well plate at the density of 1.5×10.sup.5 cells/well the previous day (p1), and then sequentially infected up to p4 in the same way. Cells at each stage of infection were treated with trypsin-EDTA to make single cells, and passaged in a 12-well plate at the density of 1.5×10.sup.5 cells/well and from the next day after the passage, 30 μg/
of GCV and 1 mM 5-FC were treated for 5 or 8 days, respectively, to confirm cell death.
[0185] As a result, as shown in of (GCV) and 1 mM 5-fluorocytocin (5-FC), the pro-drugs under an optical microscope. After infecting U87MG with 2E7 genome copies of the sRRVe-F4-TK/sRRVgp-F4-hopt-yCD virus for 7 days, 30 μg/
of GCV and 1 mM 5-FC were treated to quantitatively evaluate cell death. As a result, when GCV was treated, the cell viability decreased by about 80% until 4 days after infection, and only about 10% of cells survived 10 days after infection, suggesting that GCV killed more than 90% of cells. When 5-FC was treated, the cell viability decreased by about 40% 2 days after infection, and only about 40% of cells survived 8 days after infection, suggesting that 5-FC killed more than 60% of cells (
<Example 9> Construction of Self-Replicating Retrovirus Vector with Minimized Recombination Occurrence into which Human CD19, Cancer Antigen Gene, is Introduced
[0186] <9-1> Construction of sRRVgp-F4-hCD19/sRRVe-F4-TK Vector and Confirmation of Recombination Occurrence
[0187] Recently, many studies have been conducted on immunotherapy drugs to treat cancer, and in fact, an Immunotherapy method has been developed to load and deliver the receptor targeting an antigen specifically expressed in cancer cells, such as CAR-T, on a virus vector and is being applied in clinical practice. These immunotherapy methods can reduce side effects as much as possible by using the characteristics of immune cells in the body, and can strengthen the immune response so that the patient's body fights against cancer cells. Among them, active immunotherapy is to attack cancer cells by actively activating the immune system by administering tumor-specific antigens possessed by cancer cells to cancer patients. Accordingly, the human CD19 gene was introduced into a self-replicating retrovirus vector to be used as a gene therapy vector for cancer with minimized recombination.
[0188] Specifically, to clone the hCD19 variant 2 into the hopt-yCD site of sRRVgp-F4-hopt-yCD, the NotI-hCD19-MluI gene containing a restriction enzyme site was synthesized. Thereafter, hCD19 and sRRVgp-F4-hopt-yCD were digested with NotI and MluI and recovered, respectively, and then cloned to construct a sRRVgp-F4-hCD19 vector (SEQ. ID. NO: 44). As shown in
[0189] As a result, as shown in
TABLE-US-00006 TABLE 6 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: AmEnv961F ACAAGACCCAAGAA 42 TGTTGGCT Am 1801F ATCATTGACCCTGG 15 CCCTTC pol 7130F CGGCCCGGCACTCA 16 TTGGGAG MFGSacIR CAATCGGAGGACTG 2 GCGCCCCGAGTGA
[0190] <9-2> Construction of sRRVgp-F4-Hopt-yCD/sRRVe-F4-hCD19 Vector and Confirmation of Recombination Occurrence
[0191] As shown in Example <9-1>, it was confirmed that recombination occurred in the sRRVgp-F4-hCD19 vector into which hCD19 was inserted during virus replication in the sRRVgp-F4-hCD19/sRRVe-F4-TK vector combination. Therefore, the sRRVgp-F4-hopt-yCD gag-pol vector confirmed that no recombination occurred during virus replication was selected, and a sRRVe-F4-hCD19 vector in which the TK gene of the sRRVe-F4-TK vector was substituted with hCD19 was constructed.
[0192] Specifically, to clone hCD19 into the TK site of sRRVe-F4-TK using the hCD19 variant 2, the NotI-hCD19-MluI gene containing a restriction enzyme site was synthesized. Thereafter, hCD19 and sRRVgp-F4-TK were digested with NotI and MluI and recovered, and then cloned to construct a sRRVe-F4-hCD19 vector (SEQ. ID. NO: 45). As shown in
[0193] As shown in
<Example 10> Construction of Self-Replicating Retrovirus Vector with Minimized Recombination Occurrence into which Human CD19t (Truncated Human CD19, hCD19t), Cancer Antigen Gene, is Introduced
[0194] <10-1> Construction of sRRVgp-F4-hCD19t Vector and Confirmation of Recombination Occurrence
[0195] In addition to the CD19 N-terminal/CAR-T mechanism, in order to suppress intracellular signaling that may occur by the C-terminal of CD19, 233 amino acids of the cytoplasmic domain were removed and truncated CD19 (CD19t) composed of 323 amino acids was introduced into a self-replicating retrovirus vector to use it as a cancer gene therapy vector with minimized recombination. The CD19t consists of an extracellular N-terminal, a transmembrane domain, and a cytosolic C-terminus with only 19 amino acids.
[0196] The sRRVgp-F4-hCD19t vector was constructed as follows. To secure hCD19t, hCD19t was amplified using the hCD19 variant 2 as a template with the primers shown in Table 7 below.
TABLE-US-00007 TABLE 7 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: hCD19t- cggcggccgCATGCCACCTCC 51 NotI-F TCGCCTCCTCTTC hCD19t- caacgcgtTCATCTTTTCCTC 52 MluI-R CTCAGGACCAGG
[0197] To facilitate cloning, primers were prepared by inserting NotI at the 5′ side and MluI at the 3′ side. Then, in order to clone hCD19t into the hopt-yCD site of the sRRVgp-F4-hopt-yCD vector, the vector was digested with NotI-MluI, and the amplified hCD19t was digested with NotI-MluI and recovered, and introduced into the vector to construct a sRRVgp-F4-hCD19t vector (SEQ. ID. NO: 54) (
[0198] <10-2> Construction of sRRVe-F4-hCD19t Vector and Confirmation of Recombination Occurrence
[0199] The sRRVe-F4-hCD19t vector was constructed as follows. To secure hCD19t, hCD19t was amplified using the hCD19 variant 2 as a template with the primers shown in Table 8 below.
TABLE-US-00008 TABLE 8 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: hCD19t- cggcggccgcATGCCACCTC 51 NotI-F CTCGCCTCCTCTTC hCD19t- tggtcgacTCATCTTTTCCT 55 SalI-R CCTCAGGACCAGG
[0200] To facilitate cloning, primers were prepared by inserting NotI at the 5′ side and SalI at the 3′ side. Then, in order to clone hCD19t into the hCD19 site of the sRRVe-F4-hCD19 vector, the vector was digested with NotI-SalI, and the amplified hCD19t was digested with NotI-SalI and recovered, and introduced into the vector to construct a sRRVe-F4-hCD19t vector (SEQ. ID. NO: 56) (
<Example 11> Construction of Self-Replicating Retrovirus Vector with Minimized Recombination Occurrence into which Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) is Introduced
[0201] <11-1> Construction of sRRVgp-F4-mGM-CSF Vector and Confirmation of Recombination Occurrence
[0202] Mouse GM-CSF and human GM-CSF were introduced into a self-replicating retrovirus vector as follows to promote immunity enhancement of a patient when applying the self-replicating retrovirus vector loaded with therapeutic genes and truncated hCD19 to cancer patients.
[0203] First, the sRRVgp-F4-mGM-CSF vector was constructed. To secure mouse GM-CSF (mGM-CSF), mGM-CSF was amplified using the constructed spRRVe-mGM-CSF (SEQ. ID. NO: 57) as a template with the primers shown in Table 9 below.
TABLE-US-00009 TABLE 9 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: mGM-CSF-F- cggcggccgcAGGATGTGG 58 NotI CTGCAGAATTT mGM-CSF-R- tggtcgacTCATTTTTGGA 59 MluI CTGGTTTTT
[0204] At this time, to facilitate cloning, primers were prepared by inserting NotI at the 5′ side and MluI at the 3′ side. Then, in order to clone mGM-CSF into the hopt-yCD site of the sRRVe-F4-hopt-yCD vector, the vector was digested with NotI-MluI, and the amplified mGM-CSF was digested with NotI-MluI and recovered, and introduced into the vector to construct a sRRVgp-F4-mGM-CSF vector (SEQ. ID. NO: 60) (
[0205] <11-2> Construction of sRRVgp-F4-hGM-CSF Vector and Confirmation of Recombination Occurrence
[0206] The sRRVgp-F4-hGM-CSF vector was constructed as follows. To secure hGM-CSF, hGM-CSF was amplified using the constructed spRRVe-hGM-CSF (SEQ. ID. NO: 61) as a template with the primers shown in Table 10 below.
TABLE-US-00010 TABLE 10 SEQ. ID. Primer Sequence (5′.fwdarw.3′) NO: hGM-CSF-F- cggcggccgcAGGATGTGGC 62 NotI TGCAGAGC hGM-CSF-R- tggtcgacTCACTCCTGGAC 63 MluI TGGCTCCC
[0207] To facilitate cloning, primers were prepared by inserting NotI at the 5′ side and MluI at the 3′ side. Then, in order to clone hGM-CSF into the hopt-yCD site of the sRRVe-F4-hopt-yCD vector, the vector was digested with NotI-MluI, and the amplified hGM-CSF was digested with NotI-MluI and recovered, and cloned to construct a sRRVgp-F4-hGM-CSF vector (SEQ. ID. NO: 64) (
[0208] <11-3> Securing Human Codon-Optimized Nucleotide Sequence of hGM-CSF
[0209] In order to solve the problem that replication did not occur completely due to recombination mutation in Example <11-2>, the hGM-CSF nucleotide sequence was converted into a human codon-optimized nucleotide sequence.
[0210] Securing and synthesizing the human codon nucleotide sequence was performed by requesting Cosmogentech Co., Ltd., Korea. At this time, in order to facilitate cloning into the self-replicating retroviral vector, the sequence was synthesized by inserting NotI at the 5′ side and MluI at the 3′ side (SEQ. ID. NO: 65).
[0211] <11-4> Construction of sRRVgp-F4-Hopt-GM-CSF Vector and Confirmation of Recombination Occurrence
[0212] A sRRVgp-F4-hopt-GM-CSF vector (SEQ. ID. NO: 66) was constructed by cloning the hopt-GM-CSF synthesized in Example <11-3> into the hopt-yCD site of the sRRVe-F4-hopt-yCD vector digested with NotI and MluI (
[0213] As a result, as shown in
[0214] In addition, as shown in
<Example 12> Confirmation of Expression Level of hCD19 or hCD19t in Cells Transfected with CD19-Expressing sRRV System
[0215] <12-1> Confirmation of Expression Level of hCD19 or hCD19t by Flow Cytometry
[0216] To confirm the expression of hCD19 and hCD19t (truncated hCD19) at the cellular level, U87MG cells were transfected with CD19-expressing sRRV, followed by flow cytometry.
[0217] First, sRRVgp-F4-DsRed/sRRVe-F4-hCD19, sRRVgp-F4-hCD19t/sRRVe-F4-TK, and sRRVgp-F4-yCD/sRRVe-F4-hCD19t vectors were prepared, respectively, and then U87MG cells were transfected with each of the gag-pol vector and the env vector by 0.3 MOI, respectively. The transfected cells were cultured under the same experimental conditions as before, harvested every 3 days, reacted with anti-hCD19 antibody for 1 hour, and then FITC fluorescence was observed by flow cytometry.
[0218] As a result, as shown in
[0219] From the above results, it was confirmed that all three virus combinations induced the expression of hCD19 and hCD19t by transfection.
[0220] <12-2> Confirmation of Expression Level of hCD19 or hCD19t by Western Blotting
[0221] Western blotting was performed to confirm the expression of hCD19 and hCD19t at the protein level. Specifically, U87MG cells were transfected with each CD19-sRRV combination by 0.3 MOI (total 0.6 MOI) and the cells were harvested every 3 days. The experiment was conducted with two types of antibodies, one that reacts to hCD19t and hCD19 (66298-1-1g) and the other that reacts only to hCD19 (ab134114).
[0222] As a result, as shown in
<Example 13> Confirmation of Cancer Cell Death by Anti-CD19 CAR-T Treatment
[0223] <13-1> Confirmation of Cell Viability Using WST-1 Assay
[0224] WST-1 assay was performed to confirm whether the hCD19 and hCD19t expressed by CD19-sRRV actually induce apoptosis by anti-CD19 CAR-T.
[0225] Specifically, U87MG cells were transfected with each CD19-sRRV combination by 0.3 MOI (total 0.6 MOI) and after 9 days, the cells were harvested and seeded in a 96-well plate. On the next day, the cells were treated with anti-CD19 CAR-T at the E:T ratio of 0.05:1, 0.1:1, 0.5:1, and 1:1, and cultured together, and cell viability was measured by performing WST-1 assay every 24 hours.
[0226] As a result, as shown in
[0227] <13-2> Confirmation of Cell Viability Using Crystal Violet Staining
[0228] Crystal violet staining was performed to visually observe cell death by anti-CD19 CAR-T.
[0229] Specifically, U87 MG cells were transfected with each CD19-sRRV combination by 0.3 MOI (total 0.6 MOI), and after 9 days, the cells were harvested and seeded in a 12-well plate. On the next day, the cells were treated with anti-CD19 CAR-T at the E:T ratio of 0.1:1, 0.5:1, and 1:1, respectively, and cultured together, and observed under a microscope at 24-hour intervals. After 4 days of CAR-T treatment, crystal violet staining was performed and observed as photographs.
[0230] As a result, as shown in