CONJUGATE OF GALNAC AND SAPONIN, THERAPEUTIC COMPOSITION COMPRISING SAID CONJUGATE AND A GALNAC-OLIGONUCLEOTIDE CONJUGATE
20230263897 · 2023-08-24
Inventors
Cpc classification
A61K47/6801
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K47/554
HUMAN NECESSITIES
International classification
A61K47/68
HUMAN NECESSITIES
Abstract
The invention relates to a saponin conjugate comprising a saponin covalently linked to a ligand for ASGPR, the ligand comprising at least one GalNAc. The invention also relates to a pharmaceutical combination comprising a first pharmaceutical composition comprising the saponin conjugate of the invention and a second pharmaceutical composition comprising a second conjugate of an effector molecule and a ligand for ASGPR, or a third conjugate of an effector molecule and a binding molecule for binding to a cell-surface molecule. In addition, the invention relates to a pharmaceutical composition comprising the saponin conjugate of the invention and the second conjugate or the third conjugate. Furthermore, the invention relates to a pharmaceutical combination or pharmaceutical composition of the invention, for use as a medicament. The invention also relates to a pharmaceutical combination or pharmaceutical composition of the invention, for use in the treatment or prophylaxis of a disease or health problem in which an expression product is involved of genes: apoB, TTR, PCSK9, ALAS1, AT3, GO, CC5, X gene of HBV, S gene of HBV, AAT and LDH, and for use in the treatment or prophylaxis of a cancer, an infectious disease, a viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, AAT related liver disease, acute hepatic porphyria, TTR amyloidosis, complement-mediated disease, hepatitis B infection, or an auto-immune disease. Finally, the invention relates to an in vitro or ex vivo method for transferring the second conjugate or the third conjugate of the invention from outside a cell to inside said cell.
Claims
1. Saponin conjugate comprising at least one saponin covalently linked to a ligand for asialoglycoprotein receptor (ASGPR), wherein the ligand for ASGPR comprises at least one N-acetylgalactosamine (GalNAc) moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, wherein the at least one saponin is selected from monodesmosidic triterpenoid saponins and bidesmosidic triterpenoid saponins.
2. Saponin conjugate of claim 1, wherein the saponin comprises an aglycone core structure selected from the group consisting of: 2alpha-hydroxy oleanolic acid; 16alpha-hydroxy oleanolic acid; hederagenin (23-hydroxy oleanolic acid); 16alpha,23-dihydroxy oleanolic acid; gypsogenin; quillaic acid; protoaescigenin-21(2-methylbut-2-enoate)-22-acetate; 23-oxo-barringtogenol C-21,22-bis(2-methylbut-2-enoate); 23-oxo-barringtogenol C-21(2-methylbut-2-enoate)-16,22-diacetate; digitogenin; 3,16,28-trihydroxy oleanan-12-en; gypsogenic acid, and derivatives thereof, preferably the saponin comprises an aglycone core structure selected from quillaic acid and gypsogenin or derivatives thereof, more preferably the saponin aglycone core structure is quillaic acid or a derivative thereof.
3. Saponin conjugate of claim 1 or 2, wherein the saponin comprises a saccharide chain bound to the aglycone core structure, which is selected from group A: GlcA-, Glc-, Gal-, Rha-(1.fwdarw.2)-Ara-, Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA-, Glc-(1.fwdarw.2)-[Glc-(1.fwdarw.4)]-GlcA-, Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, Xyl-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, Glc-(1.fwdarw.3)-Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-Glc-(1.fwdarw.4)-Gal-, Rha-(1.fwdarw.2)-Gal-(1.fwdarw.3)-[Glc-(1.fwdarw.2)]-GlcA-, Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, and derivatives thereof, or the saponin comprises a saccharide chain bound to the aglycone core structure, which is selected from group B: Glc-, Gal-, Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.4)]-Rha-, Rha-(1.fwdarw.2)-[Ara-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-, Ara-, Xyl-, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R1-(.fwdarw.4)]-Fuc- wherein R1 is 4E-Methoxycinnamic acid, Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R2-(.fwdarw.4)]-Fuc- wherein R2 is 4Z-Methoxycinnamic acid, Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-3,4-di-OAc-Fuc-, Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R3-(.fwdarw.4)]-3-OAc-Fuc- wherein R3 is 4E-Methoxycinnamic acid, Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-4-OAc-Fuc-, (Ara- or Xyl-)(1.fwdarw.3)-(Ara- or Xyl-)(1.fwdarw.4)-(Rha- or Fuc-)(1.fwdarw.2)-[4-OAc-(Rha- or Fuc-)(1.fwdarw.4)]-(Rha- or Fuc-), Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, Ara/Xyl-(1.fwdarw.4)-Rha/Fuc-(1.fwdarw.4)-[Glc/Gal-(1.fwdarw.2)]-Fuc-, Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R4-(.fwdarw.4)]-Fuc- wherein R4 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R5-(.fwdarw.4)]-Fuc- wherein R5 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, 6-OAc-Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3,4-di-OAc-Qui-(1.fwdarw.4)]-Fuc-, Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, 6-OAc-Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R6-(.fwdarw.4)]-Fuc- wherein R6 is 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R7-(.fwdarw.4)]-Fuc- wherein R7 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R8-(.fwdarw.4)]-Fuc- wherein R8 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R9-(.fwdarw.4)]-Fuc- wherein R9 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R10-(.fwdarw.4)]-Fuc- wherein R10 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R11-(.fwdarw.3)]-Fuc- wherein R11 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R12-(.fwdarw.3)]-Fuc- wherein R12 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid) Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal-, and derivatives thereof, or the saponin is a bidesmosidic triterpene glycoside comprising a first saccharide chain selected from the group A bound to the aglycone core structure and comprising a second saccharide chain selected from the group B bound to the aglycone core structure.
4. Saponin conjugate of any one of the claims 1-3, wherein the saponin is selected from the group consisting of: Quillaja bark saponin, dipsacoside B, saikosaponin A, saikosaponin D, macranthoidin A, esculentoside A, phytolaccagenin, aescinate, AS6.2, NP-005236, AMA-1, AMR, alpha-Hederin, NP-012672, NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, SO1861, GE1741, SO1542, SO1584, SO1658, SO1674, SO1832, SO1862, SO1904, QS-7, QS1861, QS-7 api, QS1862, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, QS-21 B-xylo, beta-Aescin, Aescin Ia, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Digitonin, Primula acid 1 and AS64R, stereoisomers thereof, derivatives thereof, and combinations thereof, preferably the saponin is selected from the group consisting of QS-21, a QS-21 derivative, SO1861, a SO1861 derivative, SA1641, a SA1641 derivative, GE1741, a GE1741 derivative and combinations thereof, more preferably the saponin is selected from the group consisting of a QS-21 derivative, a SO1861 derivative and combinations thereof, most preferably the saponin is a SO1861 derivative.
5. Saponin conjugate of claim 3 or 4, wherein the saponin is a saponin derivative wherein i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised; ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A as defined in claim 3, the saccharide chain comprising a carboxyl group which has been derivatised; iii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group B as defined in claim 3, the saccharide chain comprising an acetoxy (Me(CO)O—) group which has been derivatised; or iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combination of two derivatisations of derivatisations i., ii. and iii.
6. Saponin conjugate of any one of the claims 1-5, wherein the saponin is any one or more of: SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillajasaponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, SO1904, stereoisomers thereof, derivatives thereof and combinations thereof, preferably the saponin is selected from the group consisting of QS-21, a QS-21 derivative, SO1861, a SO1861 derivative, SA1641, a SA1641 derivative, GE1741, a GE1741 derivative and combinations thereof, more preferably the saponin is selected from the group consisting of a QS-21 derivative, a SO1861 derivative and combinations thereof, most preferably the saponin is a SO1861 derivative.
7. Saponin conjugate of any one of the claims 1-6, wherein the saponin is a saponin derivative of the quillaic acid saponin or the gypsogenin saponin of claim 2 and is represented by Molecule 1: ##STR00042## wherein A.sub.1 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably A.sub.1 represents a saccharide chain selected from group A as defined in claim 3, more preferably A.sub.1 represents a saccharide chain selected from group A as defined in claim 3 and A.sub.1 comprises or consists of a glucuronic acid moiety; A.sub.2 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably A.sub.2 represents a saccharide chain selected from group B as defined in claim 3, more preferably A.sub.2 represents a saccharide chain selected from group B as defined in claim 3 and A.sub.2 comprises at least one acetoxy (Me(CO)O—) group, such as one, two, three or four acetoxy groups, wherein at least one of A.sub.1 and A.sub.2 is not hydrogen, preferably both A.sub.1 and A.sub.2 are an oligosaccharide chain; and R is hydrogen in gypsogenin or hydroxyl in quillaic acid; wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one, preferably one or two, more preferably one, of the following derivatisations is present: i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised; ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain selected from group A as defined in claim 3 and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised; and iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain selected from group B as defined in claim 3 and A.sub.2 comprises at least one acetoxy group, has/have been derivatised.
8. Saponin conjugate of claim 7, wherein A.sub.1 represents a saccharide chain selected from group A as defined in claim 3 and comprises or consists of a glucuronic acid moiety and wherein the carboxyl group of a glucuronic acid moiety of A.sub.1 has been derivatised and/or wherein A.sub.2 represents a saccharide chain selected from group B as defined in claim 3 and A.sub.2 comprises at least one acetoxy group and wherein at least one acetoxy group of A.sub.2 has been derivatised.
9. Saponin conjugate of claim 7 or 8, wherein the saponin represented by Molecule 1 is a bidesmosidic triterpene saponin.
10. Saponin conjugate of any one of the claims 7-9, wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one, preferably one or two, more preferably one, of the following derivatisations is present: i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised by; reduction to an alcohol; transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain selected from group A as defined in claim 3 and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AMPD such as a QS-21-Glu-AMPD or a SO1861-Glu-AMPD or a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; and iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain selected from group B as defined in claim 3 and A.sub.2 comprises at least one acetoxy group, has/have been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
11. Saponin conjugate of any one of the claims 7-10, wherein A.sub.1 is Gal-(1+42)-[Xyl-(1+43)]-GlcA and/or A2 is Glc-(1+3)-Xyl-(1+4)-Rha-(1+2)-[Xyl-(1+3)-4-OAc-Qui-(1+4)]-Fuc, preferably the saponin represented by Molecule 1 is 3-O-beta-D-galactopyranosyl-(1+2)-[beta-D-xylopyranosyl-(1+3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1+3)-beta-D-xylopyranosyl-(1+4)-alpha-L-rhamnopyranosyl-(1+2)-[beta-D-xylopyranosyl-(1+3)-4OAc-beta-D-quinovopyranosyl-(1+44)]-beta-D-fucopyranoside, more preferably the saponin is any one or more of: SO1861, GE1741, SA1641 and QS-21, or a derivative thereof, most preferably SO1861 or a derivative thereof.
12. Saponin conjugate of any one of the claims 5-11, wherein the saponin is a saponin derivative wherein i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised by: reduction to an alcohol; transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A as defined in claim 3, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AMPD such as a QS-21-Glu-AMPD or a SO1861-Glu-AMPD or a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; iii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group B as defined in claim 3, the saccharide chain comprising an acetoxy (Me(CO)O—) group which has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation; or iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combination of two derivatisations of derivatisations i., ii. and iii.; preferably, the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with EMCH wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol.
13. Saponin conjugate of claim 12, wherein the saponin is a saponin derivative wherein i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH; ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A as defined in claim 3, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety which has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; or iii. the saponin derivative comprises a combination of derivatisations i. and ii.
14. Saponin conjugate of claim 12, wherein the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group and wherein the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A as defined in claim 3, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which glucuronic acid moiety has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM).
15. Saponin conjugate of any one of the claims 1-12, wherein the saponin is a saponin derivative represented by Molecule 2: ##STR00043## or wherein the saponin is a saponin derivative represented by Molecule 3: ##STR00044##
16. Saponin conjugate of any one of the claims 1-15, wherein the at least one saponin and the ligand for ASGPR are covalently linked directly or via at least one linker.
17. Saponin conjugate of any one of the claims 1-16, wherein the GalNAc moiety is bound to the saponin S, preferably via a saponin linker L.sub.s, as shown in formula (II).sub.s: ##STR00045##
18. Saponin conjugate of any one of the claims 1-16, wherein the GalNAc moieties are each separately covalently bound via the oxygen on position “1” of the GalNAc moiety to a central bridging moiety B, which effectively forms a bridge between the GalNAc moieties and the saponin moiety, preferably via a saponin moiety linker L.sub.s, as shown in formula (III).sub.s: ##STR00046## wherein n is an integer larger than or equal to 2, preferably n is 3, L.sub.s is a saponin moiety linker and S is the saponin moiety.
19. Saponin conjugate of claim 18, wherein the GalNAc moieties are bound to the bridging moiety B via GalNAc linkers L.sub.GAL as shown in formula (IV).sub.s: ##STR00047## wherein n is an integer larger than or equal to 2, preferably n is 3, L.sub.s is a saponin moiety linker and S is the saponin moiety.
20. Saponin conjugate of any one of claims 17-19, wherein the saponin moiety linker L.sub.s represents any chemical moiety suitable for covalently binding a saponin to GalNAc as in formula (II).sub.s or to the bridging moiety B as in formula (III).sub.s and (IV).sub.s.
21. Saponin conjugate of any one of claims 17-20, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety, wherein L.sub.s1 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to GalNAc or to the bridging moiety B and L.sub.s2 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to the saponin moiety.
22. Saponin conjugate of any one of claims 17-21, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety, wherein the coupling reaction is selected from the group consisting of an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, a carbonyl reaction of the non-aldol type and an addition to a carbon-carbon double bond, preferably wherein the coupling reaction is an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, more preferably wherein the coupling reaction is an azide-alkyne cycloaddition or a thiol maleimide coupling.
23. Saponin conjugate of any one of claims 17-22, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B, the first precursor L.sub.s1 comprising an azide; and a second precursor L.sub.s2 covalently bound to the saponin moiety, the second precursor L.sub.s2 comprising an alkyne and preferably comprising a hydrazon resulting from a hydrazide/aldehyde coupling to an aldehyde of the saponin moiety.
24. Saponin conjugate of any one of claims 21-23, wherein the structure for the precursor L.sub.s1 is the following azide of formula (XVII): ##STR00048## wherein a represents an integer larger than or equal to 0, preferably a represents an integer selected from 1, 2, and 3, more preferably a represents 2, or wherein the structure for the precursor L.sub.s1 comprises the following azide of formula (XVIII): ##STR00049## wherein c represents an integer larger than or equal to 0, preferably c represents an integer in the range of 5-15, more preferably c represents 9.
25. Saponin conjugate of any one of claims 21-24, wherein the structure for the precursor L.sub.s2 comprises the following hydrazone with formula (XIX): ##STR00050## wherein a represents an integer larger than or equal to 0, preferably a represents an integer in the range of 2-6, more preferably a represents 4, and wherein L.sub.s2a represents an alkyne-containing moiety.
26. Saponin conjugate of claim 25, wherein L.sub.s2a comprises less than 20 carbon atoms, preferably L.sub.s2a represents a moiety according to formula (XX): ##STR00051##
27. Saponin conjugate of any one of claims 18-26, wherein the bridging moiety is a compound of formula (XV): ##STR00052## wherein the oxygen atoms of the compound of formula (XV) are bound to GalNAc or to the GalNAc linkers L.sub.GAL, and the nitrogen atom of the compound of formula (XV) is bound to the saponin moiety linker L.sub.S.
28. Saponin conjugate of any one of claims 19-27, wherein L.sub.GAL represents any chemical moiety suitable for covalently binding GalNAc to the bridging moiety B.
29. Saponin conjugate of any one of claims 19-28, wherein L.sub.GAL comprises 2-25 carbon atoms, preferably 7-15 carbon atoms, more preferably 11 carbon atoms and wherein L.sub.GAL comprises at least one, preferably two amide moieties.
30. Saponin conjugate of any one of claims 19-29, wherein L.sub.GAL is a compound according to formula (XVI): ##STR00053##
31. Saponin conjugate of any one of the claims 17-30, wherein the ligand for ASGPR is the (GalNAc).sub.3Tris represented by Molecule I′: ##STR00054## or wherein the ligand for ASGPR is mono-GalNAc represented by Molecule II′: ##STR00055##
32. Saponin conjugate of any one of the claims 1-31, wherein the at least one saponin is covalently bound to Molecule I′ or Molecule II′ of claim 31 via a linker represented by Molecule III′: ##STR00056## wherein the hydrazide moiety of Molecule III′ formed a covalent hydrazone bond with an aldehyde group in the saponin, and wherein the dibenzocyclooctyne group formed a covalent bond with the azide group of Molecule I′ or Molecule II′.
33. Saponin conjugate of any one of the claims 1-32, wherein the at least one saponin is covalently bound to the ligand for ASGPR via at least one cleavable linker.
34. Saponin conjugate of claim 33, wherein the cleavable linker is subject to cleavage under acidic conditions, reductive conditions, enzymatic conditions and/or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond and a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulfide bond.
35. Saponin conjugate of claim 33 or 34, wherein the cleavable linker is subject to cleavage in vivo under acidic conditions such as for example present in endosomes and/or lysosomes of mammalian cells, preferably human cells, preferably the cleavable linker is subject to cleavage in vivo at pH 4.0-6.5, and more preferably at pH≤5.5.
36. Saponin conjugate of any one of the claims 1-35, wherein the conjugate comprises 1, 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponin moieties, or any number of saponin moieties therein between, such as 7, 9, 12 saponin moieties.
37. Pharmaceutical combination comprising: a first pharmaceutical composition comprising the saponin conjugate of any one of the claims 1-36 and optionally comprising a pharmaceutically acceptable excipient and/or a pharmaceutically acceptable diluent; and a second pharmaceutical composition comprising a second conjugate of an effector molecule and a ligand for ASGPR, wherein the ligand for ASGPR preferably comprises at least one GalNAc moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, or a third conjugate of an effector molecule and a binding molecule comprising a binding site for a cell-surface molecule, and optionally comprising a pharmaceutically acceptable excipient and/or pharmaceutically acceptable diluent.
38. Pharmaceutical composition comprising: the saponin conjugate of any one of the claims 1-36; a second conjugate of an effector molecule and a ligand for ASGPR wherein the ligand for ASGPR preferably comprises at least one GalNAc moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, or a third conjugate of an effector molecule and a binding molecule comprising a binding site for a cell-surface molecule, and optionally comprising a pharmaceutically acceptable excipient and/or pharmaceutically acceptable diluent.
39. Pharmaceutical combination of claim 37 or pharmaceutical composition of claim 38, wherein the effector molecule comprises or consists of at least one of a small molecule such as a drug molecule, a toxin such as a protein toxin, an oligonucleotide such as a BNA, a xeno nucleic acid or an siRNA, an enzyme, a peptide, a protein, or any combination thereof, preferably, the effector molecule is a toxin, an enzyme or an oligonucleotide.
40. Pharmaceutical combination of claim 37 or 39, or pharmaceutical composition of claim 38 or 39, wherein the ligand for ASGPR comprises or is (GalNAc).sub.3Tris, and/or wherein the ligand for ASGPR and the effector molecule are conjugated via a covalent bond, preferably via at least one linker.
41. Pharmaceutical combination of any one of the claim 37 or 39-40 or pharmaceutical composition of any one of the claims 38-40, wherein the effector molecule is an oligonucleotide selected from any one or more of a(n): short interfering RNA (siRNA), short hairpin RNA (shRNA), anti-hairpin-shaped microRNA (miRNA), single-stranded RNA, aptamer RNA, double-stranded RNA (dsRNA), anti-microRNA (anti-miRNA, anti-miR), antisense oligonucleotide (ASO), DNA, antisense DNA, locked nucleic acid (LNA), bridged nucleic acid (BNA), 2′-O,4′-aminoethylene bridged nucleic Acid (BNA.sup.NC) BNA-based siRNA, and BNA-based antisense oligonucleotide (BNA-AON).
42. Pharmaceutical combination of any one of the claim 37 or 39-41 or pharmaceutical composition of any one of the claims 38-41, wherein the effector molecule is an oligonucleotide selected from any one or more of a(n): anti-miRNA, a BNA-AON or an siRNA, such as BNA-based siRNA, selected from chemically modified siRNA, metabolically stable siRNA and chemically modified, metabolically stable siRNA.
43. Pharmaceutical combination of any one of the claim 37 or 39-42 or pharmaceutical composition of any one of the claims 38-42, wherein the effector molecule is an oligonucleotide capable of, for example when present inside a mammalian cell, silencing any one of genes: apolipoprotein B (apoB), HSP27, transthyretin (TTR), proprotein convertase subtilisin/kexin type 9 (PCSK9), delta-aminolevulinate synthase 1 (ALAS1), antithrombin 3 (AT3), glycolate oxidase (GO), complement component C5 (CC5), X gene of hepatitis B virus (HBV), S gene of HBV, alpha-1 antitrypsin (AAT) and lactate dehydrogenase (LDH), and/or is an oligonucleotide capable of, for example when present inside a mammalian cell, targeting an aberrant miRNA.
44. Pharmaceutical combination of any one of the claim 37 or 39-43 or pharmaceutical composition of any one of the claims 38-43, wherein the effector molecule is an oligonucleotide, preferably an siRNA such as a BNA-based siRNA, or an antisense oligonucleotide such as a BNA-based antisense oligonucleotide, for example an AON based on 2′-O,4′-aminoethylene bridged nucleic acid, capable of, preferably when present inside a mammalian cell, silencing gene apolipoprotein B (apoB).
45. Pharmaceutical combination of any one of the claim 37 or 39-44 or pharmaceutical composition of any one of the claims 38-44, wherein the effector molecule is an oligonucleotide capable of, for example when present inside a mammalian cell, targeting an mRNA involved in expression of any one of proteins: apoB, HSP27, TTR, PCSK9, ALAS1, AT3, GO, CC5, expression product of X gene of HBV, expression product of S gene of HBV, AAT and LDH, or is capable of, for example when present inside a mammalian cell, antagonizing or restoring an miRNA function such as inhibiting an oncogenic miRNA (onco-miR) or suppression of expression of an onco-miR.
46. Pharmaceutical combination of any one of the claim 37 or 39-45 or pharmaceutical composition of any one of the claims 38-45, wherein the effector molecule is an oligonucleotide, preferably an siRNA such as a BNA-based siRNA, or an antisense oligonucleotide such as a BNA-based antisense oligonucleotide, for example an AON based on 2′-O,4′-aminoethylene bridged nucleic acid, capable of, preferably when present inside a mammalian cell, targeting an mRNA involved in expression of protein apoB.
47. Pharmaceutical combination of any one of the claim 37 or 39-46 or pharmaceutical composition of any one of the claims 38-46, wherein the effector molecule is or comprises a toxin which toxin comprises or consists of at least one molecule selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a proteinaceous toxin, a ribosome-inactivating protein, and/or a bacterial toxin, a plant toxin, more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin, and/or comprises or consists of at least one of a toxin targeting ribosome, a toxin targeting elongation factor, a toxin targeting tubulin, a toxin targeting DNA and a toxin targeting RNA, more preferably any one or more of emtansine, pasudotox, maytansinoid derivative DM1, maytansinoid derivative DM4, monomethyl auristatin E (MMAE, vedotin), monomethyl auristatin F (MMAF, mafodotin), a Calicheamicin, N-Acetyl-γ-calicheamicin, a pyrrolobenzodiazepine (PBD) dimer, a benzodiazepine, a CC-1065 analogue, a duocarmycin, Doxorubicin, paclitaxel, docetaxel, cisplatin, cyclophosphamide, etoposide, docetaxel, 5-fluorouracyl (5-FU), mitoxantrone, a tubulysin, an indolinobenzodiazepine, AZ13599185, a cryptophycin, rhizoxin, methotrexate, an anthracycline, a camptothecin analogue, SN-38, DX-8951f, exatecan mesylate, truncated form of Pseudomonas aeruginosa exotoxin (PE38), a Duocarmycin derivative, an amanitin, α-amanitin, a spliceostatin, a thailanstatin, ozogamicin, tesirine, Amberstatin269 and soravtansine, or a derivative thereof.
48. Pharmaceutical combination of any one of the claim 37 or 39-47 or pharmaceutical composition of any one of the claims 38-47, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is a ligand for a cell-surface molecule or an antibody comprising a binding site for a cell-surface molecule or at least one domain or fragment thereof comprising the binding site.
49. Pharmaceutical combination of any one of the claim 37 or 39-48 or pharmaceutical composition of any one of the claims 38-48, wherein the third conjugate is any one or more of: an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-nucleic acid conjugate or a receptor-ligand—nucleic acid conjugate.
50. Pharmaceutical combination of any one of the claim 37 or 39-49 or pharmaceutical composition of any one of the claims 38-49, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is capable of binding to any one of cell-surface molecules: CD71, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, asialoglycoprotein receptor (ASGPR), preferably any one of: HER2, CD71, ASGPR and EGFR, more preferably CD71.
51. Pharmaceutical combination of any one of the claim 37 or 39-50 or pharmaceutical composition of any one of the claims 38-50, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is or comprises any one of: an antibody, preferably a monoclonal antibody such as a human monoclonal antibody, an IgG, a molecule comprising or consisting of a single-domain antibody, at least one V.sub.HH domain, preferable a camelid V.sub.H, a variable heavy chain new antigen receptor (V.sub.NAR) domain, a Fab, an scFv, an Fv, a dAb, an F(ab)2 and a Fcab fragment.
52. Pharmaceutical combination of any one of the claims 37, 39-51 or pharmaceutical composition of any one of the claims 38-51, for use as a medicament.
53. Pharmaceutical combination of any one of the claims 37, 39-51 or pharmaceutical composition of any one of the claims 38-51, for use in the treatment or prophylaxis of a disease or health problem in which an expression product is involved of any one or more of genes: apoB, TTR, PCSK9, ALAS1, AT3, GO, CC5, X gene of HBV, S gene of HBV, AAT and LDH.
54. Pharmaceutical combination of any one of the claims 37, 39-51 or 53 or pharmaceutical composition of any one of the claims 38-51 or 53, for use in the treatment or prophylaxis of a disease or health problem in which an expression product is involved of gene apoB.
55. Pharmaceutical combination of any one of the claims 37, 39-51 or pharmaceutical composition of any one of the claims 38-51, or pharmaceutical combination or pharmaceutical composition for use of claim 53, for use in the treatment or prophylaxis of a cancer, an infectious disease, a viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, AAT related liver disease, acute hepatic porphyria, TTR-mediated amyloidosis, hereditary TTR amyloidosis (hATTR), complement-mediated disease, hepatitis B infection, or an auto-immune disease.
56. Pharmaceutical combination for use of claim 53, 54 or 55 or pharmaceutical composition for use of claim 53, 54 or 55, wherein the saponin is a saponin derivative, preferably a QS-21 derivative or an SO1861 derivative of any one of the claims 4-15.
57. In vitro or ex vivo method for transferring the second conjugate or the third conjugate of any one of the claims 37-51 from outside a cell to inside said cell, preferably subsequently transferring the effector molecule comprised by the second conjugate or the third conjugate of any one of the claims 37-51 into the cytosol of said cell, comprising the steps of: a) providing a cell which expresses ASGPR on its surface, and, when the third conjugate is to be transferred into the cell, which expresses the cell-surface molecule for which the third conjugate comprises a binding molecule for binding to said cell-surface molecule, the cell preferably selected from a liver cell, a virally infected cell and a tumor cell; b) providing the second conjugate or the third conjugate of any one of the claims 37-51 for transferring into the cell provided in step a); c) providing the saponin conjugate of any one of the claims 1-36; d) contacting the cell of step a) in vitro or ex vivo with the second conjugate or the third conjugate of step b) and the saponin conjugate of step c), therewith effecting the transfer of the second conjugate or the third conjugate from outside the cell into said cell, and preferably therewith subsequently effecting the transfer of the second conjugate or the third conjugate into the cytosol of said cell, or preferably therewith subsequently effecting the transfer of at least the effector molecule comprised by the second conjugate or the third conjugate into the cytosol of said cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
DETAILED DESCRIPTION
[0100] The present invention will be described with respect to particular embodiments, but the invention is not limited thereto but only by the claims.
[0101] A first aspect of the invention relates to a saponin conjugate comprising at least one saponin covalently linked to a ligand for asialoglycoprotein receptor (ASGPR), wherein the ligand for ASGPR comprises at least one N-acetylgalactosamine (GalNAc) moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, wherein the at least one saponin is selected from monodesmosidic triterpenoid saponins and bidesmosidic triterpenoid saponins.
[0102] Saponins of the triterpene glycoside type have the capacity to stimulate the delivery of effector molecules from outside a target cell to inside said cell, and subsequently into the cytosol of said cell. Saponins facilitate for example receptor mediated uptake of certain effector molecules, such as a protein toxin comprised in an ADC. Endocytosis of the toxin, as part of the ADC, delivers the toxin in the endosome and/or in the lysosome of the target cell. Without wishing to be bound by any theory, subsequent release of the ADC, or at least of the toxin, out of the endosome or lysosome and into the cell cytosol, is stimulated or mediated by the triterpenoid saponin. When a target cell is contacted with the toxin at a toxin dose that is too low for exerting an intracellular effect, co-administration of the toxin, such as part of an ADC, and a free saponin, such that the target cell is contacted with both the ADC and the saponin, can result in efficient toxin mediated killing of the target cell, at the same toxin dose that is ineffective when contacted with the cell in the absence of the saponin. Thus, under influence of the saponin, the therapeutic window of the toxin is improved. Still, the toxin dose required for efficient and sufficient target cell killing, can be accompanied by undesired off-target effects, for example when the tumor cell receptor targeted by the ADC is not a truly tumor-cell specific receptor, though is also expressed to some lower extent at the surface of e.g. healthy cells, elsewhere in a patient's body, or on cells that are present in the same organ where the target cells reside. Furthermore, the required dose of the free saponin, needed to reach a sufficient extent of toxin activation (delivery of the toxin in the target-cell cytosol), may be at a level such that the risk for saponin-mediated side effects are apparent. Since the saponin is administered systemically, and non-targeted when the target (tumor) cell to be treated with the toxin is considered, a relatively high saponin dose is to be administered to the patient in need of the toxin treatment, in order to reach the local saponin dose at the level of the target cells.
[0103] The inventors now surprisingly found that the saponin dose required for potentiating the effect of a toxin on tumor cells, can be lowered by a factor of about 100 to 1000, when the saponin is provided with a target cell targeting moiety such as a receptor ligand (e.g. EGF or a cytokine), an antibody, or a binding fragment or domain thereof. For tumor cells, nowadays a series of cell-surface receptors are known for their specific expression on the surface of such aberrant cells. Saponins are successfully coupled by the inventors to antibodies and ligands for binding to tumor-cell specific receptors such as anti-CD71 antibody OKT-9, trastuzumab, cetuximab, etc. Such targeted saponin conjugates indeed are able to stimulate e.g. the cytotoxic effect of a toxin inside a target cell, though at a 100-fold to 1000-fold lower saponin dose compared to the dose required for the same saponin in free form, not provided with a tumor cell targeting binding molecule. The current inventors further invented that target cell specific delivery and subsequent endocytosis of the (targeted) saponin, is also possible for non-aberrant cells or aberrant cells not related to e.g. cancer (tumor cells), auto-immune disease, virally infected cells, etc. That is to say, surprisingly, the inventors found that the ASGPR provides a suitable entrance on cells bearing this receptor, such as liver cells, for entry of saponins provided with a ligand for ASGPR, in particular ASGPR1. Known ligands such as mono-valent GalNAc and tri-valent GalNAc are successfully coupled to one or a multitude (2, 4, 8, etc.) of saponin molecules, providing saponin conjugates comprising the ASGPR ligand and comprising at least one saponin moiety.
[0104] Contacting cells that express the ASGPR, such as liver cells, with the saponin conjugates comprising the ligand for the ASGPR, results surprisingly in uptake of the saponin, as evident when such cells are co-targeted with e.g. conjugates comprising a gene-silencing nucleic acid and a binding molecule for a target cell surface molecule, e.g. CD71, ASGPR, resulting in saponin dependent gene silencing in the target cell, or conjugates comprising such a binding molecule for the target cell and a toxin, resulting in saponin dependent cytotoxicity. Providing the saponin with a ligand for ASGPR results in effects in the target cell, exerted by a co-administered effector molecule such as a targeted oligonucleotide or toxin (e.g. anti-CD71 antibody or ASGPR ligand coupled to a nucleic acid or to a toxin). Such effects are apparent to a much lower extent, if at all, when the target cells are contacted with the effector molecule only, in the absence of targeted saponin. Thus, the saponin conjugates of the invention improve the therapeutic efficacy of effector molecules when a target cell comprising ASGPR at its surface is considered, and such target cell is contacted with both the saponin-ASGPR ligand of the invention and the (targeted) effector molecule. Herewith, the therapeutic window of the effector molecule is improved: higher therapeutic effect at the same dose, under influence of co-administration of the saponin conjugate; or similar therapeutic effect at lower dose, under influence of co-administration of the saponin conjugate. The inventors also found that about a 100-fold to 1000-fold lower dose of the saponin conjugate is required to reach a certain level of therapeutic effect in the target ASGPR expressing cell, such as a liver cell, induced by the co-administered (targeted) effector molecule such as an ASO, an siRNA, a BNA, a toxin such as a protein toxin, when compared to the saponin dose required for reaching the similar effect, when the saponin is not provided with a ligand for ASGPR.
[0105] Thus, surprisingly, the inventors now provide for improved therapeutic methods using the ASGPR as a target receptor for saponin-mediated delivery of an effector molecule in the cytosol of ASGPR expressing cells, resulting in similar therapeutic effects induced by the effector molecule at lower doses than possible in the absence of the saponin conjugate of the invention. Thus, the present invention provides for improved therapeutic use of the stimulatory effect of saponins, when the delivery of an effector molecule into the cytosol of, e.g., liver cells is considered, by providing the saponin—ASGPR ligand conjugate of the invention. Advantages reached by the inventors are amongst others: lower dose required for the effector molecule by co-administration of the (targeted) effector molecule with saponin, and lower dose required for the saponin by providing the saponin as a covalent conjugate of a ligand for ASGPR, such as tri-valent GalNAc, and one or more saponin moieties. Surprisingly, the ligand for ASGPR can be the same in the saponin conjugate and in the targeted effector molecule conjugate, resulting in efficient effector molecule-mediated effects in the target cell, under stimulatory influence of the saponin. That is to say, the saponin conjugate and the effector molecule conjugate, both comprising covalently linked ligand for ASGPR such as tri-valent GalNAc, can be co-administered to target cells, such as liver cells exposing the ASGPR at their surface, such that the desired therapeutic effect of the effector molecule is efficiently obtained, while both conjugates target the same receptor and use the same route for endocytosis into the cell. This surprising finding is highly beneficial for liver-cell targeting therapies such as therapies involving cytosolic delivery of a nucleic acid (ASO, BNA, siRNA, to list a few), since liver cells do express the ASGPR, which ASGPR is specific for liver cells, whereas further liver cell receptors specific enough for use in liver cell targeting therapy are virtually absent. The current invention thus opens new ways to improve liver-cell directed therapies wherein effector molecules have to be intracellularly delivered and located for their mode of action. Targeted saponin provided as the saponin conjugates of the invention widens the therapeutic window of such effector molecules, and at the same time, by providing the saponin with a liver cell targeting binding molecule, also the therapeutic window of the saponin is improved, according to the invention.
Saponin Conjugate—Introduction
[0106] The present invention provides a conjugate of a saponin and a ligand for asialoglycoprotein receptor (ASGPR), referred to herein as “saponin conjugate”. The ASGPR ligand comprises at least one N-acetylgalactosamine (GalNAc) moiety. In accordance with preferred embodiments of the present invention each GalNAc moiety is bound to the remainder of the ASGPR ligand or—in case the ASGPR ligand consists of a single GalNAc moiety—to the saponin moiety, via a covalent bond to the oxygen on position “1” as indicated in formula (I):
##STR00001##
(I)
[0107] As shown in formula (II)s, the ASGPR ligand consists of a single GalNAc moiety bound to the saponin moiety S, preferably via a saponin moiety linker Ls.
##STR00002##
[0108] The ASGPR ligand may comprise more than one GalNAc moiety, such as 2, 3, 4, 5 or 6 GalNAc moieties, preferably 3 or 4 GalNAc moieties. In such case, it is preferred that the GalNAc moieties are each separately covalently bound via the oxygen on position “1” to a central bridging moiety B, which effectively forms a bridge between the GalNAc moieties and the saponin moiety, preferably via a saponin moiety linker Ls. The GalNAc moieties may be directly bound to the bridging moiety B as shown in formula (III)s:
##STR00003##
wherein n is an integer larger than or equal to 2, Ls is a saponin moiety linker and S is the saponin moiety. More preferably, the GalNAc moieties are bound to the bridging moiety B via GalNAc linkers L.sub.GAL as shown in formula (IV)s:
##STR00004##
wherein n is an integer larger than or equal to 2, Ls is a saponin moiety linker and S is the saponin moiety. While each occurrence of L.sub.GAL may be independently chosen, the skilled person will appreciate that the synthesis of the saponin conjugate is simplified in case each occurrence of L.sub.GAL represents the same moiety.
Saponin Conjugate—Linker Ls
[0109] The saponin moiety linker Ls represents any chemical moiety suitable for covalently binding a saponin to GalNAc as in formula (II)s or to the bridging moiety B as in formula (III)s and (IV)s. The identity and size of the linker is not particularly limited and covalently binding a saponin to GalNAc as in formula (II)s or to the bridging moiety B as in formula (III)s and (IV)s may be effected by means of a ‘regular’ chemical functional group (e.g. an ester bond) as well as through “click-chemistry” type linkers which typically have a long chain length, resulting in a linker E.sub.s comprising e.g. more than 10 or more than 20 carbon atoms. Suitable linkers Ls and associated coupling reactions for binding molecules to each other are described in the handbook Hermanson, Greg T. Bioconjugate techniques. Academic press, 2013.
[0110] As will be understood by the skilled person, the saponin moiety linker L.sub.s will typically be the result of a coupling reaction (e.g. “click-chemistry” type) between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety. This principle is illustrated in the following reaction scheme for the compound of formula (II)s:
##STR00005##
wherein L.sub.s is a saponin moiety linker, L.sub.s1 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to GalNAc or to the bridging moiety B and L.sub.s2 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to the saponin moiety and S is the saponin moiety.
[0111] The corresponding reaction scheme for the compound of formula (III)s is as follows:
##STR00006##
wherein L.sub.s is a saponin moiety linker, L.sub.s1 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to GalNAc and L.sub.s2 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to the saponin moiety, n is an integer larger than or equal to 2, B is a bridging moiety and S is the saponin moiety.
[0112] The corresponding reaction scheme for the compound of formula (IV)s is as follows:
##STR00007##
wherein L.sub.s is a saponin moiety linker, L.sub.s1 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to GalNAc and L.sub.s2 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to the saponin moiety, n is an integer larger than or equal to 2, B is a bridging moiety, S is the saponin moiety and L.sub.GAL is a GalNAc linker.
[0113] The saponin moiety linker L.sub.s can be the result of a coupling reaction between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety, wherein the coupling reaction is for example an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles (such as aziridines, epoxides, cyclic sulfates, aziridinium ions, episulfonium ions), a carbonyl reaction of the non-aldol type (such as urea, thiourea, hydrazon, oxime ether, amide or aromatic heterocycle formation) or an addition to a carbon-carbon double bond (such as epoxidation, aziridination, dihydroxylation, sulfentyl halide addition, nitrosyl halide addition or micheal addition), preferably wherein the coupling reaction is an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, more preferably wherein the coupling reaction is an azide-alkyne cycloaddition or a thiol maleimide coupling.
[0114] In accordance with some embodiments of the invention, the saponin moiety linker L.sub.s comprises a hydrazone and/or a 1, 2, 3-triazole, preferably a hydrazone and a 1, 2, 3-triazole. Whenever reference is made to a 1, 2, 3-triazole in the context of the linkers of the present application, this preferably means a 1H-1, 2, 3-triazole.
[0115] Such a hydrazone is e.g. the result of a coupling between a terminal hydrazide and an aldehyde containing compound (such as an aldehyde containing saponin). This hydrazide/aldehyde coupling is a known ‘click’-chemistry tool in the field of bioconjugation and is for example described in Hermanson, Greg T. Bioconjugate techniques. Academic press, 2013.
[0116] Such a 1, 2, 3-triazole is e.g. the result of a coupling between an azide and an alkyne containing compound. This azide/alkyne coupling is a commonly known ‘click’-chemistry tool in the field of bioconjugation and is for example described in Hermanson, Greg T. Bioconjugate techniques. Academic press, 2013.
[0117] Consequently, it is preferred that the saponin moiety linker L.sub.s is the result of a coupling reaction between a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B, the first precursor L.sub.s1 comprising an azide; and a second precursor L.sub.s2 covalently bound to the saponin moiety, the second precursor L.sub.s2 comprising an alkyne and preferably comprising a hydrazon resulting from a hydrazide/aldehyde coupling to an aldehyde of the saponin moiety.
[0118] Embodiments of the structure for the precursor L.sub.s1 present in the compounds of formula (V).sub.s are the following azides:
##STR00008##
wherein a represents an integer larger than or equal to 0, preferably a represents an integer selected from 1, 2, and 3, more preferably a represents 2.
[0119] Embodiments of the structure for the precursor L.sub.s1 present in the compounds of formula (VII)s or (VIII)s are the following azides:
##STR00009##
wherein c represents an integer larger than or equal to 0, preferably c represents an integer in the range of 5-15, more preferably c represents 9.
[0120] Embodiments of the structure for the precursor L.sub.s2 present in the compounds of formula (VI)s, are the following hydrazons:
##STR00010##
wherein a represents an integer larger than or equal to 0, preferably a represents an integer in the range of 2-6, more preferably a represents 4, and wherein L.sub.s2a represents an alkyne-containing moiety. As will be understood by the skilled person in light of the present disclosure, the hydrazon depicted in formula (XIX) results from a reaction of a hydrazide with an aldehyde of the saponin moiety.
[0121] L.sub.s2a preferably comprises less than 20 carbon atoms, more preferably L.sub.s2a represents a moiety according to formula (XX):
##STR00011##
Hence, in some embodiments the saponin conjugate is a compound of formula (II)s, (III)s or (IV)s as described herein, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between a compound of formula (V).sub.s, (VII).sub.s or (VIII).sub.s with a compound of formula (VI).sub.s, wherein the first precursor L.sub.s1 is an azide, for example an azide of formula (XVII) or formula (XVIII), and wherein the second precursor L.sub.s2 is a compound of formula (XIX) comprising an alkyn-containing moiety L.sub.s2a, for example the alkyn of formula (XX) and a hydrazon resulting from a reaction of a hydrazide with an aldehyde of the saponin moiety.
Saponin Conjugate—Saponin
[0122] An aspect of the invention relates to a saponin conjugate comprising at least one saponin covalently linked to a ligand for asialoglycoprotein receptor (ASGPR), wherein the ligand for ASGPR comprises at least one N-acetylgalactosamine (GalNAc) moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, wherein the at least one saponin is selected from monodesmosidictriterpenoid saponins and bidesmosidictriterpenoid saponins.
[0123] An embodiment is the saponin conjugate of the invention, wherein the saponin comprises an aglycone core structure selected from the group consisting of: [0124] 2alpha-hydroxy oleanolic acid; [0125] 16alpha-hydroxy oleanolic acid; [0126] hederagenin (23-hydroxy oleanolic acid); [0127] 16alpha,23-dihydroxy oleanolic acid; [0128] gypsogenin; [0129] quillaic acid; [0130] protoaescigenin-21(2-methylbut-2-enoate)-22-acetate; [0131] 23-oxo-barringtogenol C-21,22-bis(2-methylbut-2-enoate); [0132] 23-oxo-barringtogenol C-21(2-methylbut-2-enoate)-16,22-diacetate; [0133] digitogenin; [0134] 3,16,28-trihydroxy oleanan-12-en; [0135] gypsogenic acid, and [0136] derivatives thereof,
preferably the saponin comprises an aglycone core structure selected from quillaic acid and gypsogenin or derivatives thereof, more preferably the saponin aglycone core structure is quillaic acid or a derivative thereof. Such preferred aglycones comprise an aldehyde group at the C-23 atom or a derivative thereof as described herein elsewhere. Without wishing to be bound by any theory, such an aldehyde group contributes to the endosomal escape enhancing activity of saponins of the triterpene glycoside type, comprising an aglycone selected from Group C, especially quillajic acid and gypsogenin.
An embodiment is the saponin conjugate of the invention, wherein the at least one saponin is a monodesmosidic or bi-desmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with the aldehyde group in position C-23 and optionally comprising a glucuronic acid group in a carbohydrate substituent at the C-3beta-OH group of the saponin, preferably a bi-desmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with the aldehyde group in position C-23 and comprising a glucuronic acid group in a carbohydrate substituent at the C-3beta-OH group of the saponin.
[0137] An embodiment is the saponin conjugate of the invention, wherein the at least one saponin comprises a first saccharide chain, which is bound to the C.sub.3 atom or the C.sub.28 atom of the aglycone core structure of the at least one saponin, preferably to the C.sub.3 atom, and/or wherein the at least one saponin comprises a second saccharide chain, which is bound to the C.sub.28 atom of the aglycone core structure of the at least one saponin, preferably, the saponin comprises the first and second saccharide chain. Thus, when the saponin comprised by the saponin conjugate of the invention bears two glycans (saccharide chains), the first saccharide chain is bound at position C.sub.3 of the aglycone core structure and the second saccharide chain is bound at position C.sub.28 of the aglycone core structure.
[0138] An embodiment is the saponin conjugate of the invention, wherein [0139] the saponin comprises a saccharide chain bound to the aglycone core structure, which is selected from group A: [0140] GlcA- [0141] Glc-, [0142] Gal-, [0143] Rha-(1.fwdarw.2)-Ara-, [0144] Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA-, [0145] Glc-(1.fwdarw.2)-[Glc-(1.fwdarw.4)]-GlcA-, [0146] Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, [0147] Xyl-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, [0148] Glc-(1.fwdarw.3)-Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-Glc-(1.fwdarw.4)-Gal-, [0149] Rha-(1.fwdarw.2)-Gal-(1.fwdarw.3)-[Glc-(1.fwdarw.2)]-GlcA-, [0150] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0151] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0152] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0153] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0154] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0155] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0156] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0157] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0158] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0159] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0160] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0161] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0162] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0163] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0164] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0165] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, and [0166] derivatives thereof,
or [0167] the saponin comprises a saccharide chain bound to the aglycone core structure, which is selected from group B: [0168] Glc-, [0169] Gal-, [0170] Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.4)]-Rha-, [0171] Rha-(1.fwdarw.2)-[Ara-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-, [0172] Ara-, [0173] Xyl-, [0174] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R1-(.fwdarw.4)]-Fuc- wherein R1 is 4E-Methoxycinnamic acid, [0175] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R2-(.fwdarw.4)]-Fuc- wherein R2 is 4Z-Methoxycinnamic acid, [0176] Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0177] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-3,4-di-OAc-Fuc-, [0178] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R3-(.fwdarw.4)]-3-OAc-Fuc- wherein R3 is 4E-Methoxycinnamic acid, [0179] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0180] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0181] (Ara- or Xyl-)(1.fwdarw.3)-(Ara- or Xyl-)(1.fwdarw.4)-(Rha- or Fuc-)(1.fwdarw.2)-[4-OAc-(Rha- or Fuc-)(1.fwdarw.4)]-(Rha- or Fuc-), [0182] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0183] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0184] Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0185] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0186] Ara/Xyl-(1.fwdarw.4)-Rha/Fuc-(1.fwdarw.4)-[Glc/Gal-(1.fwdarw.2)]-Fuc-, [0187] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R4-(.fwdarw.4)]-Fuc- wherein R4 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0188] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R5-(.fwdarw.4)]-Fuc- wherein R5 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0189] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, [0190] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, [0191] 6-OAc-Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, [0192] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, [0193] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0194] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0195] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0196] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3,4-di-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0197] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0198] 6-OAc-Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0199] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0200] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0201] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, [0202] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, [0203] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R6-(.fwdarw.4)]-Fuc- wherein R6 is 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0204] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R7-(.fwdarw.4)]-Fuc- wherein R7 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0205] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R8-(.fwdarw.4)]-Fuc- wherein R8 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0206] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R9-(.fwdarw.4)]-Fuc- wherein R9 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0207] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R10-(.fwdarw.4)]-Fuc- wherein R10 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0208] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R11-(.fwdarw.3)]-Fuc- wherein R11 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0209] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R12-(.fwdarw.3)]-Fuc- wherein R12 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid) [0210] Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal-, and derivatives thereof,
or [0211] the saponin is a bidesmosidic triterpene glycoside comprising a first saccharide chain selected from the group A bound to the aglycone core structure and comprising a second saccharide chain selected from the group B bound to the aglycone core structure. Thus, when the saponin comprised by the saponin conjugate of the invention bears two glycans (saccharide chains), the first saccharide chain is bound at position C.sub.3 of the aglycone core structure and the second saccharide chain is bound at position C.sub.28 of the aglycone core structure.
[0212] Without wishing to be bound by any theory, presence of an aldehyde group or a derivative thereof in the aglycone core structure (here, also referred to as ‘aglycone’) is beneficial for the capacity of the saponin to stimulate and/or potentiate the endosomal escape of (effector) molecules when such a saponin co-localizes in a cell, in the endosome of said cell, with these (effector) molecules. Therefore, saponin conjugates of the invention comprising saponin which has an aglycone with an aldehyde group is preferred. In quillajic acid and in gypsogenin the aldehyde group is at the C.sub.23 atom of the aglycone.
[0213] An embodiment is the saponin conjugate of the invention, wherein the saponin is selected from the group consisting of: Quillaja bark saponin, dipsacoside B, saikosaponin A, saikosaponin D, macranthoidin A, esculentoside A, phytolaccagenin, aescinate, AS6.2, NP-005236, AMA-1, AMR, alpha-Hederin, NP-012672, NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, SO1861, GE1741, SO1542, SO1584, SO1658, SO1674, SO1832, SO1862, SO1904, QS-7, QS1861, QS-7 api, QS1862, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, QS-21 B-xylo, beta-Aescin, Aescin Ia, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Digitonin, Primula acid 1 and AS64R, stereoisomers thereof, derivatives thereof, and combinations thereof, preferably the saponin is selected from the group consisting of QS-21, a QS-21 derivative, SO1861, a SO1861 derivative, SA1641, a SA1641 derivative, GE1741, a GE1741 derivative and combinations thereof, more preferably the saponin is selected from the group consisting of a QS-21 derivative, a SO1861 derivative and combinations thereof, most preferably the saponin is a SO1861 derivative.
[0214] Such saponins of the triterpene glycoside type are capable of enhancing the endosomal escape of (effector) molecules that are present in the endosome (or lysosome) of a cell, when the saponin co-localizes with such (effector) molecule inside the cell. The inventors established that the endosomal escape enhancing activity of these saponins is about 100 to 1000 times more potent when the saponin is contacted with a cell when the saponin is comprised by the conjugate of the invention. The free saponin is capable of stimulating the delivery of (effector) molecules in the cytosol of cells, when such cells are contacted with the (effector) molecules and the saponin, at 100-1000 times higher saponin concentration, compared to the concentration of the same saponin which is comprised by the saponin conjugate of the invention, required to achieve the same extent of delivery of the (effector) molecule from outside the cell to inside the endsome and finally in the cytosol of said cell. Saponins which display such endosomal escape enhancing activity are listed in Table A1, as well as saponins with high structural similarity with saponins for which the ability to potentiate the cytosolic delivery of (effector) molecules has been established. When the saponin is part of the saponin conjugate of the invention, the targeted delivery of the saponin upon binding of the ligand for ASGPR to the cell-surface binding site on the target cell, on said cell, and after endocytosis, into the endosome of said cell, is thus about 100 to 1000 times more effective compared to contacting the same cell with free, untargeted saponin which is not provided with a ligand for ASGPR for binding to ASGPR of a target cell.
[0215] In embodiments the saponin conjugate comprises at least one saponin, wherein the saponin is a derivative wherein [0216] i. the aglycone core structure of the saponin comprises an aldehyde group which has been derivatised; [0217] ii. a saccharide chain of the saponin, preferably the saccharide chain selected from group A comprises a carboxyl group which has been derivatised; [0218] iii. a saccharide chain of the saponin, preferably the saccharide chain selected from group B comprises an acetoxy (Me(CO)O—) group which has been derivatised; or [0219] iv. any combination of derivatisations (i), (ii) and/or (iii) is present.
[0220] Exemplary derivatisations (i) for an aldehyde group of the aglycone core structure include reduction to an alcohol, such as a primary alcohol; transformation into a hydrazone; transformation into a hemiacetal; transformation into an acetal; oxidation to a carboxyl; transformation into an imine; transformation into an oxime; transformation into a p-hydroxy ketone; or transformation into an enone, preferably reduction to an alcohol, such as a primary alcohol; or transformation into a hydrazone.
[0221] In embodiments the saponin is a derivative wherein the aglycone core structure comprises an aldehyde group which has been derivatised by: [0222] reduction to an alcohol, such as a primary alcohol; or [0223] transformation into a hydrazone of formula R.sup.bHC═NNHR.sup.a; preferably into a hydrazone of formula R.sup.bHC═NNH(CO)R.sup.a
wherein R.sup.a is group comprising less than 20 carbon atoms, preferably less than 10 carbon atoms and R.sup.b is the remainder of the saponin. Preferably, R.sup.a is an N-alkylated maleimide. In particular embodiments, the aldehyde group has been transformation into a hydrazon bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH); N-[β-maleimidopropionic acid] hydrazide (BMPH); or N-[κ-maleimidoundecanoic acid] hydrazide (KMUH).
[0224] Exemplary derivatisations (ii) for a carboxyl group of a saccharide chain include: reduction to an alcohol, such as a primary alcohol; transformation into an amide; transformation into an ester; transformation into an amine, such as a primary or secondary amine; or decarboxylation, preferably reduction to an alcohol, such as a primary alcohol; transformation into an amide; or transformation into an ester; more preferably transformation into an amide.
[0225] Preferably, the carboxyl group which is derivatised is part of a glucuronic acid moiety and, preferably, the saccharide chain is selected from group A.
[0226] In embodiments the saponin is a derivative wherein a saccharide chain, preferably a saccharide chain selected from group A, comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by: [0227] reduction to an alcohol, such as a primary alcohol; [0228] transformation into an amide of formula R.sup.aNH(CO)R.sup.b; or [0229] transformation into an ester of formula R.sup.aO(CO)R.sup.b
wherein R.sup.a is group comprising less than 20 carbon atoms, preferably less than 10 carbon atoms and R.sup.b is the remainder of the saponin. Preferably, R.sup.a is an N-alkylated maleimide or a diol. In particular embodiments, the carboxyl group has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM).
[0230] Exemplary derivatisations (iii) for an acetoxy group of a saccharide chain include: transformation into an alcohol, such as a secondary alcohol, by deacetylation, optionally followed by transformation of the resulting alcohol into an ether; ester or ketone; preferably transformation into an alcohol, such as a secondary alcohol, by deacetylation.
[0231] Preferably, the acetoxy group which is derivatised is part of a saccharide chain selected from group B.
[0232] In embodiments the saponin is a derivative wherein a saccharide chain, preferably a saccharide chain selected from group B, comprises an acetoxy group which has been derivatised by: [0233] transformation into an alcohol, such as a secondary alcohol, by deacetylation; or [0234] transformation into an alcohol, such as a secondary alcohol, by deacetylation followed by transformation of the resulting alcohol into an ether of formula R.sup.aOR.sup.b, an ester of formula R.sup.a(CO)OR.sup.b, or a ketone of formula R.sup.a(CO)R.sup.b
wherein R.sup.a is group comprising less than 20 carbon atoms, preferably less than 10 carbon atoms and R.sup.b is the remainder of the saponin. Preferably, R.sup.a is an N-alkylated maleimide or a diol.
[0235] Hence, in embodiments the saponin is a derivative wherein: [0236] the aglycone core structure comprises an aldehyde group which has been derivatised by: [0237] reduction to an alcohol; [0238] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH); [0239] transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH); or [0240] transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH); [0241] the saccharide chain selected from group A comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM); [0242] the saccharide chain selected from group B comprises an acetoxy group (Me(CO)O—) which has been derivatised by transformation into a hydroxyl group (HO—); or [0243] any combination of derivatisations (i), (ii) and/or (iii) is present.
[0244] An embodiment is the saponin conjugate of the invention, wherein the saponin is a saponin derivative wherein [0245] i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised; [0246] ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A, the saccharide chain comprising a carboxyl group which has been derivatised; [0247] iii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group B, the saccharide chain comprising an acetoxy (Me(CO)O—) group which has been derivatised; or [0248] iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combination of two derivatisations of derivatisations i., ii. and iii.
[0249] An embodiment is the saponin conjugate of the invention, wherein the saponin is any one or more of: SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillajasaponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, SO1904, stereoisomers thereof, derivatives thereof and combinations thereof, preferably the saponin is selected from the group consisting of QS-21, a QS-21 derivative, SO1861, a SO1861 derivative, SA1641, a SA1641 derivative, GE1741, a GE1741 derivative and combinations thereof, more preferably the saponin is selected from the group consisting of a QS-21 derivative, a SO1861 derivative and combinations thereof, most preferably the saponin is a SO1861 derivative.
[0250] An embodiment is the saponin conjugate of the invention, wherein the saponin is a saponin derivative of the quillaic acid saponin or the gypsogenin saponin according to the invention and is represented by Molecule 1:
##STR00012##
wherein [0251] A.sub.1 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably [0252] A.sub.1 represents a saccharide chain selected from group A, more preferably A.sub.1 represents a saccharide chain selected from group A and A.sub.1 comprises or consists of a glucuronic acid moiety; [0253] A.sub.2 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably [0254] A.sub.2 represents a saccharide chain selected from group B, more preferably A.sub.2 represents a saccharide chain selected from group B and A.sub.2 comprises at least one acetoxy (Me(CO)O—) group, such as one, two, three or four acetoxy groups,
wherein at least one of A.sub.1 and A.sub.2 is not hydrogen, preferably both A.sub.1 and A.sub.2 are an oligosaccharide chain; [0255] and R is hydrogen in gypsogenin or hydroxyl in quillaic acid;
wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one, preferably one or two, more preferably one, of the following derivatisations is present: [0256] i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised; [0257] ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain selected from group A and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised; and [0258] iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain selected from group B and A.sub.2 comprises at least one acetoxy group, has/have been derivatised.
[0259] An embodiment is the saponin conjugate of the invention, wherein A.sub.1 represents a saccharide chain selected from group A and comprises or consists of a glucuronic acid moiety and wherein the carboxyl group of a glucuronic acid moiety of A.sub.1 has been derivatised and/or wherein A.sub.2 represents a saccharide chain selected from group B and A.sub.2 comprises at least one acetoxy group and wherein at least one acetoxy group of A.sub.2 has been derivatised.
[0260] An embodiment is the saponin conjugate of the invention, wherein the saponin represented by Molecule 1 is a bidesmosidic triterpene saponin.
[0261] An embodiment is the saponin conjugate of the invention, wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one, preferably one or two, more preferably one, of the following derivatisations is present: [0262] i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised by; [0263] reduction to an alcohol; [0264] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; [0265] transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or [0266] transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; [0267] ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain selected from group A and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AMPD such as a QS-21-Glu-AMPD or a SO1861-Glu-AMPD or a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; and [0268] iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain selected from group B and A.sub.2 comprises at least one acetoxy group, has/have been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
[0269] An embodiment is the saponin conjugate of the invention, wherein A.sub.1 is Gal-(1.fwdarw.42)-[Xyl-(1.fwdarw.43)]-GlcA and/or A2 is Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc, preferably the saponin represented by Molecule 1 is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4OAc-beta-D-quinovopyranosyl-(1.fwdarw.44)]-beta-D-fucopyranoside, more preferably the saponin is any one or more of: SO1861, GE1741, SA1641 and QS-21, or a derivative thereof, most preferably SO1861 or a derivative thereof.
[0270] An embodiment is the saponin conjugate of the invention, wherein the saponin is a saponin derivative wherein [0271] i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised by: [0272] reduction to an alcohol; [0273] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; [0274] transformation into a hydrazon bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or [0275] transformation into a hydrazon bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; [0276] ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AMPD such as a QS-21-Glu-AMPD or a SO1861-Glu-AMPD or a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; [0277] iii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group B, the saccharide chain comprising an acetoxy (Me(CO)O—) group which has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation; or [0278] iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combination of two derivatisations of derivatisations i., ii. and iii.;
preferably, the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with EMCH wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol.
[0279] An embodiment is the saponin conjugate of the invention, wherein the saponin is a saponin derivative wherein [0280] i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH; [0281] ii. the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety which has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; or [0282] iii. the saponin derivative comprises a combination of derivatisations i. and ii.
[0283] An embodiment is the saponin conjugate of the invention, wherein the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group and wherein the saponin derivative comprises a saccharide chain, preferably a saccharide chain selected from group A, the saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which glucuronic acid moiety has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM).
[0284] An embodiment is the saponin conjugate of the invention, wherein the saponin derivative is represented by Molecule 2:
##STR00013##
or wherein the saponin derivative is represented by Molecule 3:
##STR00014##
[0285] An embodiment is the saponin conjugate of the invention, wherein the at least one saponin and the ligand for ASGPR are covalently linked directly or via at least one linker.
[0286] An embodiment is the saponin conjugate of the invention, wherein the GalNAc moiety is bound to the saponin S, preferably via a saponin linker L.sub.s, as represented in formula (II).sub.s:
##STR00015##
[0287] An embodiment is the saponin conjugate of the invention, wherein the GalNAc moieties are each separately covalently bound via the oxygen on position “1” of the GalNAc moiety to a central bridging moiety B, which effectively forms a bridge between the GalNAc moieties and the saponin moiety, preferably via a saponin moiety linker L.sub.s, as shown in formula (III).sub.s:
##STR00016##
wherein n is an integer larger than or equal to 2, preferably n is 3, L.sub.s is a saponin moiety linker and S is the saponin moiety.
[0288] An embodiment is the saponin conjugate of the invention, wherein the GalNAc moieties are bound to the bridging moiety B via GalNAc linkers L.sub.GAL as shown in formula (IV).sub.s:
##STR00017##
wherein n is an integer larger than or equal to 2, preferably n is 3, L.sub.s is a saponin moiety linker and S is the saponin moiety.
[0289] An embodiment is the saponin conjugate of the invention, wherein the saponin moiety linker L.sub.s represents any chemical moiety suitable for covalently binding a saponin to GalNAc as in formula (II).sub.s or to the bridging moiety B as in formula (III).sub.s and (IV).sub.s.
[0290] An embodiment is the saponin conjugate of the invention, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety, wherein L.sub.s1 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to GalNAc or to the bridging moiety B and L.sub.s2 is a precursor of the saponin moiety linker L.sub.s which is covalently bound to the saponin moiety.
[0291] An embodiment is the saponin conjugate of the invention, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between at least a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.s2 covalently bound to the saponin moiety, wherein the coupling reaction is selected from the group consisting of an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, a carbonyl reaction of the non-aldol type and an addition to a carbon-carbon double bond, preferably wherein the coupling reaction is an azide-alkyne cycloaddition, a thiol maleimide coupling, a Staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, more preferably wherein the coupling reaction is an azide-alkyne cycloaddition or a thiol maleimide coupling.
[0292] An embodiment is the saponin conjugate of the invention, wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety B, the first precursor L.sub.s1 comprising an azide; and a second precursor L.sub.s2 covalently bound to the saponin moiety, the second precursor L.sub.s2 comprising an alkyne and preferably comprising a hydrazon resulting from a hydrazide/aldehyde coupling to an aldehyde of the saponin moiety.
[0293] An embodiment is the saponin conjugate of the invention, wherein the structure for the precursor L.sub.s1 is the following azide of formula (XVII):
##STR00018##
wherein a represents an integer larger than or equal to 0, preferably a represents an integer selected from 1, 2, and 3, more preferably a represents 2, or
wherein the structure for the precursor L.sub.s1 comprises the following azide of formula (XVIII):
##STR00019##
wherein c represents an integer larger than or equal to 0, preferably c represents an integer in the range of 5-15, more preferably c represents 9.
[0294] An embodiment is the saponin conjugate of the invention, wherein the structure for the precursor L.sub.s2 comprises the following hydrazone with formula (XIX):
##STR00020##
wherein a represents an integer larger than or equal to 0, preferably a represents an integer in the range of 2-6, more preferably a represents 4, and wherein L.sub.s2a represents an alkyne-containing moiety.
[0295] An embodiment is the saponin conjugate of the invention, wherein L.sub.s2a comprises less than 20 carbon atoms, preferably L.sub.s2a represents a moiety according to formula (XX):
##STR00021##
[0296] An embodiment is the saponin conjugate of the invention, wherein the bridging moiety is a compound of formula (XV):
##STR00022##
wherein the oxygen atoms of the compound of formula (XV) are bound to GalNAc or to the GalNAc linkers L.sub.GAL, and the nitrogen atom of the compound of formula (XV) is bound to the saponin moiety linker L.sub.s.
[0297] An embodiment is the saponin conjugate of the invention, wherein L.sub.GAL represents any chemical moiety suitable for covalently binding GalNAc to the bridging moiety B.
[0298] An embodiment is the saponin conjugate of the invention, wherein L.sub.GAL comprises 2-25 carbon atoms, preferably 7-15 carbon atoms, more preferably 11 carbon atoms and wherein L.sub.GAL comprises at least one, preferably two amide moieties.
[0299] An embodiment is the saponin conjugate of the invention, wherein L.sub.GAL is a compound according to formula (XVI):
##STR00023##
[0300] An embodiment is the saponin conjugate of the invention, wherein the ligand for ASGPR is (GalNAc).sub.3Tris represented by Molecule I′:
##STR00024##
or wherein the ligand for ASGPR is mono-GalNAc represented by Molecule II′:
##STR00025##
An embodiment is the saponin conjugate of the invention, wherein the at least one saponin is covalently bound to Molecule I′ or Molecule II′ of the invention via a linker represented by Molecule III′:
##STR00026##
wherein the hydrazide moiety of Molecule III′ formed a covalent hydrazone bond with an aldehyde group in the saponin, and wherein the dibenzocyclooctyne group formed a covalent bond with the azide group of Molecule I′ or Molecule II′.
[0301] An embodiment is the saponin conjugate of the invention, wherein the at least one saponin is covalently bound to the ligand for ASGPR via at least one cleavable linker.
[0302] An embodiment is the saponin conjugate of the invention, wherein the cleavable linker is subject to cleavage under acidic conditions, reductive conditions, enzymatic conditions and/or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond and a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulfide bond.
[0303] An embodiment is the saponin conjugate of the invention, wherein the cleavable linker is subject to cleavage in vivo under acidic conditions such as for example present in endosomes and/or lysosomes of mammalian cells, preferably human cells, preferably the cleavable linker is subject to cleavage in vivo at pH 4.0-6.5, and more preferably at pH≤5.5.
[0304] An embodiment is the saponin conjugate of the invention, wherein the conjugate comprises 1, 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponin moieties, or any number of saponin moieties therein between, such as 7, 9, 12 saponin moieties.
[0305] The skilled person will understand that if the saponin comprised in the saponin conjugate of the present invention is a compound of formula (II).sub.s, (III).sub.s or (IV).sub.s as described herein wherein the saponin moiety linker L.sub.s is the result of a coupling reaction between a first precursor L.sub.s1 covalently bound to GalNAc or the bridging moiety and a second precursor L.sub.s2 covalently bound to the saponin moiety, the second precursor L.sub.s2 comprising a hydrazone resulting from a hydrazide/aldehyde coupling to an aldehyde of the saponin moiety, as described herein, this means that the aldehyde group is already occupied by the linker, such that suitable saponin derivatives are these wherein saponin is derivatised by (ii) a carboxyl group of a saccharide chain as described herein and/or (iii) an acetoxy group of a saccharide chain as described herein.
Effector Molecule Conjugate—Introduction
[0306] Certain pharmaceutical combinations and certain pharmaceutical compositions of the present invention comprise a second conjugate of an effector molecule and a ligand for asialoglycoprotein receptor (ASGPR), referred to herein as “effector molecule conjugate”. When the effector molecule is bound to the remainder of the effector molecule conjugate it is referred to herein as an “effector moiety”. The ASGPR ligand comprises at least one N-acetylgalactosamine (GalNAc) moiety. In accordance with preferred embodiments of the present invention each GalNAc moiety is bound to the remainder of the ASGPR ligand or—in case ASGPR ligand consists of a single GalNAc moiety—to the effector moiety, via a covalent bond to the oxygen on position “1” as indicated in formula (I):
##STR00027##
(I)
[0307] As shown in formula (II).sub.E, the ASGPR ligand consists of a single GalNAc moiety bound to the effector moiety E, preferably via an effector moiety linker L.sub.E.
##STR00028##
[0308] The ASGPR ligand may comprise more than one GalNAc moiety, such as 2, 3, 4, 5 or 6 GalNAc moieties, preferably 3 or 4 GalNAc moieties. In such case, it is preferred that the GalNAc moieties are each separately covalently bound via the oxygen on position “1” to a central bridging moiety B, which effectively forms a bridge between the GalNAc moieties and the effector moiety, preferably via an effector moiety linker L.sub.E. The GalNAc moieties may be directly bound to the bridging moiety B as shown in formula (III)E:
##STR00029##
wherein n is an integer larger than or equal to 2, L.sub.E is an effector moiety linker and E is the effector moiety. More preferably, the GalNAc moieties are bound to the bridging moiety B via GalNAc linkers L.sub.GAL as shown in formula (IV).sub.E:
##STR00030##
wherein n is an integer larger than or equal to 2, L.sub.E is an effector moiety linker and E is the effector moiety. While each occurrence of L.sub.GAL may be independently chosen, the skilled person will appreciate that the synthesis of the conjugate is simplified in case each occurrence of L.sub.GAL represents the same moiety.
Effector Molecule Conjugate—Linker L.SUB.E
[0309] The effector moiety linker L.sub.E represents any chemical moiety suitable for covalently binding an effector moiety to GalNAc as in formula (II).sub.E or to the bridging moiety B as in formula (III).sub.E and (IV).sub.E. The identity and size of the linker is not particularly limited and covalently binding an effector molecule to GalNAc as in formula (II).sub.E or to the bridging moiety B as in formula (III).sub.E and (IV).sub.E may be effected by means of a ‘regular’ chemical functional group (e.g. an ether bond) as well as through “click-chemistry” type linkers which typically have a long chain length, resulting in a linker E.sub.L comprising e.g. more than 10 or more than 20 carbon atoms. Suitable effector moiety linkers L.sub.E and associated coupling reactions are described in the handbook Hermanson, Greg T. Bioconjugate techniques. Academic press, 2013.
[0310] As will be understood by the skilled person, the effector moiety linker L.sub.E will typically be the result of a coupling reaction (e.g. “click-chemistry” type) between at least a first precursor L.sub.E1 covalently bound to GalNAc or the bridging moiety B and a second precursor L.sub.E2 covalently bound to the effector moiety. This principle is illustrated in the following reaction scheme for the compound of formula (II):
##STR00031##
wherein L.sub.E is an effector moiety linker, L.sub.E1 is a precursor of the effector moiety linker L.sub.E which is covalently bound to GalNAc and L.sub.E2 is a precursor of the effector moiety linker L.sub.E which is covalently bound to the effector moiety and E is the effector moiety.
[0311] The corresponding reaction scheme for the compound of formula (III) is as follows:
##STR00032##
wherein L.sub.E is an effector moiety linker, L.sub.E1 is a precursor of the effector moiety linker L.sub.E which is covalently bound to GalNAc and L.sub.E2 is a precursor of the effector moiety linker L.sub.E which is covalently bound to the effector moiety, n is an integer larger than or equal to 2 and E is the effector moiety.
[0312] The corresponding reaction scheme for the compound of formula (IV).sub.E is s follows:
##STR00033##
wherein L.sub.E is an effector moiety linker, L.sub.E1 is a precursor of the effector moiety linker L.sub.E which is covalently bound to GalNAc and L.sub.E2 is a precursor of the effector moiety linker L.sub.E which is covalently bound to the effector moiety, n is an integer larger than or equal to 2, E is the effector moiety, and L.sub.GAL is a GalNAc linker and B is a bridging moiety.
[0313] The effector moiety linker L.sub.E can be the result of a coupling reaction between at least a first precursor L.sub.E1 covalently bound to GalNAc or the bridging moiety and a second precursor L.sub.E2 covalently bound to the effector moiety, wherein the coupling reaction is for example an azide-alkyne cycloaddition, a thiol maleimide coupling, a staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles (such as aziridines, epoxides, cyclic sulfates, aziridinium ions, episulfonium ions), a carbonyl reaction of the non-aldol type (such as urea, thiourea, hydrazon, oxime ether, amide or aromatic heterocycle formation) or an addition to a carbon-carbon double bond (such as epoxidation, aziridination, dihydroxylation, sulfentyl halide addition, nitrosyl halide addition or micheal addition), preferably wherein the coupling reaction is an azide-alkyne cycloaddition, a thiol maleimide coupling, a staudinger reaction, a nucleophilic ring-opening of strained heterocyclic electrophiles, more preferably wherein the coupling reaction is an azide-alkyne cycloaddition or a thiol maleimide coupling.
[0314] In accordance with some embodiments of the invention, the effector moiety linker L.sub.E comprises a succinimide thioether moiety. Such a succinimide thioether is e.g. the result of a thiol maleimide coupling between an N-substituted maleimide and a thiol or sulfhydryl containing compound. This thiol maleimide coupling is a commonly known ‘click’-chemistry tool in the field of bioconjugation and is for example described in Hermanson, Greg T. Bioconjugate techniques. Academic press, 2013 page 289.
[0315] Consequently, it is preferred that the effector moiety linker L.sub.E is the result of a coupling reaction between a first precursor L.sub.E1 covalently bound to GalNAc or the bridging moiety, the first precursor L.sub.E1 comprising an N-substituted maleimide; and a second precursor L.sub.E2 covalently bound to the effector moiety, the second precursor L.sub.E2 comprising a thiol or a precursor thereof. A suitable thiol precursor is a disulfide, which may be cleaved (e.g. in-situ) via reduction to the corresponding thiol.
[0316] A preferred structure for the precursor L.sub.E1 present in the compounds of formula (V).sub.E, (VII).sub.E or (VIII).sub.E is the following terminal N-substituted maleimide:
##STR00034##
wherein X represents any linker suitable for covalently bonding the terminal N-substituted maleimide to GalNAc or the bridging moiety B. As will be understood by the skilled person, X may be the result of a coupling reaction between a first moiety covalently bound to GalNAc or the bridging moiety and a second moiety covalently bound to the maleimide. X can comprise a hydrazone and/or a 1, 2, 3-triazole. Whenever reference is made to a 1, 2, 3-triazole in the context of the linkers of the present application, this preferably means a 1H-1, 2, 3-triazole.
[0317] Embodiments of the structure for the precursor L.sub.E1 present in the compounds of formula (V).sub.E, (VII).sub.E or (VIII).sub.E are the following terminal N-substituted maleimides:
##STR00035##
wherein a and b each independently represent an integer larger than or equal to 0, preferably a and b each independently represent an integer selected from 0, 1, 2, and 3, more preferably a and b represent 2, and wherein L.sub.E1a represents a hydrazone and/or a 1, 2, 3-triazole, preferably a 1, 2, 3-triazole and wherein L.sub.E1 represents a hydrazone and/or a 1, 2, 3-triazole, preferably a hydrazone;
##STR00036##
wherein b and c each independently represent an integer larger than or equal to 0, preferably b represents an integer selected from 0, 1, 2, and 3 and c represents an integer in the range of 5-15, more preferably b represents 2, and c represents 9, wherein L.sub.E1a represents a hydrazone and/or a 1, 2, 3-triazole, preferably a 1, 2, 3-triazole and wherein L.sub.E1b represents a hydrazone and/or a 1, 2, 3-triazole, preferably a hydrazone;
and
##STR00037##
wherein c represents an integer larger than or equal to 0, preferably c represents an integer in the range of 5-15, more preferably c represents 9, wherein L.sub.E1c represents a hydrazone and/or a 1, 2, 3-triazole, preferably a 1, 2, 3-triazole.
[0318] L.sub.E1a, L.sub.E1b and L.sub.E1c each preferably comprise less than 20 carbon atoms, more preferably L.sub.E1a, L.sub.E1b and L.sub.E1c each independently represent a moiety according to formula (XIII), (XIV) or (XV), preferably L.sub.E1a is the 1,2,3-triazole of formula (XIII), L.sub.E1b is the hydrazone of formula (XIV) and L.sub.E1c is the 1,2,3-triazole of formula (XV):
##STR00038##
Hence, in some embodiments the effector molecule conjugate is a compound of formula (II).sub.E, (III).sub.E or (IV).sub.E as described herein, wherein the effector moiety linker L.sub.E is the result of a coupling reaction between a compound of formula (V).sub.E, (VII).sub.E or (VIII).sub.E with a compound of formula (VI).sub.E, wherein the first precursor L.sub.E1 is a terminal N-substituted maleimide of formula (X), (XI) or (XII), wherein L.sub.E1a is for example the 1,2,3-triazole of formula (XIII), L.sub.E1b is for example the hydrazone of formula (XIV) and L.sub.E1c is for example the 1,2,3-triazole of formula (XV).
Effector Molecule Conjugate—Effector Moiety
[0319] An aspect of the invention relates to a pharmaceutical combination comprising: [0320] a first pharmaceutical composition comprising the saponin conjugate of the invention and optionally comprising a pharmaceutically acceptable excipient and/or a pharmaceutically acceptable diluent; and [0321] a second pharmaceutical composition comprising a second conjugate of an effector molecule and a ligand for ASGPR, wherein the ligand for ASGPR preferably comprises at least one GalNAc moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, or a third conjugate of an effector molecule and a binding molecule comprising a binding site for a cell-surface molecule, and optionally comprising a pharmaceutically acceptable excipient and/or pharmaceutically acceptable diluent.
[0322] An aspect of the invention relates to a pharmaceutical composition comprising: [0323] the saponin conjugate of the invention; [0324] a second conjugate of an effector molecule and a ligand for ASGPR wherein the ligand for ASGPR preferably comprises at least one GalNAc moiety, preferably three or four GalNAc moieties, more preferably the ligand for ASGPR comprises or consists of (GalNAc).sub.3Tris, or a third conjugate of an effector molecule and a binding molecule comprising a binding site for a cell-surface molecule, and optionally comprising a pharmaceutically acceptable excipient and/or pharmaceutically acceptable diluent.
[0325] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule comprises or consists of at least one of a small molecule such as a drug molecule, a toxin such as a protein toxin, an oligonucleotide such as a BNA, a xeno nucleic acid or an siRNA, an enzyme, a peptide, a protein, or any combination thereof, preferably, the effector molecule is a toxin, an enzyme or an oligonucleotide.
[0326] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the ligand for ASGPR comprises or is (GalNAc).sub.3Tris, and/or wherein the ligand for ASGPR and the effector molecule are conjugated via a covalent bond, preferably via at least one linker.
[0327] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide selected from any one or more of a(n): short interfering RNA (siRNA), short hairpin RNA (shRNA), anti-hairpin-shaped microRNA (miRNA), single-stranded RNA, aptamer RNA, double-stranded RNA (dsRNA), anti-microRNA (anti-miRNA, anti-miR), antisense oligonucleotide (ASO), DNA, antisense DNA, locked nucleic acid (LNA), bridged nucleic acid (BNA), 2′-O,4′-aminoethylene bridged nucleic Acid (BNA.sup.NC) BNA-based siRNA, and BNA-based antisense oligonucleotide (BNA-AON).
[0328] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide selected from any one or more of a(n): anti-miRNA, a BNA-AON or an siRNA, such as BNA-based siRNA, selected from chemically modified siRNA, metabolically stable siRNA and chemically modified, metabolically stable siRNA.
[0329] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide capable of, for example when present inside a mammalian cell, silencing any one of genes: apolipoprotein B (apoB), HSP27, transthyretin (TTR), proprotein convertase subtilisin/kexin type 9 (PCSK9), delta-aminolevulinate synthase 1 (ALAS1), antithrombin 3 (AT3), glycolate oxidase (GO), complement component C5 (CC5), X gene of hepatitis B virus (HBV), S gene of HBV, alpha-1 antitrypsin (AAT) and lactate dehydrogenase (LDH), and/or is an oligonucleotide capable of, for example when present inside a mammalian cell, targeting an aberrant miRNA.
[0330] Despite progress in implementation of lifestyle changes and drug treatment for prevention, cardiovascular disease is still an important cause of total years of life lost [B. G. Nordestgaard et al., Advances in lipid-lowering therapy through gene-silencing technologies, Nature Reviews—Cardiology, V 15, May 2018, pp. 261-272]. Substantial residual cardiovascular disease risk remains even after optimal lifestyle intervention, antihypertensive treatment, high-dose statin therapy and after treatment with newer classes of lipid-lowering therapy, such as the cholesterol absorption inhibitor ezetimibe, the PCSK9 inhibitors evolocumab and bococizumab, the lipid-lowering fibrate agent bezafibrate, the cholesteryl ester transfer protein inhibitor anacetrapib, and the anti-inflammatory agent canakinumab. Therapies in development, in particular antisense oligonucleotide inhibition or small interfering RNA (siRNA)-based approaches, employ gene-silencing technologies through mRNA degradation. Whereas small-molecule lipid-lowering agents are administered orally, gene-silencing drugs are usually injected subcutaneously. Gene-silencing technologies inhibit gene expression within the cell nuclei or cytoplasm to reduce protein production, resulting in reduced plasma lipoprotein levels in gram amounts. Antisense oligonucleotides and siRNAs are formulated with the aim of achieving much higher concentrations within liver cells than in plasma. Gene-silencing therapies target proteins both in plasma and within cells. LDL most likely causes atherosclerosis through intimal deposition of cholesterol. A prerequisite for a myocardial infarction (MI) or an ischaemic stroke event is the development of atherosclerosis within the coronary and other arteries. Atherosclerotic plaque initiation occurs by infiltration of LDL and remnant lipoproteins from plasma into the intima of arteries, facilitated by a blood-pressure gradient. Atherosclerotic plaque progression can occur if LDL and remnant lipoprotein levels remain elevated in plasma over prolonged periods of time. Endothelial dysfunction, which leads to increased flux of these lipoproteins into the intima, can further enhance the progression of atherosclerosis. Plaque rupture leading to MI or ischaemic stroke typically occurs at sites of unstable atherosclerotic plaques with ongoing local inflammation and no fibrous cap. After plaque rupture, activated platelets and fibrin generate a thrombus that can progress further in size if high levels of Lp(a) inhibit fibrinolysis through its homology with plasminogen. Finally, a substantial reduction in LDL and remnant lipoproteins in plasma can stabilize the plaque by reducing plaque size and local inflammation. Gene-silencing technologies take advantage of the central dogma of molecular biology: the transcription of DNA into mRNA and the translation of mRNA into proteins. If the DNA sequence of a gene is known to influence the levels of a lipoprotein fraction causative of cardiovascular disease, it is possible to synthesize a single strand of RNA (antisense oligonucleotide) or a double strand of RNA (siRNA) that will bind to the mRNA product of that gene and inactivate it, effectively turning off—or silencing—that gene. A challenge with the gene-silencing approaches based on antisense oligonucleotides or siRNA is potential off-target or adverse effects, which are minimized by preferentially delivering the medication to liver cells and thereby keeping drug concentrations low in the rest of the body. Currently, the best way of selectively delivering either antisense oligonucleotides or siRNAs to liver cells is to attach these drugs or their delivery systems to N-acetylgalactosamine (GalNAc) moieties, which facilitates selective uptake into liver cells via the asialoglycoprotein receptor. Such gene-silencing drugs with a conjugated GalNAc moiety will substantially increase drug potency, reduce the levels of the drug in plasma, and provide the promise of fewer adverse effects.
Lipid-lowering gene-silencing therapies are assessed in phase II and phase III trials. In addition to silencing the apolipoprotein B gene, also genes ANGPTL3, APOC3, LPA, and PCSK9, which are active in several lipoprotein pathways, are targets for gene-silencing therapies. An example of a lipoprotein gene silencing therapy is Mipomersen, which is an antisense oligonucleotide that binds directly to the mRNA sequence that encodes the apoB protein, which is the predominant protein carried on LDL, remnant lipoproteins, and Lp(a).
[0331] Part of the invention is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide, preferably an siRNA such as a BNA-based siRNA, or an antisense oligonucleotide such as a BNA-based antisense oligonucleotide, for example an AON based on 2′-O,4′-aminoethylene bridged nucleic acid, capable of, preferably when present inside a mammalian cell, silencing gene apolipoprotein B (apoB).
[0332] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide capable of, for example when present inside a mammalian cell, targeting an mRNA involved in expression of any one of proteins: apoB, HSP27, TTR, PCSK9, ALAS1, AT3, GO, CC5, expression product of X gene of HBV, expression product of S gene of HBV, AAT and LDH, or is capable of, for example when present inside a mammalian cell, antagonizing or restoring an miRNA function such as inhibiting an oncogenic miRNA (onco-miR) or suppression of expression of an onco-miR.
[0333] Part of the invention is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is an oligonucleotide, preferably an siRNA such as a BNA-based siRNA, or an antisense oligonucleotide such as a BNA-based antisense oligonucleotide, for example an AON based on 2′-O,4′-aminoethylene bridged nucleic acid, capable of, preferably when present inside a mammalian cell, targeting an mRNA involved in expression of protein apoB. That is to say, binding of the oligonucleotide comprised by the effector-moiety comprising conjugate to the apoB mRNA results in silencing of the expression of the protein apolipoprotein B.
[0334] The inventors now surprisingly established the improved and effective gene silencing of apoB by treatment with a BNA-AON in combination with a conjugate of a ligand for ASGPR, here tri-GalNAc, and a saponin. The saponin, here SO1861 as an example, is known for its activity to facilitate the endosomal escape of molecule entering the endosome, e.g., via receptor-mediated cellular uptake. The gene silencing of apoB resulted in reduced mRNA levels for expressing ApoB protein, lower plasma ApoB level, and resulted in lowered LDL plasma level, after treatment with the therapeutic combination of GalNAc-comprising AON conjugate and GalNAc-comprising saponin conjugate. The gene-silencing effect is apparent at 72 h after a single administration of the combination of said two conjugates, and even after over 10 days, e.g., after 14 days.
[0335] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the effector molecule is or comprises a toxin which toxin comprises or consists of at least one molecule selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a proteinaceous toxin, a ribosome-inactivating protein, and/or a bacterial toxin, a plant toxin, more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin, and/or comprises or consists of at least one of a toxin targeting ribosome, a toxin targeting elongation factor, a toxin targeting tubulin, a toxin targeting DNA and a toxin targeting RNA, more preferably any one or more of emtansine, pasudotox, maytansinoid derivative DM1, maytansinoid derivative DM4, monomethyl auristatin E (MMAE, vedotin), monomethyl auristatin F (MMAF, mafodotin), a Calicheamicin, N-Acetyl-γ-calicheamicin, a pyrrolobenzodiazepine (PBD) dimer, a benzodiazepine, a CC-1065 analogue, a duocarmycin, Doxorubicin, paclitaxel, docetaxel, cisplatin, cyclophosphamide, etoposide, docetaxel, 5-fluorouracyl (5-FU), mitoxantrone, a tubulysin, an indolinobenzodiazepine, AZ13599185, a cryptophycin, rhizoxin, methotrexate, an anthracycline, a camptothecin analogue, SN-38, DX-8951f, exatecan mesylate, truncated form of Pseudomonas aeruginosa exotoxin (PE38), a Duocarmycin derivative, an amanitin, α-amanitin, a spliceostatin, a thailanstatin, ozogamicin, tesirine, Amberstatin269 and soravtansine, or a derivative thereof.
Conjugates—Bridging Moiety B
[0336] The bridging moiety B present in the saponin conjugates of formula (III).sub.s or (IV).sub.s and in the effector molecule conjugates of formula as (III).sub.E or (IV).sub.E described herein represents any moiety suitable for covalently binding 2 or more, preferably 3 or 4, more preferably 3 GalNAc moieties and the saponin moiety linker L.sub.s or the effector moiety linker L.sub.E.
[0337] According to preferred embodiments, the bridging moiety B is a compound of formula (XV):
##STR00039##
[0338] wherein the oxygen atoms of the compound of formula (XV) are bound to GalNAc (corresponding to compounds of formula (III).sub.s or (III).sub.E) or to the GalNAc linkers L.sub.GAL (corresponding to compounds of formula (IV).sub.s or (IV).sub.E), and the nitrogen atom of the compound of formula (XV) is bound to the saponin moiety linker L.sub.s or the effector moiety linker L.sub.E.
[0339] The skilled person will understand that these compounds of formula (III).sub.s, (III).sub.E, (IV).sub.s or (IV).sub.E wherein the bridging moiety B is a compound of formula (XV) correspond to effector molecule conjugates wherein the ASGPR ligand consists of (GalNAc).sub.3Tris.
Conjugates—Linker L.SUB.GAL
[0340] The GalNAc linkers L.sub.GAL represent any chemical moiety suitable for covalently binding GalNAc to the bridging moiety as in formula (IV).sub.s or (IV).sub.E. The identity and size of the linker is not particularly limited.
[0341] According to embodiments, the GalNAc linkers L.sub.GAL each comprise 2-25 carbon atoms, preferably 7-15 carbon atoms, more preferably 11 carbon atoms. Preferably the GalNAc linkers L.sub.GALcomprise at least one, preferably two amide moieties. A particularly preferred GalNAc linker L.sub.GAL is a compound according to formula (XVI):
##STR00040##
An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is a ligand for a cell-surface molecule or an antibody comprising a binding site for a cell-surface molecule or at least one domain or fragment thereof comprising the binding site.
[0342] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the third conjugate is any one or more of: an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-nucleic acid conjugate or a receptor-ligand—nucleic acid conjugate.
[0343] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is capable of binding to any one of cell-surface molecules: CD71, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, asialoglycoprotein receptor (ASGPR), preferably any one of: HER2, CD71, ASGPR and EGFR, more preferably CD71.
[0344] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, wherein the binding molecule comprising a binding site for a cell-surface molecule, comprised by the third conjugate, is or comprises any one of: an antibody, preferably a monoclonal antibody such as a human monoclonal antibody, an IgG, a molecule comprising or consisting of a single-domain antibody, at least one V.sub.HH domain, preferable a camelid V.sub.H, a variable heavy chain new antigen receptor (V.sub.NAR) domain, a Fab, an scFv, an Fv, a dAb, an F(ab)2 and a Fcab fragment.
[0345] An aspect of the invention relates to the pharmaceutical combination of the invention or to the pharmaceutical composition of the invention, for use as a medicament.
[0346] An aspect of the invention relates to the pharmaceutical combination of the invention or to the pharmaceutical composition of the invention, for use in the treatment or prophylaxis of a disease or health problem in which an expression product is involved of any one or more of genes: apoB, TTR, PCSK9, ALAS1, AT3, GO, CC5, X gene of HBV, S gene of HBV, AAT and LDH.
[0347] Part of the invention is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, for use in the treatment or prophylaxis of a disease or health problem in which an expression product is involved of gene apoB. The expression product of the apoB gene is the lipoprotein apolipoprotein B (ApoB), present as part of LDL, remnant lipoproteins, and Lp(a). Typically, the disease is a cardiovascular disease, typically related to build-up and presence of an atherosclerotic plaque involving one or more of ApoB comprising LDL, Lp(a) and remnant lipoproteins. The inventors now surprisingly established the improved and effective gene silencing of apoB by treatment with a BNA-AON in combination with a conjugate of a ligand for ASGPR, here tri-GalNAc, and a saponin. The saponin, here SO1861 as an example, is known for its activity to facilitate the endosomal escape of molecule entering the endosome, e.g. via receptor-mediated cellular uptake. The gene silencing of apoB resulted in reduced mRNA levels for expressing ApoB protein, reduced plasma ApoB protein level, and resulted in lowered LDL plasma level, after treatment with the therapeutic combination of GalNAc-comprising AON conjugate and GalNAc-comprising saponin conjugate. The gene-silencing effect is apparent at 72 h after a single administration of the combination of said two conjugates, and even after over 10 days, e.g. after 14 days.
[0348] An embodiment is the pharmaceutical combination of the invention or the pharmaceutical composition of the invention, or the pharmaceutical combination or pharmaceutical composition for use of the invention, for use in the treatment or prophylaxis of a cancer, an infectious disease, a viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, AAT related liver disease, acute hepatic porphyria, TTR-mediated amyloidosis, hereditary TTR amyloidosis (hATTR), complement-mediated disease, hepatitis B infection, or an auto-immune disease.
[0349] An embodiment is the pharmaceutical combination for use of the invention or the pharmaceutical composition for use of the invention, wherein the saponin is a saponin derivative, preferably a QS-21 derivative or an SO1861 derivative according to the invention.
[0350] An aspect of the invention relates to an in vitro or ex vivo method for transferring the second conjugate or the third conjugate of the invention from outside a cell to inside said cell, preferably subsequently transferring the effector molecule comprised by the second conjugate or the third conjugate according to the invention into the cytosol of said cell, comprising the steps of: [0351] a) providing a cell which expresses ASGPR on its surface, and, when the third conjugate is to be transferred into the cell, which expresses the cell-surface molecule for which the third conjugate comprises a binding molecule for binding to said cell-surface molecule, the cell preferably selected from a liver cell, a virally infected cell and a tumor cell; [0352] b) providing the second conjugate or the third conjugate of the invention, for transferring into the cell provided in step a); [0353] c) providing the saponin conjugate of the invention; [0354] d) contacting the cell of step a) in vitro or ex vivo with the second conjugate or the third conjugate of step b) and the saponin conjugate of step c), therewith effecting the transfer of the second conjugate or the third conjugate from outside the cell into said cell, and preferably therewith subsequently effecting the transfer of the second conjugate or the third conjugate into the cytosol of said cell, or preferably therewith subsequently effecting the transfer of at least the effector molecule comprised by the second conjugate or the third conjugate into the cytosol of said cell.
[0355] While the invention has been described in terms of several embodiments, it is contemplated that alternatives, modifications, permutations and equivalents thereof will become apparent to one having ordinary skill in the art upon reading the specification and upon study of the drawings. The invention is not limited in any way to the illustrated embodiments. Changes can be made without departing from the scope which is defined by the appended claims.
[0356] The present invention has been described above with reference to a number of exemplary embodiments. Modifications are possible and are included in the scope of protection as defined in the appended claims. The invention is further illustrated by the following examples, which should not be interpreted as limiting the present invention in any way.
EXAMPLES AND EXEMPLARY EMBODIMENTS
Example 1. CD71-Saporin+4000 nM Trivalent GalNAc-L-SO1861
[0357] Trivalent-GalNAc is a targeting ligand that recognizes and binds the ASGPR1 receptor on hepatocytes. Trivalent GalNAc was produced (
[0358] HepG2 and Huh7 cells were also treated with a range of concentrations of CD71-saporin in combination with a fixed concentration of 1000 nM or 4000 nM trivalent-GalNAc-SO1861 (DAR=1 with regard to bound SO1861). Targeted protein toxin mediated cell killing of ASGPR1/CD71 expressing cells (HepG2 and Huh7) was determined. This revealed strong cell killing at low concentrations of CD71-Saporin (IC50=1 μM) in both cell lines, whereas equivalent concentrations CD71-Saporin (CD71-SPRN), CD71-Saporin+1000 nM trivalent-GalNAc ((GalNAc)3) or CD71-Saporin+4000 nM trivalent-GalNAc ((GalNAc)3-SPT) could only induce cell killing at high concentrations CD71-Saporin (IC50=100 pM) in both cell lines (
[0359] All this shows that trivalent-GalNAc-SO1861 ((GalNAc)3-SPT) in combination with low concentrations of CD71-Saporin (CD71-SPRN) effectively induce cell killing in ASGPR1/CD71 expressing cells. Thus trivalent-GalNAc-SO1861 effectively induces endosomal escape of a protein toxin in ASGPR1 expressing cells.
Example 2 Trivalent-GaNAc-L/S-BNA+SO1861-EMCH
[0360] HSP27BNA was conjugated to trivalent-GalNAc (
[0361] Next, ApoBBNA was conjugated in a similar manner (
[0362] All this shows that SO1861-EMCH can enhance endosomal escape and target gene silencing of trivalent-GalNAc-L-BNA or trivalent-GalNAc-S-BNA for two independent gene targets. The gene silencing is more efficient in HepG2 cells compared to Huh7 cells, suggesting that higher levels of ASGPR1 expression at the plasma membrane of the cell facilitates increased uptake of the GalNAc-BNA conjugates.
Example 3 Trivalent-GaNAc-L/S-BNA+Trivalent-GaNAc-L-SO1861
[0363] SO1861-EMCH was conjugated (labile, in a similar manner as described in
Example 4 Potency of (GalNAc)3-BNA (GalNAc)3-SO1861 in Primary Mouse Hepatocytes
[0364] (GalNAc)3 was conjugated to a linker (‘Ls’) with SO1861-EMCH revealing (GalNAc)3-SO1861, with a DAR=1 for the bound SO1861 (
[0365] Primary mouse hepatocytes were treated with a range of concentrations of either ApoB #02 BNA alone, or (GalNAc)3-ApoB #02, or (GalNAc)3-ApoB #02+2000 nM SO1861-EMCH, or (GalNAc)3-ApoB #02+250 nM (GalNAc)3-SO1861 and ApoB RNA expression was determined by qPCR after 72 hrs incubation (
[0366] This shows that only in combination with (GalNAc)3-SO1861 or SO1861-EMCH, very low concentrations of (GalNAc)3-ApoB #02 BNA are effectively inducing ApoB RNA down-modulation, i.e., gene silencing in murine primary hepatocytes.
Example 5 In Vivo Efficacy of (GalNAc)3-BNA+(GalNAc)3-SO1861 in C57BL/6J Mice
[0367] C57BL/6J mice were treated as described and dosed according to Table A5. The conjugates used in this study, (GalNAc)3-ApoB #02 and (GalNAc)3-SO1861 were produced as described in
[0368] As
[0369] As
[0370] As
[0371] In conclusion, this shows that only in combination with 5 mg/kg (GalNAc)3-SO1861, very low concentrations of trivalent-GalNAc-ApoB #02 BNA ((GalNAc)3-ApoB #02 BNA) are effectively inducing ApoB RNA down-modulation, i.e., gene silencing in the livers of C57BL/6J mice, and all ‘downstream’ biomarkers of efficacy, such as ApoB protein and LDL-cholesterol.
Example 5 In Vivo Tolerability of (GalNAc)3-BNA+(GalNAc)3-SO1861 in C57BL/6J Mice
[0372] The conjugates used in this study, (GalNAc)3-ApoB #02 and (GalNAc)3-SO1861, were produced as described in
[0373] During the course of the study, all treatments, doses, and dose regimens as described in Table A5 were well tolerated and showed no treatment-specific adverse findings or any specific clinical observations indicative of the conjugates not being tolerated. The mice in treatment groups gained weight comparable to the mice receiving vehicle. Serum ALT levels were determined and results are shown in
[0374] In conclusion, this shows that ApoB #02, (GalNAc)3-ApoB #02, and (GalNAc)3-SO1861 (alone or in combination with (GalNAc)3-ApoB #02) are well tolerated in the doses and dose regimen applied, and particularly, that co-administration of (GalNAc)3-SO1861 with (GalNAc)3-ApoB #02 has no immediate tolerability issues, while showing high potency in the C57BL/6J mouse model.
Example 6. (GalNAc)3-SO1861+10 μM CD71-Saporin and (GalNAc)3-BNA+250 nM (GalNAc)3-SO1861
[0375] SO1861-EMCH was conjugated (labile, in a similar manner as described in
[0376] Next, ApoB BNA (SEQ ID NO: 2) was conjugated to trivalent-GalNAc ((GalNAc)3) to produce (GalNAc)3-ApoBBNA (
Example 7. CD71-Saporin+Concentration Series of Trivalent GalNAc-L-SO1861, Trivalent GalNAc-(L-SO1861)4, SO1861-EMCH
[0377] Trivalent GalNAc was produced (
[0378] All this shows that trivalent-GalNAc-SO1861 and trivalent-GalNAc-(SO1861).sub.4 in combination with low concentrations of CD71-Saporin effectively induce cell killing in ASGPR1/CD71 expressing cells. Thus, trivalent-GalNAc-SO1861 effectively induces endosomal escape of a protein toxin in ASGPR1 expressing cells. Thus, SPT001 and GalNAc targeted SPT001 (DAR=1 with regard to bound SO1861) both increase potency of industry standard GalNAc targeted ASO; SO1861-EMCH with about a factor 10, and both (GN)3-SPT and (GN)3-dSPT4 about 100×, when cell viability of liver cells is considered.
Example 8. Trivalent GalNAc Conjugated with ApoB Antisense Oligonucleotide+Trivalent GalNAc-L-SO1861
[0379] Trivalent GalNAc was produced (
[0380] Primary hepatocytes which highly express ASGPR1 (ASGPR1*) were treated with a concentration range of trivalent-GalNAc-ApoBBNA ((GalNAc)3-ApoB), either or not in the presence of 300 nM trivalent-GalNAc-SO1861 ((GalNAc)3-SPT001) (
[0381] All this shows that trivalent-GalNAc-SO1861 in combination with (GalNAc).sub.3-ApoB effectively induces silencing of ApoB gene expression in ASGPR1 expressing cells. Thus trivalent-GalNAc-SO1861 effectively induces endosomal escape of a BNA in ASGPR1 expressing cells.
Example 9. Trivalent GalNAc Conjugated with SO1861, or a Concentration Series of Conjugate Trivalent GalNAc-(L-SO1861) in the Presence of a Fixed Dose of OKT-9 Anti-CD71 Monoclonal Antibody
[0382] Trivalent GalNAc was produced (
[0383] Primary hepatocytes which highly express ASGPR1 (ASGPR1*) and hepatocyte cells of cell-line Huh7 (ASGPR1.sup.+/−) were treated with a concentration range of trivalent-GalNAc-SO1861 (TrivalentGalNAc-SPT001), either or not in the presence of 10 μM CD71-saporin (monoclonal antibody OKT-9 targeting CD71 conjugated to the protein toxin saporin;
All this shows that low dose of trivalent-GalNAc-SO1861 in combination with a low concentration of CD71-Saporin effectively induce cell killing in ASGPR1 expressing cells. Thus trivalent-GalNAc-SO1861 effectively induces endosomal escape of a protein toxin in ASGPR1 expressing cells. Thus, low nM TrivalentGalNAc-SPT001 enhances cytoplasmic delivery of low pM CD71MoAb-saporin in primary hepatocytes; and Hepatocytes that lack ASGPR1 expression are not responsive at low nM concentrations of TrivalentGalNAc-SPT001.
Example 10. Trivalent GalNAc Conjugated with ApoB Antisense Oligonucleotide+Trivalent GalNAc-L-SO1861
[0384] Trivalent GalNAc was produced and SO1861-EMCH was conjugated to trivalent-GalNAc, with a DAR=1 with regard to bound SO1861, as described in Example 8 (trivalent-GalNAc-SO1861; (GalNAc)3-SPT001);
[0385] Primary hepatocytes which highly express ASGPR1 (ASGPR1*) and hepatocyte cells of cell-line Huh7 (ASGPR1.sup.+/−) were treated with a concentration range of trivalent-GalNAc-ApoBBNA (TrivalentGalNAc-ApoBBNA), either or not in the presence of 300 nM trivalent-GalNAc-SO1861 (TrivalentGalNAc-SPT001) (
[0386] All this shows that TrivalentGalNAc-SPT001 in combination with TrivalentGalNAc-ApoBBNA effectively induces silencing of ApoB mRNA expression in ASGPR1 expressing cells. Thus TrivalentGalNAc-SPT001 effectively induces endosomal escape of a BNA in ASGPR1 expressing cells.
[0387] Primary hepatocytes which highly express ASGPR1 (ASGPR1*) and hepatocyte cells of cell-line Huh7 (ASGPR1.sup.+/−) were treated with a concentration range of trivalent-GalNAc-ApoBBNA (TrivalentGalNAc-ApoBBNA), either or not in the presence of 300 nM trivalent-GalNAc-SO1861 (TrivalentGalNAc-SPT001) (
[0388] All this shows that TrivalentGalNAc-SPT001 in combination with TrivalentGalNAc-ApoBBNA effectively induces silencing of ApoB protein expression in ASGPR1 expressing cells. Thus, TrivalentGalNAc-SPT001 effectively induces endosomal escape of a BNA in ASGPR1 expressing cells. Thus, low nM trivalentGalNAc-ApoBBNA+trivalentGalNAc-SPT001 can enhance endosomal escape and cytoplasmic delivery of ApoBBNA resulting in ApoB mRNA silencing in primary hepatocytes; Low nM trivalentGalNAc-ApoBBNA+trivalentGalNAc-SPT001 can enhance endosomal escape and cytoplasmic delivery of ApoBBNA resulting in ApoB protein decay in primary hepatocytes; Cells with IowASGPR1 expression are not responsive for the therapy when ApoB expression is considered.
Materials and Methods
Abbreviations
[0389] AEM N-(2-Aminoethyl)maleimide trifluoroacetate salt [0390] AMPD 2-Amino-2-methyl-1,3-propanediol [0391] BOP (Benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate [0392] DIPEA N,N-diisopropylethylamine [0393] DMF N,N-dimethylformamide [0394] EDCl.HCl 3-((Ethylimino)methyleneamino)-N,N-dimethylpropan-1-aminium chloride [0395] EMCH.TFA N-(ε-maleimidocaproic acid) hydrazide, trifluoroacetic acid salt [0396] HATU 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate [0397] min minutes [0398] NMM 4-Methylmorpholine [0399] r.t. retention time [0400] TCEP tris(2-carboxyethyl)phosphine hydrochloride [0401] Temp temperature [0402] TFA trifluoroacetic acid
Analytical Methods
LC-MS Method 1
[0403] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: neg or neg/pos within in a range of 1500-2400 or 2000-3000; ELSD: gaspressure 40 psi, drift tube temp: 50° C.; column: Acquity C18, 50×2.1 mm, 1.7 μm Temp: 60° C., Flow: 0.6 mL/min, lin. Gradient depending on the polarity of the product: [0404] .sup.At.sub.0=2% A, t.sub.5.0min=50% A, t.sub.6.0min=98% A [0405] .sup.Bt.sub.0=2% A, t.sub.5.0min=98% A, t.sub.6.0min=98% A [0406] Posttime: 1.0 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS Method 2
[0407] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos/neg 100-800 or neg 2000-3000; ELSD: gaspressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm, Temp: 25° C., Flow: 0.5 mL/min, Gradient: t.sub.0min=5% A, t.sub.2.0min=98% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS Method 3
[0408] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product pos/neg 105-800, 500-1200 or 1500-2500; ELSD: gaspressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm, Temp: 40° C., Flow: 0.5 mL/min, Gradient: t.sub.0min=5% A, t.sub.2.0min=98% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
LC-MS Method 4
[0409] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos/neg 100-800 or neg 2000-3000; ELSD: gaspressure 40 psi, drift tube temp: 50° C. column: Waters Acquity Shield RP18, 50×2.1 mm, 1.7 μm, Temp: 25° C., Flow: 0.5 mL/min, Gradient: t.sub.0min=5% A, t.sub.2.0min=98% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS Method 5
[0410] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges: pos/neg 1500-2500; ELSD: gaspressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm, Temp: 25° C., Flow: 0.6 mL/min, Gradient: t.sub.0min=5% A, t.sub.1.3min=98% A, t.sub.1.7min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
Preparative Methods
Preparative MP-LC Method 1
[0411] Instrument type: Reveleris™ prep MPLC; column: Waters XSelect™ CSH C18 (145×25 mm, 10 μm); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 10 mM ammoniumbicarbonate in water pH=9.0); Eluent B: 99% acetonitrile+1% 10 mM ammoniumbicarbonate in water; Gradient:
.sup.At.sub.0min=5% B, t1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.At.sub.0min=5% B, t1 min=5% B, t.sub.2 min=20% B, t.sub.17 min=60% B, t.sub.11 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 235, 254 nm and ELSD.
Preparative MP-LC Method 2
[0412] Instrument type: Reveleris™ prep MPLC; Column: Phenomenex LUNA C18(3) (150×25 mm, 10 μm); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 0.1% (v/v) Formic acid in water, Eluent B: 0.1% (v/v) Formic acid in acetonitrile; Gradient:
.sup.At.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=20% B, t.sub.17 min=60% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.Bt.sub.0min=2% B, t.sub.1 min=2% B, t.sub.2 min=2% B, t.sub.17 min=30% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.Ct.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.Dt.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=5% B, t.sub.17 min=40% B, t.sub.11 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 235, 254 nm and ELSD.
Preparative LC-MS Method 3
[0413] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XSelect™ CSH (C18, 150×19 mm, 10 μm); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient:
.sup.At.sub.0=20% A, t.sub.2.5 min=20% A, t.sub.11min=60% A, t.sub.13 min=100% A, t.sub.17 min=100% A
.sup.Bt.sub.0=10% A, t.sub.2.5 min=5% A, t.sub.11min=40% A, t.sub.13 min=100% A, t.sub.17 min=100% A; Detection: DAD (210 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD.
Preparative LC-MS Method 4
[0414] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150×19 mm, 10 μm); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient:
.sup.At.sub.0=2% A, t.sub.2.5 min=2% A, t.sub.11min=30% A, t.sub.13 min=100% A, t.sub.17 min=100% A
.sup.Bt.sub.0=10% A, t.sub.2.5 min=10% A, t.sub.11min=50% A, t.sub.13 min=100% A, t.sub.17 min=100% A .sup.Ct.sub.0=5% A, t.sub.2.5 min=5% A, t.sub.11min=40% A, t.sub.13 min=100% A, t.sub.11min=100% A; Detection: DAD (210 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD
Preparative LC-MS Method 1,
[0415] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150×19 mm, 10 μm); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient:
.sup.At.sub.0=2% A, t.sub.2.5 min=2% A, t.sub.11min=30% A, t.sub.13 min=100% A, t.sub.17 min=100% A
.sup.Bt.sub.0min=10% A, t.sub.2.5 min=10% A, t.sub.11min=50% A, t.sub.13 min=100% A, t.sub.17 min=100% A; Detection: DAD (210 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD
Preparative MP-LC Method 1,
[0416] Instrument type: Reveleris™ prep MPLC; Column: Phenomenex LUNA C18(3) (150×25 mm, 10 μm); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 0.1% (v/v) Formic acid in water, Eluent B: 0.1% (v/v) Formic acid in acetonitrile; Gradient:
.sup.At.sub.0min=2% B, t.sub.1 min=2% B, t.sub.2 min=2% B, t.sub.17 min=30% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.Bt.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=5% B, t.sub.17 min=40% B, t.sub.11 min=100% B, t.sub.23 min=100% B
.sup.Ct.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.11 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 235, 254 nm and ELSD.
Flash Chromatography
[0417] Grace Reveleris X2® C-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes; maximum pump flow rate 250 mL/min; maximum pressure 50bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330 g on instrument, luer type, 750 g up to 3000 g with optional holder.
SO1861-EMCH Synthesis (SO1861-EMCH is Also Referred to as SO1861-Ald-EMCH)
[0418] To SO1861 (121 mg, 0.065 mmol) and EMCH.TFA (110 mg, 0.325 mmol) was added methanol (extra dry, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative MP-LC. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (120 mg, 90%) as a white fluffy solid. Purity based on LC-MS 96%. [0419] LRMS (m/z): 2069 [M-1].sup.1− [0420] LC-MS r.t. (min): 1.084
SO1861-EMCH-Mercaptoethanol (SO1861-EMCH (Blocked))
[0421] To SO1861-EMCH (0.1 mg, 48 nmol) 200 μL mercaptoethanol (18 mg, 230 μmol) was added and the solution was shaken for 1 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the solution was diluted with methanol and dialyzed extensively for 4 h against methanol using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, an aliquot was taken out and analyzed via MALDI-TOF-MS.
[0422] MALDI-TOF-MS (RP mode): m/z 2193 Da ([M+K]*, SO1861-EMCH-mercaptoethanol), m/z 2185 Da ([M+K]*, SO1861-EMCH-mercaptoethanol), m/z 2170 Da ([M+Na]*, SO1861-EMCH-mercaptoethanol).
Trivalent GalNAc-Azide Synthesis
Intermediate 1
tert-butyl 1-azido-17,17-bis((3-(tert-butoxy)-3-oxopropoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oate
[0423] To di-tert-butyl 3,3′-((2-amino-2-((3-(tert-butoxy)-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropionate (1.27 g, 2.51 mmol) was added a solution of 3-Azido(peg4)propionic acid N-hydroxysuccinimide ester (977 mg, 2.51 mmol) in DMF (10 mL). Next, DIPEA (657 μL, 3.77 mmol) was added and the reaction mixture was stirred overnight at room temperature. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (100 mL). The resulting solution was washed with 0.5 N potassium bisulphate solution (2×100 mL) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-10% methanol in DCM (v/v) gradient 100:0 rising to 0:100) to give the title compound (1.27 g, 65%) as a colorless oil. Purity based on LC-MS 100% (ELSD). [0424] LRMS (m/z): 780 [M+1].sup.1+ [0425] LC-MS r.t. (min): 2.10.sup.2
Intermediate 2
1-azido-17,17-bis((2-carboxyethoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oic acid
[0426] To a solution of tert-butyl 1-azido-17,17-bis((3-(tert-butoxy)-3-oxopropoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oate (1.27 g, 1.63 mmol) in DCM (5.0 mL) was added TFA (5.0 mL, 65 mmol). The reaction mixture was stirred at room temperature. After 1.5 hours the reaction mixture was evaporated in vacuo, co-evaporated with toluene (3×10 mL) and DCM (3×10 mL) to give the crude title product as a colorless oil. [0427] LRMS (m/z): 611 [M+1].sup.1+
Intermediate 3
di-tert-butyl (10-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)-10-(13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl)-5,15-dioxo-8,12-dioxa-4,16-diazanonadecane-1,19-diyl)dicarbamate
[0428] 1-azido-17,17-bis((2-carboxyethoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oic acid (997 mg, 1.63 mmol), Oxyma Pure (1.04 g, 7.35 mmol) and EDCl.HCl (1.17 g, 6.12 mmol) were dissolved in DMF (10.0 mL). Next, DIPEA (1.99 mL, 11.4 mmol) was added, followed directly by the addition of a solution of N-BOC-1,3-propanediamine (1.07 g, 6.12 mmol) in DMF (10.0 mL). The reaction mixture was stirred overnight at room temperature. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (100 mL). The resulting solution was washed with 0.5 N potassium bisulphate solution (100 mL), saturated sodium bicarbonate solution (2×100 mL) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM—10% methanol in DCM (v/v) gradient 0:100 rising to 100:0, staying at 100:0 until the product eluted) to give the title compound (1.16 g, 66%) as a yellowish viscous oil. LC-MS 99% (ELSD). [0429] LRMS (m/z): 1080 [M+1].sup.1+ [0430] LC-MS r.t. (min): 1.513
Intermediate 4
3,3′-((2-((3-((3-aminopropyl)amino)-3-oxopropoxy)methyl)-2-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)propane-1,3-diyl)bis(oxy))bis(N-(3-aminopropyl)propanamide) tris(2,2,2-trifluoroacetate) synthesis
[0431] To a solution of di-tert-butyl (10-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)-10-(13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl)-5,15-dioxo-8,12-dioxa-4,16-diazanonadecane-1,19-diyl)dicarbamate (1.16 g, 1.08 mmol) in DCM (10 mL) was added TFA (10 mL, 131 mmol). The reaction mixture was stirred at room temperature. After 2 hours the reaction mixture was evaporated in vacuo, co-evaporated with toluene (3×10 mL) and DCM (3×10 mL) to give the crude title product as a yellowish viscous oil. [0432] LRMS (m/z): 260 [M+3].sup.3*, 390 [M+2].sup.2+, 780 [M+1].sup.1+,
Intermediate 5
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((5-((2,5-dioxopyrrolidin-1-yl)oxy)-5-oxopentyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate
[0433] 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (obtain according J. Am. Chem Soc., 2014, 136,16958-16961, 3.00 g, 6.70 mmol) and N-Hydroxysuccinimide (926 mg, 8.05 mmol) were dissolved in DCM (50 mL). Next, EDCl.HCl (1.54 g, 8.05 mmol) and 4-(Dimethylamino)pyridine (82 mg, 0.67 mmol) were added and the reaction mixture was stirred overnight at room temperature. The reaction mixture was diluted with DCM and the resulting solution was washed with 0.5 N potassium bisulphate solution (150 mL), saturated sodium bicarbonate solution (150 mL) and brine (150 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo to give the title compound (3.60 g, 99%) as a white foam. Purity based on LC-MS 99% (ELSD). [0434] LRMS (m/z): 545 [M+1].sup.1+ [0435] LC-MS r.t. (min): 1.073
Intermediate 6
[(3R,6R)-3,4-bis(acetyloxy)-6-{4-[(3-{3-[2-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)-3-(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamido)propyl]carbamoyl}ethoxy)-2-[(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamido)propyl]carbamoyl}ethoxy)methyl]propoxy]propanamido}propyl)carbamoyl]butoxy}-5-acetamidooxan-2-yl]methyl acetate
[0436] 3,3′-((2-((3-((3-aminopropyl)amino)-3-oxopropoxy)methyl)-2-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)propane-1,3-diyl)bis(oxy))bis(N-(3-aminopropyl)propanamide) tris(2,2,2-trifluoroacetate) (1.21 g, 1.08 mmol) was dissolved in a mixture of DMF (10 mL) and DIPEA (1.69 mL, 9.70 mmol). Next, (2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((5-((2,5-dioxopyrrolidin-1-yl)oxy)-5-oxopentyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (2.20 g, 4.04 mmol) was added and the reaction mixture was stirred over the weekend at room temperature. Next, the reaction mixture was evaporated in vacuo and the residue was purified by flash chromatography (DCM—30% methanol in DCM (v/v) gradient 0:100 rising to 100:0) to give the title compound (1.84 g, 83%) as a yellowish foam. LC-MS 95% (ELSD). [0437] LRMS (m/z): 2068 [M+1].sup.1+ [0438] LC-MS r.t. (min): 1.183
Intermediate 7
Trivalent GalNAc-azide
[0439] [(3R,6R)-3,4-bis(acetyloxy)-6-{4-[(3-{3-[2-(1-azido-3,6,9,12-tetraoxapentadecan-15-amido)-3-(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamido)propyl]carbamoyl}ethoxy)-2-[(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamido)propyl]carbamoyl}ethoxy)methyl]propoxy]propanamido}propyl)carbamoyl]butoxy}-5-acetamidooxan-2-yl]methyl acetate (300 mg, 0.145 mmol) was dissolved in a mixture of triethylamine (2.00 mL, 14.4 mmol), methanol (2.00 mL) and water (2.00 mL) and the reaction mixture was stirred at room temperature. After 2 hours the reaction mixture was evaporated in vacuo. The residue was purified by preparative MP-LC..sup.2B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (164 mg, 67%) as a white solid. Purity based on LC-MS 97%. [0440] LRMS (m/z): 1688 [M-1].sup.1− [0441] LC-MS r.t. (min): 1.99.sup.1A
Trivalent-GalNAc-SO1861 and GalNAc-SO1861 Synthesis (FIG. 2, 4)
Intermediate 8
SO1861-NH.SUB.2
[0442] SO1861-azide (6.89 mg, 3.20 μmol) was dissolved in mixture of 32 mM potassium carbonate (150 μL, 4.80 μmol) and acetonitrile (150 μL). Directly afterwards, a 1.0 M trimethylphosphine solution in THE (32 μL, 32 μmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min. the reaction mixture was subjected to preparative MP-LC. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (5.30 mg, 78%) as a white fluffy solid. Purity based on LC-MS 94%. [0443] LRMS (m/z): 1062 [M-2].sup.2− [0444] LC-MS r.t. (min): 2.51.sup.1B
Intermediate 9
SO1861-DBCO
[0445] To SO1861-amine (48.6 mg, 22.9 μmol) and DBCO-NHS (13.0 mg, 32.4 μmol) was added to a solution of DIPEA (5.98 μL, 34.3 μmol) and DMF (2.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 4 hours the reaction mixture was diluted with a solution of 50 mM sodium bicarbonate (1.00 mL, 50 μmol). The resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was subjected to preparative MP-LC..sup.1B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (16.9 mg, 31%) as a white fluffy solid. Purity based on LC-MS 94%. [0446] LRMS (m/z): 2412 [M-1].sup.1− [0447] LC-MS r.t. (min): 2.45.sup.1B
SO1861-L-Trivalent GalNAc Synthesis
[0448] SO1861-DBCO (7.50 mg, 3.11 μmol) and trivalent GalNAc-azide (5.31 mg, 3.14 μmol) were dissolved in a mixture of water/acetonitrile (2:1, v/v, 0.90 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.3BFractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (9.60 mg, 75%) as a white fluffy solid. Purity based on LC-MS 99%. [0449] LRMS (m/z): 2050 [M-2].sup.2− [0450] LC-MS r.t. (min): 2.04.sup.1B
SO1861-L-GalNAc Synthesis
[0451] SO1861-DBCO (1.75 mg, 0.73 μmol) and GalNAc-PEG3-azide (0.82 mg, 2.18 μmol) were dissolved in a mixture of water/acetonitrile (1:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.3BFractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (1.63 mg, 81%) as a white fluffy solid. Purity based on LC-MS 100%. [0452] LRMS (m/z): 2790 [M-1].sup.1− [0453] LC-MS r.t. (min): 2.15.sup.1B
Trivalent GalNAc-BNA Oligo Synthesis (FIG. 6, 7)
Intermediate 10
4-{2-azatricyclo[10.4.0.0.SUP.4′9.]hexadeca-1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-N-[2-(2-{2-[2-({4-[(E)-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanamido]imino}methyl]phenyl}formamido)ethoxy]ethoxy}ethoxy)ethyl]-4-oxobutanamide
[0454] 4-{2-azatricyclo[10.4.0.0.sup.4′9]hexadeca-1 (12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-N-{2-[2-(2-{2-[(4-formylphenyl)formamido]ethoxyethoxy)ethoxy]ethyl-4-oxobutanamide (25.0 mg, 40.9 μmol) and EMCH.TFA (20.8 mg, 61.3 μmol) were dissolved in methanol (extra dry, 2.00 mL). Next, TFA (9.39 μL, 123 μmol) was added. The reaction mixture was shaken for 1 min and left standing overnight at room. The reaction mixture was subjected to preparative MP-LC..sup.1B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (16.2 mg, 48%) as a white solid. Purity based on LC-MS 91%. [0455] LRMS (m/z): 410.2 [M+2].sup.2+ [0456] LC-MS r.t. (min): 1.41.sup.2
Intermediate 11
Trivalent GalNAc-L-maleimide
[0457] Trivalent GalNAc-azide (20.3 mg, 12.0 μmol) and 4-{2-azatricyclo[10.4.0.0.sup.4′9]hexadeca-1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-N-[2-(2-{2-[2-({4-[(E)-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanamido]imino}methyl]phenyl}formamido)ethoxy]ethoxy}ethoxy)ethyl]-4-oxobutanamide (11.8 mg, 14.4 μmol) were dissolved in a mixture of water/acetonitrile (2:1, v/v, 0.90 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.2C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (25.6 mg, 85%) as a white solid. Purity based on LC-MS 88%. [0458] LRMS (m/z): 2101 [M-405].sup.1−, 2304 [M-202].sup.1−, 2507 [M-1].sup.1− [0459] LC-MS r.t. (min): 1.90.sup.1B (double peaks due to isomers)
Intermediate 12
Trivalent GalNAc-S-maleimide
[0460] Trivalent GalNAc-azide (20.3 mg, 12.0 μmol) and DBCO-maleimide (10.3 mg, 24.0 μmol) were dissolved in a mixture of water/acetonitrile (2:1, v/v, 0.90 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.2D Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (22.2 mg, 87%) as a white solid. Purity based on LC-MS 85%. Contains 10% of the hydrolysed maleimide. [0461] LRMS (m/z): 2115 [M-1].sup.1− [0462] LC-MS r.t. (min): 1.60.sup.1B (double peaks due to isomers)
Trivalent GalNAc-S-ApoB (or HSP27) BNA Oligo Synthesis
[0463] To ApoB BNA oligo disulfide (5.00 mg, 0.686 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL) and the resulting solution was directly added to trivalent GalNAc-S-maleimide (3.02 mg, 1.43 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.75 mg, quant.) as a white fluffy solid. Purity based on LC-MS 94% (very broad peak). [0464] LRMS (m/z): 2318 [M−4].sup.4− [0465] LC-MS r.t. (min): 1.65.sup.1A
Trivalent GalNAc-S-ApoB (or HSP27) Scrambled BNA Oligo Synthesis
[0466] To ApoB scrambled BNA oligo disulfide (5.00 mg, 0.688 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL) and the resulting solution was directly added to trivalent GalNAc-S-maleimide (3.09 mg, 1.46 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (5.91 mg, 93%) as a white fluffy solid. Purity based on LC-MS 88% (very broad peak). [0467] LRMS (m/z): 2311 [M−4].sup.4− [0468] LC-MS r.t. (min): 1.60.sup.1A
Trivalent GalNAc-L-ApoB (or HSP27) BNA Oligo Synthesis
[0469] To ApoB BNA oligo disulfide (5.00 mg, 0.686 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL) and the resulting solution was directly added to trivalent GalNAc-L-maleimide (3.63 mg, 1.45 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.68 mg, quant.) as a white fluffy solid. Purity based on LC-MS 99% (very broad peak). [0470] LRMS (m/z): 2416 [M−4].sup.4− [0471] LC-MS r.t. (min): 1.97.sup.1A
Trivalent GalNAc-L-ApoB (or HSP27) Scrambled BNA Oligo Synthesis
[0472] To ApoB scrambled BNA oligo disulfide (5.00 mg, 0.688 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL) and the resulting solution was directly added to trivalent GalNAc-L-maleimide (3.68 mg, 1.47 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (4.71 mg, 71%) as a white fluffy solid. Purity based on LC-MS 96% (very broad peak). [0473] LRMS (m/z): 2409 [M−4].sup.4− [0474] LC-MS r.t. (min): 1.93.sup.1A
Dendron(-L-SO1861).SUB.4.-Trivalent GalNAc and Dendron(-L-SO1861).SUB.8.-Trivalent GalNAc Synthesis
Intermediate 13
Trivalent GalNAc-Amine Formate
[0475] Trivalent GalNAc-azide (36.5 mg, 21.6 μmol) was dissolved in a solution of potassium carbonate (5.97 mg, 43.2 μmol) in water (1.00 mL) and acetonitrile (1.00 mL). Next, a 1.0 M trimethylphosphine solution in THE (216 μL, 216 μmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 45 min the reaction mixture was evaporated in vacuo and the residue was dissolved in water/acetonitrile (9:1, v/v, 1 mL). The resulting solution was directly subjected to preparative MP-LC..sup.2B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (36.1 mg, 98%) as a white solid. Purity based on LC-MS 100%. [0476] LRMS (m/z): 1662 [M−1].sup.1− [0477] LC-MS r.t. (min): 1.62.sup.1A
Intermediate 14
Trivalent GalNAc-DBCO
[0478] Trivalent GalNAc-amine formate (17.4 mg, 10.2 μmol) and DBCO-NHS (6.14 mg, 15.3 μmol) were dissolved in a solution of NMM (2.24 μL, 20.3 μmol) in DMF (0.50 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was evaporated in vacuo and the residue was dissolved in water/acetonitrile (8:2, v/v, 1 mL). The resulting solution was directly subjected to preparative MP-LC..sup.2C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (14.2 mg, 72%) as a white solid. Purity based on LC-MS 96%. [0479] LRMS (m/z): 1950 [M−1].sup.1 [0480] LC-MS r.t. (min): 1.86.sup.1B
Intermediate 15
Dendron(-L-SO1861).SUB.8.-azide
[0481] Dendron(-L-SO1861)8-amine (19.6 mg, 1.08 μmol) and 2,5-dioxopyrrolidin-1-yl 1-azido-3,6,9,12-tetraoxapentadecan-15-oate (4.17 mg, 10.8 μmol) were dissolved in DMF (1.50 mL). Next, DIPEA (1.87 μL, 10.8 μmol) was added and the mixture was shaken for 1 min and left standing overnight at room temperature. The reaction mixture was subjected to preparative LC-MS..sup.4B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (11.7 mg, 59%) as a white fluffy solid. Purity based on LC-MS 92% (very broad peak). [0482] LRMS (m/z): 2316 [M−8].sup.8−): 2647 [M−7].sup.7− [0483] LC-MS r.t. (min): 4.29.sup.1A
Dendron(-L-SO1861).SUB.4.-Trivalent GalNAc Synthesis
[0484] Dendron(-L-SO1861)4-azide (2.50 mg, 0.266 μmol) and trivalent GalNAc-DBCO (1.56 mg, 0.799 μmol) were dissolved in a mixture of water/acetonitrile (3:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.4B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.74 mg, 91%) as a white fluffy solid. Purity based on LC-MS 86% (very broad peak). [0485] LRMS (m/z): 2832 [M−4].sup.4− [0486] LC-MS r.t. (min): 40.7.sup.1A
Dendron(-L-SO1861).SUB.8.-Trivalent GalNAc Synthesis
[0487] Dendron(-L-SO1861)8-azide (2.50 mg, 0.135 μmol) and trivalent GalNAc-DBCO (0.79 mg, 0.405 μmol) were dissolved in a mixture of water/acetonitrile (3:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.4B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.03 mg, 74%) as a white fluffy solid. Purity based on LC-MS 100% (very broad peak). [0488] LRMS (m/z): 2559 [M−8].sup.8−, 2925 [M−7].sup.7− [0489] LC-MS r.t. (min): 4.18.sup.1A
Dendron(-L-SO1861).SUB.4.-L-BNA Oligo-Trivalent GalNAc and Dendron(-L-SO1861).SUB.8.-L-BNA Oligo-Trivalent GalNAc Synthesis
Intermediate 16
Trivalent GalNAc-Thioacetate
[0490] Trivalent GalNAc-amine formate (18.7 mg, 11.0 μmol) and 4-nitrophenyl 3-(acetylthio)propanoate (5.90 mg, 21.9 μmol) were dissolved in a solution of NMM (2.41 μL, 21.9 μmol) in DMF (0.50 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was evaporated in vacuo and the residue was dissolved in a mixture of 0.1% formic acid in water and 0.1% formic acid in acetonitrile (9:1, v/v, 1 mL). The resulting solution was directly subjected to preparative MP-LC..sup.2B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (13.0 mg, 66%) as a white solid. Purity based on LC-MS 100%. [0491] LRMS (m/z): 1749 [M−43].sup.1−, 1792 [M−1].sup.1 [0492] LC-MS r.t. (min): 1.24.sup.1B
Intermediate 17
DBCO-TCO-trivalent GalNAc
[0493] Trivalent GalNAc-thioacetate (13.0 mg, 7.25 μmol) was dissolved in methanol (0.50 mL). Next, a 1 M solution of sodium hydroxide (7.98 μL, 7.98 μmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was added to a freshly prepared solution of trifunctional linker (LS-t) (i.e., is an example of a saponin moiety linker LS) (7.39 mg, 6.13 μmol) in 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 2.00 mL).
[0494] The trifunctional linker has the IUPAC name: 5,8,11,18,21,24,27-Heptaoxa-2,14,30-triazatritriacontanoic acid, 14-[16-(11,12-didehydrodibenz[b,f]azocin-5(6H)-yl)-13,16-dioxo-3,6,9-trioxa-12-azahexadec-1-yl]-33-(2,5-dihydro-2,5-dioxo-1H-pyrrol-1-yl)-15,31-dioxo-, (1R,4E)-4-cycloocten-1-yl ester. The trifunctional linker has the following formula (XXI):
##STR00041##
[0495] The resulting mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (3.83 mg, 21%) as a white solid. Purity based on LC-MS 89%. [0496] LRMS (m/z): 2409 [M−546].sup.1−, 2955 [M−1].sup.1− [0497] LC-MS r.t. (min): 2.66.sup.1B
Intermediate 18
Methyltetrazine-L-ApoB BNA oligo
[0498] To ApoB BNA oligo disulfide (5.00 mg, 0.686 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate (1.50 mL) and the resulting mixture was directly added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (1.36 mg, 1.73 μmol) in acetonitrile (0.5 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was frozen and lyophilized overnight to yield the crude title product as a pink fluffy solid. To the crude product was added a solution of 20 mM ammonium bicarbonate (1.50 mL) and the resulting suspension was filtered over a 0.45 μm syringe filter. The filtrate was lyophilized overnight to yield the title product (5.44 mg, quant) as a pink fluffy solid. Purity based on LC-MS 90% (very broad peak). [0499] LRMS (m/z): 2648 [M−3].sup.3 [0500] LC-MS r.t. (min): 0.62.sup.4
Intermediate 19
Methyltetrazine-L-ApoB scrambled BNA oligo
[0501] To ApoB scrambled BNA oligo disulfide (5.00 mg, 0.688 μmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 2×0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate (1.50 mL) and the resulting mixture was directly added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (1.34 mg, 1.70 μmol) in acetonitrile (0.5 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was frozen and lyophilized overnight to yield the crude title product as a pink fluffy solid. To the crude product was added a solution of 20 mM ammonium bicarbonate (1.50 mL) and the resulting suspension was filtered over a 0.45 μm syringe filter. The filtrate was lyophilized overnight to yield the title product (5.48 mg, quant) as a pink fluffy solid. Purity based on LC-MS 84% (very broad peak). [0502] LRMS (m/z): 2639 [M−3].sup.3− [0503] LC-MS r.t. (min): 0.584
Intermediate 20
DBCO-L-ApoB BNA Oligo-trivalent GalNAc
[0504] To methyltetrazine-L-ApoB BNA oligo (5.44 mg, 0.684 μmol) and DBCO-TCO-trivalent GalNAc (2.03 mg, 0.687 μmol) was added 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.4c Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.87 mg, 39%) as a white fluffy solid. LC-MS shows multiple broad peaks with the correct m/z values. [0505] LRMS (m/z): 2175 [M−5].sup.5−, 2718 [M−6].sup.4− [0506] LC-MS r.t. (min): 2.60-3.00.sup.1A
Intermediate 21
DBCO-L-ApoB Scrambled BNA Oligo-Trivalent GalNAc
[0507] To methyltetrazine-L-ApoB scrambled BNA oligo (5.48 mg, 0.692 μmol) and DBCO-TCO-trivalent GalNAc (1.80 mg, 0.609 μmol) was added 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.4c Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.15 mg, 33%) as a white fluffy solid. LC-MS shows multiple broad peaks with the correct m/z values. [0508] LRMS (m/z): 2169 [M−5].sup.5−, 2711 [M−6].sup.4− [0509] LC-MS r.t. (min): 2.58-3.20.sup.1A
Trivalent Linker-L-SPT001-(Blocked TCO)-Trivalent GalNAc Synthesis
Intermediate 22 (FIG. 25)
Trivalent GalNAc-Thiol
[0510] Trivalent GalNAc-thioacetate (16.2 mg, 9.02 μmol) was dissolved in methanol (500 μL). Next, a 1.00 M solution of sodium hydroxide (11.0 μL, 11.0 μmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was submitted to preparative MP-LC..sup.1A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (13.1 mg, 83%) as a white solid. Purity based on LC-MS 98%. [0511] LRMS (m/z): 1748 [M-H].sup.1− [0512] LC-MS r.t. (min): 1.78.sup.1A
Intermediate 23: (FIG. 25)
DBCO-TCO-trivalent GalNAc
[0513] Trifunctional linker (15.0 mg, 12.4 μmol) was dissolved in acetonitrile (0.50 mL). Next, a solution of 20 mM ammonium bicarbonate (1.50 mL) was added and the resulting solution was directly transferred to trivalent GalNAc-thiol (22.7 mg, 13.0 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was frozen and lyophilized overnight to yield the crude title product as a white solid. Purity based on LC-MS 84%. [0514] LRMS (m/z): 2409 [M−546].sup.1−, 2955 [M−1].sup.1− [0515] LC-MS r.t. (min): 2.63.sup.1B
Intermediate 24 (FIG. 26)
N-(2-hydroxyethyl)-2-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)phenyl)acetamide
[0516] To a solution of methyltetrazine-NHS ester (30.0 mg, 91.7 μmol) in DMF (1.00 mL) was added ethanolamine (11.1 μL, 0.184 mmol) and triethylamine (25.5 μL, 0.183 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was submitted to preparative MP-LC..sup.1B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (19.2 mg, 77%) as a purple solid. Purity based on LC-MS 89%. [0517] LRMS (m/z): 274 [M+1].sup.1+ [0518] LC-MS r.t. (min): 0.85.sup.2
Trivalent Linker-L-SPT001-(Blocked TCO)-Trivalent GalNAc
[0519] A solution of DBCO-TCO-trivalent GalNAc (36.8 mg, 12.5 μmol) in DMF (2.0 mL) was added to SO1861-L-azide (26.8 mg, 12.5 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min N-(2-hydroxyethyl)-2-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)phenyl)acetamide (4.08 mg, 14.9 μmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was submitted to preparative MP-LC..sup.1c Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (37.3 mg, 56%) as a white fluffy solid. Purity based on LC-MS 96% (double peaks due to regioisomers). [0520] LRMS (m/z): 2676 [M−2].sup.2− [0521] LC-MS r.t. (min): 2.23.sup.1B
Trivalent Linker-(Blocked DBCO)-BNA Oligo-Trivalent GalNAc Synthesis
Intermediate 25 (FIG. 27)
Methyltetrazine-BNA Oligo
[0522] To Thiol-13-ApoB BNA oligo disulfide (20 mg, 4.17 μmol) was added a solution of 20 mM ammonium bicarbonate with 5.0 mM TCEP (2.00 mL, 10.0 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min, 4×0.50 mL). Next, the residue solution was diluted with 20 mM ammonium bicarbonate (3.00 mL) and the resulting mixture was directly added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-,6,9,12-tetraoxapentadecan-15-amide (7.22 mg, 9.16 μmol) in acetonitrile (1.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was frozen and lyophilized overnight to yield the crude title product as a pink fluffy solid. To the crude product was added a 20 mM ammonium bicarbonate/acetonitrile (2:1, v/v, 2.00 mL) and the resulting solution was subjected to preparative LC-MS..sup.1A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (20.3 mg, 89%) as a pink fluffy solid. Purity based on LC-MS 93% (broad peak). [0523] LRMS (m/z): 1817 [M−3].sup.3− [0524] LC-MS r.t. (min): 0.593
Intermediate 26 (FIG. 27)
(blocked DBCO)-TCO-trivalent GalNAc
[0525] A solution of 1-azido-3,6,9-trioxaundecane-11-ol (2.17 mg, 9.88 μmol) in DMF (0.50 mL) was added to DBCO-TCO-trivalent GalNAc (14.6 mg, 4.94 μmol. The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was submitted to preparative MP-LC..sup.1C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (10.00 mg, 64%) as a white solid. Purity based on LC-MS 98%. [0526] LRMS (m/z): 1750 [fragment] [0527] LC-MS r.t. (min): 2.33.sup.1B
Trivalent Linker-(Blocked DBCO)-BNA Oligo-Trivalent GalNAc
[0528] (blocked DBCO)-TCO-trivalent GalNAc (10.0 mg, 3.15 μmol) and Methyltetrazine-BNA oligo (10.0 mg, 1.83 μmol) were dissolved in a solution of 20 mM ammonium bicarbonate/acetonitrile (3:1, v/v, 1.00 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 3 hours the reaction mixture was frozen and lyophilized overnight. The crude product was dissolved in 20 mM ammonium bicarbonate (1 mL) and the resulting solution was directly subjected to preparative LC-MS..sup.1B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (11.3 mg, 72%) as a white fluffy solid. Purity based on LC-MS 95% (multiple (broad) peaks due to regioisomers). [0529] LRMS (m/z): 2149 [M−4].sup.4−, 2866 [M−3].sup.3− [0530] LC-MS r.t. (min): 2.92.sup.1A
Dendron(-L-SO1861).SUB.4.-Amine (Molecule 15)
[0531] N,N′-((9S,19S)-14-(6-aminohexanoyl)-1-mercapto-9-(3-mercaptopropanamido)-3,10,18-trioxo-4,11,14,17-tetraazatricosane-19,23-diyl)bis(3-mercaptopropanamide) formate (2.73 mg, 3.13 μmol) was dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3with 0.5 mM TCEP/acetonitrile (3:1, v/v, 3.00 mL). Next, SO1861-EMCH (29.2 mg, 0.014 mmol) was added and the reaction mixture was stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.3B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (12.3 mg, 43%) as a white fluffy solid. Purity based on LC-MS 97%. [0532] LRMS (m/z): 1517 [M−6].sup.6−, 1821 [M−5].sup.5−, 2276 [M−4].sup.4− [0533] LC-MS r.t. (min): 4.39.sup.5A
Dendron(-L-SO1861).SUB.4.-Trivalent GalNAc (FIG. 33A-C) and Dendron(-L-SO1861).SUB.8.-Trivalent GalNAc Synthesis
Dendron(-L-SO1861).SUB.4.-azide (molecule 19)
[0534] The dendron(-L-SO1861).sub.4-azide is synthesized based on dendron(SPT001).sub.4-NH.sub.2 (molecule 15,
Trivalent GalNAc-Amine Formate (Molecule 22 in FIG. 33C)
[0535] Trivalent GalNAc-azide (36.5 mg, 21.6 μmol; molecule 21 in
Trivalent GalNAc-DBCO (Molecule 23 in FIG. 33C)
[0538] Trivalent GalNAc-amine formate (17.4 mg, 10.2 μmol; molecule 22) and DBCO-NHS (6.14 mg, 15.3 μmol; molecule 10 in
Dendron(-L-SO1861).SUB.8.-Azide
[0541] Dendron(-L-SO1861)8-amine (19.6 mg, 1.08 μmol) and 2,5-dioxopyrrolidin-1-yl 1-azido-3,6,9,12-tetraoxapentadecan-15-oate (4.17 mg, 10.8 μmol) were dissolved in DMF (1.50 mL). Next, DIPEA (1.87 μL, 10.8 μmol) was added and the mixture was shaken for 1 min and left standing overnight at room temperature. The reaction mixture was subjected to preparative LC-MS..sup.4B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (11.7 mg, 59%) as a white fluffy solid. Purity based on LC-MS 92% (very broad peak). [0542] LRMS (m/z): 2316 [M−8].sup.8−): 2647 [M−7].sup.7− [0543] LC-MS r.t. (min): 4.29.sup.1A
Dendron(-L-SO1861).SUB.4.-Trivalent GalNAc (Molecule 24 in FIG. 33C) Synthesis
[0544] Dendron(-L-SO1861)4-azide (2.50 mg, 0.266 μmol; synthesis depicted in
Dendron(-L-SO1861).SUB.8.-Trivalent GalNAc Synthesis
[0547] Dendron(-L-SO1861)8-azide (2.50 mg, 0.135 μmol) and trivalent GalNAc-DBCO (0.79 mg, 0.405 μmol; molecule 23 in
AntiCD71-Saporin Synthesis
[0550] Custom CD71 mab-saporin conjugate was produced and purchased from Advanced Targeting Systems (San Diego, Calif.). CD71 monoclonal antibody was purchased from InVivoMab, anti-human CD71 (OKT-9), BioXCell.
HSP27BNA, ApoB and ApoB.SUB.scrambled., and ApoB #02 Oligo Sequences
[0551] HSP27 (5′-GGCacagccagtgGCG-3′) [SEQ ID NO: 1] (The antisense BNA (HSP27) was BNA, more specifically BNA.sup.NC, with oligo nucleic acid sequence 5′-GGCacagccagtgGCG-3′ according to Zhang et al. (2011) [Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, LM Greenberger and ID Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333]), ApoB (5′-GCCTCagtctgcttcGCACC-3′) [SEQ ID NO: 2] and ApoBscrambled (5′-GGCCTctctacaccgCTCGT-3′) [SEQ ID NO: 3], and murine and human sequence-compatible ApoB #02 (5′-GCattggtatTCA-3′) [SEQ ID NO: 12] BNA.sup.NC oligos were ordered with 5′-Thiol C6 linker at Bio-Synthesis Inc, with BNA bases in capitals, and fully phosphorothioate backbones. (Lewisville, Tex.).
RNA Isolation and Gene Expression Analysis from Human Cell Culture
[0552] RNA from cells was isolated and analysed according to standard protocols (Biorad). qPCR primers that were used are indicated in Table A2.
TABLE-US-00001 TABLE A2 Primers used in qPCR are shown below: Gene Primer Sequence (5′-3′) HSP27 Forward GCAGTCCAACGAGATCACCA [SEQ ID NO: 4] Reverse TAAGGCTTTACTTGGCGGCA [SEQ ID NO: 5] ApoB Forward AGGGTCCGGGAATCTGATGA [SEQ ID NO: 6] Reverse TGGGCACGTTGTCTTTCAGAG [SEQ ID NO: 7] HBMS Forward CACCCACACACAGCCTACTT [SEQ ID NO: 8] Reverse GTACCCACGCGAATCACTCT [SEQ ID NO: 9] GUSB Forward GAAAATACGTGGTTGGAGAGCT [SEQ ID NO: 10] Reverse CCGAGTGAAGATCCCCTTTTTA [SEQ ID NO: 11]
Cell Viability Assay (MTS)
[0553] After treatment the cells were incubated for 72 hr at 37° C. before the cell viability was determined by an MTS-assay, performed according to the manufacturer's instruction (CellTiter 96@ AQueous One Solution Cell Proliferation Assay, Promega). Briefly, the MTS solution was diluted 20× in DMEM without phenol red (PAN-Biotech GmbH) supplemented with 10% FBS. The cells were washed once with 200 μL/PBS well, after which 100 μL diluted MTS solution was added/well. The plate was incubated for approximately 20-30 minutes at 37° C. Subsequently, the OD at 492 nm was measured on a Thermo Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of ‘medium only’ wells was subtracted from all other wells, before the cell viability percentage of treated/untreated cells was calculated, by dividing the background corrected signal of treated wells over the background corrected signal of the untreated wells (×100).
Cell Viability Assay (CTG)
[0554] After treatment the cells were incubated for 72 hr at 37° C. before the cell viability was determined by a CTG-assay, performed according to the manufacturer's instruction (CellTiter-Glo® 2.0 Cell Viability Assay, Promega). Briefly, the cell plate was first equilibarated to RT for 30 minutes. Next, to each well containing 120 μL treatment media 120 μL CTG solution was added. The plate briefly mixed (10 sec, 600 rpm) and incubated for approximately 10 minutes in the dark at RT. Subsequently, the luminescence signal was measured on a Spectramax ID5 plate reader (Molecular Devices). For quantification, the background signal of ‘medium only’ wells was subtracted from all other wells before the cell viability percentage of treated/untreated cells was calculated by dividing the background corrected signal of treated wells over the background corrected signal of the untreated wells (×100).
FACS Analysis
[0555] Cells were seeded in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (PAN-Biotech GmbH) and 1% penicillin/streptomycin (PAN-Biotech GmbH), in T75 flasks at appropriate density for each cell-line and incubated for 72-96 hrs (5% CO.sub.2, 37° C.), until a confluency of 90% was reached. Next, the cells were trypsinized (TrypIE Express, Gibco Thermo Scientific) to single cells, transferred to a 15 mL falcon tube, and centrifuged (1,400 rpm, 3 min). The supernatant was discarded while leaving the cell pellet submerged. 500.000 Cells were transferred to round bottom FACS tubes and the washed with 3 mL cold DPBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). The cells were centrifuged at 1800 rpm, 3 min 4° C. and resuspended in 200 μL cold DPBS (Mg.sup.2. and Ca.sup.2+ free, 2% FBS) or 200 μL antibody solution; containing 5 μL antibody in 195 μL cold DPBS (Mg.sup.2. and Ca.sup.2+ free, 2% FBS). PE anti-human CD71 (#334106, Biolegend) was used to stain the transferrin receptor, PE Mouse IgG2a, κ Isotype Ctrl FC (#400212, Biolegend) was used as its matched isotype control. PE anti-human ASGPR1 (#130-122-963, Miltenyi) was used to stain the ASGPR1 receptor and PE Mouse IgG1, Isotype Ctrl (#130-113-762, Miltenyi) was used as its matched isotype control. Samples were incubated for 30 min. at 4° C. Afterwards, the cells were washed 2× with cold DPBS (Mg.sup.2. and Ca.sup.2+ free, 2% FBS) and fixated for 20 min at room temperature using a 2% PFA solution in DPBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). Cells were washed 1× with cold DPBS and resuspended in 1000 μL cold DPBS for FACS analysis. Samples were analyzed with a Sysmex Cube 8 flow cytometry system (Sysmex) and FCS Express 7 Research edition software. Results of the FACS analyses are summarized in Table A3.
TABLE-US-00002 TABLE A3 Cell membrane receptor expression levels of ASPGR1 and CD71 of HepG2 and Huh7 cells Cell ASPGR1 expression CD71 expression line level (MFI) level (MFI) HepG2 8.8 74.7 Huh7 1.6 109
Mouse Primary Hepatocyte Treatment
[0556] Cryopreserved primary mouse hepatocytes (PRIMACYT Cell Culture Technology GmbH, Germany) were thawed in hepatocyte thawing media (HTM, PRIMACYT Cell Culture Technology GmbH, Germany) and washed 1× with hepatocyte wash media (HWM, PRIMACYT Cell Culture Technology GmbH, Germany). Cells were re-suspended in hepatocyte plating media (HPM Cryo, PRIMACYT Cell Culture Technology GmbH, Germany) at a density of approx. 0.275×10.sup.6 cells/ml. Cells were seeded onto collagen-I coated plates at a density of 88.000 cells/well or 26.400 cells/well for the 48 or 96-well plates (Greiner BioOne). Cells were pre-cultured for 4-6 hrs at 37° C. allowing for cell attachment to cell culture plates before the start of treatment. Plating medium was replaced by 315 μl or 108 μl assay media (MHM, PRIMACYT Cell Culture Technology GmbH, Germany), after which conjugates were added from a 10× concentrated stock solution in PBS. Plates were incubated for 72 hr at 37° C. being harvested for gene expression and cell viability analysis.
Human Primary Hepatocyte Treatment
[0557] Cryopreserved primary human hepatocytes (Cytes Biotechnologies S.L., Spain) were thawed in hepatocyte thawing media (Cytes Biotechnologies S.L., Spain). Cells were re-suspended in hepatocyte plating media (Cytes Biotechnologies S.L., Spain). Cells were seeded onto collagen-I coated plates at a density of 215.600 cells/well or 66.600 cells/well for the 48 or 96-well plates (Greiner BioOne). Cells were pre-cultured for 4-6 hrs at 37° C. allowing for cell attachment to cell culture plates before the start of treatment. Plating medium was replaced by 315 μl or 108 μl maintenance media (Cytes Biotechnologies S.L., Spain), after which conjugates were added from a 10× concentrated stock solution in PBS. Plates were incubated for 72 hr at 37° C. being harvested for gene expression and cell viability analysis.
RNA Isolation and Gene Expression Analysis from Primary Mouse and Human Hepatocytes
[0558] RNA from cells was isolated using TRI Reagent® Solution (Thermo Scientific) according to the manufacturer's instruction. Conversion into cDNA was performed using iScript™ cDNA Synthesis Kit (BioRad) using standard protocols. ApoB expression levels and levels of specific hepatocyte housekeeping genes were determined using quantitative real-time PCR assays (qRT-PCR) using iTaq™ Universal SYBR® Green Supermix (BioRad) and the Light Cycler 480 (Roche Diagnostics, Rotkreuz, Switzerland) with specific DNA primers, listed in Table A4. Analysis was done by the ΔCt method to determine ApoB expression relative to 2 hepatocyte-specific housekeeping control mRNAs. Each analysis reaction was performed in triplicate.
TABLE-US-00003 TABLE A4 Primers used in qPCR analysis of mouse primary hepatocytes ApoB#02 Forward GCTAACACTAAGAACCAGAAGATC [SEQ ID NO: 13] Reverse TGTCCGTCTAAGGATCCTGC [SEQ ID NO: 14] Mm PPIA Forward GCGGCAGGTCCATCTACG [SEQ ID NO: 15] Reverse GCCATCCAGCCATTCAGTC [SEQ ID NO: 16] Mm SDHA Forward GAGGAAGCACACCCTCTCAT [SEQ ID NO: 17] Reverse GGAGCGGATAGCAGGAGGTA [SEQ ID NO: 18]
In Vivo Tolerability and Efficacy of Trivalent GalNAc-Conjugates in a C57BL/6J Model
[0559] Dose administration and in-life phase. Per group, 8 C57BL/6J male mice for treatment groups and 14 in vehicle control group, approximately 6-7 weeks at arrival and 8-9 weeks at dosing, were dosed. The compounds, formulated in PBS or PBS alone (vehicle) according to Table A5, were dosed at 5 ml/kg in the tail vain (intravenously, iv), with dose volumes corresponding to the individual bodyweights. Where applicable, trivalent GalNAc-SO1861-EMCH was co-administered at 5 ml/kg in the tail vain (iv) right after the trivalent GalNAc-ApoB conjugate. Animals were weighed weekly and clinical observations were performed 2-3 times daily within the first 48 hrs, and at least once daily thereafter until study end. [0560] Sampling of serum, liver, and kidney tissue. Blood was sampled before dosing (predose) and at 24 hrs, 72 hrs, 196 hrs, and at 336 hrs post dose, and serum was generated from the collected blood for biomarker analysis, using standard procedures. At the post-dose timepoints of 24 hrs and 72 hrs, 3 animals per timepoint per treatment group and 6 animals in the vehicle control group were sacrificed to collect terminal bleeds and liver, kidney and mesenteric lymph node tissues for further analyses. at end of study at 336 hrs, the remaining 2 animals (4 in the control group) per group were sacrificed. One half of the liver and one kidney was frozen and used for tissue RNA analysis.
TABLE-US-00004 TABLE A5 Experimental design in vivo tolerability and efficacy of trivalent GalNAc-conjugates Relative Co-administered BNA dose trivalent GalNAc- Dose administered SO1861-EMCH dose Group Conjugate [mg/kg] [mg/kg] [mg/kg] 1 PBS (vehicle) n/a 0 2 ApoBBNA#02 0.1 0.1 3 ApoBBNA#02 1 1 4 ApoBBNA#02 2 2 5 (GalNAc)3- 0.1 0.058 ApoBBNA#02 6 (GalNAc)3- 1 0.58 ApoBBNA#02 7 (GalNAc)3- 0.01 0.0058 5 ApoBBNA#02 8 (GalNAc)3- 0.1 0.058 5 ApoBBNA#02
Biomarker RNA Analysis in Liver Tissue
[0561] The mRNA was isolated from frozen liver tissue using TRzol® Reagent (Thermo Scientific) according to the manufacturer's instruction. Conversion into cDNA was performed using Script™ cDNA Synthesis Kit (BioRad). ApoB expression levels and levels of specific liver housekeeping genes were determined using quantitative real-time PCR assays (qRT-PCR) using iTaq™ Universal SYBR® Green Supermix (BioRad) and the Light Cycler 480 (Roche Diagnostics, Rotkreuz, Switzerland) with specific DNA primers, listed in Table A5. Analysis was done by the ΔCt method to determine ApoB expression relative to 2 liver-specific housekeeping control mRNAs. Each analysis reaction was performed in triplicate.
TABLE-US-00005 TABLE A6 Primers used in qPCR analysis of liver tissue ApoB#02 Forward GCTAACACTAAGAACCAGAAGATC [SEQ ID NO: 13] Reverse TGTCCGTCTAAGGATCCTGC [SEQ ID NO: 14] Mm RSP17 Forward GTGCGAGGAGATCGCCATTA [SEQ ID NO: 19] Reverse ATCCGCTTCATCAGATGCGT [SEQ ID NO: 20] Mm SDHA Forward GAGGAAGCACACCCTCTCAT [SEQ ID NO: 17] Reverse GGAGCGGATAGCAGGAGGTA [SEQ ID NO: 18]
Biomarker Analysis ApoB Protein
[0562] ApoB protein levels in mouse serum was determined using an ApoB ELISA (ab230932, Abcam, Cambridge, UK), according to the manufacturer's instruction. Note that no samples were analysed from 1 mg/kg ApoB #02 and 0.01 mg/kg (GalNAc)3-ApoB #03+5 mg/kg (GalNAc)3-SO861 groups at 336 hours.
Biomarker Analysis Cholesterol
[0563] LDL-cholesterol was measured in mouse serum, using an LDL-cholesterol specific two-step AU480 assay kit, respectively, from Beckman Coulter, with a photometric measurement according to the manufacturer's instructions.
Biomarker Analysis Cholesterol
[0564] Serum alanine transaminase (ALT) levels was measured using an AU480 assay kit from Beckman Coulter (photometric measurements), according to the manufacturer's instructions.