Preparation with the mycoparasitic microorganism pythium oligandrum for the treatment of dermaphytoses and yeast infections on the skin and mucouses, method of determing the cell's viability of the microorganism pythium oligandrum and method of applying the preparation

Abstract

A preparation containing the mycoparasitic microorganism Pythium oligandrum for the treatment of dermatophytoses and yeast infections on the skin and mucous membranes obtained from a dry mixture containing 0.1 to 99.9% weight mycoparasitic microorganism Pythium oligandrum and 0.1 to 99.9% auxiliary substances, containing at least one component from a group comprising adsorbent, buffer, moisturizer, deodorant and aroma. This preparation contains 1 to 10×106, with preference of 10 to 50, viable cells of the Pythium oligandrum microorganism per 1 ml of aqueous suspension at the site of applying the preparation, whereby the viable cells of the Pythium oligandrum microorganism comprise dormant oospores, encysted zoospores and viable coenocytic mycelium. Different application methods of using the preparation are claimed. Exemplary embodiments show the viability of cells using genetic tests and practical tests conducted under the supervision of dermatologists, stomatologists and veterinarians.

Claims

1. A preparation containing the mycoparasitic microorganism Pythium oligandrum for the treatment of dermatophytoses and yeast infections on the skin and mucous membranes obtained from a dry mixture containing 0.1 to 99.9% weight mycoparasitic microorganism Pythium oligandrum and 0.1 to 99.9% auxiliary substances, containing at least one component from a group comprising adsorbent, buffer, moisturizer, deodorant and aroma, wherein the preparation contains 1 to 500 viable cells of the microorganism Pythium oligandrum per 1 ml of applied preparation in an aqueous suspension at the site of application, and wherein the viable cells of the microorganism Pythium oligandrum comprise dormant oospores, encysted zoospores, and viable coenocytic mycelium.

2. The preparation according to claim 1 wherein the preparation contains 10 to 50 viable cells of the microorganism Pythium oligandrum per 1 ml of applied preparation in an aqueous suspension.

3. A method of applying the preparation of claim 1 containing the mycoparasitic microorganism Pythium oligandrum for the treatment of dermatophytoses and yeast infections on to the affected areas of the skin and mucous membranes.

4. The method of applying the preparation according to claim 3 characterized in that for the treatment of dermatophytoses in the form of tinea unguium the preparation containing 50 viable cells per 1 ml of preparation in an aqueous suspension is applied to the affected areas in the form of a wet suspension.

5. The method of applying the preparation according to claim 3 characterized in that for the treatment of dermatophytoses in the form of tinea unguium the preparation containing 50 viable cells per 1 ml of preparation in an aqueous suspension is applied to the affected areas in the form of creams, gels, ointments, wet wipes, antimicrobial sprays, moisturized patches and moisturized powders.

6. The method of applying the preparation according to claim 3 for the treatment of yeast infections in non-healing wounds characterized in that for the treatment of yeast infections in non-healing wounds the preparation is applied in the form of wet compresses containing 30 viable cells per 1 ml of preparation in an aqueous suspension in a physiological solution, and subsequent replacement of wet compresses containing 30 viable cells per 1 ml of preparation in an aqueous suspension after 8 hours for a period of 4 days.

7. The method of applying the preparation according to claim 3 characterized in that the preparation is applied using wet healing products in the form of creams, ointments, wet wipes, antimicrobial sprays, moisturized patches and powders containing 30 viable cells per 1 ml of preparation in an aqueous suspension and subsequently replacing these wet-healing products every 8 hours for a period of 4 days.

8. The method of applying the preparation according to claim 3 for the treatment of yeast infections in the oral cavity characterized in that the application is made by rinsing with the preparation containing 10 viable cells per 1 ml of preparation in an aqueous suspension, in that the rinses are done at least twice a day for a period of 5 consecutive days.

9. The method of applying the preparation according to claim 3 characterized in that the application is made using a preparation containing 10 viable cells per 1 ml of preparation in an aqueous suspension that is part of toothpastes, gels or oral sprays or the application is made by introducing an aqueous suspension to the oral cavity using syringe and needle, in that such applications are made at least twice a day for a period of 5 consecutive days.

10. A method of applying the preparation of claim 2 containing the mycoparasitic microorganism Pythium oligandrum for the treatment of dermatophytoses and yeast infections on to the affected areas of the skin and mucous membranes.

11. The method of applying the preparation according to claim 10 characterized in that for the treatment of dermatophytoses in the form of tinea unguium the preparation containing 50 viable cells per 1 ml of preparation in an aqueous suspension is applied to the affected areas in the form of a wet suspension.

12. The method of applying the preparation according to claim 10 characterized in that for the treatment of dermatophytoses in the form of tinea unguium the preparation containing 50 viable cells per 1 ml of preparation in an aqueous suspension is applied to the affected areas in the form of creams, gels, ointments, wet wipes, antimicrobial sprays, moisturized patches and moisturized powders.

13. The method of applying the preparation according to claim 10 for the treatment of yeast infections in non-healing wounds characterized in that for the treatment of yeast infections in non-healing wounds the preparation is applied in the form of wet compresses containing 30 viable cells per 1 ml of preparation in an aqueous suspension in a physiological solution, and subsequent replacement of wet compresses containing 30 viable cells per 1 ml of preparation in an aqueous suspension after 8 hours for a period of 4 days.

14. The method of applying the preparation according to claim 10 characterized in that the preparation is applied using wet healing products in the form of creams, ointments, wet wipes, antimicrobial sprays, moisturized patches and powders containing 30 viable cells per 1 ml of preparation in an aqueous suspension and subsequently replacing these wet-healing products every 8 hours for a period of 4 days.

15. The method of applying the preparation according to claim 10 for the treatment of yeast infections in the oral cavity characterized in that the application is made by rinsing with the preparation containing 10 viable cells per 1 ml of preparation in an aqueous suspension, in that the rinses are done at least twice a day for a period of 5 consecutive days.

16. The method of applying the preparation according to claim 10 characterized in that the application is made using a preparation containing 10 viable cells per 1 ml of preparation in an aqueous suspension that is part of toothpastes, gels or oral sprays or the application is made by introducing an aqueous suspension to the oral cavity using syringe and needle, in that such applications are made at least twice a day for a period of 5 consecutive days.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The technical solution is further described in detail in exemplary embodiments and explained in more detail in the appended schematic drawings, in which

(2) FIG. 1 shows a laboratory test of the effectiveness of suppressing dermatophytes and yeasts depending on the quantity of added viable encysted zoospores of the Pythium oligandrum microorganism, whereby it refers in more detail to

(3) FIG. 1A and FIG. 1B, depicting an effectiveness test with the use of the dermatophyte Trichophyton interdigitale var. mentagrophytes of the collection strain DMF2374 after 24 and 48 hours of incubation,

(4) FIG. 1C and FIG. 1D, depicting an effectiveness test with the use of the dermatophyte Microsporum canis of the collection strain CCM8353 after 24 and 48 hours of incubation,

(5) FIG. 1E and FIG. 1F, depicting an effectiveness test with the use of the dermatophyte Epidermophyton floccosum of the collection strain PL231 after 24 and 48 hours of incubation,

(6) FIG. 1G and FIG. 1H, depicting an effectiveness test with the use of the pathogenic yeast Candida albicans of the collection strain CCF8261 after 24 and 48 hours of incubation,

(7) FIG. 2 shows the clinical results in the treatment of experimental dermatophytosis of guinea pigs, in that the upper part of the figure shows the results for guinea pigs treated with a placebo and the lower part of the figure shows the results for guinea pigs treated with the use of a suspension according to exemplary embodiment 1 of this invention, and in more detail in

(8) FIG. 2A, showing photographs of the back of a guinea pig under anesthetic with the application of a placebo on the 16.sup.th day of treatment with characteristic rediness of the skin in the infected places,

(9) FIG. 2B, depicting a histological section of the skin of an animal with the application of a placebo, showing the characteristic proliferation of keratinocytes in the upper layer of the skin in reaction to irritation by untreated dermatophyte,

(10) FIG. 2C, depicting the clinical index of dermatophytosis of animals with the application of a placebo on the individual days of treatment, marked as the rediness index (the light gray column) and the skin damage index (the dark gray column),

(11) FIG. 2D, showing a photograph of the back of a guinea pig under anesthetic with the application of a suspension according to exemplary embodiment 1 of this invention on the 16.sup.th day of treatment with a lower level of rediness of the skin in the infected areas,

(12) FIG. 2E, depicting a histological section of the skin of an animal with the application of a suspension according to exemplary embodiment 1 of this invention, showing a significantly lower level of proliferation of keratinocytes in a successfully treated animal,

(13) FIG. 2F, depicting the clinical index of dermatophytosis of animals with the application of a suspension according to exemplary embodiment 1 of this invention on the individual days of treatment, marked as the redness index (the light gray column) and the skin damage index (the dark gray column).

EXEMPLARY EMBODIMENTS OF THE INVENTION

(14) The solution which we propose is made possible based on further laboratory analyses and practical tests of preparations for human and veterinary medicine according to this invention, build on CZ 302297, the detailed formulation of which was now specified with regard to use in the treatment of dermatophytoses and tinea unguium, the elimination of yeasts from non-healing wounds, and from oral cavity. The invention submitted is further described in detail in the following exemplary embodiments, but should not be limited to them. These exemplary embodiments are presented to ensure that the description is thorough and describes the essence of the invention to the extent of the patented claims.

Example 1

(15) The preparation of dry mixtures containing the Pythium oligandrum microorganism of a known viability determined for the treatment of dermatophytoses in guinea pigs, tinea unguium and the elimination of yeasts in non-healing wounds and in the oral cavity.

(16) (Table 1, Table 2, Table 3)

(17) a) Preparation of the Mycoparasitic Microorganism Pythium oligandrum

(18) Pythium oligandrum strain M1 (strain DV74, sequential protocol of which is found on the next page) was maintained in agar and the starting culture was prepared by a liquid cultivation. Sterilized millet grains (Panicum miliaceum L.) were inoculated with the liquid culture. Cultivation proceeded under sterile conditions for a period of around 7 days and the wet biomass was subsequently carefully dried and ground into powder containing particles of an average size of 35 to 50 μm. The quantity of oospores was estimated under the microscope, and the preparation was standardized according to the conditions of CZ 302297 to a content of 7±1×10.sup.6 oospores per 1 g.
b) Measuring the Viability of Cells of the Microorganism Pythium oligandrum in 3 Batches
To determine the number of viable cells of the microorganism Pythium oligandrum, the applicant of the submitted invention developed an original procedure which is conducted using a genetic test of the preparation in the form of an aqueous suspension according to this invention, measuring the level of expression of the constitutive gene for the β-tubulin of the microorganism Pythium oligandrum maintained in a medium rich in nutrients in a standard atmosphere at 30° C.

(19) The quantity of viable cells in the analyzed material was determined using the following procedure: 1 g of dried substance was weighed out and mixed in 100 ml of water in a kitchen blender. 0.5 ml of this suspension was mixed with 4.5 ml of cultivation medium in a six-well culture dish incubated at 30° C., in that 50 μl samples were taken 48 hours, 72 hours and 96 hours after the beginning of incubation. Nucleic acids were extracted and the extract diluted 50× in nuclease-free water. This was followed by reverse transcription and PCR amplification according to the standard protocol in a reaction mixture containing 4 μl of the extract, 1 μl of a mixture of primers for the amplification of the β-tubulin of Pythium oligandrum (3) and 5 μl of enzyme mixture. The exponential curve obtained was linearized and extrapolated to the initial zero time. The viability ascertained in this way was 41,700 per g of substance in the case of batch of mycoparasitic microorganism Pythium oligandrum (A), 12,500 per g of substance in the case of batch of mycoparasitic microorganism Pythium oligandrum (B) and 8,300 per g of substance in the case of batch of mycoparasitic microorganism Pythium oligandrum (C). Note: The letters A, B and C in parentheses in this and other embodiments mark the individual batches of the mycoparasitic microorganism Pythium oligandrum having the above described viabilities.

(20) The Sequential Protocol of the Applied Pythium oligandrum M1 is Shown Below: Pythium oligandrum M1_ITS4_RNA of Tested Strain DV74

(21) TABLE-US-00001 ATCATTACCACACCTAAAAACTTTCCACGTGAACCGTTATAACTATGTTC TGTGCTTCGTCGCAAGACTTGAGGCTGAACGAAGGTGAGTCTGCGTCTAT TTTGGATGCGGATTTGCTGATGTTATTTTAAACACCTATTACTTAATACT GAACTATACTCCGAATACGAAAGTTTTTGGTTTTAACAATTAACAACTTT CAGCAGTGGATGTCTAGGCTCGCACATCGATAAGAACGCTGCGAACTGCG ATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGC ATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGT ACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAAATTAGAGATGGCAG AATGTGAGGTGTCTCGCGCTGTCTTTTTAAAGATGGTTCGAGTCCCTTTA AATGTACGTTGATTCTTTCTTGTGTCTGCGAATTGCGATGCTATGCTCTT TGTGATCGGTTTAGATTGCTTTGCGCTGGTGGGCGACTTCGGTTAGGACA TATGGAAGCAACCTCAATTGGCGGTATGTTCGGCTTTGCCTGACGTTAAG CTAAGCGAGTGTAGTTTTCTGTOTTTTCCTTGAGGTGTACCTGTCGTGTG TGAGGTTGATTTAGGCTATATGGTTGCTTGGTTGTGTGGTTTAGCGTTTT CAGACGCCTGCTTCGGTAGGTAAAGGAGACAACACCAATTTGGGACTGAG AGTTTACT
Pythium oligandrum M1, COXII Mitochondrial Cytochrome Oxidase of Tested Strain DV74

(22) TABLE-US-00002   1 atggaaggta ttattaactt tcatcatgat ttagtatttt ttttaattat tgtgactgtt  61 tttgtttgtt ggttattatt tagagtaatc gtattattcg atgaaaaaaa aaacccaata 121 cctgctacat ttgtacatgg agcaactatt gaaattattt ggacaacaat tccagcatta 181 attttattaa ccgtagcagt tccatctttt gctttattat attcaatgga tgaaattatt 241 gatccaatta taactttaaa agtaataggt agtcaatggt actggagtta tgaatattct 301 gataatttag aatttgcaga tgaaccttta atttttgata gttacatggt tcaagataat 361 gacttagaaa taggacaatt taggttatta gaagtagaca accgtgttgt tgtaccaact 421 aatagccata ttagagtttt aataacagct tctgacgttt tacattcatg ggctataccc 481 tctttaggtt taaaattaga tgcttgtcca ggtcgtttaa atcaaacttc aatgtttatt 541 aaaagagaag gtgtatttta cggtcaatgt agtgaaatat gtggtataaa tcatggtttt 601 atgccaatag ttgttgaagc agtttcatta gaagattatt tagtttggtt aaaaaacaa 661 attaattttg attttaatgt ataa
c) Preparation and Application of Mixture to Treat Dermatophytoses and Tinea Unguium

(23) TABLE-US-00003 TABLE 1 Composition of preparation for the treatment of dermatophytoses and tinea unguium Weight % of Used Weight % of component in Composition of component component in aqueous Function dry mixture CAS No. dry substance suspension of component Pythium — 4 0.12 Mycoparasitic oligandrum (A) component Citric acid 77-92-9 23 0.67 Buffer Sodium 144-55-8 18 0.52 Buffer/ bicarbonate deodorant Silicon oxide 7631-86-9 8 0.23 Adsorbent PEG 6000 25322-68-3 3 0.09 Moisturizer Sodium 497-19-8 2 0.06 Buffer carbonate Water content in aqueous application suspension up to 100% Application (100 ml) solvent Concentration of viable cells of the mycoparasitic 50 viable cells per 1 ml of microorganism Pythium oligandrum preparation in aqueous suspension
d) Preparation and Application of Mixture to Eliminate Yeasts in Non-Healing Wounds

(24) TABLE-US-00004 TABLE 2 Composition of preparation to eliminate yeasts in non-healing wounds Used % active Composition of component substance in dry mixture CAS No. Weight % application Function Pythium 6 0.24 Mycoparasitic oligandrum(B) component Silicon oxide 7631-86-9 94 3.76 Adsorbent Content of physiological solution in aqueous up to 100% application suspension (250 ml) Concentration of viable cells of the mycoparasitic 30 viable cells per 1 ml of microorganism Pythium oligandrum preparation in aqueous suspension
e) Preparation and Application of Mixture to Eliminate Yeasts in the Oral Cavity

(25) TABLE-US-00005 TABLE 3 Composition of preparation to eliminate yeasts in the oral cavity Weight % of Used Weight % of component in Composition of component component in aqueous Function dry mixture CAS No. dry substance suspension of component Pythium — 4 0.16 Mycoparasitic oligandrum (C) component Citric acid 77-92-9 31 0.90 Buffer substance Sodium 144-55-8 27 0.79 Buffer substance, bicarbonate deodorant Sorbitol 50-7-4 24 0.70 Moisturizer Silicon oxide 7631-86-9 8 0.23 Adsorbent PEG 6000 25322-68-3 3 0.09 Moisturizer Sodium carbonate 497-19-8 2 0.06 Buffer substance D-Limonen 5989-27-5 1 0.03 Aroma Water content in aqueous application suspension up to 100% (100 ml) Concentration of viable cells of the mycoparasitic 10 viable oospores per 1 ml of microorganism Pythium oligandrum preparation in aqueous suspension

Example 2

(26) Suppression of Growth and Elimination of Dermatophytes and Yeasts in a Laboratory Test

(27) (FIG. 1)

(28) The application of the microorganism Pythium oligandrum in the form of encysted zoospores prepared according to the published protocol (5) was chosen for laboratory effectiveness tests. The suspension method of testing, which is preferred for the verification of the anti-microbial activities of other preparations (1), was chosen. Zoospores were encysted by vortexing for a period of 2 minutes, and maintained under these conditions at 16° C. until the beginning of the experiment. Suspensions of microconidia from the dermatophytes Trichophyton interdigitale var. mentagrophytes DMF2374, Microsporum canis CCM8353 and Epidermophyton floccosum PL231 and a suspension of Candida albicans CCM8261 yeasts were prepared according to the published methodologies (7, 1). The suspension of zoospores and the suspension of microconidia or yeast cells were diluted to the required concentration, and cells were cultivated in a suspension in six-well plastic dishes for a period of 48 hours at 30° C. Samples for determination of the number of living cells by the cultivation method were taken after 24 and 48 hours.

(29) The result of the experiment is shown in FIG. 1. It is shown that in all tested cases, the quantity of encysted zoospores was optimum for suppressing the growth of the dermatophytes and pathogenic yeast Candida albicans being studied at between 10 and 50 viable cells per 1 ml of examined solution with dermatophyte or yeast. If the quantity of encysted zoospores was lower, the effective suppression of growth was not guaranteed. Surprisingly, not even a higher quantity of zoospores led to better results in suppressing the growth of the targeted microorganisms, this growth being either identical or higher.

Example 3

(30) The Elimination of Dermatophytes and the Establishment of Physiological Microflora in Guinea Pigs Infected with Dermatophytes

(31) (FIG. 2)

(32) This test was conducted according to the published protocol (4, 7) with infection by verified strain of Trichophyton interdigitale var. mentagrophytes DMF2374. An identical mixture to that in the exemplary embodiment of this invention was used as a placebo during application, the cultivation biomass being replaced by water and a fungicidal substance according to exemplary embodiment 1c of this invention as the experimental substance.

(33) The result of this test is described in in FIG. 2. The overall appearance of a treated guinea pig in the lower part of FIG. 2 and the histology of the skin of the animal and the value of the clinical dermatophytosis indexes of the animal clearly show the significant clinical effect in the treatment of experimental dermatophytosis in comparison with an animal treated using a placebo from which the active substance Pythium oligandrum was omitted.

Example 4

(34) The Elimination of Dermatophytes and Improvement of the Clinical Condition of Patients with Tinea Unguium

(35) (Table 4)

(36) Table 4 on the next page shows the results of a study involving 21 patients affected by tinea unguium in combination with other dermatophytoses. Prior to the application of the preparation according to this invention, all 21 patients had positive findings by microscopy, and the occurrence of at least one dermatophyte, in some cases two dermatophytes, was confirmed in all the patients by cultivation. The occurrence of the pathogenic yeast Candida albicans was by far the most common among the accompanying microbiology. Most common in the accompanying diagnoses were diabetes, tinea pedis and tinea pedis interdigitale, and, in one case, a fungal disease of the hand was observed. One or more nails on the foot were affected to an average extent of 1.5 of the area of the nail.

(37) The application of the preparation according to exemplary embodiment 1c was conducted for all patients in the study in the form of night nail wraps for two consecutive nights with application repeated after 14 days and one month.

(38) An evaluation of effectiveness was conducted nine months after the end of application, which is 10 months after the beginning of the study. Most patients were negative under the microscope, while cultivation revealed that two patients had residual sporadic occurrence of the dermatophyte Trichophyton rubrum, this dermatophyte occurred to a heightened extent in one patient, and the Candida albicans yeast occurred sporadically in one patient. Overall, then, the level of mycological treatment could be evaluated as highly satisfactory, with the resolution of the mycological load in 95% of patients and clinical treatment evaluated on average at a level of 2.1 on the six-point scale (1—full treatment without malformation of nails, 6—deterioration in condition). In total, tinea unguium was cured in 12 patients without any malformation of the nails (54.5%), 1 patient was treated with residual malformation (4.5%), clinical improvement of more than 50% was evident in 6 patients (27.3%), there was insignificant improvement of up to 50% in one patient (4.5%) and there was no change in clinical condition in two patients even 9 months after the end of application (9.2%), although medical documentation would suggest a high likelihood of reinfection in these cases. There were no patients who suffered deterioration in clinical condition.

(39) TABLE-US-00006 TABLE 4 Summary of clinical data for 21 patients suffering from tinea unguium Before application 3 months after application 9 months after application Final evaluation Participating No, Init, Age Micr Cult Nail Other Micr Cult Nail Other Micr Cult Nail Other Mycol Clin dermatologist  1, AV, 72 y Ab (m) 0.4 n 0.2 n 0.1 100 3 Raj  2, CJ, 77 y Tr (m), Ca (m) 0.8 n 0.4 n 0 100 2 Bab  3, CL, 45 y Tr (m), Ab (m) 2.4 y Tr (m) 0.8 y Tr (a) 0.4 63 3 Vor  4, GP, 55 y Ab (m) 0.4 dm n 0.1 dm n 0 dm 100 1 Vor  5, HM, 71 y Tr (m) 0.4 dm y Tr (a) 0.2 dm y Tr (s) 0.1 dm 50 3 Kov  6, IF, 40 y Ab (m), Ca (m) 0.3 ti n 0.1 n 0 100 1 Vor  7, IS, 52 y Tr (m), Ef (m) 6 hm n 3 n 1 100 3 Bub  8, IV, 76 y Tr (m), Ab (m) 1.5 y Tr (a) 0.5 y Tr (s) 0.4 88 3 Raj  9, KB, 55 y Tr (s), Ca (m) 1 n 0.5 n 0 100 1 Nov 10, KJ, 27 y Ab (a) 0.3 n 0.1 n 0 100 1 Voj 11, KK, 71 y Tr (m), Ef (a) 2.5 n 2 n 1 100 4 Vor 12, KS, 22 y Ab (a) 0.5 tp n 0.1 n 0 100 1 Boh 13, MK, 51 y Ab (a) 3.1 n 2.4 n 3.2 100 5 Boh 14, LM. 73 y Tr (m), Ca (m) 1 dm n 0.4 dm n 0 dm 100 1 Bub 15, MH, 29 y Tr (m), Ca (m) 0.6 n 0.2 y Ca (s) 0 88 1 Bub 16, MP, 66 y Tr (m) 1.5 n 0.8 n 0 100 1 Kov 17, MS, 69 y Ab (m) 1.3 tp n 0.6 n 0 100 1 Bub 18, NB, 63 y Tr (m), Ab (m) 3 n 1.8 n 0.8 100 3 Bub 19, PM, 69 y Tr (m), Ca (m) 1 dm n 0.8 dm n 0 dm 100 1 Vor 20, TM, 48 y Tr (m), Ab (a) 2 n 0.8 n 0 100 1 Bub 21, VJ, 70 y Ab (a) 0.6 ti n 0.2 n 0 100 1 Bub Average age 58 1.5 0.81 0.4 95 2.1 S.D. 17 1.3 0.83 0.8 17 1.4 Abbreviations used: No—number of patient in study, Init—initials of patient, Micr—microscopy in KOH, Cult—cultivation result, Nail - area of affected nail, Other - other medical observations, Mycol - evaluation of final mycological treatment, Clin - final clinical evaluation of doctor on a six-point scale, y - positive result, n - negative result, Ab—Arthroderma benhamiae, Tr—Trichophyton rubrum, Ca—Candida albicans, Ef—Epidermophyton floccosum, (m) - massive occurrence, (a) - abundant occurrence, (s) - sporadic occurrence, dm—diabetes mellitus, Ti—tinea interdigitale, hm - mycosis of the hand, tp—tinea pedis.

Example 5

(40) The Suppression and Elimination of Pathogenic Yeasts in Non-Healing Wounds in Patients

(41) (Table 5)

(42) The influence of the application of the preparation according to this invention on a group of 12 patients with non-healing wounds complicated by yeast infection with the pathogenic yeasts Candida albicans was monitored in a preliminary practical study. Six of the patients suffered from diabetes, six did not. The average age of the patients in the diabetic group was 77.5 years and in the non-diabetic group 57.2 years. There is a predominance of women, who are known to have a higher susceptibility to the occurrence of varicose ulcers and non-healing wounds. It further ensues from the patients' anamnesis that there had been no advancement in the treatment of non-healing wounds for a minimum period of 6 months after the beginning of treatment using commonly used medical preparations, including antibiotics, and for an even longer period for some patients (up to 2 years).

(43) Wet treatment was provided for patients with the use of a suspension prepared using preparations according to exemplary embodiment 1 d as part of wet healing. The application dressings were replaced every 8 hours for a total period of 4 days. The application described reduced the microbiological load very significantly, in that the occurrence of the pathogenic yeast was reduced by 95.3% in the case of diabetic patients and 75.3% in non-diabetic patients, a reduction of 85.3% being observed for the whole study. There was an improvement in the clinical picture of infection based on the evaluation of the participating doctors assessing the extent of the inflammatory process, the intensity of pus discharge etc. of 78.3% in diabetic patients and 67,2% in non-diabetic patients, meaning an improvement of 72.8% in total for the whole study. A highly significant correlation was found between the reduction of the microbial load and the improvement of the clinical picture of microbial infection, which is a very significant finding within the context of the published medical literature.

(44) TABLE-US-00007 TABLE 5 Correlation of the improvement of the microbiological load and the improvement of clinical microbiology in 12 patients with non-healing wounds affected by yeast infection Initials, Improvement (%) Improvement (%) age, sex in microbial in clinical Correlation of patients status of patients status of patients coefficient Diabetic patients LS, 89, f 72 60 LS, 87, f 100 90 MM, 79, f 100 90 ZM, 71, f 100 90 MN, 70, m 100 80 BR, 69, m 100 60 Average age: 77.5 95.3 78.3 0.98 Non-diabetic patients LK, 75, f 32 28 BS, 66, f 20 30 OK, 65, m 100 90 OB, 54, f 100 90 JJ, 44, f 100 80 JS, 37, f 100 85 Average age: 57.2 75.3 67.2 0.99 Total for study: 85.3 72.8 0.98

Example 6

(45) The Suppression and Elimination of Pathogenic Yeasts in the Oral Cavity

(46) (Table 6)

(47) A study was conducted among 12 patients with the presence of pathogenic yeasts in the oral cavity at dental hygiene ambulancies under the supervision of the stomatologists.

(48) After microbiological sampling and clarification of the nature of the diagnosis, patients were informed and provided with one pack of the preparation to eliminate pathogenic yeasts in the oral cavity containing 5 effervescent tablets according to exemplary embodiment 1 d. After the evening oral hygiene, patients carefully washed the oral cavity and followed this by rinsing with the preparation for at least five minutes on the condition that it contained an average of 10 viable oospores of the microorganism Pythium oligandrum after prior activation in lukewarm water. The oral cavity was not rinsed after this so that the remainder of the application solution would remain there overnight. The application was repeated in the morning and patients continued in this way for a period of 5 days, using the 5 effervescent tablets in the pack.

(49) Subsequent clinical monitoring and evaluation of effectiveness then proceeded around 6 months after application. The pathogenic yeast was eliminated from the oral cavity in 67.1% of cases, this accompanied by an average improvement in the clinical condition of the affected patients by 66.8%. Patients mainly suffered from repeat inflammations of the oral cavity and periodontal diseases. A correlation was again identified between the reduction in the occurrence of yeasts in the oral cavity and an improvement in clinical condition.

(50) TABLE-US-00008 TABLE 6 Correlation of the improvement of the microbiological load and an improvement in the clinical condition of 10 patients with yeast infection in the oral cavity Initials, Improvement (%) Improvement (%) age, sex in microbial in clinical Correlation of patients status of patients status of patients coefficient CJ, 40 75 50 HL, 38 75 66 JJ, 39 75 67 KA, 26 50 40 LI, 60 80 76 PP, 74 50 70 SK, 35 70 66 SM, 37 75 82 SS, 34 50 54 ZK, 35 75 80 Average 67.1 66.8 0.95

INDUSTRIAL APPLICABILITY

(51) The preparation for the treatment of dermatophytoses and yeast infections on the skin and mucous membranes could be used to suppress symptoms associated with infection by dermatophytes or yeasts on the skin and mucous membranes, such as socially troublesome smell symptoms, excessive perspiration of the foot, irritation and burning, and for the suppression and elimination of the occurrence of dermatophytes and yeasts in non-healing wounds, in the oral cavity, on the skin, on the urogenital mucous membranes, in the hair and in other places affected by these microorganisms.

CITED LITERATURE

(52) 1. Barros M E S, Santos D A, Hamdan J S (2006) Mycol Res 110, 1355-1360. 2. Calderona R A, Fonzi W A (2001) Trends Microbiol 9, 327-335. 3. Horner N R, Grenville-Briggs U, van West P (2012) Fungal Biol 116, 24-41. 4. Klimeš R, Suchánek M, Maštalková L et al (2016) Vet Dermatol, in print. 5. Madsen A M, Robinson H L, Deacon J W (1995) Mycol Res 99, 1417-1424. 6. Martinez D A, Oliver B G, Graser Y et al (2012) mBio 3, e00259-12. 7. Saunte D M, Simmel F, Frimodt-Moller N (2007) Antimicrob Agents Chemother 51, 3317-3321. 8. CZ 302297 (published 2011) Suchánek M, Klimeš R 9. CZ 28816 U (published 16 Nov. 2015) Suchánek M, Klimeš R 10. CZ 9883 U (published 14 Apr. 2000) Veselý D, Veselý L 11. Yacoub A, Berger H, Gerbore J et al. (2016) Genome Announcements 4, e00215-16.