Composition for preventing or treating inflammatory diseases, containing, as active ingredient, stem cells overexpressing SOD3

Abstract

The present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases, containing, as an active ingredient, stem cells overexpressing SOD3. The present inventor has ascertained that mesenchymal stem cells (MSCs) overexpressing SOD3 have a stronger antioxidant activity and immune regulatory function than normal MSCs, and thus the MSCs overexpressing SOD3 can be an effective treatment agent for inflammatory diseases, autoimmune diseases, organ transplant rejection and the like.

Claims

1. A method for treating an inflammatory skin disease in a subject, the method comprising administering an effective amount of a composition comprising, as an active ingredient, mesenchymal stem cells overexpressing extracellular superoxide dismutase (SOD3) to the subject in need thereof, wherein the inflammatory skin disease is one or more disease selected from the group consisting of psoriasis and atopic dermatitis.

2. The method of claim 1, wherein the mesenchymal stem cells are derived from a tissue selected from the group consisting of umbilical cord, umbilical cord blood, placenta, bone marrow, adipose tissue, muscle, amniotic fluid, and amniotic membrane.

3. The method of claim 1, wherein the SOD3 comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

4. The method of claim 1, wherein the mesenchymal stem cells overexpressing SOD3 are obtained by transfecting mesenchymal stem cells with a recombinant expression vector comprising a polynucleotide encoding SOD3.

5. The method of claim 4, wherein the recombinant expression vector is selected from the group consisting of a retrovirus vector, an adenovirus vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a herpes virus vector, a lentivirus vector, and an avipox virus vector.

6. The method of claim 4, wherein the polynucleotide encoding SOD3 comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the experiment results of RT-PCR (FIG. 1A), western blot (FIG. 1B) and SOD3 activity (FIG. 1C) to investigate expression patterns of SOD3 in SOD3-transfected MSCs (SOD3-MSC) or control MSCs (MSC).

(2) FIG. 2 shows fluorescent staining images and a fluorescence spectrophotometry result graph to observe reactive oxygen species generated by TNF-α and IFN-γ stimulation in SOD3-MSCs and MSCs.

(3) FIG. 3 shows MTT assay results over time (FIG. 3A) and the number of measured cells (FIG. 3B) to investigate effects of SOD3 transfection on MCS proliferation.

(4) FIG. 4 shows RT-PCR results to investigate effects of SOD3-MSCs or MSCs on the expressions of inflammation-related cytokines of HaCaT cells.

(5) FIG. 5 shows expression levels of intracellular IL-1Ra(icIL-1Ra), soluble IL-1Ra(sIL-1Ra), and unspliced IL-1Ra measured by RT-PCR (FIG. 5A), quantitative analysis of icIL-1Ra mRNA level (FIG. 5B), expression levels of HO-1, DIO-1, TGF-β, Galectin-1, and IL-10 (FIG. 5C), and PGE2 level in culture media of corresponding cells measured by immunoassay (FIG. 5D) in MSCs, LacZ-transfected MSCs (LACZ-MSC), and SOD3-transfected MSCs (SOD3-MSC).

(6) FIG. 6 shows flow cemetery (FACS) results to determine CD4.sup.+ T and CD8.sup.+ T cell proliferation in CFSE based-mixed lymphocyte reaction experiments co-cultured with a negative control (Control (−)), a positive control (Control (+), and, according to experimental conditions, untreated MSCs (MSC), LacZ-transfected MSCs (LACZ-MSC), SOD3-transfected MSCs (SOD3-MSC), and SOD3-trandsuced MSCs treated with DETCA (SOD3-MSC+DETCA). DETCA is an SOD3 inhibitor.

(7) FIG. 7 shows graphs quantifying the FACS results of FIG. 6. “Stimulation index (1)” on the vertical axis indicates the number of cells when stimulation was applied/the percentage of cells when stimulation was not applied.

(8) FIG. 8 shows graphs depicting RT-PCR results to determine the expression levels of T-cell lineage-specific master transcription factors and cytokines.

(9) FIG. 9 shows RT-PCR results (upper) to determine the expression levels of Treg lineage-specific master transcription factors and cytokines and flow cemetery results (lower) depicting effects of MSCs on Treg cell differentiation.

(10) FIG. 10 is a schematic diagram showing an experimental setup for mice with IMQ-induced chronic and aggressive dermatitis.

(11) FIG. 11 shows images of mouse back skin depicting the lesion progression of each group of mice in the IMQ-induced chronic and aggressive dermatitis biological model experiments.

(12) FIG. 12 shows microscopy images of back skin sections of each group of mice stained with H&E in IMQ-induced chronic and aggressive dermatitis mouse experiments.

(13) FIG. 13 shows a bar graph comparing epidermal thickness measurement results of back skin for each group of mice in IMQ-induced chronic and aggressive dermatitis mouse experiments.

(14) FIG. 14 shows graphs depicting the proportions of T cells, neutrophils (Gr1.sup.+), and dendritic cells (CD11C.sup.+) infiltrating into spleens of each group of mice in IMQ-induced chronic and aggressive dermatitis mouse experiments.

(15) FIG. 15 shows microscopy images of T cells, neutrophils (Gr1.sup.+), and dendritic cells (CD11C.sup.+), which infiltrated into skin of each group of mice, stained and analyzed by immunohistochemistry, in IMQ-induced chronic and aggressive dermatitis mouse experiments. Arrows indicate stained cells.

(16) FIG. 16 shows graphs depicting the numbers of T cells, neutrophils (Gr1.sup.+), and dendritic cells (CD11C.sup.+) infiltrating into spleens of each group of mice in IMQ-induced chronic and aggressive dermatitis biological model experiments.

(17) FIG. 17 show graphs depicting RT-PCR results to determine mRNA levels of pro-inflammatory mediators expressed in skin of each group of mice in IMQ-induced chronic and aggressive dermatitis mouse experiments.

(18) FIG. 18 shows western blot results to depict the expression levels and phosphorylation levels of TLR-7, NF-kB, JNK, p38, STAT1, STAT3, JAK1, and JAK2 present in skin of each group of mice in IMQ-induced chronic and aggressive dermatitis biological model experiments.

(19) FIG. 19 shows a bar graph depicting cAMP concentration measured in blood plasma of each group of mice in IMQ-induced chronic and aggressive dermatitis biological model experiments.

(20) FIG. 20 is a schematic diagram showing an experimental setup for ovalbumin (OVA)-induced atopy-like dermatitis mouse experiments.

(21) FIG. 21 shows skin images depicting the lesion progression of each group of mice in ovalbumin (OVA)-induced atopy-like dermatitis mouse experiments.

Mode For Carrying Out The Invention

(22) Hereinafter, the present invention will be described in detail.

(23) However, the following examples are merely for illustrating the present invention and are not intended to limit the scope of the present invention.

(24) <Methods>

(25) Culture and Identification of MSCs

(26) Human umbilical cord blood derived mesenchymal stem cells (hUCB-MSCs) were collected from blood samples of human umbilical cord with the consent of donors. The blood samples of umbilical cord were stored in a blood collection bag containing citrate phosphate glucose as an anti-coagulant. Treatments for experiments were conducted within 24 hours. A fraction of the mononuclear cells was separated by centrifugation in a Ficoll-Paque PLUS gradient (Amersham Biosciences). The fraction was washed with HBSS (Jeil Biotech Services), and resuspended in low-glucose Dulbecco's modified Eagle's medium (DMEM, Invitrogen Corp), 20% fetal bovine serum (Gibco-BRL), 2 mM L-glutamine, 1 mM sodium pyruvate, and 1% antibiotic/antimycotic (Life Technologies). The antibiotic/antimycotic contains 100 U/ml penicillin, 100 μg/ml streptomycin, and 25 μg/ml amphotericin B. After 7 days, non-adherent cells were discarded, and adherent cells were cultured with two medium changes per week. Cells were maintained at 37E in a humidified atmosphere containing 5% CO.sub.2. Approximately 60% of the confluent cells were detached with 0.1% trypsin-EDTA and re-plated in culture flasks.

(27) The immunophenotypes of the hUCB-MSC were assessed for the presence of positive markers for MSC-related antigens and the absence of markers for hematopoietic lineage markers by flow cytometry (Epics XL, Beckman Coulter). The positive markers include CD90 (Thy-1), CD105 (endoglin), and SH3 (CD73), and the hematopoietic lineage markers include CD34 and CD45 and endothelial markers such as CD31. The cells were positive for HLA class I but negative for HLA-DR. The respective fluorescent conjugated monoclonal antibodies were obtained from Becton Dickinson.

(28) Confirmation of SOD3 Transfection and SOD3 Overexpression Using Electroporation

(29) The experimental results in FIGS. 1 to 4 were obtained by using SOD3-transfected MSCs by electroporation. For electroporation, electrical stimulation (1000 voltage, 1 pulse) was applied to MSCs according to the Neon™ protocol (Invitrogen) to increase the permeability of cell membranes and inject DNA into cells, and the presence or absence of DNA overexpression was determined by obtaining proteins, followed by western blotting or by amplifying the human SOD3 gene (Genbank accession number NM 003102.2) by PCR, followed by identification on the 5% agarose gel. The amplification program consisted of 94 ═5 min; 94□40 s, 57□30 s, 72□60 s (35 cycle); 72□10 min; and 4□ 0−∞ (∞ is infinite, meaning that there is no specified time).

(30) Adenovirus Expression Vector an Transfection Conditions for SOD3 Transfection

(31) The experimental results in FIGS. 5 to 21 were obtained by using SOD3-transfected MSCs by electroporation. pRC/CMV hSOD3 vector containing human SOD3 was inserted into E1 shuttle vector pCA14 by homologous recombination. Merge shuttle vector and vector dE1-k35/LacZ were integrated again by homologous recombination to generate the final construct dE1-k35/SOD3. Supernatants containing recombinant adenoviruses were separated from plaque and amplified on 293 cells. Mesenchymal stem cells (MSCs) were then transfected with prepared adenoviral human SOD3 and control LacZ at 10 multiplicity of infection (MOI).

(32) SOD3 Activity Measurement

(33) The enzyme activity of SOD3 was confirmed by measuring superoxide radicals. 200M xanthine (Sigma) and 50M WST-1 (Dojindo) in PBS were mixed with 20 μl of sample, followed by treatment with 0.0005 units of XOD (Sigma), and then the formazan dye signal development was spectroscopically measured.

(34) MTT Assay

(35) MTT assay was conducted to measure the cell proliferation of MSCs (Man et al., 2006; Weichert et al., 1991). 6×10.sup.3 MSCs were incubated for 24 hours, and the cultured MSCs were transfected with human SOD3 gene using electroporation, and at 24 hours, 48 hours, and 72 hours, corresponding wells were treated with 20 μl of MTT (5 mg/ml), and further incubated for 4 hours. Medium was removed, and the cells were lysed with 100 μl of dimethyl sulfoxide per well, and the absorbance was measured using absorption wavelength of 595 nm (Bio-Tek Instruments, Winooski, Vt., USA).

(36) Measurement of Reactive Oxygen Species Generated in MSCs by TNF-α and IFN-γ Stimulations

(37) MSCs were dispensed on 6-well plates and incubated for 24 hours, and then stimulated with 10 ng/ml TNF-α and 100 U/ml IFN-γ for 1 hour. The cells were stabilized with Hanks balanced salt solution (HBSS) for 30 minutes, and then stained with 10 μM 2,7-dichlorofluorescin diacetate (H2DCF-DA) at 37□ for 30 minutes. ROS was observed by a confocal microscope at an emission wavelength of 513 nm and an excitation wavelength of 488 nm through DCF-fluorescence, and fluorescence was measured by a fluorescence spectrophotometer (Synergy, BIOTEK, US).

(38) Immunosuppressive Molecule Expression Analysis

(39) For analysis of the expression of genes with immunosuppressive functions expressed in MSCs, MSCs were incubated by the following method, and the gene expression was analyzed in the presence or absence of stimulations with TNF-α and IFN-γ: Day 0: MSCs (1×10.sup.4 cells/cm.sup.2) were incubated on a 60-mm culture dish (medium volume: 3 ml) and cells were incubated to 70-80% confluency. Day 1: The incubated MSCs were transfected with SOD3 by the infection with adenovirus containing wild-type SOD3 or a control virus (AdLacZ) for 24 hours. Day 2: The medium was exchanged with new MSC growth medium 24 h after viral infection. Day 3: After additional incubation for 24 hours, TNF-α (10 ng/ml) and IFN-γ (100 Unit/ml) were added to obtain stimulated or unstimulated cells, and the corresponding gene expressions were analyzed by the measurement of mRNA levels.

(40) For gene expression analysis, cDNA was synthesized from 1 μl of total RNA using QuantiTect Reverse Transcription Kit (QIAGEN). Briefly, genomic DNA was removed from template RNA using gDNA wipeout buffer, incubated at 42E for 2 m, and immediately stored on ice. Thereafter, the reverse transcriptase, RT buffer, and RT primer mix were mixed with the template RNA, and the reaction was carried out at 42□ for 15 m and at 95□ for 3 m. The synthesized cDNA was stored at −20 □ before use. Then, 0.25 template, 1 μl of corresponding primers, 10 μl of TOP polymerase mixture, and 8.75 μl of distilled water were mixed, and RT-PCR was performed in a final volume of 20 μl. The PCR results were confirmed by electrophoresis on 1% agarose gel. The primer sequences used for RT-PCR and real-time PCR were as follows, and were customized by Bioneer (Korea): icIL-1Ra forward 5′-TTATGGGCAGCAGCTCAGTT-3′(SEQ ID NO: 15), reverse 5′-TTGACACAGGACAGGCACAT-3′(SEQ ID NO: 16); sIL-1Ra forward 5′-TCCGCAGTCACCTAATCACTC-3′(SEQ ID NO: 17), reverse 5′-TTGACACAGGACAGGCACAT-3′(SEQ ID NO: 18); unspliced IL-1Ra forward 5′-GGCCTCCGCAGTCACCTAATCACTCT-3′(SEQ ID NO: 19), reverse 5′-GGTCGCACTATCCACATCTGGG-3′(SEQ ID NO: 20); HO-1 forward 5′-CCTGGTGTCCCTTCAATCAT-3′(SEQ ID NO: 21), reverse 5′-GGCGATGAGGTGGAATACAT-3′(SEQ ID NO: 22); IDO-1 forward 5′-TGTGAACCCAAAAGCATTTTTC-3′(SEQ ID NO: 23), reverse 5′-AAAGACGCTGCTTTGGCC-3′(SEQ ID NO: 24); TGF-β forward 5′-CCCAGCATCTGCAAAGCTC-3′(SEQ ID NO: 25), reverse 5′-GTCAATGTACAGCTGCCGCA-3′(SEQ ID NO: 26); Galectin-1 forward 5′-GGTCTGGTCGCCAGCAACCTGAAT-3′(SEQ ID NO: 27), reverse 5′-TGAGGCGGTTGGGGAACTTG-3′(SEQ ID NO: 28); IL-10 forward 5′-AAGCTGAGAACCAAGACCCAGACATCAAGGCG-3′(SEQ ID NO: 29), reverse 5′-AGCTATCCCAGAGCCCCAGATCCGATTTTGG-3′(SEQ ID NO: 30); and GAPDH forward 5′-AAGGTCGGAGTCAACGGATTTGGT-3′(SEQ ID NO: 31), reverse 5′-AGTGATGGCATGGACTGTGGTCAT-3′(SEQ ID NO: 32).

(41) Prostaglandin E2 Immunoassay

(42) The measurement of prostaglandin E2 (PGE2) was repeated two times for all standards and samples. 100 μl of standard diluent (Tissue Culture Media) was placed in NSB and Bo (0 pg/ml standard material), and 100 μl of standard material was added to appropriate wells. Similarly, 100 μl of samples were added to the wells. Then, 50 μl of assay buffer was added to the NSB wells, and 50 μl of blue conjugate was added to each well except total activity (TA) and blank wells. Thereafter, μl of yellow antibody was added to each well, and incubated in a plate shaker (500 rpm or less) for 2 h. Each well was washed three times with 400 μl wash solution. After the last wash, a buffer for each well was removed, and the remaining washing buffer was removed using a lint free paper towel, and then, 5 μl of blue conjugate was added to the TA well. Then, 200 μl of pNpp substrate solution was added to each well. After the reaction was allowed to proceed at room temperature without vibration for 45 minutes, 50 μl of stop solution was added to each well, and then the absorbance was measured at 405 nm.

(43) T Cell Proliferation Assay

(44) Carboxyfluorescein diacetate succinimidyl ester (CFSE)-MLR assay was performed to determine the proliferation of CD4.sup.+ and CD8.sup.+ T cells co-cultured with MSCa and SOD3-transfected MSCs. The assay was performed by plating 1×10.sup.6 CFSE-labeled responder cells (whole spleen cells from CS7BL/6 mice) in triplicate in 24-well plates (Costar, Corning, N.Y.). The cells were stimulated with 1×10 stimulator cells (Balb/c mouse cells) irradiated with 3000cGY. For CFSE labeling, 200×10.sup.6 cells/ml of responder cells were resuspended in PBS. CFSE (Molecular Probes, Inc) was added to make a final concentration of 5 μM, and the cells, while protected from light, were gently shaken at room temperature for 10 minutes. CFSE labeling of cells was stopped by the addition of cold RPMI 1640 growth medium (GIBCO) and kept on ice for 5 minutes. The cells were pelleted and washed twice with the growth medium and resuspended. Both the CFSE-labeled responder cells and irradiated stimulator cells were adjusted to a concentration of 2×10.sup.6 cells/ml in the growth medium, and co-cultured in a total volume of ml in 24-well plates with MSCs or SOD3-transfected MSCs at a ratio of 10:1 and incubated at 37 □, in 5% CO.sub.2 and 100% humidity. After a 5-day culture period, cells were harvested, washed twice, and resuspended in PBS. Subordinate factors of responder cells were quantified by using the FITC conjugated anti-mouse CD4 and PE-conjugated anti-mouse CD8 (BD Biosciences Pharmingen).

(45) T Cell Differentiation Assay

(46) Naive CD4.sup.+ T cells were isolated by negative selection from spleens and lymph nodes of C57BL/6 mice using MACS column (Miltenyi Biotech). The isolated cells were activated by plate-bound anti-CD3 antibody, and anti-CD28 antibody (2 μg/ml) added to RPMI 1640 medium containing 10% FBS, 2 mM glutamine, and 1% penicillin-streptomycin. The cells were polarized under Th1 polarizing conditions (10 μg/ml anti-IL4 Ab, 10 ng/ml IL-12), Th2 polarizing conditions (10 μg/ml anti-IFN-γ Ab, 10 ng/ml IL-4), Th17 polarizing condition (20 ng/ml IL-6, 5 ng/ml TGF-β, 10 μg/ml IFN-γ antibody, 10 μg/ml IL-4 antibody) or Treg polarizing conditions (5 ng/ml TGF-β and 10 ng/ml IL-2), and then co-cultured with MSCs or SOD3-transfected MSCs at a ratio of 10:1 for 4 days. All cytokines and antibodies used for CD4.sup.+ T cell differentiation were purchased from BD Biosciences. After 4 days, the cells were harvested for mRNA expression analysis using cytokines or molecules specific for Th1, Th2, Th17, or Treg cell differentiation.

(47) Experimental Models and Disease Models

(48) The mice used in the experiments were 8-week aged C57BL/6 mice and fed with standard mouse feed and water without specific pathogen, and the experiments were performed following the regulations of the Catholic Ethics Committee of the Catholic University in accordance with the guidelines of the Ministry of Health and Welfare.

(49) For induction of chronic and aggressive inflammation on skin of the mice, the hair of the back of the mice was removed by shaving, and 62.5 mg of imiquimod (IMQ) cream (5%, Aldara 3M pharmaceuticals) were applied to the skin of the shaved mice.

(50) For introduction of atopy-like dermatitis, a mixture of 10 μg of OVA protein and 4 mg of aluminum hydroxide as an antigen adjuvant was intraperitoneally injected into mice grown in SPF conditions at the start of the experiment (D0), day 7 (D7), and day 14 (D14), so that the animals were sensitized. From day 21 after the start of the experiment, a patch was prepared by wetting 1×1 cm.sup.2 gauze in 100 μg of OVA dissolved in 100 μl of PBS, and then attached to the shaved back of the mice to induce immune responses for 7 days. The immune responses were again induced by OVA patch in the same manner for one week starting from day 35. MSCs, LacZ-MSCs, and SOD3-MSCs were injected into the lesion site on day 42 after the start of the experiment, and skin changes were observed to the naked eye on day 49.

(51) Subcutaneous Injection of MSCs into Mice

(52) In the animal experiments using IMQ and ovalbumin, the subcutaneous injection of MSCs was conducted by subcutaneously injecting MSCs into mice at a cell number of 2×10.sup.6 cells for each experimental condition. Equal volume of phosphate buffered saline (PBS), which is a control for MSC subcutaneous injection, was subcutaneously injected.

(53) Analysis of cAMP Concentration in Mouse Skin

(54) The back skin cells and blood plasma were obtained from the mice at day 6 and 12 after IMQ coating to determine the cAMP concentration. For cAMP concentration analysis, cAMP ELISA kit (BD immunocytometry) was used.

(55) Histological Evaluation and Fluorescent Immunohistochemistry in Mouse Models

(56) The back skin cells were obtained from mice at day and 12, and fixed in 4% paraformaldehyde (PFA) and embedded in paraffin. For skin samples, 4 μm-thick tissue sections were prepared using a rotary microtome (Leica). Then, the tissue sections were dewaxed using xylene and dehydrated through gradients of alcohol. The pre-treated tissue sections were then stained with Hematoxylene and eosin stain (H and E stain). The fluorescent immunohistochemistry was performed by incubated the tissue sections with primary antibodies against CD4, CD8, CD11c, or Gr-1 and then proper fluorescence-labeled secondary antibodies against Alexa fluor 488 and Alexa fluor 647.

(57) Flow Cytometry Analysis of Mouse Splenocytes

(58) Total spleen cells were harvested from each group of mice and resuspended in MACS buffer (1×PBS with 0.5% BSA). The cells were stained with FITC-conjugated anti-mouse CD4, PE-conjugated anti-mouse CD8, APC-conjugated anti-mouse Gr1, and PE-conjugated anti-mouse CD11c. After the staining was done for 30 minutes, the cells were washed with MACS buffer, followed by centrifugation, and then the cells were resuspended in 500 μl of MACS buffer for FACS analysis.

(59) Reverse Transcriptase-PCR and Real-Time Quantitative PCR for Mouse Skin Gene Expression Analysis

(60) Total RNA was isolated from mouse back skin using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 ug of total RNA using a reverse transcription system (Qiagen, Hilden, Germany). Primer sets of IL-1α (QT00113505), IL-1β (QT00021385), IL-4 (QT00160678), IL-6 (QT00182896), IL-10 (QT00106169), IL-17 (QT00103278), IL-20 (QT00126735), IL-22 (QT00128324), IL-23 (QT01663613), IFNγ (QT00000525), TNF-α (QT01079561), TGF-(QT00025718), CXCL-1 (QT00199752), CCL20 (QT00261898), and GAPDH (QT02448075) were purchased from Qiagen (The serial number in parentheses is the Qiagen catalog number). Primer sequences for determining the expression levels of Foxp3, T-bet, GATA3, RORγt, and SOD3 are as follows: Foxp3 forward GCAACAGCACTGGAACCTTC(SEQ ID NO: 5), Foxp3 reverse GCATTGCTTGAGGCTGCGTA(SEQ ID NO: 6); T-bet forward AGCCAGCCAAACAGAGAAGA(SEQ ID NO: 7), T-bet reverse AATGTGCACCCTTCAAACCC(SEQ ID NO: 8); GATA3 forward ACATGTCATCCCTGAGCCAC(SEQ ID NO: 9), GATA3 reverse AGGAACTCTTCGCACACTTG(SEQ ID NO: 10); RORγt forward GCCTACAATGCCACCACC(SEQ ID NO: 11), RORγt reverse ATT GAT GAG AAC CAG GGC(SEQ ID NO: 12); SOD3 forward TGTTGGAGCAGAGGAGAAGCTCAAC(SEQ ID NO: 13); and SOD3 reverse AAGCTCTCTTGGAGCAGCTGGAAA(SEQ ID NO: 14). GAPDH mRNA was used as an endogenous control. PCR was performed using Rotor-Gene 6000 (Corbett) and QuantiTect SYBR Green PCR Kit(Qiagen). The amplification program consisted of 1 cycle at 95 □ for 10□min, followed by 35 cycles of at 95□ for 20 □seconds, 55□ for 20□seconds, and 72□ for 20□ seconds.

(61) Western Blot for Mouse Skin Protein Expression Analysis

(62) Total protein was extracted using mice back skin. Equal amount of proteins were loaded per lane, followed by electrophoresis, and the proteins are blotted on membranes. Target proteins were incubated with primary antibodies specific for target molecules and detected using enhanced chemiluminescence system (GE health care Life Sciences).

(63) Statistical Analysis

(64) Data was expressed as means±SD, and statistical significance was assessed by student t-test or ANOVA for independent groups. Statistically significant differences are indicated by *, $, #in the drawings.

(65) All the experiments were repeated three times unless otherwise stated.

Example 1

(66) Production of Mesenchymal Stem Cells (MSCs) Overexpressing SOD3 and Verification of Efficacy Thereof

(67) <1-1> Confirmation of SOD3 Overexpression in SOD3-Transfected MSCs

(68) SOD3 protein expression patterns and SOD3 activity of human SOD3 gene-transfected mesenchymal stem cells (MSCs) were investigated.

(69) MSCs were transfected with human SOD3 gene using electrophoresis and harvested after 24 hours, and the protein expression levels were investigated by performing RT-PCR and western blot. The SOD3 activity was determined by measuring the amount of superoxide radicals present in the cell culture solution cultured for 24 hours.

(70) As shown in FIG. 1, it can be seen that SDO3 mRNA (FIG. 1A) and SOD3 protein (FIG. 1B) were overexpressed in SOD3-transfected MSCs (SOD3-MSC) compared with untransfected MSCs (MSC). In addition, with respect to SOD3 activity, SOD3-MSCs showed remarkably higher SOD3 activity than MSCs (FIG. 1C). It was verified that SOD3-transfected MSCs overexpressed SOD3 and had high SOD3 activity.

(71) <1-2> Reduction of Reactive Oxygen Species in SOD3-Transfected MSCs

(72) The amount of reactive oxygen species (ROS) generated due to TNF-α/IFN-γ stimulations in SOD3-transfected MSCs was investigated.

(73) MSCs were transfected with human SOD3 gene using electrophoresis, and stimulated with TNF-α (10 ng/ml) and IFN-γ (100 U/ml) for 1 hour. The generated ROS were fluorescence-stained with H2DCF-DA and measured using a fluorescence spectrophotometer.

(74) As shown in FIG. 2, ROS were generated in large amounts due to TNF-α/IFN-γ stimulations to show strong fluorescence intensity in untransfected MSCs, but the amount of ROS was not greatly changed even after the stimulations with TNF-α/IFN-γ in SOD3-MSCs compared with a control treated with PBS, and a fluorescence reduction tendency was rather observed. That is, it was verified that the reactive oxygen species generation ability was greatly suppressed in SOD3-MSCs compared with untransfected MSCs.

(75) <1-3> Effect of SOD3 Transfection on Cell Proliferation of MSCs

(76) The effect of SOD3 transfection on the proliferation of MSCs was investigated using MTT assay.

(77) As shown in FIG. 3, compared with the untransfected MSCs, SOD3-MSCs showed an improvement in cell proliferation (FIG. 3A) and a remarkable increase in the number of cells (FIG. 3B) up to 72 hours from 24 hours after the transfection. The above results indicate that SOD3-induced transfection promotes the cell proliferation of MSCs. The increased cell proliferation activity of SODS-transfected MSCs suggests the possibility that SOD3-transfected MSCs have higher therapeutic efficiency when developed into cell therapeutic agents for inflammatory diseases.

(78) <1-4> Inhibitory Effect of SODS-Transfected MSCs on Expression of Inflammation-Related Cytokines

(79) The effect of SOD3-transfected MSCs on the expression levels of cytokines, which are important mediators in inflammatory responses, was investigated.

(80) SOD3-MSCs resulted from the transfection by electrophoresis or MSCs were stimulated with TNF-α and IFN-γ for 12 hours while co-cultured with the human keratinocytes HaCaT cells, and then HaCaT cells were harvested. The levels of various inflammatory cytokines expressed by HaCaT cells are measured by qRT-PCT.

(81) As shown in FIG. 4, the mRNA expression levels of IL-1α, TNF-α, and CCL-20 cytokines were greatly increased by TNF-α and IFN-γ stimulations in HaCaT cells co-cultured with MSCs (MSC) and the expression levels of the above cytokines were effectively suppressed in HaCaT cells co-cultured with SOD3-transfected MSCs overexpressing SODS (SODS-MSCs). As for CXCL-1, the expression level was hardly changed due to TNF-α and IFN-γ stimulations in HaCaT cells co-cultured with untransfected MSCs (MSC), but the expression level was further reduced in HaCaT cells co-cultured with SOD3-MSCs (SOD-MSC). As for TGF-which is both an anti-inflammatory cytokine and a Treg marker, HaCaT cells co-cultured with SOD3-MSCs (SOD-MSC) showed a higher expression level than HaCaT cells co-cultured with untransfected MSCs (MSC) in the absence of TNF-α and IFN-γ stimulations, and the increase width was observed to be further enlarged due to TNF-α and IFN-γ treatments.

(82) The above results indicate that MSCs overexpressing and secreting SOD3, compared with MSCs not-overexpressing SOD3, inhibited the expressions of inflammatory cytokines induced by TNF-α and IFN-γ more effectively and improved the expressions of anti-inflammatory cytokines greatly in co-cultured neighboring HaCaT cells, thereby regulating inflammatory responses multi-directionally and effectively.

(83) <1-5> Analysis of Immunosuppression-Related Molecule Expressions in SOD3-Transfected MSCs

(84) The expression patterns of immunosuppression-related materials expressed in SOD3-transduced MSCs were analyzed.

(85) MSCs were incubated and transfected with AdLacZ or AdSOD3 adenovirus, and the intracellular mRNA expression levels of intracellular IL-1Ra (icIL-1Ra), soluble IL-1Ra (sIL-1Ra), unspliced IL-1Ra, HO-1, IDO-1, TGF-β, aalectin-1, and IL-10 were measured using RT-PCR in the presence or absence of TNF-α (10 ng/ml) and IFN-γ (100 U/ml) (A to FIGS. 5A and 5C). The relative expression level of icIL-1Ra was analyzed by real-time PCR (FIG. 5B), and GAPDHA was used as a control. In addition, supernatants in which MSCs were cultured were obtained, and the PGE2 concentration was determined using PGE2 ELISA kit (Enzo Life Sciences, NY, USA).

(86) As shown in FIG. 5A to 5C, the expression levels of various genes having immunosuppressive functions, such as icIL-1Ra, TGF-β, IL-10, HO-1, and IDO-1, were significantly increased in MSCs transfected to overexpress SOD3 (SOD3-MSC) compared with untransfected MSCs (MSC) or LacZ-transfected MSCs (LacZ-MSC) as a control. Interestingly, the expressions of IDO-1 and IL-10 were increased in MSCs stimulated with TNF-α and IFN-γ, but the expressions of these genes were further increased in SOD3-MSCs. However, it was observed that the overexpression of SOD3 did not greatly affect the amount of PGE2 secreted (FIG. 5D) or the expression level of galactin-1.

(87) It has been reported that the number of graft-infiltrating leukocytes was sharply reduced in transplant patients administered with IL-1Ra (Shiraishi M et al., J Surg Res., 58(5): 465-470, 1995). It can be therefore expected that the expression of IL-1Ra is greatly increased in MSCs overexpressing SOD3, through which the inflammation responses and transplant rejection can be effectively suppressed in transplant patients.

(88) Meanwhile, TGF-β and HO-1 are involved to promote the production of IL-10 and the formation of immunosuppressive Treg cells but inhibit pro-inflammatory cytokines in vitro and in vivo. HO-1 was confirmed to inhibit Th17 responses and exhibit anti-inflammatory activity by inhibiting p-STAT3-RORγt pathway to regulate the kinetics of RORγt and Foxp3 expressions, so that HO-1 is a novel therapeutic target for asthma, psoriasis, atopic dermatitis, and the like. In addition, human MSCs has been known to be able to induce the expression of indoleamine-2,3-dioxygenase-1 (IDO-1), and IDO-1 has been received as a key regulator of autoimmune diseases, such as acute graft-versus-host disease (GVHD), by inhibiting T cell proliferation and inducing apoptosis of immune cells to induce immunosuppression. Therefore, as verified in the above examples, the induction of activation of the catabolic pathway of tryptophan, such as HO-1 or IDO-1 by the overexpression of SOD3 in MSCs can be a potent therapeutic target for a number of autoimmune diseases.

(89) <1-6> Effect of SOD3-Transfected MSCs on T Cell Proliferation

(90) The effect of SOD3-transfected MSCs on the inhibition of T cell differentiation and proliferation was investigated.

(91) The CFSE based-mixed lymphocyte reaction (MLR) experiment was performed while T cells isolated from different species of mice (C67BL/6 and BalB/C) were co-cultured without MSCs, or with untreated MSCs, LacZ-transfected MSCs, or SOD3-transfected MSCs according to the experiment condition, and then flow cytometry was subjected to CD4.sup.+ or CD8.sup.+ cells (FIG. 6) and the flow cytometry assay results were quantified (FIG. 7). As shown in FIG. 7, the proliferation of CD4.sup.+ T cells and CD8.sup.+ T cells was suppressed in the co-culture with untreated MSCs (MSC) or LacZ-transfected MSCs (LACZ-MSC) compared with the co-culture without MSCs (No MSCs), and the proliferation of T cells was further suppressed in the co-culture with SOD3-transfected MSCs (SOD3-MSC). Meanwhile, SOD3-MSCs treated with the SOD3 inhibitor DETCA (SOD3-MSC+DETCA) showed a T cell proliferation inhibitory effect at similar levels to untreated MSCs (MSC). That is, it can be seen that the T cell proliferation inhibitory effect of SOD3-transfected MSCs is further enhanced due to the activity of overexpressed SOD3 than that of untransfected MSCs.

(92) <1-7> Effect of SOD3-Transfected MSCs on T Cell Differentiation

(93) The effect of SOD3-transfected MSCs on T cell differentiation was investigated.

(94) Naïve T cells were co-cultured with untreated MSCs (MSC), LacZ-MSCs, or SOD3-MSCs according to the experimental conditions in each differentiation condition of Th1, Th2, Th17, or Treg cells, and the expression levels of differentiation-related major transcription factors expressed by differentiated T cells were measured by real-time qRT-PCR.

(95) As shown in FIG. 8, the expression patterns of lineage-specific transcription factors and cytokines IFNγ, T-bet, IL-4, GATA3, IL-17, RORγt, and CCL20 of T cells cultured in Th1, Th2, and Th17 differentiation conditions were determined by mRNA measurement, and as a result, it was verified that the expressions of the above genes were reduced in T cells co-cultured with untreated MSCs (MSC) or LacZ-MSCs (LACZ-MSC) compared with a control co-cultured without MSCs ((+) in FIG. 7), and the expressions of the transcription factors and cytokines were further remarkably reduced in the cells co-cultured with SOD3-MSCs. The gene expression inhibitory effect by SOD3-MSCs was more potent for Th17 cell-specific genes IL-17, RORγt, and CCL-20. Meanwhile, the co-culture with SOD3-MSCs added with the SOD3 inhibitor DETCA (SOD3-MSC+DETCA) showed the gene expression inhibitory effects at similar levels to the co-culture with MSCs or LacZ-MSCs, and these results indicate that the synergistic effect of SOD3-MSCs on the inhibition of gene expression is induced by SOD3 activity.

(96) As shown in FIG. 9, the expression patterns of lineage-specific transcription factors and cytokines Foxp3, TGF-β, and IL-10 of T cells cultured in Treg differentiation conditions were determined by mRNA measurement, and as a result, it was verified that the expressions of the above genes were increased in T cells co-cultured with untreated MSCs (MSC) or LacZ-MSC(LACZ-MSC) compared with a control co-cultured without MSCs (+) in FIG. 9), and the expressions of the transcription factors and cytokines were further remarkably increased in the cells co-cultured with SOD3-MSCs. Especially, the increase effect of SOD3-MSCs on FOXP3 expression could be verified at the cellular level by flow cytometry (lower part in FIG. 9). Meanwhile, the co-culture with SOD3-MSCs added with the SOD3 inhibitor DETCA (SOD3-MSC+DETCA) showed the gene expression inhibitory effects at similar levels to the co-culture with MSCs or LacZ-MSCs, and these results indicate that the synergistic effect of SOD3-MSCs on the increase of Treg-related gene expression is induced by SOD3 activity.

(97) These results indicate that SON transfection remarkably increases the original T cell differentiation regulatory effect of MSCs, and especially suggest the possibility that SOD3 transfection can suppress inflammation more effectively by lowering the differentiation of Th17 cells acting as pathogenic cells and inducing the differentiation of Treg cells having an inflammation-modulating effect in inflammatory diseases.

Example 2

(98) Imiquimod-Induced Chronic and Aggressive Dermatitis Biological Models

(99) <2-1> Skin Inflammation Inhibitory Effect of SOD3-Transfected MSCs

(100) It was investigated whether SOD3-transfected MSCs has an inflammation-modulating effect in the body, on the basis of the regulatory effect of MSCs overexpressing SOD3 on T cell proliferation and differentiation, observed in <Example 1>.

(101) The imiquimod (IMQ), which is known to induce psoriasis-like acute and aggressive dermatitis by activating signaling of the innate immune system, was applied to the shaved back skin in mice every day to induce skin inflammation responses. According to the experimental setup in FIG. 10, each group of mice (five mice per group) were subcutaneously injected with untreated MSCs, LacZ-transfected MSCs, SOD3-transfected MSCs at 2×10.sup.6 cells before IMQ application, and then IMQ was consecutively applied to the shaved back of the mice for 12 days, to conduct comparative observation of inflammation responses occurring the skin. For quantitative analysis of skin inflammation symptoms, the back skin tissue of the mice was collected, the tissue samples were stained with H&E, and the epidermal thickness was measured.

(102) As shown in FIG. 11, compared with a control without IMQ application, the mice with the IMQ application without subcutaneous injection of MSCs started to display signs of erythema, scaling, and thickening, which can be confirmed by the naked eye, accompanied by inflammation symptoms, after 2-3 days. Such symptoms were clearly observed 6 days after the start of the experiment (Day 6), and continued until 12 days after the start of the experiment (Day 12). The mice injected with untreated MSCs (MSC) or LacZ-transfected MSCs (LACZ-MSC) showed a tendency to alleviate IMQ-induced skin symptoms. Meanwhile, the symptoms, such as erythema and scaling, were observed to be apparently reduced to the naked eye in the mice injected with SOD3-transfected MSCs (SOD3-MSC) compared with the mice injected with MSCs or LACZ-MSCs.

(103) As shown in FIGS. 12 and 13, the dermal thickness, which was measured from the skin tissue sections of control mice and each group of mice, also showed similar results compared with the skin inflammation conditions observed to the naked eye. IMQ application without MSC injection remarkably increased the epidermal thickness compared with the control, and the injection of MSCs or LacZ-MSCs reduced the IMQ-induced dermal thickness. Meanwhile, the mice injected with SOD3-MSCs showed little increase in the dermal thickness after IMQ application, which corresponded similar levels compared with the control without IMQ application. The epidermal thickness was significantly thin in the mice injected with SOD3-MSCs compared with the mice injected with MSCs or LacZ-MSCs.

(104) These results indicate that MSCs, which overexpress SOD3 by SOD3 transfection, had a significant effect in the alleviation of skin inflammation compared with general MSCs.

(105) <2-2> Inhibitory Effect of SOD3-Transfected MSCs on Infiltration of Neutrophils and Dendritic Cells

(106) The composition and recruitment of immune cells in spleens and skin of mice with IMQ-induced dermatitis were investigated.

(107) CD4.sup.+ T cells, CD8.sup.+ T cells, neutrophils (Gr1.sup.+ cells), and dendritic cells (CD11c.sup.+ cells), which constitute the spleens of the mice injected with respective types of MSCs according to the experimental conditions, were examined by flow cytometry (FIG. 14), and the back skin tissue sections of the mice with IMQ application were stained with different kinds of immune cell markers and the number of cells was measured (FIGS. 15 and 16).

(108) As shown in FIG. 14, CD4.sup.+ T cells and CD8.sup.+ T cells were reduced in the spleens of the mice treated with IMQ compared with the control mice not treated with IMQ, and CD4.sup.+ T cells and CD8.sup.+ T cells were slightly increased in the mice injected with MSCs. On the contrary, the numbers of neutrophils (Gr1.sup.+ cells) and dendritic cells (CD11c.sup.+ cells) in the spleens were increased due to IMQ treatment, and the number of neutrophils and dendritic cells were reduced due to SODS-MSC treatment.

(109) As shown in FIGS. 15 and 16, CD3.sup.+ T cells, CD8.sup.+ T cells (data not shown), neutrophils (Gr1.sup.+), and dendritic cells (CD11c.sup.+) were all remarkably increased in the skin due to IMQ treatment, and the infiltration of immune cells induced by IMQ was reduced in the mice treated with MSCs or LacZ-MSCs. The filtration was further suppressed in the mice treated with SOD3-MSCs than the mice treated with the other types of MCSs, and thus T cells, neutrophils, and dendritic cells in the skin tissues were observed to be all remarkably reduced.

(110) <2-3> Inhibitory Effect of SOD3-Transfected MSCs on Expression of Inflammation Response Mediators

(111) The expression patterns of cytokines in the back skin of the mice with skin inflammations induced by IMQ were measured by qRT-PCR.

(112) As shown in FIG. 17, the RNA levels of various inflammatory cytokines were significantly increased due to IMQ application, and the expression levels of these cytokines had a slight reduction tendency in the mice injected with MSCs or LacZ-MSCs. The inhibitory effect on the expressions of these inflammatory cytokines was observed to be the greatest in the mice injected with SOD3-MSCs compared with the mice injected with the other types of MSCs. Specifically, the expression levels of IL-17 and IL-22, expressed in Th17 cells, and IL-23, IL-1β, IL-6, and TNF-α as major inflammatory mediator cytokines, were observed to be remarkably reduced by SOD3-MSCs.

(113) The expression level of IL-10, which is an anti-inflammatory cytokine and is associated with the inflammation modulation of Treg, was slightly increased due to MSC treatment unlike the other inflammatory cytokines, and the IL-10 increase effect was observed to be excellent in SOD3-MSCs.

(114) The above results indicate that the inflammation-modulating action of MSCs was increased more effectively due to SOD3 introduction, suggesting that the symptoms of inflammation diseases can be alleviated by complexly regulating the expressions and actions of various cytokines.

(115) <2-4> Effect of SOD3-Transfected MSCs on Inflammation-Related Signaling

(116) IMQ has been known to activate TLR-7 and/or TLR-8 and exhibit biological effects through subordinate NFkB signaling systems. Therefore, the effect of the treatment with MSCs, including MSCs overexpressing or not-overexpressing SOD3, on signaling by TLR-7/TRL-8 was investigated by western blot experiments using IMQ-applied skin.

(117) As shown in FIG. 18, TLR-7 and phosphorylated NFkB (p-NFkB) were activated and the expression levels thereof were also increased in the back skin of the IMQ-applied mice (FIG. 18A). The signaling of TLR-7 activated by IMQ showed a reduction tendency due to the treatment with MSCs or LacZ-MSCs, and was further reduced by SOD3-MSCs. Similar results were also observed in STAT1/3 and JAK1. However, SOD3-MSCs showed a significant inhibitory effect on, especially, NF-kB signaling systems.

(118) <2-5> cAMP Concentration Increase in Blood Plasma and Cells

(119) Inflammation is triggered when T-helper cells stimulated by antigens infiltrating into the body proliferate to secrete inflammation-inducing substances. The proliferation of T-helper cells occurs by a changed ratio of cAMP to cGMP, which are two substances responsible for cell division. The high cGMP concentration results in faster cell division, and the high cAMP concentration results in slow cell division. The imbalance of such a ratio increases the likelihood of suffering from inflammatory diseases. For example, the cGMP concentration in cells or blood plasma is high in many psoriasis patients. Therefore, the cAMP concentration in the blood plasma of the mice treated with the respective types of MSCs according to the experimental conditions was measured by ELISA.

(120) As shown in FIG. 19, the cAMP level in the blood plasma of the mice injected with MSCs or LacZ-MSCs was increased compared with a control group, and especially, the cAMP level in the blood plasma of the mice injected with SODS-MSCs was observed to be the highest. Such a tendency was more apparent on day 6 of IMQ application. These results mean that SOD3-MSCs have a protective function from cellular stress.

Example 3

(121) Atopic-Like Dermatitis Biological Model Induced by Ovalbumin

(122) The in vivo inflammation regulatory effect of MSCs overexpressing SODS was investigated using other animal models. Atopic-like dermatitis was induced in Balb/C mice using ovalbumin (OVA) as an antigen, and the inflammation inhibitory effects by MSCs were compared and observed.

(123) According to the experimental setup shown in FIG. 20, a mixture of OVA protein and aluminum hydroxide as an antigen adjuvant was intraperitoneally injected into mice grown in SPF conditions at the start of the experiment (D0), day 7 (D7), and day 14 (D14), so that the animals were sensitized. From day 21 after the start of the experiment, a patch was prepared by wetting 1×1 cm.sup.2 gauze in 100 μg of OVA dissolved in 100 μl of PBS, and then attached to the shaved back of the mice to induce immune responses for 7 days. The immune responses were again induced by OVA patch in the same manner for one week starting from day 35. MSCs, LacZ-MSCs, and SOD3-MSCs were injected into the lesion site on day 42 after the start of the experiment (five mice per group) according to the experimental conditions, and skin changes were observed to the naked eye on day 49.

(124) As shown in FIG. 21, skin inflammation including rough skin, scaling, and reddish swelling was progressed on the back skin of the mice treated with only OVA (OVA) without MSC injection compared with a control. The skin inflammation was somewhat alleviated in the mice injected with untreated MSCs (OVA+MSC) or the mice injected with LacZ-MSCs (OVA+LACZ-MSC) compared with the mice treated with only OVA. The skin condition in the mice injected with SOD3-MSCs (OVA+SOD3-MSC) was improved to be similar to that in the control, as scaling and inflammation responses almost disappeared, and especially, an apparent inflammation alleviating effect was confirmed in the mice injected with SOD3-MSCs (OVA SOD3-MSC) compared with the mice injected with the other types of MSCs. The above results indicate that MSCs overexpressing SOD3 have an excellent effect in the alleviation of skin inflammation compared with general MSCs.

INDUSTRIAL APPLICABILITY

(125) The mesenchymal stem cells overexpressing SOD3 have more potent antioxidative activity, immunoregulatory functions, and cellular immunoregulatory functions than general mesenchymal stem cells. The mesenchymal stem cells overexpressing SOD3 can be favorably used in the development of more effective stem cell therapeutics for inflammatory diseases, autoimmune diseases, or transplant rejections.