Use of genomic NW_006882077.1 in CHO cell for stably expressing a protein

Abstract

Use of genomic NW_006882077.1 in CHO cell for stably expressing a protein is disclosed. The certain site in CHO cell genome for stably expressing a protein is positioned at a base of No. 691045 in a CHO cell gene NW_006882077.1; a sequence of 5′ NNNNNNNNNNNNNNNNNNNNNGG3′ that can be identified by CRISPR/Cas9 technology and positioned in a base range of No. 690980-691090 around the certain site is a target sequence. Various of protein genes are introduced into a fixed site in CHO cell genome, and expressed stably in the present disclosure.

Claims

1. A method for stably expressing a protein at a predetermined site in a Chinese Hamster Ovary (CHO) cell genome, wherein the predetermined site in the CHO cell genome for stably expressing the protein is positioned at base of No. 691045 in a CHO cell gene comprising the nucleotide sequence of SEQ ID NO: 11; the method comprises: identifying the sequence of SEQ ID NO: 10 in a base range of No. 690980-691090 in the CHO cell gene comprising the nucleotide sequence of SEQ ID NO: 11, around the predetermined site by CRISPR/Cas9 technology and position as a target sequence; transforming the CHO cell with a recombinant donor carrier to obtain a recombine CHO cell; culturing the recombinant CHO cell, and collecting a supernatant to detect the expression level of the protein, and adapting an adherent recombinant CHO cell to a suspension culture; and culturing the adapted recombinant CHO cell to express the protein.

2. The method according to claim 1, wherein the protein is one having a molecular weight of less than 160 KDa.

3. The method according to claim 1, wherein the protein is one selected from the group consisting of a polypeptide, a functional protein, an antibody, and a fusion protein.

4. The method according to claim 1, wherein the target sequence includes the bases positioned at No. 691068-691090 around the base of No. 691045 in the CHO cell gene comprising the nucleotide sequence of SEQ ID NO: 11, and the target sequence is the nucleotide sequence of SEQ ID NO: 1.

5. The method according to claim 1, wherein the target sequence is the nucleotide sequence of SEQ ID NO:2.

6. The method according to claim 1, wherein the target sequence is the nucleotide sequence of SEQ ID NO:3.

7. The method according to claim 1, wherein the target sequence is the nucleotide sequence of SEQ ID NO:4.

8. The method according to claim 1, wherein the target sequence is the nucleotide sequence of SEQ ID NO:5.

9. The method according to claim 1, wherein the target sequence is the nucleotide sequence of SEQ ID NO:6.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The FIGURE shows a schematic diagram of the present disclosure.

DETAILED DESCRIPTION

(2) The present disclosure is described in detail below with reference to the drawings and embodiments.

(3) The FIGURE is a schematic diagram of a donor plasmid for integration to the site and a simulated schematic diagram of how to integrate to the site by homologous recombination. GOI as a target gene is integrated to a target site via two homologous recombination arms of 5′arm and 3′ arm under a puromycin screening concentration of 4 μg/mL. In addition, the sequence upstream of 5′arm as a negative mark of screening can be used to remove monoclonal cells that are randomly integrated, such that recombinant CHO cells that are integrated at a specific site can be finally recovered.

Example 1

(4) Selection of High Expression Site

(5) Zsgreen1 gene was integrated at the base of No. 691045 in NW_006882077.1 gene of a cell. The obtained fluorescence cell was cultured for no less than 50 passages. The expression level was detected with a flow cytometry. The 50th generation of fluorescent cells still had a good green fluorescent protein expression level. The fluorescent signal was stably retained during the passage of the cells.

(6) In addition, this fluorescent cell was also adapted to suspension, and the expression level of the fluorescent protein after adaption was detected again with a flow cytometry. The results show that among the recombinant CHO cells that are suspended over 50 passages, more than 95% maintains the expression level of the green fluorescent protein after suspension. It can be seen that the site is very stable and the fluorescent protein gene will not be lost due to passage of the cells.

Example 2

(7) Selection of a Specific Target Sequence

(8) According to proximity principle, the sequence of 5′CCAATGCTATTACCTTCTTCAGCATCTGTTCTTGAAGACCTTCAGTCACTTTAGTTAA CTCTTCCACTTTCGTTACTG-CAACTCTCAGATCTAACTTGGCTTG 3′, as shown in SEQ ID NO:7, was input into CRISRPRater System, and a target sequence with low off-target rate was predict and select. The parameter settings are as follows: 1) the maximum number of mismatched bases of the first 15 base pairs (bps) after NGG is 0; 2) the number of mismatched bases of all 21 bps after NGG is 2.

(9) According to the above operation, the following sequence with a score of 0.87 is selected as the target sequence:

(10) 5′-GATCTAACTTGGCTTGCCTGAGG-3′, as shown by SEQ ID NO:1; and

(11) according to the CRISPRater System, LOW efficacy (score<0.56); MEDIUM efficacy (0.56⇐score⇐0.74); and HIGH efficacy (score>0.74).

(12) According to the CRISPRater System, all target sequences in the range of 690980-691090 near NW_006882077.1 have scores above 0.56, all of which are in the range of moderate or highly effective, and can be used as 5′ GG3′, as shown by SEQ ID NO:10 target sequence that can be identified by CRISPR/Cas9 technology.

Example 3 Selection of Promoters

(13) The promoter of CMV (a strong promoter for expression in a mammalian cell derived from human cytomegalovirus) is replaced with various promoters including common promoters such as EF-1a (a strong promoter for expression in a mammalian cell derived from human elongation factor 1a), SV40 (a promoter for expression in a mammalian cell derived from simian vacuole virus 40), PGK1 (a promoter for expression in a mammalian cell derived from phosphoglycerate kinase gene), UBC (a promoter for expression in a mammalian cell derived from human ubiquitin C gene), human beta actin (a promoter for expression in a mammalian cell derived from β-actin gene), and CAG (a strong hybrid promoter for expression in a mammalian cell). It is determined by testing that the above promoters can regulate the downstream red fluorescence proteingene sequence and express the corresponding red fluorescence protein.

Example 4

(14) The red fluorescence protein (DsRed, 26 KDa) is integrated at a specific site. For homologous recombination mediated by CRISPR/Cas9 later, sgRNA and donor plasmid were required to be constructed as follows.

(15) 1. First, the following sequence was synthesized for construction of SgRNA:

(16) sgRNA-1fwd 5′ TTTGGATCTAACTTGGCTTGCCTGGT 3′, as shown in SEQ ID NO:8; and

(17) sgRNA-1rev 5′ TAAAACCAGGCAAGCCAAGTTAGATC 3′ as shown in SEQ ID NO:9.

(18) 1) The plasmid of PSK-u6-gRNA was digested with BBsI enzyme, and the resulted carriers were recovered;

(19) 2) synthetic fragments were annealed into double strands with sticky ends:

(20) TABLE-US-00001 sgRNA-1fwd (100 μM)  4 μL sgRNA-1rev (100 μM)  4 μL 10 × NEB buffer2  2 μL H.sub.2O 10 μL 20 μL

(21) by treated in a water bath at 95° C. for 5 min, and then naturally cooled to room temperature;

(22) 3) the fragments were joint and recombinant plasmids were constructed

(23) TABLE-US-00002 recycled linear carriers 50 ng annealed segments  1 μL 10 × T4 ligase buffer  1 μL T4 ligase  1 μL H.sub.2O to 10 μL ;

(24) 4) joining at room temperature for more than 1 h, or at 4° C. overnight and conversion; and

(25) 5) cloning cells were selected and subjected to PCR identification, and the primer used for identification is M13—Synthetic primer R; those showing bands were identified as positive clones.

(26) 2. Construction of donor plasmid

(27) The donor plasmid is described in the FIGURE in details: segments expect for GOI were synthesized; the sequence of 600 bps upstream and downstream of the target sequence is the sequence information of the left and right homology arms of the donor plasmid. The GOI is obtained by integrating HSA onto the donor plasmid with the existing C115 kit from Vazyme Biotech.

(28) 3. Cas9 (donated by Dr. Helene F Kildegaard from Technical University of Denmark), SgRNA and donor plasmid with a molar ratio of 1:1:1 were co-transfected into CHO cells cultured at 37° C. with 5% CO.sub.2, and transfection reagent is Lipofectamine 3000 (Thermo Fisher Scientific). The method of transfection can be referred to instructions from the supplier. 4 μg/mL puromycin was then added into the resulted cells for screening for 10 days. MoFloXDP FACS machine (Beckman Coulter) was used to monoclonal cell sorting. Cells having red fluorescence but without green fluorescence are selected and inoculated into a 96-well plate.

(29) 4. After 2 weeks of growth, part of the cells was taken for identification with 5′ junction PCR, 3′Junction PCR and out-out PCR, and keep positive cells.

Example 5

(30) The glucagon-like peptide-1-human serum albumin fusion protein gene (NGGH, 75 KDa) was integrate at a specific site. In order to construct CRISPR/Cas9-mediated homologous recombination at a later stage, sgRNA and Donor Plasmid need to be constructed as below.

(31) 1. SgRNA was constructed as in example 4.

(32) 2. Construction of donor plasmid

(33) The donor plasmid is described in the FIGURE in details: segments expect for GOI were synthesized; the sequence of 600 bps upstream and downstream of the target sequence is the sequence information of the left and right homology arms of the donor plasmid. The GOI is obtained by integrating HSA onto the donor plasmid with the existing C115 kit from Vazyme Biotech.

(34) 3. Cas9 (donated by Dr. Helene F Kildegaard from Technical University of Denmark), SgRNA and donor plasmid with a molar ratio of 1:1:1 were co-transfected into CHO cells cultured at 37° C. with 5% CO.sub.2, and transfection reagent is Lipofectamine 3000 (Thermo Fisher Scientific). The method of transfection can be referred to instructions from the supplier. 4 μg/mL puromycin was then added into the resulted cells for screening for 10 days. MoFloXDP FACS machine (Beckman Coulter) was used to monoclonal cell sorting. Cells without any fluorescence are selected and inoculated into a 96-well plate.

(35) 4. After 2 weeks of growth, part of the cells was taken for identification with 5′ junction PCR, 3′Junction PCR and out-out PCR, and keep positive cells.

Example 6

(36) The antibody gene (Avastin, 160 KDa) was integrated at a specific site. In order to construct CRISPR/Cas9-mediated homologous recombination at a later stage, sgRNA and Donor Plasmid need to be constructed as below.

(37) 1. SgRNA was constructed as in example 4.

(38) 2. Construction of donor plasmid

(39) The donor plasmid is described in the FIGURE in details: segments expect for GOI were synthesized; the sequence of 600 bps upstream and downstream of the target sequence is the sequence information of the left and right homology arms of the donor plasmid. The GOI is obtained by integrating Avastin onto the donor plasmid with the existing C115 kit from Vazyme Biotech.

(40) 3. Cas9 (donated by Dr. Helene F Kildegaard from Technical University of Denmark), SgRNA and donor plasmid with a molar ratio of 1:1:1 were co-transfected into CHO cells cultured at 37° C. with 5% CO.sub.2, and transfection reagent is Lipofectamine 3000 (Thermo Fisher Scientific). The method of transfection can be referred to instructions from the supplier. 4 μg/mL puromycin was then added into the resulted cells for screening for 10 days. MoFloXDP FACS machine (Beckman Coulter) was used to monoclonal cell sorting. Cells without any fluorescence are selected and inoculated into a 96-well plate.

(41) 4. After 2 weeks of growth, part of the cells was taken for identification with 5′ junction PCR, 3′Junction PCR and out-out PCR, and keep positive cells.

Example 7

(42) The human serum albumin gene (HSA, 68 KDa) is integrated at a specific site. For homologous recombination mediated by CRISPR/Cas9 later, sgRNA and donor plasmid were required to be constructed as follows.

(43) 1. SgRNA was constructed as in example 4.

(44) 2. Construction of donor plasmid

(45) The donor plasmid is described in the FIGURE in details: segments expect for GOI were synthesized; the sequence of 600 bps upstream and downstream of the target sequence is the sequence information of the left and right homology arms of the donor plasmid. The GOI is obtained by integrating Avastin onto the donor plasmid with the existing C115 kit from Vazyme Biotech.

(46) 3. Cas9 (donated by Dr. Helene F Kildegaard from Technical University of Denmark), SgRNA and donor plasmid with a molar ratio of 1:1:1 were co-transfected into CHO cells cultured at 37° C. with 5% CO.sub.2, and transfection reagent is Lipofectamine 3000 (Thermo Fisher Scientific). The method of transfection can be referred to instructions from the supplier. 4 μg/mL puromycin was then added into the resulted cells for screening for 10 days. MoFloXDP FACS machine (Beckman Coulter) was used to monoclonal cell sorting. Cells without any fluorescence are selected and inoculated into a 96-well plate.

(47) 4. After 2 weeks of growth, part of the cells was taken for identification with 5′ junction PCR, 3′Junction PCR and out-out PCR, and keep positive cells.

TESTING EXAMPLES

(48) The four cell lines prepared in Examples 4-7 were tested by ELISA to observe whether the protein of interest was expressed and whether it was stable long-term expression.

(49) Detection method: all four tests were performed by ELISA method. All selected positive cells were cultured in a 6-well plate and tested for long-term stably expressing the target protein with kits of Human Albumin ELISA Kit (RK00157) and Human IgG(Total) ELISA Kit(RK00393).

(50) The cell line expression of the red fluorescence protein prepared in Example 4 was detected again with a flow cytometry, expression of red fluorescence was observed, and all the cells within 50 generations can stably express red fluorescent protein.

(51) Detection method: cells at different passages were collected and detected directly with a flow cytometry, expression of red fluorescence was observed, and it was detected that more than 95% of the recombinant CHO cells at different passages expressed red fluorescence protein.

(52) Good results were obtained for the above test in which the 5′-GATCTAACTTGGCTTGCCTGAGG-3′, as shown by SEQ ID NO. 1, sequence is selected. Therefore, it shows that the target sequences in claims 5-9 can successfully construct a stable expression cell line by site-specific integration, and the protein of interest can be stably expressed for all cell lines.