ANTISENSE-OLIGONUCLEOTIDES AS INHIBITORS OF TGF-R SIGNALING

20220143071 · 2022-05-12

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to antisense-oligonucleotides having a length of at least 10 nucleotides, wherein at least two of the nucleotides are LNAs, their use as inhibitors of TGF-R signaling, pharmaceutical compositions containing such antisense-oligonucleotides and the use for prophylaxis and treatment of neurological, neurodegenerative, fibrotic and hyperproliferative diseases.

    Claims

    1. Antisense-oligonucleotide consisting of 10 to 18 nucleotides and at least two of the 10 to 18 nucleotides are LNAs, wherein the antisense-oligonucleotide has a gapmer structure with 1 to 5 LNA units at the 3′ terminal end and 1 to 5 LNA units at the 5′ terminal end, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to said sequence CCCTAAACAC (Seq. ID No. 5) or sequence ACTACCAAAT (Seq. ID No. 6) or sequence GGACGCGTAT (Seq. ID No. 7) or sequence GTCTATGACG (Seq. ID No. 8) or sequence TTATTAATGC (Seq. ID No. 9) respectively or salts or optical isomers of said antisense-oligonucleotide, wherein the antisense-oligonucleotide inhibits expression of TGF-R.sub.II.

    2. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide hybridizes selectively only with the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9) of the region of the gene encoding the TGF-R.sub.II or of the region of the mRNA encoding the TGF-R.sub.II.

    3. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide has phosphate, phosphorothioate and/or phosphorodithioate as internucleotide linkages.

    4. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide is represented by the following sequence: TABLE-US-00184 (Seq. ID No. 12) 5′-N.sup.1-GTCATAGA-N.sup.2-3′ or (Seq. ID No. 98) 5′-N.sup.3-ACGCGTCC-N.sup.4-3′ or (Seq. ID No. 11) 5′-N.sup.5-TTTGGTAG-N.sup.6-3′ or (Seq. ID No. 101) 5′-N.sup.9-ATTAATAA-N.sup.10-3′ or (Seq. ID No. 10) 5′-N.sup.11-TGTTTAGG-N.sup.12-3′ wherein N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or CCGAGCCCCCAGCGCAGCGG; N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or T; N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sup.10 represents: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AG CTATTTG GTAG -, G CTATTTG GTAG -, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

    5. Antisense-oligonucleotide according to claim 1, wherein the last 2 to 4 nucleotides at the 5′ terminal end are LNA nucleotides and the last 2 to 4 nucleotides at the 3′ terminal end are LNA nucleotides and between the LNA nucleotides at the 5′ terminal end and the LNA nucleotides at the 3′ terminal end at least 6 consecutive nucleotides are present which are non-LNA nucleotides or which are DNA nucleotides.

    6. Antisense-oligonucleotide according to claim 1, wherein the LNA nucleotides are linked to each other through a phosphorothioate group or a phosphorodithioate group or wherein all nucleotides are linked to each other through a phosphate group or a phosphorothioate group or a phosphorodithioate group.

    7. Antisense-oligonucleotide according to claim 1, wherein the LNA nucleotides are selected from the group consisting of: ##STR00012## wherein IL′ represents —X″—P(═X′)(X″)—; X′ represents ═O or ═S; X.sup.− represents —O.sup.−, —OH, —OR.sup.H, —NHR.sup.H, —N(R.sup.H).sub.2, —OCH.sub.2CH.sub.2OR.sup.H, —OCH.sub.2CH.sub.2SR.sup.H, —BH.sub.3.sup.−, —R.sup.H, —SH, —SR.sup.H, or —S.sup.−; X″ represents —O—, —NH—, —NR.sup.H—, —CH.sub.2—, or —S—; Y is —O—, —NH—, —NR.sup.H—, —CH.sub.2— or —S—; R.sup.C and R.sup.H are independently of each other selected from hydrogen and C.sub.1-4-alkyl; and B represents a nucleobase selected from the group consisting of: adenine, thymine, guanine, cytosine, uracil, 5-methylcytosine, 5-hydroxymethyl cytosine, N.sup.4-methylcytosine, xanthine, hypoxanthine, 7-deazaxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 6-ethyladenine, 6-ethylguanine, 2-propyladenine, 2-propylguanine, 6-carboxyuracil, 5,6-dihydrouracil, 5-propynyl uracil, 5-propynyl cytosine, 6-aza uracil, 6-aza cytosine, 6-aza thymine, 5-uracil, 4-thiouracil, 8-fluoroadenine, 8-chloroadenine, 8-bromoadenine, 8-iodoadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-fluoroguanine, 8-chloroguanine, 8-bromoguanine, 8-iodoguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-trifluoromethyluracil, 5-fluorocytosine, 5-bromocytosine, 5-chlorocytosine, 5-iodocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 3-deazaguanine, 3-deazaadenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine.

    8. Antisense-oligonucleotide according to claim 1 having one of the following gapmer structures selected from the group consisting of: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, and 4-11-3.

    9. Antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide binds with 100% complementarity to the mRNA encoding TGF-R.sub.II and do not bind to any other region in the human transcriptome.

    10. A method for promoting regeneration and functional reconnection of damaged nerve pathways and/or for treatment and compensation of age induced decreases in neuronal stem cell renewal comprising administering to a patient an antisense-oligonucleotide according to claim 1.

    11. A method for prophylaxis and treatment of a disease selected from the group consisting of neurodegenerative diseases, neuroinflammatory disorders, traumatic or posttraumatic disorders, neurovascular disorders, hypoxic disorders, postinfectious central nervous system disorders, fibrotic diseases, hyperproliferative diseases, cancer, tumors, presbyakusis and presbyopia comprising administering to a patient an antisense-oligonucleotide according to claim 1.

    12. The method according to claim 11, wherein the neurodegenerative diseases and neuroinflammatory disorders are selected from the group consisting of: Alzheimer's disease, Parkinson's disease, Creutzfeldt Jakob disease, new variant of Creutzfeldt Jakobs disease, Hallervorden Spatz disease, Huntington's disease, multisystem atrophy, dementia, frontotemporal dementia, motor neuron disorders, amyotrophic lateral sclerosis, spinal muscular atrophy, spinocerebellar atrophies, schizophrenia, affective disorders, major depression, meningoencephalitis, bacterial meningoencephalitis, viral meningoencephalitis, CNS autoimmune disorders, multiple sclerosis, acute ischemic/hypoxic lesions, stroke, CNS and spinal cord trauma, head and spinal trauma, brain traumatic injuries, arteriosclerosis, atherosclerosis, microangiopathic dementia, Binswanger' disease, retinal degeneration, cochlear degeneration, macular degeneration, cochlear deafness, AIDS-related dementia, retinitis pigmentosa, fragile X-associated tremor/ataxia syndrome, progressive supranuclear palsy, striatonigral degeneration, olivopontocerebellear degeneration, Shy Drager syndrome, age dependant memory deficits, neurodevelopmental disorders associated with dementia, Down's Syndrome, synucleinopathies, superoxide dismutase mutations, trinucleotide repeat disorders, trauma, hypoxia, vascular diseases, vascular inflammations, and CNS-ageing and wherein the fibrotic diseases are selected from the group consisting of: pulmonary fibrosis, cystic fibrosis, hepatic cirrhosis, endomyocardial fibrosis, old myocardial infarction, atrial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis, nephrogenic systemic fibrosis, Crohn's Disease, keloid, systemic sclerosis, arthrofibrosis, Peyronie's disease, Dupuytren's contracture, and residuums after Lupus erythematodes.

    13. A pharmaceutical composition comprising at least one single-stranded antisense-oligonucleotide according to claim 1 together with at least one pharmaceutically acceptable carrier, excipient, adjuvant, solvent or diluent.

    Description

    DESCRIPTION OF FIGURES

    [0524] FIG. 1 shows the inhibitory effect of the antisense-oligonucleotides (ASO). The DNA is transcribed to the Pre-mRNA to which in the nucleus of the cell, the antisense-oligonucleotides (ASO) can bind or hybridize to the complementary sequence within an exon (as represented by the first ASO from the right side and the first ASO from the left side) or within an intron (as represented by the second ASO from the right side) or at allocation consisting of an area of an exon and an area of an adjacent intron (as represented by the second ASO from the left side). By post-transcriptional modification, i.e. the splicing, the mRNA is formed to which the ASO can bind or hybridize in the cytoplasma of the cell in order to inhibit translation of the mRNA into the protein sequence. Thus, the ASO knock down the target gene and the protein expression selectively.

    [0525] FIG. 2 shows a nucleoside unit (without internucleotide linkage) or nucleotide unit (with internucleotide linkage) which are non-LNA units and which may be contained in the antisense-oligonucleotides of the present invention especially in the region B in case the antisense-oligonucleotide of the present invention is a gapmer.

    [0526] FIG. 3 shows TGF-beta and its effects on neural stem cells, cancer stem cells, and tumors. TGFbeta inhibits neural stem cell proliferation. It may affect the transition to a cancer stem cell, which might escape from TGF-beta growth control. Later in tumor progression, TGF-beta acts as an oncogene; it further promotes tumor growth by promoting angiogenesis and suppressing the immune system. In addition, it promotes cellular migration, thereby driving cells into metastasis.

    [0527] FIG. 4 shows the antisense-oligonucleotide of Seq ID No 218b in form of a gapmer consisting of 16 nucleotides with 3 LNA units (C*b.sup.1 and Ab.sup.1 and Tb.sup.1) at the 5′ terminal end and 4 LNA units (Ab.sup.1 and Gb.sup.1 and Tb.sup.1 and Ab.sup.1) at the 3′ terminal end and 9 DNA nucleotides (dG, dA, dA, dT, dG, dG, dA, dC, and dC) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first LNA unit from the 5′ terminal end.

    TABLE-US-00053 Seq ID SP L No Sequence, 5′-3′ 4217 16 218b C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsd GsdGsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0528] FIG. 5: ASO (Seq. ID No. 218b) treatment leads to intracellular pSmad2 protein reduction. Labeling with an antibody against pSmad2 (left column, red) in A549 (FIG. 5A) and ReNcell CX® (FIG. 5B) cells after gymnotic transfer with ASO Seq. ID No. 218b for 72 h or 96 h respectively. Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b.

    [0529] FIG. 6: ASO (Seq. ID No. 218c) treatment leads to intracellular pSmad2 protein reduction. Labeling with an antibody against pSmad2 (left column, red) in A549 (FIG. 6A) and ReNcell CX® (FIG. 6B) cells after gymnotic transfer with ASO Seq. ID No. 218c for 72 h or 96 h respectively. Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and Corel DRAW®X7 Software. A=untreated control, B=Ref.1, D=Seq. ID No. 218c.

    [0530] FIG. 7: In presence of TGF-β1, ASO (Seq. ID No. 218b) treatment leads to downregulation of TGF-R.sub.II mRNA. Potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 7A) and ReNcell CX® (FIG. 7B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1, ±=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    [0531] FIG. 8: In presence of TGF-β1, ASO (Seq. ID No. 218c) treatment leads to downregulation of TGF-R.sub.II mRNA. Potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 8A) and ReNcell CX® (FIG. 8B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-β1, ±=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    [0532] FIG. 9 shows the antisense-oligonucleotide of Seq ID No 209y in form of a gapmer consisting of 16 nucleotides with 2 LNA units (Gb.sup.1 and Tb.sup.1) at the 5′ terminal end and 3 LNA units (Ab.sup.1 and Gb.sup.1 and C*b.sup.1) at the 3′ terminal end and 11 DNA nucleotides (dA, dG, dT, dG, dT, dT, dT, dA, dG, dG, and dG) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the last LNA unit from the 5′ terminal end.

    TABLE-US-00054 Seq ID SP L No Sequence, 5′-3′ 2064 16 209y Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsd TsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1sC*b.sup.1

    [0533] FIG. 10 shows the antisense-oligonucleotide of Seq ID No 210q in form of a gapmer consisting of 16 nucleotides with 4 LNA units (Gb.sup.1 and C*b.sup.1 and Tb.sup.1 and Ab.sup.1) at the 5′ terminal end and 3 LNA units (Gb.sup.1 and Tb.sup.1 and Tb.sup.1) at the 3′ terminal end and 9 DNA nucleotides (dT, dT, dT, dG, dG, dT, dA, dG, and dTs) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the second LNA unit from the 5′ terminal end.

    TABLE-US-00055 Seq ID SP L No Sequence, 5′-3′ 2072 16 210q Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsd GsdGsdTsdAsdGsdTsGb.sup.1sTb.sup.1sTb.sup.1

    [0534] FIG. 11: In presence of TGF-β1, ASO (Seq. ID No. 218b) treatment leads to downregulation of CTGF mRNA. Potent downregulation of CTGF mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 11A) and ReNcell CX® (FIG. 11B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1, ±=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    [0535] FIG. 12: In presence of TGF-β1, ASO (Seq. ID No. 218b) treatment leads to reduction of CTGF cellular protein. CTGF protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 12A) and ReNcell CX® (FIG. 12B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. Cells were labeled with an antibody against CTGF (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID. 218b, E=TGF-β1.

    [0536] FIG. 13: In presence of TGF-β1, ASO (Seq. ID No. 218b) treatment leads to intracellular pSmad2 protein reduction. pSmad2 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 13A) and ReNcell CX® (FIG. 13B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. Cells were labeled with an antibody against pSmad2 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID. 218b, E=TGF-β1.

    [0537] FIG. 14: In presence of TGF-β1, ASO (Seq. ID No. 218c) treatment leads to downregulation of CTGF mRNA. Potent downregulation of CTGF mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 14A) and ReNcell CX® (FIG. 14B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-β1, ±=SEM, *p<0.05, **p<0.01 in reference to A, Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons. Note different scales.

    [0538] FIG. 15: In presence of TGF-β1, ASO (Seq. ID No. 218c) treatment leads to reduction of CTGF cellular protein. CTGF protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 cells. ASOs were incubated for 72 h in presence of TGF-β1. Cells were labeled with an antibody against CTGF (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, D=Seq. ID. 218c, E=TGF-β1.

    [0539] FIG. 16: In presence of TGF-β1, ASO (Seq. ID No. 218c) treatment leads to intracellular pSmad2 protein reduction. pSmad2 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-β1 pre-incubated (48 h) A549 (FIG. 16A) and ReNcell CX® (FIG. 16B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-β1, respectively. Cells were labeled with an antibody against pSmad2 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, D=Seq. ID. 218c, E=TGF-β1.

    [0540] FIG. 17: ASO (Seq. ID No. 218b) pretreatment and subsequent TGF-β1 co-exposure leads to reduction of TGF-R.sub.II membrane protein. TGF-R.sub.II protein was reduced after gymnotic transfer of TGF-R.sub.II specific ASO followed by co-exposure of TGF-β1 (48 h) A549 (FIG. 17A) and ReNcell CX® (FIG. 17B) cells. ASOs were incubated for 72 h or 96 h, respectively, in advance to 48 h TGF-β1 co-exposure. Cells were labeled with an antibody against TGF-R.sub.II (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID. 218b, E=TGF-β1.

    [0541] FIG. 18: ASO (Seq. ID No. 218b) pretreatment and subsequent TGF-β1 co-exposure leads to intracellular pSmad3 protein reduction. pSmad3 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO followed by co-exposure of TGF-β1 (48 h) A549 (FIG. 18A) and ReNcell CX® (FIG. 18B) cells. ASOs were incubated for 72 h or 96 h, respectively, in advance to 48 h TGF-β1 co-exposure. Cells were labeled with an antibody against pSmad3 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID. 218b, E=TGFβ1.

    [0542] FIG. 19: ASO (Seq. ID No. 218b) enhances and TGF-β1 reduces neurogenesis in human neural precursor ReNcell CX® cells. Neurogenesis marker DCX mRNA is upregulated in ReNcell CX® cells after repeated gymnotic transfer (2×96 h) of inventive ASOs. A strong reduction of DCX mRNA expression was recognized after an 8-day TGF-β1 exposure. mRNA levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post-hoc comparison. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1, ±=SEM, +p<0.05 in reference to C 2.5 μM, #p<0.05 in reference to C 10 μM.

    [0543] FIG. 20: ASO (Seq. ID No. 218b) enhances and TGF-β1 reduces proliferation in human neural precursor ReNcell CX® cells. Proliferation marker Ki67 protein expression is increased in ReNcell CX® cells after repeated gymnotic transfer (2×96 h) of inventive ASOs. Reduced Ki67 protein expression was recognized after an 8-day TGF-β1 exposure. Cells were labeled with an antibody against Ki67 (left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1.

    [0544] FIG. 21: Despite proliferative conditions ASO (Seq. ID No. 218b) enhances differentiation in human neural precursor ReNcell CX® cells. Neural markers NeuN (FIG. 23 A, left column, red) and ΔIII-Tubulin (FIG. 23 B, left column, red) in ReNcell CX® were observed. ASO treatment was applied for initial 4 days under proliferative conditions followed by further 4 days under either proliferative (+EGF/FGF) or differentiating conditions (−EGF/FGF). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1, +EGF/FGF=proliferation, −EGF/FGF=differentiation.

    [0545] FIG. 22: ASO-mediated (Seq. ID No. 218b) rescue from TGF-β-induced neural stem cell proliferation arrest. Human neural precursor ReNcell CX® cells proliferation was observed with or without TGF-β1 exposure for 7 days followed by ASO treatment for 8 days. Upregulation of GFAP (FIG. 24A), Ki67 (FIG. 24B) and DCX (FIG. 24C) mRNA 7 days after TGF-β1 pre-incubation indicates recovery of stem cell proliferation. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1, ±=SEM, *p<0.05 in reference to A, Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc multiple comparisons.

    [0546] FIG. 23: ASO reduces proliferation of human lung-cancer cells (A549). Proliferation marker Ki67 protein expression is decreased in A549 cells after gymnotic transfer (72 h) of inventive ASOs. Reduced Ki67 protein expression was recognized (left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1.

    [0547] FIG. 24: ASO reduces proliferation of several human tumor cell-lines. HPAFII, K562, MCF-7, Panc-1, and HTZ-19 cells were exposed 4×72 h to inventive ASOs and proliferation was analyzed by light microscopy (Nikon, TS-100® F LED). A=untreated control, B=Ref.1, C═Seq. ID No. 218b.

    [0548] FIG. 25: ASO treatment mediates neural anti-fibrotic effects and ameliorates cellular stress. ReNcell CX® cells were observed after TGF-β1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-β1 treatment for 96 h. Cells were labeled with an antibody against CTGF (FIG. 29A, left column, red), FN (FIG. 29B, left column, green) and of Phalloidin (actin-cytoskeleton, FIG. 29C, left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1.

    [0549] FIG. 26: ASO treatment mediates tumor anti-fibrotic effects and ameliorates cellular stress. A549 cells were observed after treatment with either TGF-β1 or gymnotic transfer of inventive ASO (72 h). Cells were labeled with an antibody against FN (FIG. 30A, left column, green), Phalloidin (actin-cytoskeleton, FIG. 30B, left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1.

    [0550] FIG. 27: ASO treatment mediates tumor anti-fibrotic effects. A549 human lung cancer cells were observed after TGF-β1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-β1 treatment for 72 h. Cells were labeled with an antibody against CTGF (FIG. 31A, left column, red) and FN (FIG. 31B, left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, C═Seq. ID No. 218b, E=TGF-β1.

    [0551] FIG. 28: ASO treatment mediates tumor anti-fibrotic effects. A549 human lung cancer cells were observed after TGF-β1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-β1 treatment for 72 h. Cells were labeled with an antibody against CTGF (FIG. 32A, left column, red) and FN (FIG. 32B, left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-β1.

    [0552] FIG. 29 shows the antisense-oligonucleotide of Seq ID No 209× in form of a gapmer consisting of 16 nucleotides with 2 LNA units (Gb.sup.1 and Tb.sup.1) at the 5′ terminal end and 3 LNA units (Ab.sup.1 and Gb.sup.1 and C*b.sup.1) at the 3′ terminal end and 11 DNA nucleotides (dA, dG, dT, dG, dT, dT, dT, dA, dG, dG, and dG) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s), the nucleobase 5-methylcytosine (C*) in the last LNA unit from the 5′ terminal end, and with O—P(O)(S″)OC.sub.3H.sub.6OH as terminal end groups at the 5′ terminal end and at the 3′ terminal end.

    TABLE-US-00056 Seq ID SP L No Sequence, 5′-3′ 2064 16 209x /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsd GsdTsdTsdTsdAsdGsdGsdGs Ab.sup.1sGb.sup.1sC*b.sup.1/3SpC3s/

    [0553] FIG. 30 shows the antisense-oligonucleotide of Seq ID No 152h in form of a gapmer consisting of 15 nucleotides with 4 LNA units (C*b.sup.1 and Gb.sup.1 and Ab.sup.1 and Tb.sup.1) at the 5′ terminal end and 3 LNA units (Ab.sup.1 and C*b.sup.1 and Ab.sup.1) at the 3′ terminal end and 8 DNA nucleotides (dA, dC, dG, dC, dG, dT, dC, and dC) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first and second last LNA unit from the 5′ terminal end.

    TABLE-US-00057 Seq ID SP L No Sequence, 5′-3′ 429 15 152h C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsd CsdGsdTsdCsdCsAb.sup.1sC*b.sup.1sAb.sup.1

    [0554] FIG. 31 shows the antisense-oligonucleotide of Seq ID No 143h in form of a gapmer consisting of 14 nucleotides with 2 LNA units (C*b.sup.1 and Tb.sup.1s) at the 5′ terminal end and 3 LNA units (C*b.sup.1 and C*b.sup.1 and Gb.sup.1) at the 3′ terminal end and 9 DNA nucleotides (dC, dG, dT, dC, dA, dT, dA, dG, and dA) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first, third from last and second LNA unit from the 5′ terminal end.

    TABLE-US-00058 Seq ID SP L No Sequence, 5′-3′ 355 14 143h C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsd TsdAsdGsdAsC*b.sup.1sC*b.sup.1sGb.sup.1

    [0555] FIG. 32 shows the antisense-oligonucleotide of Seq ID No 213k in form of a gapmer consisting of 17 nucleotides with 3 LNA units (C*b.sup.1 and Ab.sup.1 and Gb.sup.1) at the 5′ terminal end and 3 LNA units (Gb.sup.1 and Tb.sup.1 and Gb.sup.1) at the 3′ terminal end and 11 DNA nucleotides (dG, dC, dA, dT, dT, dA, dA, dT, dA, dA, and dA) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first LNA unit from the 5′ terminal end.

    TABLE-US-00059 Seq ID SP L No Sequence, 5′-3′ 2355 17 213k C*b.sup.1sAb.sup.1sGb.sup.1sdGsdCsdAsdTsdTsd AsdAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1

    EXAMPLES

    Material and Methods

    [0556] Most Antisense-Oligonucleotides as well as control or reference oligonucleotides used herein were synthesized by EXIQON as custom oligonucleotides according to the needs of the inventors/applicant. Oligonucleotides having the following sequences were used as references:

    TABLE-US-00060 (Seq. ID No. 147c) Ref. 0 = dCsdAsdGsdCsdCsdCsdCsdCsdGsdAsdCsdCsdCsd AsdTsdG; (Seq. ID No. 76) Ref. 1 = Ab1sAb1sC*b1sdAsdCsdGsdTsdCsdTsdAsdTsdAs C*b1sGb1sC*b1; (Seq. ID No. 147m) Ref. 2 = C*b1sAb1sGb1sdCsdCsdCsdCsdCsdGsdAsdCsdC sdCsAb1sTb1sGb1; (Seq. ID No. 80) Ref. 3 = TTGAATATCTCATGAATGGA; having 2′-MOE-wings (5 units 5′and 3′) and phosphorothioate linkages; (Seq. ID No. 82) Ref. 4 = ; CAGAAGAGCTATTTGGTAGT, having 2′-MOE-wings (5 units 5′and 3′) and phosphorothioate linkages; (Seq. ID No. 85) Ref. 5 = TGGTAGTGTTTAGGGAGCCG, (Seq. ID No. 344) Ref. 6 = GTGCAGGGGAAAGATGAAAA, (Seq. ID No. 345) Ref. 7 = GAGCTCTTGAGGTCCCTGTG, (Seq. ID No. 346) Ref. 8 = AGCCTCTTTCCTCATGCAAA, (Seq. ID No. 347) Ref. 9 = CCTTCTCTGCTTGGTTCTGG, and (Seq. ID No. 348) Ref. 10 = GCCATGGAGTAGACATCGGT.

    Standard Procedures Protocols

    Cell Culture:

    [0557]

    TABLE-US-00061 TABLE 10 The following human cell lines were used for antisense-oligonucleotide experiments: Cell CO.sub.2— Description line Content Medium Melanoma HTZ-19 5% DMEM F12 (Gibco 31331-018) + 1% dM-Mix (Transferrin (30 mg/ml in water 835 μl, non-essential AS (100x) 10 ml, Sodium-selenite (0.2 mg/ml in water) 70 μl, 10 ml PBS), 1% P/S Lung carcinoma A549 5% Kaighn's F12 K + 10% FCS + 1% P/S hepatocellular HepG2 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S carcinoma hepatocellular Hep3B 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S carcinoma pancreatic Panc-1 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S epithelioid carcinoma pancreatic HPAFII 5% DMEM (Sigma D5796) + 15 FCS, 1% P/S, 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution, 1% non-essential AS (100x) pancreatic BxPC-3 5% RPMI (Gibco A10491-01) + 10% FCS + 1% P/S + 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution pancreatic cancer L3.6pl 5% DMEM (Sigma D5796) + 15% FCS, 1% P/S, 1% liver metastasis Antibiotic/Antimycotic, 1% Vitamin, 1% non-essential AS (100x) colorectal HT-29 5% DMEM (Sigma D5796) + 15% FCS, 1% P/S, 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution, 1% non-essential AS (100x) epithelial CaCo2 5% DMEM (Sigma D5796) + 20% FCS + 1% P/S colorectal adenocarcinoma gastric carcinoma TMK-1 5% DMEM (Sigma D5796) + 10% FCS + 1% P/S, 1% Antibiotic/Antimycotic, 1% MEM Vitamin Solution malignant HTZ- 5% DMEM (Sigma D6046) + 10% FCS + 1% P/S + 1% astrocytoma 243 non-essential AS + 1% MEM Vitamin Solution Mamma- MCF-7 5% DMEM (Sigma D6046) + 10% FCS + 1% P/S Carcinoma prostatic PC-3M 5% RPMI (Gibco #61870-010), 10% FCS, 1% Sodium adenocarcinoma pyruvate, 1% Sodium bicarbonate, 1% P/S acute KG-1 5% RPMI (Gibco #61870-010) + 10% FCS + 1% P/S myelogenous leukemia chronic K562 5% RPMI (Gibco #61870-010) + 10% FCS + 1% P/S myelogenous leukemia monocytic THP-1 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia promyelocytic HL60 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia lymphocytic CEM- 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia C7H2 acute Pre- 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S lymphoblastic B697 leukemia histiocytic U937 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S lymphoma Neuronal ReNcell 5% ReNcell Neural Stem Cell Maintenance Medium precursor cells of CX (Millipore #SCM005) + human FGF Basic human + cortical brain human EGF + N2-Supplement region

    Material:

    FCS (ATCC #30-2020)

    [0558] Sodium pyruvate (Sigma #S8636)
    Sodium bicarbonate (Sigma #S8761-100ML)

    Transferrin (Sigma #T8158-100MG)

    Natrium Selenite (Sigma #S5261-10G)

    Penicillin/Streptomycin (P/S) (Sigma-Aldrich #P4458)

    Non-essential Amino Acids (AS) 100× (Sigma #M7145)

    Antibiotic/Antimycotic (Sigma #A5955)

    MEM Vitamin Solution (Sigma #M6895)

    PBS (Sigma #D8537)

    [0559] FGF Basic human (Millipore #GF003)
    EGF human (Millipore #GF144)

    N-2 Supplement (Life Technologies #17502048)

    ReNcell Neural Stem Cell Maintenance Medium (Millipore #SCM005)

    Culturing and Disseminating Cells:

    [0560] After removing the medium, cells were washed with PBS and incubated with accutase (Sigma-Aldrich #P4458) (5 min, RT). Following incubation, cells were peened and full medium (3 ml, company: see Tab.10 for respective cell lines) was added. Afterwards, cells were transferred into a 5 ml Eppendorf Cup and centrifuged (5 min, 1000 rpm, RT). Pellet from 1 T75-bottle (Sarstedt #833.910.302) was resuspended in 2.5 ml fresh medium. Cell number of cell suspension was determined with Luna-FL™ automated cell counter (Biozym #872040) by staining with acridine orange/propidium iodide assay viability kit (Biozym #872045). Laminin-coating (Millipore #CC095) of dishes was necessary for adhesion of ReNcell CX® cells before seeding the cells for experiments in a concentration of 2 μg/cm.sup.2. Laminin-PBS solution was given in the respective amount directly to wells and flasks and was incubated for 1.5 h at 37° C. For experiments cells were seeded and harvested as mentioned in method part of respective experimental chapter. After overnight incubation of cells at 37° C. and 5% CO.sub.2, cells were treated as explained in respective experimental description. 500 μl of remaining cell suspension was given into a new T75-bottle filled with 10 ml fresh full medium for culturing cells.

    RNA-Analysis

    [0561] Total RNA for cDNA synthesis was isolated using innuPREP® RNA Mini Kit (Analytik Jena #845-KS-2040250) according to manufacturer's instructions. In order to synthesize cDNA, total RNA content was determined using a photometer (Eppendorf, BioPhotometer D30 #6133000907), diluted with nuclease-free water. Afterwards first-strand cDNA was prepared with iScript™ cDNA Synthesis Kit (BioRad #170-8891) according to manufacturer's recommendations. For mRNA analysis real-time RT-PCR was performed using a CFX96 Touch™ Real Time PCR Detection System (BioRad #185-5196).

    [0562] All primer pairs were ready-to-use standardized and were mixed with the respective ready-to-use Mastermix solution (SsoAdvanced™ Universial SYBR® Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Primer-pairs for in vivo experiments were adapted according to individual species.

    TABLE-US-00062 TABLE 11 Primer pairs used for mRNA Analysis Primer pair Company Unique Assay ID Human CDKN1A BioRad qHsaCID0014498 Human CDNK1B BioRad qHsaCID0012509 Human CFLAR BioRad qHsaCID0038905 Human Col4A1 BioRad qHsaCID0010223 Human CTGF BioRad qHsaCED0002044 Human DCX BioRad qHsaCID0010869 Human FN1 BioRad qHsaCID0012349 Human GFAP BioRad qHsaCID0022307 Human GNB2L1 BioRad qHsaCEP0057912 Human ID-2 BioRad qHsaCED0043637 Human MKi67 BioRad qHsaCID0011882 Human Nestin BioRad qHsaCED0044457 Human SERPINE1 BioRad qHsaCED0043144 Human SOX2 BioRad qHsaCED0036871 Human TGFβ-RII BioRad qHsaCID0016240 Human TP53 BioRad qHsaCID0013658

    [0563] As template, 1 μl of respective cDNA was used. RNA that was not reverse transcribed served as negative control for real-time RT-PCR. For relative quantification housekeeping gene Guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1) was used. Real-time RT-PCR was performed with the following protocol:

    TABLE-US-00063 TABLE 12 Protocol for real-time RT-PCR. Initiation period 2 min 95° C.  1x Denaturation 5 s 95° C. 40x Annealing, 30 s 60° C. 40x Extension Melting curve 65° C.-95° C.  1x (0.5° C. gradient)

    [0564] Afterwards, BioRad CFX Manager 3.1 was used for quantification of respective mRNA-level relative to GNB2L1 mRNA and then normalized to untreated control.

    Western Blot:

    [0565] For protein analysis, cells/tissues were lysed using M-PER® Mammalian Protein Extraction Reagent/T-PER® Tissue Protein Extraction Reagent (Thermo Scientific, #78501/#78510) according to manufacturer instructions, respectively. SDS-acrylamide-gels (10%) were produced using TGX Stain Free™ Fast Cast™ Acrylamide Kit (BioRad #161-0183) according to manufacturer instructions. Protein samples (20 μl) were diluted 1:5 with Lämmli-buffer (6.5 μl, Roti®-Load1, Roth #K929.1), incubated at 60° C. for 30 min and loaded on the gel with the entire volume of the protein solution. Separation of proteins was performed by electrophoresis using PowerPac™ Basic Power Supply (Biorad #164-5050SP) and Mini-PROTEAN® Tetra cell electrophoresis chamber (BioRad #165-8001-SP) (200 V, 45 min). Following electrophoresis, the proteins were blotted using Trans-Blot® Turbo Transfer System (BioRad #170-4155SP). All materials for western blotting were included in Trans-Blot® Turbo RTA PVDF-Midi Kit (BioRad #170-4273).

    [0566] The PVDF-membrane for blotting procedure was activated in methanol (Merck #1.06009.2511) and equilibrated in 1× transfer buffer. Following blotting (25 V, 1 A, 30 min), membranes were washed (3×, 10 min, RT) with 1×TBS (Roth #10.60.1) containing 0.5 ml Tween-20 (Roth #9127.1). Afterwards, the membranes were blocked with 5% BSA (Albumin-IgG-free, Roth #3737.3) diluted with TBS-T for 1 h at RT, the primary antibodies (diluted in 0.5% BSA in TBS-T, Table 13) were added and incubated at 4° C. for 2 days. Antibodies for in vivo experiments were chosen for species specificity accordingly.

    TABLE-US-00064 TABLE 13 Antibodies used for Western Blot analysis. Dilution Company Order Number Primary Antibody Alpha-Tubulin 1:2000 Cell Signaling cs12351s HRP-linked (rabbit) ColIV (rabbit) 1:1000 Abcam ab6586 CTGF (rabbit) 1:1000 Genetex GTX-26992 FN (rabbit) 1:250  Proteintech 15613-1-AP GAPDH XP 1:1000 Cell Signaling cs8884s HRP-linked (rabbit) Ki67 (rabbit) 1:500  Abcam ab15580 pAkt (rabbit) 1:1000 Cell signaling cs4060s pErk1/2 (rabbit) 1:1000 Cell signaling cs4370s pSmad2 (rabbit) 1:500  Cell Signaling cs3104 TGF-βRII (rabbit) 1:400  Aviva ARP44743-T100 Secondary Antibody Anti-rabbit IgG,  1:10000 Cell signaling cs#12351S HRP-linked

    [0567] In the next step, membranes were washed in TBS-T (3×10 min, RT) and incubated with the secondary antibody (1 h, RT, Table 13). Following incubation, blots were washed with TBS-T, emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with a luminescent image analyzer (ImageQuant™ LAS 4000, GE Healthcare). Afterwards, the blots were washed in TBS-T (3×10 min, RT) and blocked with 5% BSA diluted in TBS-T (1 h, RT). For housekeeper comparison, the membranes were incubated with HRP-conjugated anti alpha-tubulin (1:2000 in 0.5% BSA, 4° C., overnight). The next day blots were emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with the luminescent image analyzer. Finally, the blots were washed with TBS-T (3×, 5 min) and stained using 1× Roti®-Blue solution (Roth #A152.2) and dried at RT.

    Immunocytochemistry

    [0568] Cells were treated and harvested as described before. Following fixation of cells with Roti®-Histofix 4% (Roth #P087.4) on 8-well, cell culture slide dishes (6 min, RT) were washed three times with PBS. After blocking cells for 1 h at RT with Blocking Solution (Zytomed #ZUC007-100) cells were incubated with respective primary antibodies listed in Table 14 and incubated at 4° C. overnight.

    [0569] Afterwards, cell culture slides were washed three times with PBS following incubation with secondary antibody (1 h, RT). All antibody-dilutions were prepared with Antibody-Diluent (Zytomed #ZUC025-100).

    TABLE-US-00065 TABLE 14 Antibodies used for immunocytochemistry. Dilution Company Order Number Primary Antibody ColIV (rabbit) 1:50 Abcam ab6586 CTGF (rabbit) 1:50 Genetex GTX26992 βIII-Tubulin (rabbit)  1:100 cell signaling cs5568 FN (rabbit) 1:50 Proteintech 15613-1-AP Ki67 (rabbit)  1:100 Abcam ab15580 NeuN (rabbit)  1:250 Abcam Ab104225 Phalloidin Alexa Fluor 1:20 Cell signaling cs8953 555 pSmad2 (rabbit) 1:50 Cell signaling cs3104s pSmad3 (rabbit) 1:50 Cell signaling cs9520s TGF-R.sub.II (rabbit) 1:50 Millipore 06-227 Secondary Antibody Alexa Fluor 488  1:750 Life Technologies A21441 Cy3 goat-anti-rabbit  1:1000 Life Technologies A10520

    [0570] Following incubation with secondary antibody, cells were washed three times with PBS, coverslips were separated from cell culture dish and mounted with VECTASHIELD® HardSet™ with DAPI (Biozol #VEC-H-1500). Slides were dried overnight at 4° C. before fluorescence microscopy (Zeiss, Axio® Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW® X7 Software.

    In Vivo Experiments

    Peripheral Blood Mononuclear Cell (PBMC) Assay

    [0571] PBMCs were isolated from buffy coats corresponding to 500 ml full blood transfusion units. Each unit was obtained from healthy volunteers and glucose-citrate was used as an anti-agglutinant. The buffy coat blood was prepared and delivered by the Blood Bank Suhl of the Institute for Transfusion Medicine, Germany. Each blood donation was monitored for HIV antibody, HCV antibody, HBs antigen, TPHA, HIV RNA, and SPGT (ALAT). Only blood samples tested negative for infectious agents and with a normal SPGT value were used for leukocyte and erythrocyte separation by low-speed centrifugation. The isolation of PBMCs was performed about 40 h following blood donation by gradient centrifugation using Ficoll-Histopague® 1077 (Heraeus™ Multifuge™ 3 SR). For IFNα assay, PBMCs were seeded at 100,000 cells/96-well in 100 μl complete medium plus additives (RPMI1640, +L-Glu, +10% FCS, +PHA-P (5 μg/ml), +IL-3 (10 μg/ml)) and test compounds (5 μl) were added for direct incubation (24 h, 37° C., 5% CO.sub.2). For TNFα assay, PBMCs were seeded at 100,000 cells/96-well in 100 μl complete medium w/o additives (RPMI1640, +L-Glu, +10% FCS) and test compounds (5 μl) were added for direct incubation (24 h, 37° C., 5% CO.sub.2). ELISA (duplicate measurement out of pooled supernatants, 20 μl) for huIFNα (eBioscience, #BMS216INSTCE) was performed according to the manufacturer's protocol. ELISA (duplicate measurement out of pooled supernatants, 20 μl) for huTNFα (eBioscience, #BMS223INSTCE) was performed according to the manufacturer's protocol.

    bDNA Assay

    [0572] TGF-R.sub.II mRNA levels were determined in liver, kidney, and lung lysate by bDNA assay according to manufacturer's instructions (QuantiGene® kit, Panomics/Affimetrix).

    Immunofluorescence

    [0573] Paraffin-embedded spinal cord and brain tissue was cut into 5 μm sections (3-4 slides per object plate). Paraffin sections were deparaffinized and demasked by heating in citrate buffer (10 mM, 40 min) in a microwave oven. Afterwards, deparaffinized sections were incubated with 0.3% H.sub.2O.sub.2 (30 min, RT), washed with PBS (10 min, RT) and blocked with Blocking Solution (Zytomed #ZUC007-100) for 30 min. After blocking for 1 h at RT with Blocking Solution (Zytomed) slides were incubated with 150 μl of the respective primary antibodies and incubated at 4° C. overnight. After washing with PBS (three times, 5 min RT) the slices were incubated with the secondary antibody for 1 h at RT. All antibody dilutions were prepared with Antibody Diluent (Zytomed #ZUC025-100). Afterwards the slices were washed again with PBS (three times, 5 min, RT) and mounted using VECTASHIELD® Mounting Medium with DAPI (Vector). Antibodies for immunofluorescence were comparable to cell culture experiments and adapted for each species.

    Electrochemiluminescence

    [0574] For immunological and hematological alterations, electrochemiluminescence technique (MesoScale Discovery®, Maryland, United States) was used. For each assay, 25 μl of the protein, blood, and liquor samples were used and the procedure was performed according to manufacturer's instructions.

    BrdU Assay

    [0575] Labeling of dividing cells was performed by intraperitoneal injection of the thymidine analogue BrdU (Sigma, Steinheim, Germany) at 50 mg/kg of body weight using a sterile solution of 10 mg/ml of BrdU dissolved in a 0.9% (w/v) NaCl solution. The BrdU injections were performed daily within the last experimental week.

    Surgery

    [0576] For chronic central infusion, animals underwent surgery for an icy cannula attached to an Alzet® osmotic minipump (mice, rats, infusion rate: 0.25 μl/h, Alzet®, Model 2004, Cupertino, USA) or a gas pressure pump (Cynomolgus monkeys, infusion rate 0.25 ml/24 h, Tricumed®, Model IP 2000V, Germany). The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump/gas pressure pump was implanted subcutaneously in the abdominal region via a skin incision at the neck of the animals and connected with the icy cannula by silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, animals were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. Blood, liquor, and tissues were collected for analysis. Histological verification of the icy implantation sites was performed at 40 μm coronal, cresyl violet-stained brain sections.

    Outcome Parameters and Functional Analysis

    [0577] Onset of symptomatic disease, onset of first paresis and survival were used as in vivo endpoints. Onset of symptomatic disease was defined as a lack of leg stretching in reaction to tail suspending. Time point at which gait impairments were first detected (e.g., hobbling or waddling) was classified as onset of first paresis. These parameters were determined daily starting at age 40 days.

    [0578] To monitor disease progression, running wheel testing (LMTB, Berlin, Germany) was performed. Animals were caged separately with access to a running wheel starting at 33 days of age. Motor activity was directly correlated with the rotations per minute, generated by each animal in the running wheel. Each full turn of the wheel triggered two electromagnetic signals, directly fed into a computer attached to a maximum of 120 wheels. Running wheel data were recorded and analyzed with “Maus Vital” software (Laser- and Medizin-Technologie, Berlin, Germany). Assessment time lasted for 12 hours from 6:00 μm to 6:00 am.

    Spatial Learning Test (Morris-Water-Maze)

    [0579] Behavioral testing was performed between 8:00 and 13:00.

    [0580] Rats were trained in a black circular pool (1.4 m in diameter, 50 cm high, filled with 20° C. warm water to a height of 30 cm) to find a visible white target (10 cm in diameter, raised above the water's surface of approximately 1 cm) that was located throughout the study in the center of the same imaginary quadrant (proximally cued). Each animal was trained to navigate to the platform in 3 consecutive sessions with 12 trials/sessions, one session per day and an inter-trial interval of 10-20 s.

    Microbiological Analysis

    [0581] Antisense-oligonucleotide samples were microbiologically analyzed according to Ph. Eur. 2.6.12, USP 30<61> regarding the Total Aerobic Microbial Count (TAMC) and the Total Combined Yeast and Mould Count (TYMC).

    Anion-Exchange High-Performance Liquid Chromatography (AEX-HPLC)

    [0582] Integrity and stability of antisense-oligonucleotide (ASO) samples was determined by AEX-HPLC using ÄKTAexplorer™ System (GE healthcare, Freiburg, Germany). The purified ASO samples were desalinated by ethanol precipitation. The identity of the ASO was confirmed by electrospray-ionization-mass-spectrometry (ESI-MS) and the purity was determined by AEX-HPLC with a Dionex DNAPac™ 200 (4×250 mm) column.

    Example 1: Determination of Inhibitory Activity of Inventive Antisense-Oligonucleotides on mRNA Level

    1.1 Transfection of Antisense-Oligonucleotides

    [0583] The inhibitory activity of several antisense-oligonucleotides directed to TGF-R.sub.II was tested in human epithelial lung cancer cells (A549). TGF-R.sub.II mRNA was quantified by branched DNA assay in total mRNA isolated from cells incubated with TGF-R.sub.II specific oligonucleotides.

    Description of Method:

    [0584] Cells were obtained and cultured as described above. Transfection of antisense-oligonucleotides was performed directly after seeding 10,000 A549 cells/well on a 96-well plate, and was carried out with Lipofectamine® 2000 (Invitrogen GmbH, Karlsruhe, Germany, cat. No. 11668-019) as described by the manufacturer. In two independent single dose experiments performed in quadruplicates, oligonucleotides were transfected at a concentration of 20 nM. After transfection, cells were incubated for 24 h at 37° C. and 5% CO.sub.2 in a humidified incubator (Heraeus GmbH, Hanau, Germany). For measurement of TGF-R.sub.II mRNA, cells were harvested and lysed at 53° C. following procedures recommended by the manufacturer of the QuantiGene® Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) for isolation of branched DNA (bDNA). For quantitation of housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA the QuantiGene® Explore Kit was used, whereas quantitation of TGF-R.sub.II mRNA was conducted with QuantiGene® 2.0 (custom manufacturing for Axolabs GmbH, Kulmbach, Germany). After incubation and lysis, 10 μl of the lysates were incubated with probe sets specific to human TGF-R.sub.II and human GAPDH. Both reaction types were processed according to the manufacturer's protocol for the respective QuantiGene® kit. Chemoluminescence was measured in a Victor.sup.2™ multilabel counter (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the TGF-R.sub.II probe sets were normalized to the respective GAPDH values for each well and then normalized to the corresponding mRNA readout from mock-treated cells.

    Results

    [0585] Results show the efficient downregulation of TGF-R.sub.II by several ASOs after transfection of A549 cells. Downregulation after transfection of reference oligonucleotides Ref. 6-Ref. 10 was not as efficient and resulted in downregulation of >60%.

    TABLE-US-00066 TABLE 15 Downregulation of TGF-R.sub.II mRNA. Transfection with TGF-R.sub.II specific antisense-oligonucleotides (ASOs) in human epithelial lung carcinoma cells (A549). Quantitation of mRNA expression levels was performed relative to housekeeping gene GAPDH using QuantiGene ® Kit. Probes were then normalized to the corresponding mRNA readout from mock-treated cells. A549 (c = 20 nM) GAPDH TGF-R.sub.II ASO mean SD mean SD Seq. ID No. 141j 1.41 0.05 0.02 0.01 Seq. ID No. 143aj 0.76 0.03 0.02 0.01 Seq. ID No. 139c 0.9 0.03 0.02 0.01 Seq. ID No. 145c 0.91 0.05 0.03 0.01 Seq. ID No. 209ax 1.52 0.58 0.03 0.01 Seq. ID No. 152ak 0.88 0.03 0.04 0 Seq. ID No. 218ar 1.08 0.03 0.04 0 Seq. ID No. 144c 0.5 0.07 0.05 0.03 Seq. ID No. 210ap 0.92 0.05 0.05 0.01 Seq. ID No. 142c 1.33 0.05 0.06 0.03 Seq. ID No. 213ak 1.2 0.03 0.07 0.01 Seq. ID No. 153f 1.09 0.07 0.08 0.03

    Conclusion

    [0586] TGF-R.sub.II mRNA was efficiently targeted by the inventive ASOs. The named ASOs achieved an effective target mRNA downregulation after transfection of A549 cells.

    1.2 Gymnotic Uptake of Antisense-Oligonucleotides

    1.2.1a Comparison of Target-Knockdown Between Inventive ASOs and Prior-Art Sequences by Gymnotic Transfer in A549 and Panc-1 Cells

    [0587] The downregulatory activity of several antisense-oligonucleotides directed to TGF-R.sub.II was tested in human epithelial lung tumor cells (A549) by direct uptake without transfection reagents (“gymnotic uptake”). TGF-R.sub.II mRNA was quantified by branched DNA assay in total mRNA isolated from cells incubated with TGF-R.sub.II specific oligonucleotides.

    Description of Method:

    [0588] Cells were obtained and cultured as described in general methods. Gymnotic transfer of antisense-oligonucleotides was performed by preparing a 96-well plate with the respective antisense-oligonucleotides and subsequently seeding of 10,000 cells (Panc-1) or 8,000 cells (A549)/well. Experiments were performed in quadruplicates, oligonucleotides were used at final concentrations of 5 μM (Panc-1) and 7.5 μM (A549). Cells were incubated for 72 h at 37° C. and 5% CO.sub.2 in a humidified incubator (Heraeus GmbH, Hanau, Germany). For measurement of TGF-R.sub.II mRNA, cells were harvested and lysed at 53° C. following procedures recommended by the manufacturer of the QuantiGene® Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) for branched DNA (bDNA). For quantitation of housekeeping gene GAPDH mRNA the QuantiGene® Explore Kit was used, whereas quantitation of TGF-R.sub.II mRNA was conducted with QuantiGene® 2.0 (custom manufacturing for Axolabs GmbH, Kulmbach, Germany). After incubation and lysis, 10 μl of the lysates were incubated with probe sets specific to human TGF-R.sub.II and human GAPDH. Both reaction types were processed according to the manufacturer's protocol for the respective QuantiGene® kit. Chemoluminescence was measured in a Victor.sup.2™ multilabel counter (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the TGF-R.sub.II probe sets were normalized to the respective GAPDH values for each well and then normalized to the corresponding mRNA readout from PBS treated cells.

    [0589] Selected results are shown in Table 16a. Further modifications of Seq. ID No. 209ay, Seq. ID No. 209ax and Seq. ID No. 209y, namely ASOs listed in Table 6 of the description, showed comparable values to these three antisense-oligonucleotides. In addition, modifications of Seq. ID No. 152h, namely ASOs listed in Table 5 of the description, showed comparable values to this antisense-oligonucleotide. Modifications of Seq. ID No. 218b, namely ASOs listed in Table 8 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 218b. Modifications of Seq. ID No. 213k, namely ASOs listed in Table 9 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 213k. Also modifications of Seq. ID No. 210q, namely ASOs listed in Table 7 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 210q. Finally, modifications of Seq. ID No. 143h, namely ASOs listed in Table 4 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 143h. Transfer of antisense-oligonucleotides listed in Tables 4-9 resulted in a more potent downregulation of the target TGF-RII mRNA compared to the transfer of tested reference sequences (A549: downregulation<0.5; Panc1 cells: downregulation<0.4).

    TABLE-US-00067 TABLE 16a Efficacy of target mRNA downregulation by gymnotic transfer. Remaining TGF-R.sub.II mRNA after gymnotic uptake of selected TGF-R.sub.II specific ASOs in A549 and Panc-1 cells. mRNA expression levels were determined relative to housekeeping gene Glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) and compared to PBS treated cells as reference control (=1) using QuantiGene ® Kit. Remaining mRNA of TGF-R.sub.II (PBS treated cells = 1) A549 cells Panel cells ASO mean SD mean SD Seq. ID No. 209ay 0.11 0.01 0.07 0.02 Seq. ID No. 209ax 0.14 0.02 0.08 0.01 Seq. ID No. 209bb 0.19 0.01 0.11 0.01 Seq. ID No. 209az 0.19 0.03 0.13 0.02 Seq. ID No. 209ba 0.23 0.02 0.18 0.03 Seq. ID No. 209y 0.27 0.04 0.17 0.01 Seq. ID No. 152h 0.29 0.04 0.12 0.02 Seq. ID No. 218b 0.30 0.02 0.07 0.01 Seq. ID No. 213k 0.34 0.04 0.17 0.04 Seq. ID No. 210q 0.37 0.05 0.18 0.02 Seq. ID No. 210aq 0.39 0.03 0.18 0.02 Seq. ID No. 143h 0.43 0.04 0.35 0.05 Ref. 2 0.59 0.05 0.40 0.04 Ref. 0 0.89 0.06 1.10 0.07 Ref. 3 0.68 0.03 0.62 0.03 Ref. 4 0.74 0.04 0.71 0.01

    Conclusion

    [0590] Gymnotic transfer of inventive ASOs results in a continuously stronger downregulation of the target TGF-R.sub.II mRNA than the transfer of tested reference sequences. The claimed antisense-oligonucleotides outperformed all tested sequences known from prior-art, independently of the chosen human cell line. Nevertheless, in general antisense-oligonucleotides having a length of 12-20 nucleotides result in a more effective downregulation of the target TGF-R.sub.II mRNA than shorter or longer antisense-oligonucleotides. This effect was even more noticeable for antisense-oligonucleotides having a length of 14-18 nucleotides, which in general show the most potent effects.

    1.2.1b Analysis of Gymnotic Transfer in A549 Cells by Branched DNA Assay

    [0591] Most effective antisense-oligonucleotides against TGF-R.sub.II from the transfection screens were further characterized by gymnotic uptake in A549 cells. TGF-R.sub.II mRNA was quantified by branched DNA in total mRNA isolated from cells incubated with TGF-R.sub.II specific antisense-oligonucleotides.

    Description of Method:

    [0592] A549 cells were cultured as described before under standard conditions. For single-dose and dose-response experiments 80,000 A549 cells/well were seeded in a 6-well culture dish and incubated directly with oligonucleotides at a concentration of 7.5 μM. For measurement of TGF-R.sub.II mRNA, cells were harvested, lysed at 53° C. and analyzed by branched DNA Assay following procedures recommended by the manufacturer of the QuantiGene® Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) as described above (see 1.1).

    Results

    [0593] Listed ASOs in Table 16b showed reduced target mRNA level of TGF-R.sub.II relative to the housekeeping gene GAPDH in A549 cells. The ten most efficient ASOs were also tested for inhibitory concentration 50 (IC.sub.50). All together Seq. ID No. 209t, Seq. ID No. 218b, Seq. ID No. 218c and Seq. ID No. 209y lead to most proper knockdown of TGF-R.sub.II at low concentration levels.

    TABLE-US-00068 TABLE 16b Downregulation of TGF-R.sub.II mRNA after gymnotic uptake of TGF- R.sub.II specific ASOs in A549 cells. mRNA levels were determined relative to housekeeping gene GAPDH using QuantiGene ® Kit. TGF-R.sub.II GAPDH IC.sub.50 ASO n = 4 SD n = 4 SD n = 4 Seq. ID No. 209t 0.19 0.05 1.13 0.11 1.63 Seq. ID No. 218c 0.25 0.04 0.94 0.18 1.17 Seq. ID No. 218b 0.26 0.08 1.08 0.28 2.54 Seq. ID No. 218q 0.27 0.07 1.11 0.08 2.39 Seq. ID No. 209y 0.34 0.06 0.96 0.06 1.57 Seq. ID No. 218t 0.36 0.12 0.76 0.04 2.57 Seq. ID No. 218m 0.41 0.06 1.16 0.29 1.66 Seq. ID No. 209w 0.44 0.07 1.00 0.11 5.76 Seq. ID No. 218p 0.46 0.12 0.88 0.07 Seq. ID No. 209v 0.48 0.25 0.96 0.07 3.10 Seq. ID No. 209x 0.52 0.02 0.87 0.06 5.60 Seq. ID No. 218u 0.53 0.20 0.79 0.05 Seq. ID No. 218v 0.54 0.13 0.77 0.04 Seq. ID No. 210q 0.60 0.23 1.11 0.11 Seq. ID No. 218o 0.61 0.15 0.96 0.06 Seq. ID No. 210p 0.65 0.24 1.01 0.23 Seq. ID No. 218n 0.89 0.36 1.07 0.22 Seq. ID No. 210o 0.95 0.08 0.97 0.14 Seq. ID No. 209s 0.96 0.31 1.14 0.24 pos. Ctrl aha-1 0.22 0.04 0.77 0.02 Ref. 1 1.43 0.40 1.27 0.18 IC.sub.50 = inhibitory concentration for 50% of downregulation, Pos. Ctrl: aha-1 = activator of heat shock 90 kDa protein ATPase homolog 1 (Aha1) directed LNA as positive control, Ref. 1 = Scrambled control.

    Conclusion

    [0594] The target downregulation by the most efficient inventive ASOs was again excellent without transfection reagents. Thus, gymnotic transfer is feasible and the preferred method for further drug development.

    1.2.2 Analysis of Gymnotic Uptake in A549 and ReNcell CX® Cells

    [0595] Inhibitory activity on the target mRNA by antisense-oligonucleotides (ASOs) was determined in human neuronal progenitor cells from cortical brain region (ReNcell CX® cells, Millipore #SCM007). Questions regarding adult neurogenesis as therapeutic target were assessed by gymnotic transfer studies with most effective ASOs. A549 cells were used as reference cell line.

    Description of Method:

    [0596] A549 and ReNcell CX® cells were cultured as described above. For treatment studies cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For treatment of A549 and ReNcell CX® cells, medium was removed and replaced by fresh full medium (0.5 ml for 24-well). Ref.1, ASO with Seq. ID No. 218b, and ASO with Seq. ID No. 218c were then added in medium at concentrations of 2.5 and 10 μM for analysis of target downregulation at different time points (A549 cells: 18 h, 72 h, 6 d, ReNcell CX® cells: 18 h, 96 h, 8 d) at 37° C. and 5% CO.sub.2. For harvesting, cells were washed twice with PBS and frozen at −20° C. For analysis of mRNA by real-time RT-PCR, cells were processed as described above. Ready-to-use and standardized primer pairs for real-time RT-PCR (see Table 11) were used and mixed with the respective ready-to-use Mastermix solution (SsoAdvanced™ Universial SYBR® Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Probes were analyzed as triplicates and data was quantified relative to GNB2L1 mRNA using BioRad CFX Manager™ 3.1 and then normalized to untreated control. Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Results:

    [0597] Results showed that gymnotic transfer with Seq. ID No. 218b and 218c result in a proper downregulation of TGF-R.sub.II mRNA in A549 and ReNcell CX® cells in a dose- and time dependent manner (Table 17). Target mRNA in A549 cells was significantly reduced after 18 h, and was even more efficient reduced after 72 h and 6 d. After 18 h in ReNcell CX® only a depression of TGF-R.sub.II mRNA after gymnotic uptake of 100 could be observed, but target downregulation was significant after 72 h for both tested concentrations and was stable until day 8.

    TABLE-US-00069 TABLE 17 Dose- and time-dependent downregulation of TGF-R.sub.II mRNA after gymnotic transfer with TGF-R.sub.II specific ASO in A549 and ReNcell CX ® cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line A549 Target TGF-R.sub.II TGF-R.sub.II TGF-R.sub.II Time point 18 h, n = 3 72 h, n = 3 6 d, n = 3 A 1.00 ± 0.03 1.00 ± 0.20 1.00 ± 0.38 B 2.5 μM 1.17 ± 0.06 0.87 ± 0.21 0.88 ± 0.14 B 10 μM 0.98 ± 0.10 0.77 ± 0.06 1.03 ± 0.10 C 2.5 μM 0.60*++ ± 0.09  .sup.  0.41* ± 0.07  0.13 ± 0.03 C 10 μM 0.49**++ ± 0.02  .sup.  0.15** ± 0.02  0.02*+ ± 0.00 .sup.  D 2.5 μM 0.46** ± 0.09  D 10 μM 0.21* ± 0.04  Cell line ReNcell CX Target TGF-R.sub.II TGF-R.sub.II TGF-R.sub.II Time point 18 h, n = 3 96 h, n = 3 8 d, n = 3 A 1.00 ± 0.41 1.00 ± 0.04 1.00 ± 0.18 B 2.5 μM 1.38 ± 0.58 0.89 ± 0.09 0.80 ± 0.33 B 10 μM 1.70 ± 0.68 0.81 ± 0.10 1.16 ± 0.43 C 2.5 μM 1.04 ± 0.36 0.32** ± 0.06  0.42 ± 0.16 C 10 μM 0.64 ± 0.24 0.16** ± 0.02  0.21 ± 0.09 D 2.5 μM 0.53 ± 0.07 D 10 μM 0.23** ± 0.03  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, D = Seq. ID No. 218c, ± = SEM, *p < 0.05, **p < 0.01 in reference to A, +p < 0.05, ++p < 0.01 in reference to B. Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0598] Efficient and stable downregulation of target mRNA by gymnotic uptake of ASOs is achieved even in long-term applications. ReNcell CX® cells could therefore be used e.g. for experiments addressing recovery of adult neurogenesis as a therapeutic option in patients. The same applies for other indications as shown by A549 experiments.

    [0599] Taken together, efficient downregulation of TGF-R.sub.II is suitable independently from method of transfer and cell type. Gymnotic uptake of ASOs is the preferred transfer method as in clinical applications the absence of additional transfection agents suggests high safety for patients.

    Example 2: Determination of Inhibitory Activity of the Antisense-Oligonucleotides Directed to TGF-R.SUB.II .on Protein Level

    [0600] Western Blot Analysis and Immunocytochemistry was performed to determine whether reduced TGF-R.sub.II mRNA level, mediated by inventive antisense-oligonucleotides (ASOs) in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX®) results in a reduction of target protein.

    Description of Method:

    [0601] Cells were cultured as described above. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300, 80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802, 10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For gymnotic transfer of A549 and ReNcell CX® cell medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (scrambled control), the respective inventive ASO was then added in medium at concentrations of 2.5 and 10 μM for protein analysis of target downregulation after 72 h in A549 cells and 96 h in ReNcell CX® cells. The cells were lysed and examined by Western Blot as described in general method part. The primary antibody anti-TGF-R.sub.II was diluted in 0.5% BSA in TBS-T and incubated at 4° C. for 2 days. Afterward membranes were incubated with the second antibody anti-rabbit IgG HRP-linked diluted in 0.5% BSA in TBS-T (1 h, RT). Following incubation, blots were washed with TBS-T, emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with a luminescent image analyzer (ImageQuant™ LAS 4000, GE Healthcare). For housekeeper comparison, the membranes were incubated with HRP-conjugated anti-GAPDH (1:1000 in 0.5% Blotto, 4° C., overnight). Densitometric quantification was calculated relative to GAPDH and then normalized to untreated control with Image Studio™ Lite Software.

    [0602] Procedure for immunocytochemistry was performed as described in standard protocol. For verification of target-downregulation anti-TGF-R.sub.II was diluted and incubated overnight at 4° C. Cy3 goat-anti-rabbit was used as secondary antibody. All antibody-dilutions were prepared with Antibody-Diluent (Zytomed® #ZUC025-100). Examination of cells was performed by fluorescence microscopy (Zeiss Axio® Observer.Z1). Images were analyzed with Image J Software and CorelDRAW® X7 Software.

    Results after Gymnotic Transfer:

    [0603] Western Blot Analysis and immunocytochemistry were used to verify the reduction of TGF-R.sub.II protein level. 72 h after gymnotic transfer, TGF-R.sub.II protein was significantly reduced using high concentration of different ASOs according to the invention in comparison to untreated control in A549 cells (Table 18). Reduced TGF-R.sub.II levels were also observed in ReNcell CX® cells (Table 18). For both cell lines, reduction of TGF-R.sub.II protein level was shown by Western Blot Analysis. Immunocytochemistry revealed a strong dose-dependent reduction of TGF-R.sub.II protein in both cell lines in comparison to untreated cells and scrambled control treated cells.

    TABLE-US-00070 TABLE 18 Densitometric analysis after TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after gymnotic transfer with TGF-R.sub.II specific ASOs in A549 and ReNcell CX ® cells could be observed after 72 h or 96 h, respectively. Protein levels were determined relative to housekeeping gene GAPDH using Image Studio ™ Lite Software and were normalized to untreated control. Cell line A549 ReNcell CX Target TGF-R.sub.II TGF-R.sub.II Time point 72 h, n = 3 96 h, n = 2 A 1.00 ± 0.00 1.00 ± 0.00 B 2.5 μM 0.85 ± 0.13 0.91 ± 0.12 B 10 μM 1.06 ± 0.47 1.23 ± 0.16 C 2.5 μM 0.34 ± 0.11 0.59 ± 0.05 C 10 μM 0.39* ± 0.11  0.63 ± 0.17 D 2.5 μM 0.68 ± 0.14 1.21 ± 0.28 D 10 μM 0.39* ± 0.07  0.77 ± 0.10 F 2.5 μM 0.51 ± 0.08 0.71 ± 0.16 F 10 μM 0.45 ± 0.09 0.57 ± 0.12 G 2.5 μM 0.41 ± 0.13 0.61 ± 0.10 G 10 μM 0.40* ± 0.06  0.58 ± 0.08 H 2.5 μM 0.75 ± 0.12 0.83 ± 0.13 H 10 μM 0.51 ± 0.07 0.77 ± 0.06 I 2.5 μM 0.58 ± 0.14 0.91 ± 0.21 I 10 μM 0.38* ± 0.14  0.67 ± 0.09 J 2.5 μM 0.42 ± 0.15 0.75 ± 0.23 J 10 μM 0.34* ± 0.05  0.59 ± 0.08 K 2.5 μM 0.45 ± 0.17 0.69 ± 0.16 K 10 μM 0.36* ± 0.09  0.49 ± 0.09 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, D = Seq. ID No. 218c, F = Seq. ID No. 210q, G = Seq. ID No. 213k, H = Seq. ID No. 143h, I = Seq. ID No. 152h, J = Seq. ID No. 209az, K = Seq. ID No. 209y, ± = SEM, *p < 0.05 in reference to A. Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0604] In addition to target mRNA downregulation, gymnotic transfer of Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, and Seq. ID No. 209y resulted in excellent reduction of protein level in A549 and ReNcell CX® cells. Staining of TGF-R.sub.II revealed a dose-dependent reduction of TGF-R.sub.II protein after treatment with these ASOs in both cell lines.

    Results after Gymnotic Transfer with Further ASOs:

    [0605] Protein analysis showed a reduced amount of TGF-R.sub.II in A549 cells and ReNcell CX® cells gymnotic transfer of tested ASOs (10 μM, Table 19). This was also verified by immunocytochemistry. For both cell lines, reduction of TGF-R.sub.II protein level by gymnotic transfer of the tested ASOs could be detected in comparison to untreated cells and scrambled control treated cells.

    TABLE-US-00071 TABLE 19 Densitometric analysis after TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after gymnotic transfer with further TGF-R.sub.II-specific antisense-oligonucleotides (ASO) in A549 and ReNcell CX ® cells could be observed after 72 h or 96 h, respectively. Protein levels were determined relative to housekeeping-gene GAPDH using Studio ™ Lite Software and were then normalized to untreated control. ASO No. in Test Seq ID No. Result 1 233d B 2 234d A 3 143j  C 4 143p A 5 143q A 6 143r.sup.  A 7  143w A 8  143af C 9  143ag C 10  143ah C 11 235b B 12 235d A 13 141d A 14 141g A 15 141i  A 16 237b A 17 237c A 18 237i  C 19  237m A 20 238c A 21 238f.sup.  A 22 239e B 23 240c B 24 241b C 25 242a C 26 246e C 27 247d A 28 248b A 29 248e B 30 248g A 31 152k B 32 152s B 33 152t  B 34 152u B 35  152ab C 36  152ag B 37  152ah C 38  152ai C 39 249c A 40 249e A 41 250b A 42 250g B 43 251c A 44 251f.sup.  A 45 252e B 46 253c A 47 254b C 48 255a C 49 259e C 50 260d B 51 261b A 52 261e B 53 261g A 54 262d B 55 262e A 56 209s A 57 209v B 58 .sup. 209w B 59 209x C 60  209ai B 61  209an C 62  209at A 63  209au B 64  209av B 65 263b B 66 263c A 67 263i.sup.  B 68  263m A 69 264e A 70 264h A 71 265e B 72 266c A 73 267b B 74 268a B 75 272e B 76 273d A 77 274a A 78 274d B 79 274f.sup.  A 80 275g A 81 275i.sup.  B 82 210o A 83 210v B 84 .sup. 210w B 85 210x C 86  210ab B 87  210ac A 88  210ad B 89  210af A 90   210am B 91 276b B 92 276c A 93 276j B 94 276k B 95 277d A 96 277e A 97 278f.sup.  B 98 279c B 99 280b C 100 281a C 101 220d C 102 221d B 103 222b A 104 222c A 105 222f.sup.  B 106 223c B 107 223f.sup.  A 108  218ad B 109 218n A 110 218t.sup.  B 111 218u B 112 218v C 113  218ah C 114  218an A 115  218ao B 116  218ap B 117 224i.sup.  B 118  224m B 119 225c A 120 225f.sup.  A 121 226e B 122 227c A 123 228b C 124 229a C 125 285d C 126 286d A 127 287d B 128 287e A 129 287f.sup.  A 130 288e A 131 288i.sup.  A 132 289d B 134 289h A 135 289o B 136 289p B 137 289q B 138 213o B 139 213p B 140 213q B 141 213s B 142 213y B 143 213z B 144  213aa B 145  213af B 146 290c A 147 290f.sup.  B 148 290i.sup.  A 149 291c B 150 292c C 151 293b C 152 294a C Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons. Reduction of protein level for ASO 1-25 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 143h; B = more than 10% but less than 20% inferior to SEQ ID No. 143h; C = more than 20% but less than 30% inferior to SEQ ID No. 143h. Reduction of protein level for ASO 26-48 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 152h; B = more than 10% but less than 20% inferior to SEQ ID No. 152h; C = more than 20% but less than 30% inferior to SEQ ID No. 152h. Reduction of protein level for ASO 49-74 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y. Reduction of protein level for ASO 75-100 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 210q; B = more than 10% but less than 20% inferior to SEQ ID No. 210q; C = more than 20% but less than 30% inferior to SEQ ID No. 210q. Reduction of protein level for ASO 101-124 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c. Reduction of protein level for ASO 125-152 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 213k; B = more than 10% but less than 20% inferior to SEQ ID No. 213k; C = more than 20% but less than 30% inferior to SEQ ID No. 213k.

    Conclusion:

    [0606] Taken together, dose-dependent downregulation of TGF-R.sub.II mRNA by gymnotic transfer in A549 and ReNcell CX® cells resulted in a dose-dependent reduction of protein levels. Inventive ASOs are potent in protein target downregulation as demonstrated in A549 and ReNcell CX® cells.

    Example 3: Analysis of the Effects of the Antisense-Oligonucleotides to the Downstream Signaling Pathway of TGF-R.SUB.II

    [0607] Functional analyses were performed in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX®). TGF-β downstream signaling pathway was analyzed, following to an effective downregulation of TGF-R.sub.II mRNA and reduction of protein levels by gymnotic transfer of the inventive ASOs. Therefore, mRNA and protein levels of Connective Tissue Growth Factor (CTGF), known as downstream-mediator of TGF-β, were evaluated. In addition, phosphorylation of Smad2 (mothers against decapentaphlegic homolog 2) was examined. The phosphorylation of Smad2 is a marker for an active TGF-β pathway followed by the upregulation of the downstream target gene CTGF.

    Description of Method:

    [0608] Cells were cultured as described before. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For gymnotic transfer, A549 and ReNcell CX® cell medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (Scrambled control), ASO with sequence identification number 218b (Seq. ID No. 218b), No. 218c (Seq. ID No. 218c) was then added in medium at concentrations of 2.5 and 10 μM and respective analysis was performed after 72 h in A549 cells and 96 h in ReNcell CX® cells. To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To check for CTGF and pSmad2 protein levels, Western Blot and immunocytochemistry were used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

    3.1. Results for Seq. ID No. 218b

    3.1.1 Effects on CTGF mRNA and Protein Level

    [0609] CTGF mRNA was significantly and dose-dependently reduced after gymnotic transfer with ASO Seq. ID No. 218b in A549 (72 h) and ReNcell CX® (96 h) cells. Downstream-mediator of TGF-β was reduced to 52%±0.02 in ReNcell CX® cells and to 39%±0.03 in A549 cells after gymnotic transfer with 10 μM Seq. ID No. 218b (Table 20). According to these downregulated CTGF mRNA levels, a strong reduction of CTGF protein expression was observed in A549 cells (Table 21).

    TABLE-US-00072 TABLE 20 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in A549 and ReNcell CX ® cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. Cell line A549 ReNcell CX Target CTGF CTGF Time point 72 h, n = 3 96 h, n = 3 A 1.00 ± 0.08 1.00 ± 0.04 B 2.5 μM 0.87 ± 0.06 0.97 ± 0.06 B 10 μM 0.80 ± 0.03 0.86 ± 0.17 C 2.5 μM 0.60** ± 0.04  0.66** ± 0.02  C 10 μM 0.39** ± 0.03  0.52** ± 0.02  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    TABLE-US-00073 TABLE 21 Densitometric analysis of CTGF Western Blot. Downregulation of CTGF protein 72 h after gymnotic transfer with ASO Seq. ID No. 218b in A549 was recognized. Protein levels were determined relative to housekeeping gene alpha-Tubulin using Studio ™ Lite Software and were normalized to untreated control. Cell line A549 Target CTGF Time point 72 h, n = 1 A 1.00 B 2.5 μM 0.91 B 10 μM 1.31 C 2.5 μM 0.05 C 10 μM 0.086 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

    Conclusion:

    [0610] Functional inhibition of TGF-β signaling was achieved with gymnotic transfer of Seq. ID No. 218b as shown by downregulation of target CTGF mRNA and reduced CTGF protein levels in A549 and ReNcell CX® cells.

    3.1.2 Effects on pSmad2 Protein Level

    [0611] pSmad2 protein levels were analyzed to proof the CTGF downregulation as a specific result of the ASO-mediated TGF-β signaling inhibition.

    [0612] Staining against pSmad2 after gymnotic transfer of ASO Seq. ID No. 218b after 72 h in A549 and 96 h in ReNcell CX® cells showed a dose-dependent inhibition of Smad2 phosphorylation (FIG. 5). In addition, reduction of pSmad2 expression levels by ASO Seq. ID No. 218b was verified by Western Blot Analysis in A549 cells (Table 22).

    TABLE-US-00074 TABLE 22 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein 72 h after gymnotic transfer with ASO Seq. ID No. 218b in A549 was recognized. Protein levels were determined relative to housekeeping gene GAPDH using Studio ™ Lite Software and normalized to untreated control. Cell line A549 Target pSmad2 Time point 72 h, n = 1 A 1.00 B 2.5 μM 1.81 B 10 μM 1.79 C 2.5 μM 0.66 C 10 μM 0.72 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

    Conclusion:

    [0613] Gymnotic transfer of Seq. ID No. 218b in A549 and ReNcell CX® cells resulted in a dose-dependent inhibition of downstream mediators of TGF-β signaling. CTGF and phosphorylation of Smad2 was reduced by ASO Seq. ID No. 218b, both indicating an inhibited TGF-β pathway.

    3.2 Results for Seq. ID No. 218c

    3.2.1 Effects on CTGF mRNA and pSmad2 Protein Level

    [0614] Gymnotic transfer of ASO Seq. ID No. 218c downregulates CTGF mRNA in A549 and ReNcell CX® cells (Table 23). Immunocytochemistry against pSmad2 confirmed an inhibition of TGF-β signaling (FIG. 6). Therefore, downregulation of CTGF mRNA is an direct effect of reduced TGF-β signaling.

    TABLE-US-00075 TABLE 23 Significant downregulation of CTGF mRNA was observed in A549 and ReNcell CX ® cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Cell line A549 ReNcell CX Target CTGF CTGF Time point 72 h, n = 4 96 h, n = 3 A 1.00 ± 0.08 1.00 ± 0.10 B 2.5 μM 0.97 ± 0.07 0.88 ± 0.08 B 10 μM 0.85 ± 0.06 0.89 ± 0.07 D 2.5 μM 0.49** ± 0.05  1.10 ± 0.08 D 10 μM 0.31** ± 0.03  0.82 ± 0.02 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. ± = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0615] ASO Seq. ID No. 218c was efficient in inhibiting TGF-β signaling after downregulation of target TGF-R.sub.II mRNA. This was examined by determination of downregulated CTGF mRNA and reduced pSmad2 protein levels as a marker for TGF-β signaling.

    [0616] Taken together, inventive ASOs are efficient in mediating a functional inhibition of TGF-β signaling by downregulation of TGF-R.sub.II. Thus, inventive ASOs will be beneficial for medical indications in which elevated TGF-β levels are involved, e.g. neurological disorders, fibrosis and tumor progression.

    Example 4: Inhibitory Activity of the Inventive ASOs on Target mRNA Levels in TGF-β1 Treated Cells

    4.1 Gymnotic Uptake of ASOs in A549 and ReNcell CX® Cells after TGF-β1 Pre-Treatment

    [0617] To analyze inhibitory activity of antisense oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX®) under pathological conditions, cells were pre-treated with Transforming Growth Factor-β 1 (TGF-β1). From previous studies it is known that TGF-β1 is found in high concentrations in Cerebrospinal Fluid (CSF) of all neural disorders e.g. ALS. Therefore, inhibitory efficacy of ASOs on TGFβ-signaling was examined after pre-treatment and in presence with TGF-β1. A549 cells were used as reference cell line.

    Description of Method:

    [0618] A549 and ReNcell CX® were cultured as described above. For treatment studies cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For treatment of A549 and ReNcell CX® cells, medium was removed and replaced by fresh full medium (0.5 ml for 24-well). Following TGF-β1 (10 ng/ml, PromoCell #C-63499) exposition for 48 h, medium was changed, TGF-β1 pre-treatment was performed in combination with Ref.1 (Scrambled control, 10 μM), ASO Seq. ID No. 218b (10 μM), or ASO Seq. ID No. 218c (10 μM) in medium. A549 cells were incubated for further 72 h, whereas ReNcell CX® cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) as described before. Used primer pairs for real-time RT-PCR are listed in Table 11.

    4.1.1 Results for Seq. ID No. 218b

    [0619] Efficacy in mRNA downregulation of TGF-R.sub.II by ASO Seq. ID No. 218b was not influenced by TGF-β1 pre-incubation in A549 and ReNcell CX® cells (Table 24, FIG. 7). Target mRNA in A549 cells was significantly downregulated after single treatment (remaining mRNA: 15%±0.05) with ASO, but also after treatment in presence of TGF-β1, following pre-treatment (remaining mRNA: 7%±0.01). In ReNcell CX® cells ASO Seq. ID No. 218b showed similar potency in inhibiting TGF-R.sub.II mRNA in absence of TGF-β1 (25%±0.01) or in presence of TGF-β1, following pre-treatment of TGF-β1 (17%±0.02).

    TABLE-US-00076 TABLE 24 In presence of TGF-β1, ASO Seq. ID No. 218b leads to a potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer in A549 and ReNcell CX ® cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Target Time point TGF-R.sub.II 48 h TGF-β1 −> 72 h/96 h TGF-β1 + ASOs/single treatment A549 ReNcell CX Cell line n = 4 n = 3 A 1.00 ± 0.07 1.00 ± 0.11 B 10 μM 0.90 ± 0.17 0.89 ± 0.26 C 10 μM 0.15** ± 0.05  0.25 ± 0.01 E 10 ng/ml 0.71 ± 0.05 0.79 ± 0.34 E 10 ng/ml + B 10 μM 0.74 ± 0.05 0.89 ± 0.25 E 10 ng/ml + C 10 μM 0.07** ± 0.01  0.27 ± 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1, ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0620] Target mRNA was efficiently downregulated to approx. 20% by gymnotic uptake of inventive ASOs in presence of TGF-β1, following pre-incubation in both tested cell lines.

    4.1.2 Results for Seq. ID No. 218c

    [0621] Downregulation of TGF-R.sub.II mRNA by ASO Seq. ID No. 218c was effective in presence of TGF-β1 in A549 and ReNcell CX® cells (Table 25, FIG. 8). Target mRNA in both tested cell lines was significantly downregulated, regardless of a single treatment with ASO Seq. ID No. 218c or in presence with TGF-β1.

    TABLE-US-00077 TABLE 25 In presence of TGF-β1, ASO Seq. ID No. 218c leads to a potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer in A549 and ReNcell CX ® cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. Target Time point TGF-R.sub.II 48 h TGF-β1 −> 72 h/96 h TGF-β1 + ASOs/single treatment A549 ReNcell CX Cell line n = 2 n = 2 A 1.00 ± 0.12 1.00 ± 0.18 B 10 μM 0.92 ± 0.06 0.51 ± 0.14 D 10 μM 0.31** ± 0.04  0.05** ± 0.01  E 10 ng/ml 0.68 ± 0.05 0.88 ± 0.73 E 10 ng/ml + B 10 μM 0.86 ± 0.04 0.45 ± 0.09 E 10 ng/ml + D 10 μM 0.16** ± 0.05  0.03** ± 0.01  A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-β1, ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0622] Taken together, the inventive ASOs were effective in downregulating TGF-R.sub.II mRNA in presence of TGF-β1, indicating that ASOs are functional under pathological conditions.

    Example 5: Inhibitory Activity of the Inventive ASOs on Target Protein Levels in TGF-β1 Treated Cells

    [0623] To analyze inhibitory activity of antisense oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX®) under pathological conditions, cells were pre-treated with Transforming Growth Factor-β 1 (TGF-β1). From previous studies it is known that TGF-β1 is found in high concentrations in Cerebrospinal Fluid (CSF) of all neural disorders e.g. ALS. Therefore, inhibitory efficacy of ASOs on TGFβ-signaling was examined after pre-treatment and in presence with TGF-β1. A549 cells were used as reference cell line.

    Description of Method:

    [0624] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For investigation of gymnotic transfer effects (A549 and ReNcell CX), after pre-incubation with TGF-β1 (Promocell #C-63499), medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-β1 (10 ng/ml, 48 h) medium was changed, TGF-β1 (10 ng/ml), Ref.1 (Scrambled control, 10 μM), and inventive ASOs (10 μM) was added, in combination and in single treatment, to the cells. A549 cells were incubated for further 72 h, whereas ReNcell CX® cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for protein isolation (6-well dishes) following Western Blot analysis or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Procedures for used techniques were performed as described before. Used antibodies and dilutions for respective methods are listed in Table 13 and 14.

    Results after Gymnotic Transfer

    [0625] Western Blot and immunocytochemical analysis for A549 cells showed that the ASOs having Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, Seq. ID No. 209y generate a potent target downregulation in presence of TGF-β1 (Table 26). Staining of TGF-R.sub.II on fixed ReNcell CX® cells confirmed the results observed in A549 cells. Tested ASOs revealed a strong target downregulation after single treatment but also in presence with TGF-β1.

    TABLE-US-00078 TABLE 26 Densitometric analysis of TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after TGF-β1 pre-incubation followed by gymnotic transfer with different ASOs in A549 was observed. Protein levels were determined relative to housekeeping gene GAPDH using Studio ™ Lite Software and were then normalized to untreated control. Target Time point TGF-R.sub.II 48 h TGF-β1 −> 72 h TGF-β1 + ASOs/single treatment A549 Cell line n = 1 A 1.00 B 10 μM 1.20 C 10 μM 0.31 D 10 μM 0.42 F 10 μM 0.45 G 10 μM 0.35 H 10 μM 0.47 I 10 μM 0.33 J 10 μM 0.27 K 10 μM 0.30 E 10 ng/ml 2.03 E 10 ng/ml + B 10 μM 1.50 E 10 ng/ml + C 10 μM 0.78 E 10 ng/ml + D 10 μM 1.16 E 10 ng/ml + F 10 μM 1.21 E 10 ng/ml + G 10 μM 0.83 E 10 ng/ml + H 10 μM 1.02 E 10 ng/ml + I 10 μM 0.76 E 10 ng/ml + J 10 μM 0.69 E 10 ng/ml + K 10 μM 0.77 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, C = Seq. ID No. 218b, D = Seq. ID No. 218c, F = Seq. ID No. 210q, G = Seq. ID No. 213k, H = Seq. ID No. 143h, I = Seq. ID No. 152h, J = Seq. ID No. 209az, K = Seq. ID No. 209y, E = TGF-β1.

    Conclusion:

    [0626] TGF-β1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, and Seq. ID No. 209y resulted, in addition to target mRNA downregulation, in a reduction of protein level in A549 and ReNcell CX® cells.

    Results after Gymnotic Transfer with Further ASOs:

    [0627] Western Blot analysis showed a reduced amount of TGF-R.sub.II protein in A549 cells (Table 27) after gymnotic transfer for 72 h in comparison to untreated cells and cells treated with scrambled control. Pre-incubation of TGF-β1 followed by gymnotic transfer of tested ASOs evoked a reduction in comparison to cells which were pre-treated with TGF-β1 followed by gymnotic transfer with scrambled control. Immunocytochemical examination of A549 and ReNcell CX® after staining against TGF-R.sub.II showed that tested ASOs mediated a strong reduction of target protein after gymnotic transfer with or without pre-treatment of TGF-β1.

    TABLE-US-00079 TABLE 27 Densitometric analysis of TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after TGF-β1 pre-incubation followed by gymnotic transfer with further TGF-RII- specific antisense oligonucleotides (ASOs) in A549 could be detected. Protein levels were determined relative to housekeeping gene GAPDH using Studio ™ Lite Software and were then normalized to untreated control. ASO No. in Test Seq ID No. Result 1 233d B 2 234d A 3 143j.sup.  C 4 143p A 5 143q A 6 143r.sup.  A 7 .sup. 143w A 8  143af B 9  143ag C 10  143ah C 11 235b B 12 235d A 13 141d A 14 141g A 15 141i.sup.  B 16 237b A 17 237c A 18 237i.sup.  C 19  237m A 20 238c A 21 238f.sup.  A 22 239e B 23 240c B 24 241b C 25 242a C 26 246e C 27 247d A 28 248b A 29 248e B 30 248g A 31 152k B 32 152s B 33 152t.sup.  B 34 152u B 35  152ab C 36  152ag B 37  152ah A 38  152ai A 39 249c A 40 249e A 41 250b A 42 250g B 43 251c A 44 251f.sup.  A 45 252e B 46 253c A 47 254b C 48 255a C 49 259e C 50 260d B 51 261b A 52 261e B 53 261g A 54 262d B 55 262e A 56 209s A 57 209v B 58 .sup. 209w A 59 209x C 60  209ai B 61  209an C 62  209at B 63  209au B 64  209av B 65 263b B 66 263c A 67 263i.sup.  B 68  263m A 69 264e A 70 264h A 71 265e B 72 266c A 73 267b B 74 268a B 75 272e B 76 273d B 77 274a A 78 274d B 79 274f.sup.  A 80 275g A 81 275i.sup.  B 82 210o A 83 210v B 84 .sup. 210w B 85 210x C 86  210ab B 87  210ac A 88  210ad B 89  210af A 90   210am B 91 276b B 92 276c A 93 276j.sup.  B 94 276k B 95 277d A 96 277e A 97 278f.sup.  B 98 279c B 99 280b C 100 281a C 101 220d C 102 221d B 103 222b A 104 222c A 105 222f.sup.  B 106 223c B 107 223f.sup.  A 108  218ad B 109 218n A 110 218t.sup.  B 111 218u B 112 218v C 113  218ah C 114  218an A 115  218ao B 116  218ap B 117 224i.sup.  B 118  224m B 119 225c A 120 225f.sup.  A 121 226e B 122 227c B 123 228b C 124 229a C 125 285d C 126 286d A 127 287d B 128 287e A 129 287f.sup.  A 130 288e A 131 288i.sup.  A 132 289d B 134 289h A 135 289o B 136 289p A 137 289q B 138 213o B 139 213p B 140 213q B 141 213s B 142 213y B 143 213z B 144  213aa B 145  213af C 146 290c A 147 290f.sup.  B 148 290i.sup.  A 149 291c B 150 292c C 151 293b C 152 294a C 125 285d C Reduction of protein level for ASO 1-25 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 143h; B = more than 10% but less than 20% inferior to SEQ ID No. 143h; C = more than 20% but less than 30% inferior to SEQ ID No. 143h. Reduction of protein level for ASO 26-48 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 152h; B = more than 10% but less than 20% inferior to SEQ ID No. 152h; C = more than 20% but less than 30% inferior to SEQ ID No. 152h. Reduction of protein level for ASO 49-74 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y. Reduction of protein level for ASO 75-100 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 210q; B = more than 10% but less than 20% inferior to SEQ ID No. 210q; C = more than 20% but less than 30% inferior to SEQ ID No. 210q. Reduction of protein level for ASO 101-124 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c. Reduction of protein level for ASO 125-152 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 213k; B = more than 10 % but less than 20% inferior to SEQ ID No. 213k; C = more than 20% but less than 30% inferior to SEQ ID No. 213k.

    Conclusion:

    [0628] Even after TGF-β1 pre-incubation, gymnotic transfer of inventive ASOs results in reduction of TGF-R.sub.II protein in A549 and ReNcell CX® cells.

    Example 6: Analysis of the Effects of the Inventive ASOs to the Downstream Signaling Pathway of TGF-R.SUB.II .after TGF-β1-Preincubation

    [0629] Functional analyses were performed in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell MCC)). TGF-β1 downstream signaling pathway was analyzed, following to an effective downregulation of TGF-R.sub.II mRNA and reduction of protein levels by gymnotic transfer of the inventive ASOs in presence of TGF-β1. Therefore, mRNA and protein levels of Connective Tissue Growth Factor (CTGF), known as downstream-mediator of TGF-β, were evaluated. In addition, phosphorylation of Smad2 (mothers against decapentaphlegic homolog 2) was examined. The phosphorylation of Smad2 is a marker for an active TGF-β pathway followed by the upregulation of the downstream target gene CTGF.

    Description of Method:

    [0630] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For investigation of gymnotic transfer effects (A549 and ReNcell CX® cells), after pre-incubation with TGF-β1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-β1 (10 ng/ml, 48 h) medium was changed, TGF-β1 (10 ng/ml), Ref.1 (Scrambled control, 10 μM), ASO with Seq. ID No. 218b (10 μM), and ASO with Seq. ID No. 218c (10 μM) was added in combination and in single treatment to cells. A549 cells were incubated for further 72 h, whereas ReNcell CX® cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To check for CTGF and pSmad2 protein levels, Western Blot and immunocytochemistry were used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

    6.1. Results for Seq. ID No. 218b

    6.1.1 Effects on CTGF mRNA and Protein Levels

    [0631] CTGF mRNA was downregulated after gymnotic transfer with ASO Seq. ID No. 218b in A549 (72 h, 0.52±0.05) and ReNcell CX® (96 h, 0.70±0.25) cells, whereas TGF-β1 incubation for 5 days (A549: 48 h+72 h, 6.92±2.32) or 6 days (ReNcell CX: 48 h+96 h, 1.60±015) respectively, caused significant upregulation of CTGF mRNA. ASO Seq. ID No. 218b was potent enough to evoke a CTGF mRNA downregulation by blocking TGF-β1 effects in presence of TGF-β1 (Table 28, FIG. 11). According to observations for mRNA levels, immunochemical staining against CTGF also confirmed these observations for protein levels (FIG. 12).

    TABLE-US-00080 TABLE 28 Downregulation of CTGF mRNA in presence of TGF-β1 followed by gymnotic transfer with Seq. ID No. 218b in A549 and ReNcell CX ® cells. MRNA expression levels were quantified relative to housekeeping GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Time point CTGF 48 h TGF-β1 −> 72 h/96 h TGF-β1 + ASOs/single treatment A549 ReNcell CX Cell line n = 5 n = 3 A 1.00 ± 0.22  1.00 ± 0.04 B 10 μM 0.89 ± 0.19  0.85 ± 0.01 C 10 μM 0.52 ± 0.05  0.70* ± 0.25 E 10 ng/ml 6.92* ± 2.32  1.60** ± 0.15 E 10 ng/ml + B 10 μM 8.79** ± 2.72  1.71** ± 0.03 E 10 ng/ml + C 10 μM 2.53.sup.++ ± 0.59.sup.  .sup. 1.19.sup.++ ± 0.04 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1, ± = SEM, *p < 0.05, **p < 0.01 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    Conclusion:

    [0632] In presence of TGF-β1 and following treatment of ASO Seq. ID No. 218b resulted firstly in downregulation of TGF-R.sub.II mRNA and secondary in reduced CTGF mRNA and protein levels in A549 and ReNcell CX® cells. That indicates that ASO Seq. ID No. 218b is potent enough to be active under high TGF-β1 pathological conditions and is able to rescue from TGF-β1 mediated effects.

    6.1.2 Effects on pSmad2 Protein Level

    [0633] To verify if CTGF downregulation is a consequence of specific TGF-β signaling inhibition, mediated by ASO Seq. ID No. 218b in presence of TGF-β1, pSmad2 protein levels were analyzed.

    [0634] Staining pSmad2 after TGF-β1 pre-incubation followed by gymnotic transfer of ASO Seq. ID No. 218b with parallel TGF-β1 exposition leads to an inhibition of Smad2 phosphorylation in both tested cell lines (FIG. 13). In addition, reduced pSmad2 protein levels were verified by Western Blot Analysis in A549 and ReNcell CX® cells (Table 29).

    TABLE-US-00081 TABLE 29 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein after gymnotic transfer with ASO Seq. ID No. 218b was recognized. Also reversion of TGF-β1 mediated effects by inventive ASOs was found, when combination treatments were compared. Protein levels were determined relative to housekeeping gene GAPDH using Studio ™ Lite Software and were then normalized to untreated control. Target Time point pSmad2 48 h TGF-β1 −> 72 h/96 h TGF-β1 + ASOs/single treatment A549 ReNcell CX Cell line n = 2 n = 2 A 1.00 ± 0.00 1.00 ± 0.00 B 10 μM 1.23 ± 0.47 0.89 ± 0.22 C 10 μM 0.58 ± 0.08 0.66 ± 0.14 E 10 ng/ml 1.40 ± 0.31 1.19 ± 0.61 E 10 ng/ml + B 10 μM 1.27 ± 0.46 2.19 ± 0.76 E 10 ng/ml + C 10 μM 0.81 ± 0.31 1.55 ± 0.42 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0635] ASO Seq. ID No. 218b results in a functional inhibition of TGF-β signaling in A549 and ReNcell CX® cells in presence of TGF-β1, confirmed by reduced phosphorylation of Smad2.

    6.2 Results for Seq. ID No. 218c

    6.2.1 Effects on CTGF mRNA and Protein Level

    [0636] Data show CTGF mRNA downregulation after combination treatment with ASO Seq. ID No. 218c and TGF-β1 (A549: 0.86, ReNcell CX®: 0.23) compared to combination treatment with scrambled control and TGF-β1 (A549: 5.89, ReNcell CX®: 1.25) (Table 30 and FIG. 14). In addition to these observations, immunochemical staining of CTGF confirmed prevention of TGF-β1 mediated effects on protein level by ASO Seq. ID No. 218c (FIG. 15).

    TABLE-US-00082 TABLE 30 CTGF mRNA levels after TGF-β1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218c and parallel TGF- β1 treatment in A549 and ReNcell CX ® cells. Data confirmed effective prevention of TGF-β1 effects on CTGF mRNA levels by ASO Seq. ID No. 218c. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated controls. Target Time point CTGF 48 h TGF-β1 −> 72 h/96 h TGF-β1 + ASOs/single treatment A549 ReNcell CX Cell line n = 3 n = 2 A 1.00 ± 0.05 1.00 ± 0.03 B 10 μM 0.86 ± 0.11 0.85 ± 0.01 D 10 μM 0.53 ± 0.10 0.17* ± 0.02  E 10 ng/ml 4.71 ± 1.76 1.39 ± 0.08 E 10 ng/ml + B 10 μM 5.89* ± 2.16  1.25 ± 0.44 E 10 ng/ml + D 10 μM 0.86.sup.++ ± 0.06.sup.  0.23*.sup.++ ± 0.02 .sup.   A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-β1, ± = SEM, **p < 0.01 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    Conclusion:

    [0637] Data confirmed an effective prevention of TGF-β1 induced effects on CTGF mRNA and protein levels by ASO Seq. ID No. 218c.

    6.2.2 Effects on pSmad2 Protein Level

    [0638] To verify if CTGF downregulation (6.2.1) is a consequence of TGF-β1 signaling-inhibition mediated by ASO Seq. ID No. 218c, even in presence of TGF-β1-preincubation, pSmad2 protein levels were analyzed.

    [0639] Phosphorylation of Smad2 was induced by TGF-β1 incubation (1.52±0.19), whereas ASO gymnotic transfer mediated a reduction of pSmad2 in A549 cells (0.89±0.05). TGF-β1 pre-incubation with following combination treatment results in suppression of TGF-β1 effects on phosphorylation of Smad2 (Western Blot Analysis, Table 31). Immunocytochemistry supported the data observed by Western Blot Analysis (FIG. 16).

    TABLE-US-00083 TABLE 31 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein after gymnotic transfer with ASO Seq. ID No. 218c was measured. Suppression of TGF-β1 mediated effects by inventive ASOs was shown, when combination treatments were compared. Protein levels were determined relative to housekeeping gene GAPDH using Studio ™ Lite Software and normalized to untreated controls. Target Time point pSmad2 48 h TGF-β1 −> 72 h TGF-β1 + ASOs/single treatment A549 Cell line n = 2 A 1.00 ± 0.00 B 10 μM 1.23 ± 0.27 D 10 μM 0.89 ± 0.05 E 10 ng/ml 1.52 ± 0.19 E 10 ng/ml + B 10 μM 1.27 ± 0.29 E 10 ng/ml + D 10 μM 0.93 ± 0.35 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-β1. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion:

    [0640] ASO Seq. ID No. 218c is efficiently inhibiting TGF-β signaling after TGF-β1 pre-incubation followed by ASO gymnotic transfer. This was shown by examination of downstream pSmad2 protein levels.

    [0641] Taken together, inventive ASOs are extraordinary capable in mediating a functional inhibition of TGF-β signaling in presence of pathological, high TGF-β1 levels by efficiently downregulating TGF-R.sub.II mRNA. Thus, inventive ASOs will be beneficial in medical indications in which elevated TGF-β levels are involved, e.g. neurological disorders, fibrosis, tumor progression and others.

    Example 7: Determination of Prophylactic Activity of the Antisense-Oligonucleotides on mRNA Level (TGF-β1 Post-Treatment)

    [0642] To analyze prophylactic activity of antisense-oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX®), ASOs were transferred to cells by gymnotic uptake following Transforming Growth Factor-β1 (TGF-β1) treatment.

    Description of Method:

    [0643] A549 and ReNcell CX® cells were cultured as described above. For prophylactic treatment studies, cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. Afterwards, Ref. 1 (Scrambled control, 10 μM) or ASO with Seq. ID No. 218b (10 μM) were added to media for 72 h (A549) or 96 h (ReNcell CX®). Following incubation time after gymnotic transfer, TGF-β1 (10 ng/ml, Promocell #C-63499) was added, without medium replacement, to the cells for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) following mRNA analysis by real-time RT-PCR. Ready-to-use and standardized primer pairs for real-time RT-PCR were used and mixed with the respective ready-to-use Mastermix solution (SsoAdvanced™ Universial SYBR® Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Methods were performed as described above.

    7.1 Results for Seq. ID No. 218b

    [0644] Efficacy in TGF-R.sub.II mRNA downregulation by ASO Seq. ID No. 218b was not influenced by TGF-β1 post-incubation in A549 and ReNcell CX® cells (Table 32). Significant decrease of target mRNA in ReNcell CX® cells was shown after single treatment (0.33*±0.11) with ASO Seq. ID No. 218b. ASO gymnotic transfer with post-treatment of TGF-131, strongly reduced the target TGF-R.sub.II mRNA. In A549 cells, Seq. ID No. 218b showed similar potency in inhibiting TGF-R.sub.II mRNA in single (0.25±0.07) or combination treatment with post-incubation of TGF-β1 (0.24±0.06).

    TABLE-US-00084 TABLE 32 Downregulation of TGF-R.sub.II mRNA after gymnotic transfer following TGF-β1 treatment of inventive ASO in A549 and ReNcell CX ® cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Time point TGF-R.sub.II 72 h/96 h ASOs −> 48 h TGF-β1 A549 ReNcell CX Cell line n = 3 n = 3 A 1.00 ± 0.44 1.00 ± 0.19 B 10 μM 0.95 ± 0.22 1.42 ± 0.14 C 10 μM 0.25 ± 0.07 0.33* ± 0.11  E 10 ng/ml 1.96 ± 0.16 1.42 ± 0.08 E 10 ng/ml + B 10 μM 1.14 ± 0.39 1.25 ± 0.14 E 10 ng/ml + C 10 μM 0.24.sup.++ ± 0.06.sup.  0.56.sup.++ ± 0.10.sup.  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1. ± = SEM, *p < 0.05 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    Conclusion:

    [0645] Gymnotic uptake of ASO Seq. ID No. 218b followed by TGF-β1 post-incubation was effective in target TGF-R.sub.II mRNA downregulation, indicating that ASO Seq. ID No. 218b is feasible for prophylactic treatment in medical indications.

    Example 8: Determination of Inhibitory Activity of the Inventive ASOs on Protein Level Following TGF-β1 Treatment

    [0646] To analyze prophylactic activity of inventive ASOs in human neuronal progenitor cells from cortical brain region (ReNcellCX®), ASOs were transferred to cells by gymnotic uptake following TGF-β1 treatment.

    Description of Method:

    [0647] Cells were cultured as described before in standard protocol. For treatment cells were seeded in 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. Afterwards, Ref.1 (Scrambled control, 10 μM) or ASO sequence identification number 218b (Seq. ID No. 218b, 10 μM) were added to media for 72 h (A549) or 96 h (ReNcell CX®). Following gymnotic transfer TGF-β1 (10 ng/ml, Promocell #C-63499) was added, without medium replacement, to the cells for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for immunocytochemical analysis. Procedure was performed as described before. Used antibodies and dilutions for respective methods are listed in Table 13 and 14.

    8.1 Results of TGF-R.SUB.II .Protein Reduction after Gymnotic Transfer with Seq. ID No. 218b Following TGF-β1 Treatment

    [0648] Immunocytochemical analysis against TGF-R.sub.II for A549 and ReNcell CX® cells showed that ASO Seq. ID No. 218b generates potent TGF-R.sub.II mRNA target downregulation after following TGF-β1 treatment (FIG. 17).

    Conclusion:

    [0649] Gymnotic transfer of ASO Seq. ID No. 218b following TGF-β1 treatment resulted in target mRNA downregulation, as well as a strong reduction of TGF-R.sub.II protein level in A549 and ReNcell CX® cells.

    [0650] Taken together, efficacy of downregulating TGF-R.sub.II protein mediated by ASO Seq. ID No. 218b in combination with post-treatment of TGF-β1 was still given, concluding that the inventive ASOs are effective for prophylactic applications.

    Example 9: ASO Treatment Effects on Downstream Signaling Pathway of TGF-R.SUB.II .Following TGF-β1 Treatment

    [0651] Efficacy of inventive ASOs in mediating an inhibition of TGF-β signaling was evaluated for TGF-β1 treatment followed gymnotic transfer in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX®). Therefore, downstream molecules of TGF-β signaling, Smad3 (mothers against decapentaphlegic homolog 3) and Connective Tissue Growth factor (CTGF), were analyzed.

    Description of Method:

    [0652] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. Afterwards, Ref.1 (Scrambled control, 10 μM) or ASO Seq. ID No. 218b (10 μM) were added to media for 72 h (A549) or 96 h (ReNcell CX®). Following gymnotic transfer, TGF-β1 (10 ng/ml, Promocell #C-63499) was added without medium replacement for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To determine pSmad3 protein levels, immunocytochemistry was used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

    9.1. Results for Seq. ID No. 218b
    9.1.1 Effects on CTGF mRNA and pSmad3 Protein Level

    [0653] CTGF mRNA was reduced after gymnotic transfer with ASO Seq. ID No. 218b in A549 (5 days: 0.67±0.02) and ReNcell CX® (6 days: 0.70±0.02) cells. Adding TGF-β1 after 72 h or 96 h respectively, cells react with an increase of CTGF mRNA, but in comparison to gymnotic transfer of scrambled control following TGF-β1 treatment, induction of CTGF mRNA was strongly reduced (Table 33). To verify if CTGF mRNA downregulation was a consequence of TGF-β signaling inhibition, mediated by ASO Seq. ID No. 218b, also after followed TGF-β1 treatment, pSmad3 protein levels were examined. FIG. 18 demonstrates that TGF-β signaling was in fact blocked by gymnotic transfer of ASO Seq. ID No. 218b in A549 (FIG. 18 A) and ReNcell CX® cells (FIG. 18 B). This effect was also present after gymnotic transfer of tested ASO following TGF-β1 treatment.

    TABLE-US-00085 TABLE 33 Downregulation of CTGF mRNA after gymnotic transfer of ASO Seq. ID No. 218b followed by TGF-β1 treatment in A549 and ReNcell CX ® cells. Quantification of mRNA expression levels were performed relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point CTGF 72 h/96 h ASOs −> +/− 48 h TGF-β1 A549 ReNcell CX Cell line n = 3 n = 3 A 1.00 ± 0.13 1.00 ± 0.09 B 10 μM 0.80 ± 0.03 1.07 ± 0.07 C 10 μM 0.67 ± 0.02 0.70 ± 0.02 E 10 ng/ml 4.54** ± 0.68  1.56* ± 0.08  E 10 ng/ml + B 10 μM 4.07** ± 0.38  1.62* ± 0.09  E 10 ng/ml + C 10 μM 1.90.sup.+ ± 0.03  0.97.sup.++ ± 0.10.sup.  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1. ± = SEM, *p < 0.05, **p < 0.01 in reference to A, .sup.+p < 0.05, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    Conclusion:

    [0654] Gymnotic transfer of ASO Seq. ID No. 218b resulted in downregulation of TGF-R.sub.II mRNA and protein, as well as in reduced CTGF mRNA and pSmad3 protein levels in A549 and ReNcell CX® cells, independently of TGF-β1 treatment.

    [0655] That indicates that ASO Seq. ID No. 218b is potent enough to be also active under prophylactic conditions to resume or reduce ongoing TGF-β1 mediated effects.

    Example 10: Analysis of Potential Proinflammatory and Toxicological Effects of Antisense-Oligonucleotides

    10.1 Peripheral Blood Mononuclear Cell (PBMC) Assay

    [0656] To analyze antisense-oligonucleotide (ASO) for immunostimulatory properties, peripheral blood mononuclear cells (PBMCs) were incubated with control ASOs and test compounds followed by ELISAs for IFNα and TGFα.

    Description of Method:

    [0657] PBMCs were isolated from buffy coats corresponding to 500 ml full blood transfusion units. Each unit was obtained from healthy volunteers and glucose-citrate was used as an anti-agglutinant. The buffy coat was prepared and delivered by the Blood Bank Suhl on the Institute for Transfusion Medicine, Germany. Each blood donation was monitored for HIV antibody, HCV antibody, HBs antigen, TPHA, HIV RNA, and SPGT (ALAT). Only blood samples tested negative for infectious agents and with a normal SPGT value were used for leukocyte and erythrocyte separation by low-speed centrifugation. The isolation of PBMCs was performed about 40 h following blood donation by gradient centrifugation using Ficoll-Histopague® 1077 (Heraeus™ Multifuge™ 3 SR). For IFNα assay, PBMCs were seeded at 100,000 cells/96-well in 100 μl complete medium plus additives (RPMI1640, +L-Glu, +10% FCS, +PHA-P (5 μg/ml), +IL-3 (10 μg/ml)) and test compounds (5 μl) were added for direct incubation (24 h, 37° C., 5% CO.sub.2). For TNFα assay, PBMCs were seeded at 100,000 cells/96-well in 100 μl complete medium w/o additives (RPMI1640, +L-Glu, +10% FCS) and test compounds (5 μl) were added for direct incubation (24 h, 37° C., 5% CO.sub.2). ELISA (duplicate measurement out of pooled supernatants, 20 μl) for hulFNα (eBioscience, #BMS216INSTCE) was performed according to the manufacturer's protocol. ELISA (duplicate measurement out of pooled supernatants, 20 μl) for huTNFα (eBioscience, #BMS223INSTCE) was performed according to the manufacturer's protocol.

    Results:

    [0658] There was no immunostimulatory effect of ASO treatment on PBMCs indicated by no detectable IFNα (Table 34) and TNFα (Table 35) secretion upon ASO incubation. Assay functionality is proven by the immunostimulatory effect of immunostimulatory, cholesterol-conjugated siRNA (XD-01024; IFNα) and polyinosinic:polycytidylic acid (poly I:C; TNFα; InvivoGen #tlrl-pic) which is a synthetic analog of double-stranded RNA, binds to TLR3 and stimulates the immune system.

    TABLE-US-00086 TABLE 34 IFNα response to inventive ASO exposure: shows the IFNα response of PBMCs upon ASO incubation. Quantification of expression levels were determined to positive controls (ODN2216 [class A CpG oligonucleotide; recognized by TLR9 and leading to strong immunostimulatory effects; InvivoGen tlrl-2216], poly I:C, XD-01024) using ELISA assay. Mean of duplicates [pg/ml] Test candidate Donor 1 Donor 2 mock −0.084 0.720 Seq. ID No. 209y −0.061 −0.039 Seq. ID No. 209t −0.308 −0.520 Seq. ID No. 209v −0.191 −1.252 Seq. ID No. 218b −0.001 −0.093 Seq. ID No. 218m −0.140 −0.163 Seq. ID No. 218q −0.755 0.005 Seq. ID No. 218c −0.852 −0.805 Seq. ID No. 218t −0.469 0.450 ODN2216 0.300 1.311 poly I:C −1.378 2.053 XD-01024 13.961 26.821 All values except positive control (XD-01024) below limit of quantification

    TABLE-US-00087 TABLE 35 TNFα response to inventive ASO exposure: Quantification of expression levels were determined to control candidates (ODN2216, poly I:C, XD-01024) using ELISA assay. Mean of duplicates [pg/ml] Test candidate Donor 1 Donor 2 mock 0.647 −0.137 Seq. ID No. 209y 2.397 −0.117 Seq. ID No. 209t 0.734 0.193 Seq. ID No. 209v 0.360 0.063 Seq. ID No. 218b 0.670 0.183 Seq. ID No. 218m 0.594 0.519 Seq. ID No. 218q 0.049 0.194 Seq. ID No. 218c −0.212 0.029 Seq. ID No. 218t 0.593 0.758 ODN2216 0.085 0.894 poly I:C 115.026 102.042 XD-01024 1.188 1.418 All values except positive control (poly I:C) below limit of quantification

    10. 2 In Vivo Toxicology of Inventive Antisense-Oligonucleotides

    [0659] To analyze antisense-oligonucleotides (ASOs) for toxicological properties, C57/Bl6N mice received three intravenous ASO injections, and following sacrification, transaminase levels within serum, liver and kidney were examined.

    Description of Method:

    [0660] Female C57/Bl6N mice at the age of 6 weeks were treated with test compounds (Seq. ID No. 218b, Seq. ID No. 218c) for seven days. ASOs (200 μl, 15 mg/kg/BW) were injected intravenously on day one, two, and three of the treatment period. Body weight development (Seq. ID No. 218c) was monitored on every consecutive day and on day four serum was collected from the vena fascicularis. On day eight the animals were sacrificed (CO.sub.2) and serum from the vena cava, the liver (pieces of ≈50 mg), the kidneys, and the lung were collected for mRNA and transaminase quantification. TGF-R.sub.II mRNA levels were determined in liver, kidney, and lung lysate by bDNA assay (QuantiGene® kit, Panomics/Affimetrix). Aspartate transaminase (ASP) and alanine transaminase (ALT) were measured on Cobas Integra® 400 from 1:10 diluted serum.

    TABLE-US-00088 TABLE 36 Serum expression levels of alanine transaminase and aspartate transaminase of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. Serum transaminases [U/L] 3 days post injection 7 days post injection Test compound ALT AST ALT AST Seq. ID No. 209ax 13.87 ± 1.44 47.33 ± 15.88  64.91 ± 21.01 108.99 ± 13.56  Seq. ID No. 143h 13.68 ± 3.33 53.50 ± 6.99  12.47 ± 1.64 33.35 ± 8.17  Seq. ID No. 152h 16.66 ± 6.29 67.23 ± 29.91 17.49 ± 2.81 45.75 ± 17.14 Seq. ID No. 209ay 18.29 ± 6.37 69.96 ± 35.44 287.29 ± 65.39 273.45 ± 101.33 Seq. ID No. 210q 11.70 ± 3.80 36.44 ± 5.36  11.11 ± 6.31 40.81 ± 13.32 Seq. ID No. 218b 19.60 ± 8.62 67.61 ± 42.75 18.38 ± 4.60 48.91 ± 17.86 Seq. ID No. 213k 13.59 ± 3.28 54.47 ± 36.15  96.00 ± 46.74 89.12 ± 21.82 Saline  9.52 ± 9.21 67.18 ± 28.60  9.99 ± 2.29 28.29 ± 2.23  ± = SEM.

    TABLE-US-00089 TABLE 37 Expression levels of TGF-R.sub.II within liver, kidney, and lung tissue of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. TGF-RII mRNA/GAPDH mRNA expression Test compound Liver Kidney Lung Seq. ID No. 209ax 0.64 ± 0.03 1.31 ± 0.11 13.25 ± 0.67 Seq. ID No. 143h 0.26 ± 0.02 0.65 ± 0.22 11.10 ± 0.11 Seq. ID No. 152h 0.58 ± 0.10 0.87 ± 0.17 13.42 ± 0.69 Seq. ID No. 209ay 0.62 ± 0.06 1.30 ± 0.10 13.93 ± 0.57 Seq. ID No. 210q 0.39 ± 0.06 0.83 ± 0.15 13.53 ± 1.23 Seq. ID No. 218b 0.72 ± 0.08 0.97 ± 0.06 15.63 ± 1.45 Seq. ID No. 213k 0.42 ± 0.01 1.20 ± 0.04 14.44 ± 1.03 Saline 0.66 ± 0.04 1.10 ± 0.08 15.14 ± 0.65 ± = SEM.

    TABLE-US-00090 TABLE 38 Serum expression levels of alanine transaminase and aspartate transaminase of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. Serum transaminases [U/L] Test 3 days post injection 7 days post injection compound ALT AST ALT AST Seq. ID No. 24.63 ± 2.10 51.87 ± 5.99  18.10 ± 4.01 39.99 ± 2.09 218c Saline 28.68 ± 3.23 79.95 ± 30.24 14.52 ± 4.89 36.08 ± 3.32 ± = SEM.

    TABLE-US-00091 TABLE 39 Expression levels of TGF-R.sub.II within liver and kidney tissue of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. TGF-RII mRNA/GAPDH mRNA expression Test compound Liver Kidney Seq. ID No. 218c 0.21 ± 0.03 0.16 ± 0.02 Saline 0.35 ± 0.05 0.24 ± 0.03 ± = SEM.

    TABLE-US-00092 TABLE 40 Body weight development during the 7-day ASO treatment paradigm. Body weight gain was quantified compared to body weight on day 0, which was set to 100%. Body weight development [%] Test compound Day 0 Day 1 Day 2 Day 3 Day 4 Day 7 Seq. ID 100% 99% 99% 99% 102% 104% No. 218c Saline 100% 99% 100% 100% 101% 103%

    Conclusion:

    [0661] There were no proinflammatory or toxic effects of relevant inventive ASOs on PBMCs or C57/Bl6N mice. Therefore, ASO treatment targeting TGF-R.sub.II reflects a safe method to treat a variety of TGF-β associated disorders.

    Example 11: Determination of Intracerebroventricular Infusion of Inventive ASOs on TGF-β Induced Neural Stem Inhibition and Neural Progenitor Cell Proliferation In Vivo

    [0662] The goal of the present study was to evaluate the potential of inventive ASOs against TGF-R.sub.II i) to prevent and ii) to treat the TGF-β1 induced effects on neural stem and progenitor cell proliferation in vivo.

    Description of Method:

    11.1 Prevention of TGF-β1 Associated Downregulation of Neurogenesis

    [0663] Two-month-old female Fischer-344 rats (n=32) received intracerebroventricular infusions via osmotic minipumps (Model 2002, Alzet) connected to stainless steel cannulas. The surgical implantation of the minipumps was performed under deep anesthesia using intramuscular injections. Animals were infused with inventive ASOs according to the invention (1.64 mM concentration present in the pump), scrambled ASO (1.64 mM concentration present in the pump) or aCSF (artificial cerebrospinal fluid) for 7 days. At day 8, pumps were changed and the animals were infused with either i) aCSF, ii) TGF-β1 (500 ng/ml present in the pump), iii) TGF-β1 (500 ng/ml present in the pump) plus scrambled ASO (1.64 mM concentration present in the pump), or iv) TGF-β1 (500 ng/ml present in the pump) plus inventive ASO (1.64 mM concentration present in the pump) for 14 days. At the end of the infusion-period all animals were transcardially perfused with 4% paraformaldehyde. The brains were analyzed for cannula tract localization and animals with incorrect cannula placement were excluded from the analysis. During the last 24 hours of the pump period, the animals received an intraperitoneal injection of 200 mg/kg bromo-deoxyuridine (BrdU).

    [0664] The tissue was processed for chromogenic immunodetection of BrdU-positive cells in 40 μm sagital sections. BrdU positive cells were counted within three 50 μm×50 μm counting frames per section located at the lowest, middle and upper part of the subventricular zone. Positive profiles that intersected the uppermost focal plane (exclusion plane) or the lateral exclusion boundaries of the counting frame were not counted. For hippocampal analysis, the volume of the hippocampus was determined and all positive cells within and adjacent to the boundaries were counted. The total counts of positive profiles were multiplied by the ratio of reference volume to sampling volume in order to obtain the estimated number of BrdU-positive cells for each structure. All extrapolations were calculated for one cerebral hemisphere and should be doubled to represent the total brain values. Data are presented as mean values±standard deviations (SD). Statistical analysis was performed using the unpaired, two-sided t-test comparison Student's t-test between the TGF-β1 treated and control groups (Graph Pad Prism 4 software, USA). The significance level was assumed at p<0.05.

    11.2 Treatment of TGF-β1 Associated Down-Regulation of Neurogenesis

    [0665] Animals received either aCSF or recombinant human TGF-ß1 (500 ng/ml present in pump) at a flow rate of 0.5 μl per hour for 14 days. After 14 days, pumps were changed and the animals were infused with either i) aCSF, ii) recombinant human TGF-ß1 (500 ng/ml present in pump) or co-infused with iii) inventive ASO (1.64 mM concentration present in the pump) plus recombinant human TGF-ß1 (500 ng/ml present in pump) or iv) scrambled ASO (1.64 mM concentration present in the pump) plus recombinant human TGF-ß1 (500 ng/ml present in pump). At the end of the infusion-period all animals were transcardially perfused with 4% paraformaldehyde. The brains were analyzed for cannula tract localization and animals with incorrect cannula placement were excluded from the analysis. During the last 24 hours of the pump period, the animals received an intraperitoneal injection of 200 mg/kg bromo-deoxyuridine (BrdU). Histological analysis was done as described above (11.1).

    Results:

    [0666] The treatment with ASO of Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q specifically and partially reduced the effect of TGF-β1 on cell proliferation in the hippocampus and in the ventricle wall. Treatment with an inventive ASO specifically and partially rescues from the inhibitory effect of TGF-β1 on neurogenesis.

    Conclusion:

    [0667] The ASOs of the present invention demonstrating cross-reactivity with rodents induce neurogenesis in this in vivo experiment. The ASOs of the present invention demonstrating no cross-reactivity, exert mostly even more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-ß1 induced inhibition of neural stem and progenitor proliferation.

    Example 12: Analysis of the Effect of the Inventive Antisense-Oligonucleotides on Proliferation and Specific Markers of Human Neural Progenitor Cells

    [0668] Amyotrophic lateral sclerosis (ALS) is a neurodegenerative lethal disorder with no effective treatment so far. The current molecular genetic campaign is increasingly elucidating the molecular pathogenesis of this fatal disease, from previous studies it is known that TGF-β is found in high concentrations in Cerebrospinal Fluid (CSF) of ALS patients. These high levels of circulating TGF-β are known to promote stem cell quiescence and therefore cause inhibition of adult neurogenesis within the subventricular zone (SVZ) of the brain. Thus, regeneration of degenerating neurons seems to be prevented by an enhanced TGF-β signaling.

    [0669] To figure out if selective inhibition of TGF-β signaling mediated by the inventive antisense-oligonucleotides might allow reactivation of adult neurogenesis, evidence of TGF-β mediated cell cycle arrest has to be proofed.

    Description of Methods:

    Cell Cycle Arrest Studies:

    [0670] Cells were cultured as described before in standard protocol. For experiments, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For determination of TGF-β1 mediated effects on cell cycle under proliferative (+EGF/FGF) (Millipore: EGF #GF144, bFGF #GF003) or differentiating (−EGF/FGF) conditions, cells were treated for 4 d with TGF-β1 (PromoCell #C-63499, 10 or 50 ng/ml) after removing and replacement of respective medium. At day 4 medium was refreshed and TGF-β1 treatment was repeated until day 7. On day 7, cells were harvested by washing twice with PBS and subsequently used for RNA (24-well dishes) isolation as described above. For evaluating TGF-β1-mediated effects on cell cycle by real-time RT-PCR, mRNA of proliferation marker Ki67, tumor suppressor gene p53, cyclin-dependent kinase inhibitor 1 (p21) and of neurogenesis marker Doublecortin (DCX) were analyzed. Respective primer pairs are listed in Table 11.

    mRNA Analysis for Effects of ASO Seq. ID No. 218b on Human Neural Progenitor Cells:

    [0671] Cells were cultured as described before in standard protocol. For experiments, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For present experiments, cell medium was changed and Ref.1 (Scrambled control, 2.5 and 10 μM), ASO with Seq. ID No. 218b (2.5 and 10 μM) or TGF-β1 (10 ng/ml, Promocell #C-63499) were added to cells for 96 h. After incubation time, medium was changed once more and further treatment was performed for further 96 h. After 8 days of treatment cells were harvested. Cells were washed twice with PBS and subsequently used for RNA (24-well dishes) isolation. To evaluate effects on progenitor cells, Nestin (early neuronal marker), Sox2 (early neuronal marker), DCX (indicator of neurogenesis) and Ki67 (proliferation marker) mRNA levels were determined by real-time RT-PCR as described before. Respective primer pairs are listed in Table 11.

    Proliferative and Differentiating Effects of TGFR.SUB.II .Specific ASOs by Gymnotic Transfer on ReNcell CX® Cells:

    [0672] The next goal was to investigate, whether TGF-R.sub.II specific ASO influence the proliferation of ReNcell CX® cells. Therefore, cells were cultured as described before and seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) or 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. For obtaining a proliferation curve, cells were treated after medium change for 72 h with Ref.1 (Scrambled control, 2.5 and 10 μM) and with ASO Seq. ID No. 218b (2.5 and 10 μM). After incubation time, medium change and treatment was repeated two times. After collecting supernatant, remaining cells were harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2×), treated with accutase (500 μl/well) and incubated for 5 min at 37° C. Afterwards 500 μl medium were added and cell number was determined using Luna FL™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 μl of the cell suspension were added to 2 μl of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 μl were added onto Cell Counting Slide (Biozym #872011), cells were counted and calculated in total cells/ml and percentage of alive cells compared to dead cells. After gymnotic transfer of Ref.1 (10 μM), Seq. ID No. 218b (10 μM) and corresponding treatment of TGF-β1 (10 ng/ml) for 8 days, cells of 8-well cell culture slide dishes were fixed and stained with an antibody against Ki67. For investigating differentiation ability of ReNcell CX® cells after gymnotic transfer, other 8-well cell culture slide dishes were treated with Ref.1 (10 μM), Seq. ID No. 218b (10 μM) and corresponding treatment of TGF-β1 (10 ng/ml) for 96 h under proliferative conditions (+EGF/FGF). Afterwards, one part of the cells was treated for further 96 h under proliferative conditions whereas the other part of cells was treated and hold under differentiating conditions (−EGF/FGF). Following staining of cells, Neurofilament N (NeuN) and βIII-Tubulin expression levels were determined by fluorescence microscopy. Protocol for harvesting, fixing and staining cells was described above and respective antibody dilutions are listed in Table 14.

    mRNA Analysis of Markers for Proliferation and Neurogenesis after Gymnotic Transfer Following TGF-β1 Pre-Incubation:

    [0673] Cells were cultured as described before in standard protocol. For experiments cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and incubated overnight at 37° C. and 5% CO.sub.2. For inducing cell cycle arrest, ReNcell CX® cells were treated with TGF-β1 for 4 days. Afterwards medium was changed and TGF-β1 (10 ng/ml) was added freshly. One day 8 medium was changed on more time, and gymnotic transfer was performed for 96 h by adding Ref.1 (10 μM), Seq. ID No. 218b (10 μM) in combination with TGF-β1 (10 ng/ml). Cells were harvested after incubation by washing twice with PBS. Following RNA isolation and mRNA analysis by real-time RT-PCR were performed as described.

    12.1.1 Mediation of Cell Cycle Arrest by TGF-β1 in Human Neural Progenitor Cells

    [0674] Detection of stem cell quiescence markers showed that TGF-β1 mediates cell cycle arrest 7 days after exposure of cells. Proliferation marker Ki67 mRNA expression was dose-dependently reduced. Also mRNA expression of tumor suppressor gene p53 was downregulated correlating to TGF-β1 concentration. In contrast, cyclin-dependent kinase inhibitor 1 (p21) was significantly upregulated by TGF-β1. In summary these results indicate stem cell quiescence induced by TGF-β1. Interestingly, DCX, a marker for neurogenesis, was strongly reduced by TGF-β1 (Table 41).

    TABLE-US-00093 TABLE 41 mRNA expression of Ki67, p27, p21, and DCX 7 days after TGF-β1 treatment in ReNcell CX ® cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 7 days after TGF-β1 exposure Ki67 p53 p21 DCX Target n = 3 n = 3 n = 3 n = 3 A + EGF/ 1.00 ± 0.38 1.00 ± 0.38 1.00 ± 0.25 1.00 ± 0.49 FGF E 10 ng/ml + 0.67 ± 0.20 0.66 ± 0.18 1.90* ± 0.22  0.37 ± 0.06 EGF/FGF E 50 ng/ml + 0.43 ± 0.09 0.42 ± 0.06 1.45 ± 0.16 0.16 ± 0.01 EGF/FGF A − EGF/ 1.00 ± 0.15 1.00 ± 0.13 1.00 ± 0.14 1.00 ± 0.31 FGF E 10 ng/ml − 0.87 ± 0.08 0.97 ± 0.10 1.00 ± 0.04 0.72 ± 0.14 EGF/FGF E 50 ng/ml − 0.93 ± 0.11 0.93 ± 0.09 0.90 ± 0.09 0.71 ± 0.24 EGF/FGF A = untreated control, E = TGF-β1. ± = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparison.

    Conclusion

    [0675] Proliferation of ReNcell CX® cells was blocked by TGF-β1.

    12.1.2 Results of Antisense-Oligonucleotide Effects on Markers of Human Neuronal Stem Cells

    [0676] To figure out the effect of ASO Seq. ID No. 218b on stem cell markers, 8 days after repeated gymnotic transfer (2×96 h) in ReNcell CX® cells, different markers of early neural progenitor cells were tested (Table 42). Gene expression levels of Nestin and Sox2 were not influenced by ASO Seq. ID No. 218b. GFAP mRNA was slightly upregulated after gymnotic transfer with 10 μM ASO Seq. ID No. 218b and in contrast, DCX was clearly induced after gymnotic uptake of ASO Seq. ID No. 218b. Expression of all tested markers was strongly reduced after TGF-β1 treatment (8 d) (Table 42, FIG. 19).

    TABLE-US-00094 TABLE 42 mRNA expression of Nestin, Sox2, GFAP and DCX 8 days after gymnotic transfer of Seq. ID No. 218b in ReNcell CX ® cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 8 days after gymnotic transfer or TGF-β1 exposure Nestin Sox2 GFAP DCX Target n = 4 n = 4 n = 4 n = 4 A 1.00 ± 0.18 1.00 ± 0.25 1.00 ± 0.22 1.00 ± 0.32 B 2.5 0.97 ± 0.32 0.88 ± 0.33 0.78 ± 0.13 1.31 ± 0.42 μM B 10 0.89 ± 0.16 0.79 ± 0.13 1.02 ± 0.20 1.44 ± 0.48 μM C 2.5 1.09 ± 0.21 0.93 ± 0.09 0.99 ± 0.14 1.67 ± 0.46 μM C 10 0.90 ± 0.09 0.89 ± 0.11 1.21 ± 0.11 1.95 ± 0.37 μM E 10 0.48 ± 0.12 0.32 ± 0.06 0.41# ± 0.13  0.05+# ± 0.01 .sup.  ng/ml A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1, ± = SEM, +p < 0.05 in reference to C 2.5 μM, #p < 0.05 in reference to C 10 μM. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparison.

    Conclusion:

    [0677] Results for mRNA analysis indicate that ASO Seq. ID No. 218b guides ReNcell CX® cells into the direction of an even more stem cell like state (GFAP upregulation). In addition, induction of DCX indicates an elevated neurogenesis. TGF-β1 treatment results in an opposite direction.

    12.1.3 Results of Antisense-Oligonucleotide Effects on Proliferation of Human Neuronal Stem Cells

    [0678] Further analysis was performed to investigate whether gymnotic transfer of ASO Seq. ID No. 218b has really effects on proliferation rate by counting cells 9 days after repeated gymnotic transfer (3×72 h) and determination of Ki67 protein levels 8 days after gymnotic uptake (2×96 h).

    Results

    [0679] Cell number was increased after gymnotic uptake of ASO Seq. ID No. 218b in accordance to an increased protein expression of proliferation marker Ki67 observed in immunochemical staining of cells (Table 43, FIG. 20). Fluorescence analysis of immunocytochemical staining also revealed a proliferation stop mediated by TGF-β1.

    TABLE-US-00095 TABLE 43 Increased cell number 9 days after repeated gymnotic transfer (3 × 72 h) of ReNcell CX ® cells. Cell number was determined using Luna FL ™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Cell line ReNcell CX Cell number alive cells × 10.sup.5, n = 2 dead cells × 10.sup.5, n = 2 A 3.34 ± 0.09 0.51 ± 0.05 B 2.5 μM 4.34 ± 0.56 0.60 ± 0.09 B 10 μM 4.36 ± 0.96 0.58 ± 0.09 C 2.5 μM 4.63 ± 1.28 0.47 ± 0.02 C 10 μM 5.24 ± 0.42 0.37 ± 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM.

    Conclusion

    [0680] Gymnotic transfer of ASO Seq. ID No. 218b in ReNcell CX® cells results in an increased cell number, paralleled by an enhanced Ki67 protein expression, altogether indicating increased neuronal precursor proliferation.

    12.1.3 Results of Antisense-Oligonucleotide Effects on Differentiation Ability of Human Neuronal Stem Cells

    [0681] To exclude an influence of ASO Seq. ID No. 218b on cell ability to differentiate, ASO Seq. ID No. 218b was transferred to cells by gymnotic uptake for 96 h under proliferative conditions (+EGF/FGF). After incubation time, medium was changed and to one part of cells proliferative medium was added whereas to the other part of cells differentiating medium (−EGF/FGF) was added. Afterwards, another gymnotic transfer for 96 h was performed. Cells were analyzed by expression levels of neuronal markers Neurofilament N (NeuN) and βIII-Tubulin.

    Results

    [0682] Immunochemical staining against NeuN (FIG. 23A) and βIII-Tubulin (FIG. 23B) demonstrates no effects on the ability to differentiate after gymnotic ASO transfer under proliferative conditions followed by gymnotic transfer under differentiating conditions. Signal for βIII-Tubulin, a human neuron specific protein, was not influenced by ASO Seq. ID No. 218b under differentiating conditions and was comparable to untreated control. Also NeuN expression was not influenced after gymnotic transfer under differentiating conditions. Thus, cells are still capable to differentiate into neural cells. Strikingly, ReNcell CX® cells expressed neuronal marker NeuN and βIII-Tubulin after gymnotic transfer of ASO under proliferative conditions (2×96 h) for both periods, indicating that gymnotic transfer of ASO could promote a specific shift into differentiation of neurons even under proliferative conditions. In addition, elevated proliferation rates of neural precursor cells were observed (Table 43, FIG. 20). Further, staining against NeuN revealed that cells treated with ASO Seq. ID 218b look more viable compared to all other treatments (FIG. 21A). Obviously, cells which were treated with TGF-β1 were significantly less proliferative.

    Conclusion

    [0683] The ability to differentiate was not influenced by inventive ASO Seq. ID No. 218b. Interestingly, ReNcell CX® cells showed differentiation to neurons after gymnotic transfer under proliferative and differentiating conditions. This indicates in context to the observation of an increased proliferation rate, that inventive ASO Seq. ID No. 218b promotes neurogenesis with a tendency towards elevated neuronal differentiation.

    12.1.4 Results of Inventive Antisense-Oligonucleotides on Proliferation of Human Neuronal Stem Cells after TGF-β1 Pre-Incubation

    [0684] To analyze whether gymnotic transfer of ASO Seq. ID No. 218b is efficient in reversing TGF-β1 mediated effects on ReNcell CX® cells, further studies were performed with TGF-β1 pre-incubation for 7 days followed by gymnotic transfer for 8 days (2×96 h).

    Results

    [0685] Gene expression of GFAP (Table 44, FIG. 22A) as an early neuronal marker, Ki67 (Table 44, FIG. 22B), as a marker for proliferation, and DCX (Table 44, FIG. 22C) as marker for neurogenesis were elevated after single ASO treatment, whereas TGF-β1 resulted in the opposite. In addition, 7 days after TGF-β1 pre-incubation, inventive ASO treatment reversed TGF-β1-induced effects. Thus the analysis demonstrates that ASO Seq. ID No. 218b is potent in recovering TGF-β1 mediated effects upon stem cell and proliferation markers

    TABLE-US-00096 TABLE 44 mRNA expression of GFAP, Ki67 and DCX 7 days after TGF- β1 pre-incubation followed by 2 × 96 h gymnotic transfer of Seq. ID No. 218b in ReNcell CX ® cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 7 d after TGF-β1 pre-incubation followed by 2 × 96 h gymnotic transfer GFAP Ki67 DCX Target n = 2 n = 1 n = 2 A 1.00 ± 0.20 1.00 1.00 ± 0.16 B 10 μM 1.62 ± 0.15 0.91 1.52 ± 0.24 C 10 μM 2.23 ± 0.52 1.52 4.82 ± 1.15 E 10 ng/ml 0.76 ± 0.01 0.48 0.68 ± 0.03 E 10 ng/ml + B 10 μM 0.58 ± 0.07 0.61 0.83 ± 0.10 E 10 ng/ml + C 10 μM 2.04 ± 1.04 7.40 1.55 ± 0.24 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1, ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    Conclusion

    [0686] Results indicate that adult neurogenesis could be reactivated by inventive TGF-R.sub.II specific ASO-mediated blocking of TGF-β signaling.

    [0687] Taken together, TGF-R.sub.II specific ASO Seq. ID No. 218b rescued cells from TGF-β mediated stem cell quiescence and promotes adult neurogenesis without having an impact on differentiation. This makes it an ideal treatment drug for brain repair.

    Example 13: Determination of Therapeutic Activity of Inventive Antisense-Oligonucleotides Disease Progression of ALS in SOD1 Mice

    [0688] To analyze the therapeutic potential of ASOs as a medication for amyotrophic lateral sclerosis (ALS) male and female transgenic, SOD1 G93A mice were treated with different doses of inventive ASOs by icy administration into the lateral ventricle via osmotic ALZET® minipumps. In addition, riluzole was used as a reference. Riluzole is a drug used to treat amyotrophic lateral sclerosis and is marketed by Sanofi Pharmaceuticals. It delays the onset of ventilator-dependence or tracheostomy in selected patients and may increase survival by approximately two to three months

    Description of Method:

    [0689] For long-lasting central infusion an icy cannula attached to an Alzet® osmotic minipump (infusion rate: 0.25 μl/h, Alzet®, Model 2004, Cupertino, USA), was stereotaxically implanted under isoflurane anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the mouse and connected with the icy cannula by silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 0.3 mm, lateral 1 mm, depth 3 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko® Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the development and the progression of ALS, the onset of symptoms, paresis, and survival were used as in vivo endpoints. At the age of nine weeks, mice were sacrificed and brains were removed for neuropathology analysis. Histological verification of the icy implantation sites was performed at 40-μm coronal, cresyl violet-stained brain sections.

    [0690] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of ALS model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-β1 induced inhibition of neural stem and progenitor proliferation, and thereby treating ALS and other neurodegenerative disorders.

    Examples 14: Determination of the Therapeutic Activity of Antisense-Inventive ASOs Directed to TGF-R.SUB.II .on Disease Development and Progression of Huntington's Disease in R6/2 Mice

    [0691] To analyze the therapeutic potential of ASOs as a medication for Huntington's disease (HD), male and female transgenic R6/2 mice were treated with different doses of inventive TGF-R.sub.II specific ASO by icy administration into the lateral ventricle via osmotic minipumps.

    [0692] Description of Method:

    [0693] For chronic central infusion, mice underwent surgery for an icy cannula attached to an Alzet® osmotic minipump (infusion rate: 0.25 μl/h, Alzet®, Model 2004, Cupertino, USA) at the age of five weeks. The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the mouse and connected with the icy cannula by a silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 0.3 mm, lateral 1 mm, depth 3 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the development and the progression of HD the onset of symptoms, grip strength, general motoric, and survival were used as in vivo endpoints. At the age of nine weeks, mice were sacrificed and brains were removed for histological analyzation. Histological verification of the icy implantation sites was performed at 40-μm coronal, cresyl violet-stained brain sections.

    [0694] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of Huntington model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-β1 induced inhibition of neural stem and progenitor proliferation, and thereby treating HD and other neurodegenerative disorders.

    Example 15: Determination of Therapeutic Activity of the Inventive ASOs on Disease Progression of TGFβ-Induced Hydrocephalus and Associated Cognitive Deficits in Fischer-344 Rats

    [0695] The goal of the present study is to treat animals suffering from the TGFβ induced effects on i) neural stem cell proliferation and neurogenesis, ii) formation of hydrocephalus, and iii) spatial learning deficits by intraventricular infusion of inventive ASO in a dose-dependent manner.

    [0696] Description of Method:

    [0697] Osmotic minipumps for intracerebroventricular infusion were implanted into female Fischer-344 rats of 180 to 200 g body weight (n.sub.total=70, n.sub.group=10). Infused were a) artificial cerebrospinal fluid (aCSF: 148.0 mM NaCl, 3.0 mM KCl, 1.4 mM CaCl.sub.2), 0.8 mM MgCl.sub.2, 1.5 mM Na.sub.2HPO.sub.4, 0.2 mM NaH.sub.2PO.sub.4, 100 μg/ml rat serum albumin, 50 μg/ml Gentamycin, pH 7.4) as control, or b) TGF-β1 1 μg/mL in aCSF using an Alzet® osmotic pump 2004 with flow rate of 0.25 μl/h for 14 days. After 14 days the pumps are changed and Alzet® osmotic pumps 2004 (flow rate 0.25 μl/h) were used for the following infusions: aCSF or TGF-β1 (1 μg/ml) in combination with varying concentrations of TGF-R.sub.II ASO (1.1 mmol/L, 3.28 mmol/I, 9.84 mmol/I) or scrambled ASO (3.28 mmol/I) were infused (2×4 weeks). During the last four days of the infusion period, animals received a daily intraperitoneal injection of BrdU (50 mg/kg of body weight) to label proliferating cells. Pumps are removed, and two weeks later animals are functionally analyzed in a spatial learning test (Morris-Water-Maze) for 14 days. One day later, animals are perfused with 0.9% NaCl, brains are removed, the ipsilateral hemisphere is postfixed in 4% paraformaldehyde for quantitative histological analysis of PCNA, BrdU, DCX, BrdU/NeuN, and BrdU/GFAP, and for stereological analysis of the volume of the lateral ventricles as a measure for the hydrocephalus. The contralateral hemisphere is further dissected and different areas (ventricle wall, hippocampus, cortex) are processed for quantitative RT-PCR to analyze TGF-R.sub.II expression levels. MR images were taken of 4 animals of group 1, group 3, and group 6 at day four before pump implantation, one week after pump implantation, at the day of the first pump change and from then on every 2 weeks until the end of the infusion period. Histological verification of the icy implantation sites was performed at 40-μm coronal, cresyl violet-stained brain sections.

    TABLE-US-00097 TABLE 46 Treatment scheme and the group classification of the Hydrocephalus experiment. 2. aCSF + 4. TGF-β1 + 5.-7. TGF-β1 + Group 1. aCSF ASO 3. TGF-β1 scramb-ASO ASO treatment aCSF- aCSF plus TGF-β1- TGF-β1 plus TGF-β1 plus infusion ASO infusion ASO infusion ASO infusion infusion treatment week 1 week 1 and 2: week 1 and 2: week 1 and 2: week 1 and 2: scheme to 10 aCSF 1 μg/ml TGF-β1: 1 μg/ml TGF-β1: 1 μg/ml week 3 to week 3 week 3 to 10: week 3 to 10: 10: ASO: to 10: TGF-β1: 1 μg/ml TGF-β1: 1 μg/ml 3.28 mmol/l 1 μg/ml scramb.-ASO: ASO: 1.1 mmol/l 3.28 mmol/l 3.28 mmol/l 9.84 mmol/l n 10 10 10 10 10 per dose n-total 10 10 10 10 30

    [0698] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of Hydrocephalus model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-β1 induced inhibition of neural stem and progenitor proliferation, and thereby treating Hydrocephalus and other neurodegenerative disorders.

    Example 16: Determination of Therapeutic Activity of the Antisense-Oligonucleotides Directed to TGF-β11 on Rehabilitation of Spinal Cord Injury in Fischer 344 Rats

    [0699] To analyze the therapeutic potential of ASOs as a medication for spinal cord injury (SCI), male and female Fischer-344 rats were treated with different doses of inventive ASOs by icy administration into the lateral ventricle via osmotic minipumps.

    Description of Method:

    [0700] SCI was simulated by cervical tungsten wire knife dorsal column transection at the C3 level. In the next step, for chronic central infusion rats, (180-200 g body weight) underwent surgery for an icy cannula attached to an Alzet® osmotic minipump (infusion rate: 0.25 μl/h, Alzet®, Model 2004, Cupertino, USA). The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the rat and connected with the icy cannula by a silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 1.0 mm, lateral 1.0 mm, depth 1.8 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, rats were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 0.5 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the rehabilitation process following SCI, 4 weeks post-surgery an in vivo MRI structural analysis was performed (3T MRI, Allegra Siemens, phased array—small animal coil). 6 weeks after surgery, animals were sacrificed and the spinal cord was removed for histological and immunohistochemical analysis. Histological verification of the icy implantation sites was performed at 40-μm coronal, cresyl violet-stained brain sections.

    [0701] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of a Fischer-344—rat spinal cord paraplegia model. In MRI images and neuropathological analysis, the inventive ASOs showed high treatment efficacy. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-β1 induced inhibition of neural stem and progenitor proliferation, and thereby treating spinal cord injury and other neurodegenerative disorders.

    Example 17: ASO-Mediated Effects on Proliferation of Human Lung Cancer Cell Line A549

    [0702] mRNA of Ki67, p53, Caspase 8 (Casp8) and of DNA-binding protein inhibitor 2 (ID2) were analyzed as representative markers on proliferation in several tumor cells. It is known from previous studies, that expression of tumor suppressor gene p53 and ID2 is often dramatically elevated in tumor tissues. Ki67 is a proliferation marker and Casp8 is an indicator for apoptosis. In addition, cell numbers were determined after gymnotic transfer.

    Description of Method:

    [0703] A549 were cultured as described above. For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) or 8-x-well cell culture slide dishes (Sarstedt #94.6140.802) (20,000 cells/well) (0.5 ml for 24-well and 8-well cell culture slide dishes and 1 ml for 6-well dishes) and were incubated overnight at 37° C. and 5% CO.sub.2. To analyze mRNA expression and influence on proliferation, cells were treated with Ref.1 (Scrambled control) and ASO Seq. ID No. 218b at concentrations of 2.5 μM and 10 μM and were incubated for 72 h at 37° C. and 5% CO.sub.2. Treatment including medium replacement was repeated for 3 times every 72 h (12 days in total). For immunocytochemical analysis of proliferation (Ki67), gymnotic transfer of ASO Seq. ID No. 218b was limited to 72 h. Afterwards, cells were washed twice with PBS and subsequently used for protein isolation (6-well dishes), immunocytochemistry (in 8-well cell culture slide dishes), proliferation curve and RNA isolation (24-well dishes). Protocols for RNA, protein and immunocytochemistry were performed as described above. For proliferation curve, remaining cells were harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2×), treated with accutase (500 μl/well) and incubated for 7 min at 37° C. Afterwards 500 μl medium was added and cell number was determined using Luna FL™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 μl of the cell suspension was added to 2 μl of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 μl were added onto Cell Counting Slide (Biozym #872011). Cells were counted and calculated in distinction of alive and dead cells.

    17.1 Results for ASO Seq. ID No. 218b

    [0704] mRNA analysis showed reduced Ki67, p53 and ID2 expression levels 12 days after gymnotic transfer of ASO Seq. ID No. 218b. In contrast, Casp8 was elevated at low levels of ASO Seq. ID No. 218b (Table 46). These observations indicate that a reduced tumor growth is associated with a slight increase in apoptotic cells. Furthermore, Western Blot analysis showed reduction in protein level of Ki67 and pAkt 12 days after gymnotic transfer of inventive ASOs (Table 47). Immunochemical examination of A549 cells after gymnotic transfer of ASO Seq. ID No. 218b showed a reduced level of Ki67 signals in comparison to scrambled control for both concentrations applied (FIG. 23). Finally, cell number of A549 cells was reduced about nearly 50% 12 days after gymnotic transfer of ASO Seq. ID No. 218b (Table 48).

    TABLE-US-00098 TABLE 46 mRNA expression of Ki67, p53, Casp8 and ID2, 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549 cells. Regulation of examined genes demonstrates diminished proliferation rates after gymnotic transfer of inventive ASOs. Reduced ID2 mRNA levels are beneficial in dampening expansion of tumor cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Cell line A549 mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) Ki67 p53 Casp8 ID2 Target n = 2 n = 2 n = 2 n = 2 A 1.00 ± 0.37 1.00 ± 0.31 1.00 ± 0.05 1.00 ± 0.03 B 2.5 μM 0.92 ± 0.05 1.06 ± 0.02 1.36 ± 0.37 0.73 ± 0.01 B 10 μM 0.96 ± 0.03 1.11 ± 0.92 1.52 ± 0.15 0.82 ± 0.15 C 2.5 μM 0.55 ± 0.33 0.27 ± 0.04 1.59 ± 0.48 0.59 ± 0.01 C 10 μM 0.57 ± 0.20 0.53 ± 0.07 0.98 ± 0.17 0.35 ± 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00099 TABLE 47 Densitometric analysis of Ki67 and pAkt Western Blot. Downregulation of Ki67 and pAkt protein 12 days after gymnotic transfer with TGF- R.sub.II specific ASO Seq. ID No. 218b was observed in A549 cells. Protein levels were determined relative to housekeeping gene GAPDH using Image Studio ™ Lite Software and were then normalized to untreated control. Cell line A549 protein levels 12 days after repeated gymnotic transfer (4 × 72 h) Ki67 pAKT Target n = 1 n = 1 A 1.00 1.00 B 10 μM 1.18 0.80 C 10 μM 0.57 0.39 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM.

    TABLE-US-00100 TABLE 48 Cell numbers 12 days after repeated gymnotic transfer. Cell numbers were determined 12 days after repeated gymnotic transfers (4 × 72 h) of A549 cells using Luna FL ™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Cell line A549 cell number 12 days after repeated gymnotic transfer (4 × 72 h) alive cells × 10.sup.5 dead cells × 10.sup.5 Cell number n = 3 n = 3 A 4.25 ± 0.50 0.47 ± 0.09 B 10 μM 3.88 ± 0.95 0.31 ± 0.11 C 10 μM 2.35 ± 0.07 0.35 ± 0.16 A = untreated control, C = Seq. ID No. 218b, ± = SEM.

    Conclusion

    [0705] These observations indicate that reduced tumorous growth is associated with an increase in apoptotic cells. Notably, ID2, which is a possible therapeutic target gene in tumors, is reduced after gymnotic transfer of TGF-R.sub.II specific ASO Seq. ID No. 218b. Taken together, ASO Seq. ID No. 218b is efficient in minimizing proliferation rates and reduces tumor promoting gene expression.

    Example 18: Effect of ASO Gymnotic Transfer on Proliferation of Several Tumor Cell Lines

    [0706] TGF-β signaling is a critical pathway in cancer development. On the one hand TGF-β promotes factors, which act tumor suppressive but on the other hand, this growth factor leads to stimulation of cell migration, cell invasion, cell proliferation, immune regulation, and promotes an environmental reorganization in advantage to progression and metastasis of tumor cells. Thus, TGF-β is a key target in cancer treatment. mRNA and protein levels of proliferation marker (Ki67) and cell numbers were determined after gymnotic uptake of inventive ASOs as markers of proliferation rate in tumor cells. Furthermore, mRNA levels of tumor suppressor gene p53 and of DNA-binding protein inhibitor 2 (ID2) were examined.

    Description of Methods

    [0707] Several tumor cell lines were cultured as described above (Table 10). For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) (0.5 ml for 24-well and 1 ml for 6-well dishes) and were incubated overnight at 37° C. and 5% CO.sub.2. To analyze mRNA expression and influence on proliferation, cells were treated with Ref.1 (Scrambled control) and ASO Seq. ID No. 218b at concentrations of 2.5 μM and 10 μM and were incubated for 72 h at 37° C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes), protein isolation (6-well dishes), or proliferation curve. Protocols for RNA and protein isolation were performed as described above. Before counting cells for proliferation curve, cells were analyzed by using light microscopy (Nikon, TS-100 F LED #MFA33500). Remaining cells were then harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2×), treated with accutase (500 μl/well) and incubated for 5-7 min at 37° C. Afterwards 500 μl medium was added and cell number was determined using Luna FL™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 μl of the cell suspension were added to 2 μl of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 μl were added onto Cell Counting Slide (Biozym #872011). Cells were counted and calculated in distinction of alive and dead cells.

    18.1 Results for Seq. ID No. 218b

    [0708] Ki67 mRNA levels were efficiently decreased independently (A549, L3.6p1, Panc-1) or dependently (HT-29, Panc-1, CaCo2) of used ASO concentrations, 12 days after gymnotic transfer (Table 40). Gene expression level of p53 was also affected in A549, HT-29, K562, KG-1, CaCo2 and TMK-1 by tested ASO (Table 50). Verification of reduced Ki67 protein expression was shown for A549, L3.6p1, TMK-1, HT-29 and K562 (Table 51). Notably, ID2 mRNA expression showed a consistent efficiently and dose-dependently downregulation in A549, HT-29, K562 and TMK-1 cells mediated by ASO Seq. ID No. 218b (Table 51). In addition, ASO Seq. ID No. 218b resulted in a reduced proliferation rate of several tumor cell lines (Table 53). A dose-dependent decrease of cell number was recognized for HPAFII, MCF-7, KG1, K562, U937 and HTZ-19 cells. Lung cancer cells (A549) showed approx. 50% reduction of cell numbers elicited by ASO Seq. ID No. 218b. Reduced cell numbers were additionally confirmed by light microscopy for HPAFII, K562, MCF-7, Panc-1 and HTZ-1, 12 days after gymnotic transfer of ASO Seq. ID No. 218b (FIG. 24).

    [0709] Comparable results are obtainable for the antisense-oligonucleotides of the Seq. ID Nos. 141d, 141g, 141i, 143r, 143w, 143af, 143ag, 143ah, 143j, 143p, 143q, 233d, 234d, 235b, 235d, 237b, 237c, 237i, 237m, 238c, 238f, 239e, 240c, 241b, 242a, 246e, 247d, 248b, 248e, 248g, 152k, 152s, 152t, 152u, 152ab, 152ag, 152ah, 152ai, 249c, 249e, 250b, 250g, 251c, 251f, 252e, 253c, 254b, 255a, 259e, 260d, 261b, 261e, 261g, 262d, 262e, 209s, 209v, 209w, 209x, 209ai, 209an, 209at, 209au, 209av, 2100, 210v, 210w, 210x, 210ab, 210ac, 210ad, 210af, 210 am, 263b, 263c, 263i, 263m, 264e, 264h, 265e, 266c, 267b, 268a, 272e, 273d, 274a, 274d, 274f, 275g, 275i, 276b, 276c, 276j, 276k, 277d, 277e, 278f, 279c, 280b, 281a, 218ad, 218n, 218t, 218u, 218v, 218ah, 218an, 218ao, 218ap, 220d, 221d, 222b, 222c, 222f, 223c, 223f, 224i, 224m, 225c, 225f, 226e, 227c, 2130, 213p, 213q, 213s, 213y, 213z, 213aa, 213af, 228b, 229a, 285d, 286d, 287d, 287e, 287f, 288e, 288i, 289d, 289h, 2890, 289p, 289q, 290c, 290f, 290i, 291c, 292c, 293b, and 294a. Most of the afore-mentioned antisense-oligonucleotides could not beat Seq. ID Nos. 218b and 218c, but are still far more advantageous than the state of the art antisense-oligonucleotides. Thus the antisense-oligonucleotides of the present invention are highly useful for the treatment of hyperproliferative diseases such as cancer and tumors.

    TABLE-US-00101 TABLE 49 mRNA expression of proliferation marker Ki67. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, L3.6pl, KG1, Panc-1 and CaCo2 cells, Ki67 mRNA was decreased in all cell lines, respectively. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Ki67 mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) Cell line A549 HT-29 L3.6pl KG1 Panc-1 CaCo2 n = 2 n = 2 n = 2 n = 1 n = 1 n = 1 A 1.00 ± 0.37 1.00 ± 0.00 1.00 ± 0.25 1.00 1.00 1.00 B 2.5 μM 0.92 ± 0.05 0.89 ± 0.46 0.93 ± 0.03 0.72 0.76 1.21 B 10 uM 0.96 ± 0.03 0.60 ± 0.11 0.96 ± 0.16 0.76 0.79 1.07 C 2.5 μM 0.55 ± 0.33 0.34 ± 0.11 0.42 ± 0.03 0.16 0.68 0.99 C 10 μM 0.57 ± 0.20 0.17 ± 0.02 0.64 ± 0.05 0.33 0.37 0.37 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00102 TABLE 50 mRNA expression of tumor suppressor p53. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, K562, KG1, CaCo2 and TMK-1 cells, p53 mRNA was decreased in all cell lines, respectively. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target p53 mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) Cell line A549 HT-29 K562 KG1 TMK-1 CaCo2 n = 2 n = 1 n = 1 n = 1 n = 1 n = 1 A 1.00 ± 0.31 1.00 1.00 1.00 1.00 ± 0.04 1.00 B 2.5 μM 1.06 ± 0.02 0.72 0.90 1.37 0.74 ± 0.11 0.82 B 10 μM 1.11 ± 0.92 0.68 1.35 0.87 0.71 ± 0.15 1.25 C 2.5 μM 0.27 ± 0.04 0.51 0.27 0.65 0.14* ± 0.14  0.99 C 10 μM 0.53 ± 0.07 0.32 0.46 0.67 0.21* ± 0.05  0.30 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, *p < 0.05 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00103 TABLE 51 mRNA expression of ID2. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, K562 and TMK-1 cells, ID2 mRNA was dose-dependently downregulated in all cell lines, respectively. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target ID2 mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 HT-29 K562 TMK-1 Cell line n = 2 n = 1 n = 1 n = 1 A 1.00 ± 0.03 1.00 1.00 ± 0.23 1.00 ± 0.23 B 2.5 μM 0.73 ± 0.01 0.93 0.97 ± 0.15 0.88 ± 0.15 B 10 μM 0.82 ± 0.15 1.00 0.82 ± 0.05 0.82 ± 0.05 C 2.5 μM 0.59 ± 0.01 0.31 0.70 ± 0.10 0.70 ± 0.10 C 10 μM 0.35 ± 0.02 0.25 0.29* ± 0.09  0.30* ± 0.09  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, *p < 0.05 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc multiple comparisons.

    TABLE-US-00104 TABLE 52 Densitometric analysis of Ki67 Western Blot. Downregulation of Ki67 protein after gymnotic transfer with ASO Seq. ID No. 218b was recognized. Protein level was quantified relative to housekeeping gene alpha-tubulin using Image Studio ™ Lite Software and normalized to untreated controls. Target Ki67 protein level 12 days after repeated gymnotic transfer (4 × 72 h) A549 L3.6pl TMK-1 HT29 K562 Cell line n = 1 n = 2 n = 2 n = 2 n = 1 A 1.00 1.00 ± 0.00 1.00 ± 0.00 1.00 ± 0.00 1.00 B 10 μM 1.18 0.59 ± 0.00 0.75 ± 0.00 1.19 ± 0.68 1.05 C 10 μM 0.57 0.19 ± 0.17 0.53 ± 0.26 0.69 ± 0.05 0.35 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    TABLE-US-00105 TABLE 53 Cell numbers in several cancer cell lines 12 days after repeated gymnotic transfer (4 × 72 h). ASO Seq. ID No. 218b was transferred to several cancer cell lines. Cell numbers were determined using Luna FL ™ Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Treatment A B 2.5 μM B 10 μM C 2.5 μM C 10 μM Cell cell number × 10.sup.5 Line a d a d a d a d a d n p= A549 4.25 ± 0.47 ± 3.88 ± 0.31 ± 2.35 ± 0.35 ± 3 0.50 0.09 0.95 0.11 0.07 0.16 HPAFII 2.80 ± 0.35 ± 2.88 ± 0.36 ± 2.56 ± 0.39 ± 0.66 ± 0.25 ± 0.20 ± 0.06 ± 2 0.33 0.11 2.04 0.06 0.45 0.06 0.47 0.07 0.09 0.02 KG1 17.40 ± 0.43 ± 16.5 ± 0.58 ± 13.80 ± 0.26 ± 10.90 ± 0.59 ± 7.63 ± 0.48*+ ± 3 A vs. C 3.00 0.16 0.85 0.24 0.80 0.17 0.20 0.18 3.08 0.14 10 μM *p < 0.01 B 2.5 μM vs. C 10 μM +p < 0.01 C 10 μM vs. D 10 μM #p < 0.01 K562 10.93 ± 1.37 ± 7.44 ± 2.40 ± 6.40 ± 2.36 ± 5.60 ± 2.66 ± 3.33 ± 0.62* ± 3 A vs. C 1.58 0.40 1.05 0.62 0.38 0.30 0.08 0.41 0.54 0.07 10 μM *p < 0.01 MCF-7 6.73 2.37 6.51 1.57 6.51 3.35 5.21 1.64 2.47 0.73 1 U937 26.43 ± 7.04 ± 14.5 ± 2.88 ± 17.67 ± 2.36 ± 11.34* ± 3.07 ± 7.56* ± 2.25 ± 3 A vs. C 2.05 0.28 2.73 0.37 0.50 0.30 2.85 0.97 1.49 0.44 2.5 μM *p < 0.01 A vs. C 10 μM *p < 0.01 Panc-1 2.16 ± 0.11 ± 1.82 ± 0.15 ± 2.98 ± 0.16 ± 1.15* ± 0.07 ± 1.20*+ ± 0.36 ± 3 A vs. C 0.08 0.02 0.36 0.04 0.27 0.02 0.51 0.02 0.23 0.02 2.5 μM *p < 0.05 A vs. C 10 μM *p < 0.05 B 10 μM vs. C 10 μM +p < 0.01 HTZ-19 2.06 ± 3.05 ± 2.57 ± 1.78 ± 2.55 ± 1.22 ± 1.78 ± 0.88 ± 1.17+ ± 0.49 ± 3 B 10 μM vs. C 0.02 0.36 0.16 0.15 0.22 0.15 0.25 0.09 0.14 0.05 10 μM +p < 0.05 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, a = alive cells, d = dead cells. ± = SEM. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons test.

    Conclusion

    [0710] Modulation of Ki67, p53 and ID2 mRNA by ASO Seq. ID No. 218b indicates a beneficial effect in dampening tumor expansion in several organs and with different origin. Ki67, ID2 and p53 are known to be upregulated and promote cell proliferation in different cancer types. Proliferation marker Ki67, p53 and ID2 were efficiently downregulated. Cell counting and light microscopy of several tumor cells 12 days after gymnotic transfer revealed ASO Seq. ID No. 218b as a potent agent to reduce cell proliferation. Taken together, TGF-R.sub.II specific ASO Seq. ID No. 218b was efficiently reducing proliferation rates parallel to recognized mRNA modulations of Ki67, p53 and ID2. These data suggest that the inventive ASOs are promising drug candidates for dampening tumor cell progression and metastasis of tumor cells.

    Example 19: Analysis of the Effect of the Antisense-Oligonucleotides to Angiogenesis in Several Tumor Cell Lines

    [0711] Modulation of angiogenesis is essential for organ growth and repair. An imbalance in blood vessel growth contributes to different diseases like e.g. tumor growth, ischemia, inflammatory and immune disorders. TGF-β is known to be a pro-angiogenic factor. This may be most relevant in inflammatory and neoplastic processes, when overshooting angiogenesis is responsible for disease progression. These effects may go hand in hand with TGF-β1 induced fibrosis. Therefore Inhibition of TGF-β signaling by TGFR.sub.II specific ASO may represent an adequate therapeutic approach.

    [0712] To test this assumption, these ASOs were transferred to several tumor cell lines by gymnotic uptake. 12 days after repeated gymnotic transfers, cell supernatant was analyzed for protein levels of pro-angiogenic factors by multiplex analysis. This technology allowed investigation of multiple pro-angiogenic proteins (VEGF, Tie-2, FLt-1, PlGF and bFGF) by electro-chemiluminescence. Vascular endothelial growth factor (VEGF) is a potent tumor secreted cytokine that promotes angiogenesis and therewith contributes to e.g. tumor proliferation. Tie-2 is a protein which is expressed from actively growing blood vessels. Fms-like tyrosine kinase 1 (Flt-1), also known as vascular endothelial growth factor receptor 1 (VEGFR1), is a transmembrane tyrosine receptor kinase that is highly expressed in vascular endothelial cells and Placental Growth Factor (PlGF) acts together with VEGF and is upregulated under pathological conditions e.g. in tumor formation. Besides, basic Fibroblast Growth Factor (bFGF) is a growth factor that also induces angiogenesis. PAI-1 is a target gene of TGF-β and mediates scar formation and angiogenic effects of TGF-β. Therefore, PAI-1 demonstrates also a key factor for tumor invasion and metastasis. Patients showing a high PAI-1 concentration level are considered to a poor prognostic factor e.g. in breast cancer, lung, colorectal and gastric cancer. High PAI-1 concentrations also are a risk factor for diseases where thrombosis plays a role (e.g. myocardial infarction, stroke). Thus, PAI-1 mRNA regulation by TGF-β specific antisense oligonucleotides was also tested.

    Description of Methods:

    [0713] Tumor cell lines were cultured as described above (Table 10). For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) incubated overnight at 37° C. and 5% CO.sub.2. The next day, Ref.1 (Scrambled control) and ASO Seq. ID No. 218b (were added to refreshed medium at concentrations of 2.5 and 10 μM and were incubated for 72 h at 37° C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). Afterwards cell supernatant was collected and analyzed by a MesoScale Discovery® Assay (MSD Discovery). This technology allowed investigation of multiple pro-angiogenic proteins (VEGF, Tie-2, FLt-1, PlGF and bFGF) by electro-chemiluminescence. Experiment performance and information about the individual growth factors were extracted by manufacturer instructions (MSD MesoScale Discovery®, #K15198G). The results were evaluated by GraphPad Prism® 6.0 Software.

    [0714] Afterwards, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) to analyze, whether gymnotic transfer of ASO may regulate mRNA levels of Plasminogen Activator inhibitor-1 (PAI-1) by real-time RT-PCR. Protocols and primers were used and listed as described before.

    19.1 Results for Seq. ID 218b

    [0715] Table 54 demonstrates that PAI-1 mRNA was downregulated in a dose-dependent manner in several tested cancer cells (A549: lung cancer, HPAFII: pancreatic adenocarcinoma, HT-29: colorectal adenocarcinoma, HTZ-19: melanoma, TMK-1: gastric carcinoma, THP-1: monocytic leukemia) after repeated gymnotic transfer of ASO Seq. ID No. 218b. In addition, VEGF protein levels in stimulated cell supernatants showed also a dose-dependent decrease in A549, HTZ-19, HPAFII and PC3M (prostatic adenocarcinoma). For HPAFII and PC3M cells downregulation was significant (Table 55). Influence of ASO Seq. ID No. 218b to bFGF confirmed observations for VEGF, meaning that ASO Seq. ID No. 218b is potent to suppress angiogenesis (Table 56) In A549 and PC3M results showed also a significant reduction of bFGF. Protein amount of PlGF in cell supernatants was only slightly but dose-dependently depressed in A549 and HTZ-19 cells. In PC3M cells basic endogenous PlGF level was higher than in all other tested cells and ASO effect was also stronger (Table 57). Finally, downregulation of Flt-1 protein in HT-29 cells (Table 58) and Tie-2 depression in HTZ-19 (ASO Seq. ID No. 218b 2.5 μM) and MCF-7 (mamma-carcinoma, 10 μM) could be detected (Table 59).

    [0716] Comparable results are obtainable for the antisense-oligonucleotides of the Seq. ID Nos. 141d, 141g, 141i, 143r, 143w, 143af, 143ag, 143ah, 143j, 143p, 143q, 152k, 152s, 152t, 152u, 152ab, 152ag, 152ah, 152ai, 209s, 209v, 209w, 209x, 209ai, 209an, 209at, 209au, 209av, 2100, 210v, 210w, 210x, 210ab, 210ac, 210ad, 210af, 210 am, 213o, 213p, 213q, 213s, 213y, 213z, 213aa, 213af, 218ad, 218n, 218t, 218u, 218v, 218ah, 218an, 218ao, 218ap, 220d, 221d, 222b, 222c, 222f, 223c, 223f, 224i, 224m, 225c, 225f, 226e, 227c, 228b, 229a, 233d, 234d, 235b, 235d, 237b, 237c, 237i, 237m, 238c, 238f, 239e, 240c, 241b, 242a, 246e, 247d, 248b, 248e, 248g, 249c, 249e, 250b, 250g, 251c, 251f, 252e, 253c, 254b, 255a, 259e, 260d, 261b, 261e, 261g, 262d, 262e, 263b, 263c, 263i, 263m, 264e, 264h, 265e, 266c, 267b, 268a, 272e, 273d, 274a, 274d, 274f, 275g, 275i, 276b, 276c, 276j, 276k, 277d, 277e, 278f, 279c, 280b, 281a, 285d, 286d, 287d, 287e, 287f, 288e, 288i, 289d, 289h, 2890, 289p, 289q, 290c, 290f, 290i, 291c, 292c, 293b, and 294a. Most of the afore-mentioned antisense-oligonucleotides could not beat Seq. ID Nos. 218b and 218c, but are still far more advantageous than the state of the art antisense-oligonucleotides. Thus the antisense-oligonucleotides of the present invention are highly useful for the treatment of hyperproliferative diseases such as cancer and tumors.

    TABLE-US-00106 TABLE 54 mRNA expression of PAI-1 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HPAFII, HT-29, HTZ-19, TMK-1 and THP-1 cells. Regulation of PAI-1 gene expression is dose-dependently affected by ASO Seq. ID No. 218b in a manner for an improved disease prognosis. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target PAI-1 mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) Cell line A549 HPAFII HT-29 HTZ-19 TMK-1 THP-1 n = 3 n = 1 n = 2 n = 2 n = 2 n = 2 A 1.00 ± 0.10 1.00 1.00 ± 0.11 1.00 ± 0.21 1.00 ± 0.06 1.00 ± 0.11 B 2.5 μM 1.28 ± 0.03 1.48 0.88 ± 0.27 0.99 ± 0.34 0.89 ± 0.04 1.14 ± 0.79 B 10 μM 1.03 ± 0.27 1.05 0.81 ± 0.08 1.30 ± 0.00 1.16 ± 0.00 1.21 ± 0.37 C 2.5 μM 0.91 ± 0.28 0.62 0.60 ± 0.13 1.13 ± 0.10 0.56 ± 0.04 0.83 ± 0.20 C 10 μM 0.56 ± 0.13 0.32 0.50 ± 0.18 0.77 ± 0.10 0.45 ± 0.23 0.09 ± 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00107 TABLE 55 VEGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HPAFII, HTZ-19, PC3M cells by MesoScale Discovery ® Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target VEGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 × 72 h) A549 HPAFII HTZ-19 PC3M Cell line n = 1 n = 2 n = 2 n = 2 A 8186 23266 ± 876 4411 ± 66  2657 ± 103 B 2.5 μM 8387  22278 ± 5711 3385 ± 57 1993 ± 5.4 B 10 μM 8623 20776 ± 497 4044 ± 21  813 ± 0.8 C 2.5 μM 8846 15479**++ ± 512  .sup.   3444 ± 197 1266*+ ± 20.5 .sup.  C 10 μM 6842 11214** ± 898  2882 ± 90 442** ± 14.3 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, *p < 0.05 and **p < 0.01 in reference to A, +p < 0.05 and ++p < 0.01 in reference to B 2.5 μM. Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00108 TABLE 56 bFGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549 and PC3M cells by MesoScale Discovery ® Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target bFGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 × 72 h) A549 PC3M Cell line n = 2 n = 2 A 50.7 ± 2.9 21.2 ± 0.2 B 2.5 μM 54.4 ± 3.1 16.8 ± 0.1 B 10 μM 51.8 ± 2.7 14.7 ± 0.2 C 2.5 μM 26.7**++ ± 2.1  .sup.  11.3**+ ± 0.0  .sup.   C 10 μM 24.2 ± 3.4 7.6**++ ± 0.0  .sup.  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, *p < 0.05 and **p < 0.01 in reference to A, +p < 0.05 and ++p < 0.01 in reference to B 2.5 μM, #p < 0.05 and ##p < 0.01 in reference to B 10 μM. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00109 TABLE 57 PIGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HTZ-19 and PC3M cells by MesoScale Discovery ® Assay (MSD MesoScale Discovery ®, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target PIGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 × 72 h) A549 HTZ-19 PC3M Cell line n = 2 n = 1 n = 2 A 9.9 ± 0.4 11.6 61.7 ± 2.1 B 2.5 μM 9.6 ± 0.2 8.1 54.1 ± 1.9 B 10 μM 8.6 ± 0.1 8.4 59.5 ± 3.2 C 2.5 μM 8.2 ± 0.8 8.2 69.4 ± 2.4 C 10 μM 6.3** ± 0.9  6.5 45.0 ± 3.5 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons

    TABLE-US-00110 TABLE 58 Flt-1 protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in HTZ-19 cells by MesoScale Discovery ® assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target Flt-1 protein (pg/ml) 12 days after repeated gymnotic transfer (4 × 72 h) HT-29 Cell line n = 1 A 33.9 B 2.5 μM 27.7 B 10 μM 27.7 C 2.5 μM 18.2 C 10 μM 18.7 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00111 TABLE 59 shows Tie-2 protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in HTZ-19 and MCF-7 cells by MesoScale Discovery ® Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target Tie-2 protein (pg/ml) 12 days after repeated gymnotic transfer (4 × 72 h) HTZ-19 MCF-7 Cell line n = 1 n = 1 A 13.5 98.1 B 2.5 μM 6.2 B 10 μM 149.2 C 2.5 μM 3.2 C 10 μM 76.9 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    Conclusion

    [0717] All analyzed pro-angiogenic factors (VEGF, bFGF, PlGF, Flt-1 and Tie-2) could be regulated by ASO Seq. ID No. 218b in a manner that would have a favorable impact on suppressing tumor progression and other pathological mechanisms dependent on enhanced angiogenesis. Furthermore, PAI-1 mRNA was dose-dependently reduced by ASO Seq. ID No. 218b. This factor, a TGF-β target gene and e.g. an approved prognostic marker in breast cancer, was also dose-dependently downregulated. Taken together, all tested inventive ASOs were efficient in reducing angiogenic processes that favors tumor progression, metastasis, inflammation, and thrombosis. Thus, the inventive ASOs directed against TGF-R.sub.II are potent therapeutic candidate in different types of cancer and thrombosis related diseases.

    Example 20: Analysis of the Effect of Inventive ASOs Upon Fibrosis

    [0718] TGF-β is involved in a lot of processes such as cell proliferation, migration, wound healing, angiogenesis and cell-cell interactions. It's known from several studies, that this factor is often elevated during pathogenesis in several diseases including primary open angle glaucoma, Alzheimer disease, pulmonal fibrosis and diabetic nephropathy. These diseases are related to pathologic modifications in extracellular matrix (ECM) and the aktin-cytoskeleton. Often, these observed alterations correlate with severity disease progression and resistance to treatment (Epithelial Mesenchymal transition—EMT—in tumors). Connective tissue growth factor (CTGF) is a downstream-mediator of TGF-β and mediates fibrotic effects of TGF-β. Thus, it is shown that CTGF mediates deposition of ECM and modulates reorganization of aktin-cytoskeleton. To investigate whether the inventive ASOs contribute to a resolution of fibrotic processes by inhibiting TGF-β signaling, CTGF levels were evaluated in addition to fibronectin (FN) and Collagen IV (ColIV), which represent two main components of ECM in several different cancer cells. Furthermore, effects of ASOs on CTGF, FN and on aktin-cytoskeleton were examined in neural precursor (ReNcell CX) and human lung cancer (A549) cells.

    20.1 Fibrosis in Neurodegeneration

    Description of Methods

    [0719] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. To investigate a response of ReNcell CX® cells to TGF-β1 cells were treated after refreshing of medium with TGF-β1 (2 and 10 ng/ml, PromoCell #C63499) for 48 h, followed by mRNA analysis for CTGF. To figure out the ASO effect on CTGF and FN, ReNcell CX® cells, medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (Scrambled control), ASO Seq. ID No. 218b and Seq. ID No. 218b were then added in medium at concentrations of 2.5 and 10 μM and respective analysis (real-time RT-PCR, Western Blot analysis and Immunocytochemistry) was performed after 96 h. To examine the ASO impact after investigation of pre-incubation with TGF-β1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-β1 (10 ng/ml, 48 h) medium was changed, TGF-β1 (10 ng/ml), Ref.1 (10 μM), ASO with Seq. ID No. 218b (10 μM) and ASO with Seq. ID No. 218c (10 μM) were added in combination and in single treatment to cells. ReNcell CX® cells were then harvested 96 h after gymnotic transfer. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Protocols, antibodies, dilutions and primers were used as described before.

    20.1.1 Results of TGF-β1 Effects on Neural Precursor Cells (ReNcell CX)

    [0720] Nothing was known about reaction of ReNcell CX® to TGF-β1 exposure. Thus ReNcell CX® cells were treated for 48 h with TGF-β1 in two different concentrations (Table 60). Evaluation of real-time RT-PCR revealed a dose-dependent induction of CTGF- and TGF-β1 gene expression.

    TABLE-US-00112 TABLE 60 CTGF and TGF-β1 mRNA expression 48 h after stimulation with TGF-β1. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after 48 h TGF-β1 treatment CTGF TGF-β1 Target 48 h 48 h Time point n = 3 n = 3 A 1.00 ± 0.43 1.00 ± 0.10 E 2 ng/ml 1.73 ± 0.92 1.34 ± 0.45 E 10 ng/ml 2.15 ± 1.14 1.85 ± 0.65 A = untreated control, E = TGF-β1. ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparison.

    Conclusion

    [0721] ReNcell CX® cells showed a response to TGF-β1 exposure presenting self-induction of TGF-β1 and elevation of TGF-β1 target gene CTGF. Taken together, ReNcell CX® cells are ideal to examine questions addressing TGF-β effects.

    20.1.2 Results for Seq. ID No. 218b

    20.1.2.1 Effects of Gymnotic Transfer

    [0722] Gymnotic transfer of ASO Seq. ID No. 218b results in a dose-dependent and significant reduction of CTGF and FN (Table 61). This impact of ASO Seq. ID No. 218b was verified for FN protein level. FN protein level was depressed by about 70% 96 h after gymnotic transfer of tested ASO, whereas TGF-β1 treatment of ReNcell CX® cells resulted in a 3.4-fold induction of FN (Table 62).

    TABLE-US-00113 TABLE 61 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in ReNcell CX ® cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after gymnotic transfer Target CTGF FN Time point 96 h, n = 3 96 h, n = 3 A 1.00 ± 0.04 1.00 ± 0.00 B 2.5 μM 0.97 ± 0.06 0.81 ± 0.14 B 10 μM 0.86 ± 0.17 0.67 ± 0.07 C 2.5 μM 0.66** ± 0.02  0.59 ± 0.02 C 10 μM 0.52** ± 0.02  0.39* ± 0.03  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    TABLE-US-00114 TABLE 62 Densitometric analysis after Western Blotting for Fibronectin. Downregulation of FN protein 96 h after gymnotic transfer of ASO Seq. ID No. 218b in ReNcell CX ® cells could be recognized. Protein level was determined relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Cell line ReNcell CX protein levels after gymnotic transfer Target FN Time point 96 h, n = 1 A 1.00 B 2.5 μM 1.06 B 10 μM 0.60 C 2.5 μM 0.46 C 10 μM 0.30 E 10 ng/ml 3.43 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

    Conclusion

    [0723] ASO Seq. ID No. 218b was potent in downregulating mRNA levels of CTGF and FN in human neuronal precursor cells. ASO Seq. ID No. 218b treatment reduced FN protein, 96 h after gymnotic transfer. Thus, TGF-R.sub.II specific ASO mediates blocking of TGF-β induced fibrotic effects ReNcell CX® cells.

    20.1.2.2 Effects of Gymnotic Transfer after TGF-β Pre-Incubation

    [0724] To analyze whether ASO Seq. ID No. 218b is also potent in inhibiting fibrotic effects mediated by TGF-β under pathological conditions, ReNcell CX® cells were pre-incubated with TGF-β pre-incubation followed by gymnotic transfer for 96 h. Afterwards, determined mRNA levels of CTGF and FN indicate a strong anti-fibrotic effect of ASO Seq. ID No. 218b also after TGF-β induction of CTGF and FN gene expression (Table 63). Immunocytochemical staining for CTGF (FIG. 25A) and FN (FIG. 25B) confirmed data from mRNA analysis. In addition, staining with phalloidin for analysis of actin-cytoskeleton showed an induction of stress-fibers after TGF-β treatment, whereas ASO Seq. ID No. 218b was efficient in blocking TGF-β-mediated stress fiber induction (FIG. 25C).

    TABLE-US-00115 TABLE 63 Downregulation of CTGF and FN mRNA after TGF-β1-pre- incubation followed by gymnotic transfer with Seq. ID No. 218b in ReNcell CX ® cells (compared to scrambled control). mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and was then normalized to untreated control. Cell line ReNcell CX mRNA levels after 48 h TGF-β1 −> 96 h TGF-β1 + ASOs/single treatment Target CTGF FN Time point 96 h, n = 3 96 h, n = 3 A  1.00 ± 0.04 1.00 ± 0.10 B 10 μM  0.85 ± 0.01 0.78 ± 0.20 C 10 μM  0.70* ± 0.25 0.44 ± 0.04 E 10 ng/ml 1.60** ± 0.15 2.25 ± 0.31 E 10 ng/ml + B 10 μM 1.71** ± 0.03 4.08*++ ± 0.90  .sup.  E 10 ng/ml + C 10 μM 1.19++ ± 0.04.sup.  1.74++ ± 0.61 .sup.  A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β, ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion

    [0725] ASO Seq. ID No. 218b showed strong anti-fibrotic effects under simulated pathological conditions (TGF-β1 pre-incubation). Aside from downregulation of FN as one main component of ECM, actin-cytoskeleton was also affected by inventive ASO in a manner that may be beneficial for a better outcome in fibrotic diseases.

    20.1.3 Results for Seq. ID No. 218c

    20.1.3.1 Effects of Gymnotic Transfer

    [0726] Gymnotic transfer of ASO Seq. ID No. 218c results in a strong and significant reduction of CTGF mRNA after gymnotic transfer of 10 μM ASO Seq. ID No. 218c (Table 64).

    TABLE-US-00116 TABLE 64 Downregulation of CTGF mRNA after gymnotic transfer of Seq. ID No. 218c in ReNcell CX ® cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after gymnotic transfer Target CTGF Time point 96 h, n = 3 A 1.00 ± 0.10 B 2.5 μM 0.88 ± 0.08 B 10 μM 0.89 ± 0.07 D 2.5 μM 0.48 ± 0.08 D 10 μM 0.17* ± 0.02  A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. ± = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion

    [0727] ASO Seq. ID No. 218c was efficient in dose-dependent reduction of CTGF mRNA.

    20.1.3.2 Effects of Gymnotic Transfer after TGF-β Pre-Incubation

    [0728] Results for gymnotic transfer for ASO Seq. ID 218c followed by TGF-β1 pre-incubation verified an effective blockage of TGF-β1 induced effects on CTGF mRNA levels (Table 65). ASO was such potent in blocking TGF-β1 effect on CTGF that combination treatment is comparable to ASO Seq. ID No. 218c single treatment.

    TABLE-US-00117 TABLE 65 CTGF mRNA level after TGF-β1 pre-incubation following gymnotic transfer of Seq. ID No. 218c and parallel TGF- β1 treatment in ReNcell CX ® cells. Data confirmed an effective blocking of TGF-β1 induced effects on CTGF mRNA level by ASO Seq. ID No. 218c in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point ReNcell CX mRNA levels 48 h TGF-β1 −> 96 h TGF-β1 + ASOs/single treatment CTGF Cell line n = 3 A 1.00 ± 0.03 B 10 μM 0.85 ± 0.01 D 10 μM 0.17* ± 0.02  E 10 ng/ml 1.39 ± 0.08 E 10 ng/ml + B 10 μM 1.25 ± 0.44 E 10 ng/ml + D 10 μM 0.23* ± 0.02  A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-β1. ± = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion

    [0729] ASO Seq. ID No. 218c showed a strong downregulation of CTGF mRNA and protein even under artificial pathological conditions (TGF-β1 pre-incubation).

    [0730] Taken together, aside from strong anti-fibrotic effects, TGF-R.sub.II specific ASOs showed a modulation of actin-cytoskeleton. Induction of stress fibers may cause an elevation of cell rigidity and stiffness that may play a role e.g. in Alzheimer disease and other Neurodegenerative Disorders. ECM deposition may also mediate fast pathogenic modifications e.g. in primary open angle glaucoma. Thus, reduction of ECM deposition and suppression of stress fiber formation may be profitable for a better prognosis in fibrotic related neurological disorders. Thereby, TGF-R.sub.II specific ASOs are potent therapeutic agents for the treatment e.g. Alzheimer disease and primary open angle glaucoma.

    20.2. Pulmonary Fibrosis

    Description of Methods

    [0731] For investigation of ASO effects to ECM and actin-cytoskeleton in lung, human lung cancer (A549) cells were examined and cultured as described before. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. To investigate a response of A549 cells to TGF-β1 cells were treated after refreshing of medium with TGF-β1 (2 and 10 ng/ml, PromoCell #C63499) for 48 h following mRNA analysis for CTGF. To investigate the ASO effect on CTGF and FN A549 cells, medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-x-well). Ref. 1 (scrambled control), ASO Seq. ID No. 218b and Seq. ID No. 218b were then added in medium at concentrations of 2.5 and 10 μM and respective analysis (real-time RT-PCR, Western Blot analysis and Immunocytochemistry) was performed after 72 h in ReNcell CX® cells. To show possible ASO impact after pre-incubation with TGF-β1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-β1 (10 ng/ml, 48 h) medium was changed, TGF-β1 (10 ng/ml), Ref.1 (10 μM), ASO with Seq. ID No. 218b (10 μM) and ASO with Seq. ID No. 218c (10 μM) was added in combination and in single treatment to cells. A549 cells were then harvested 72 h after gymnotic transfer. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Protocols, used antibodies, dilutions and primers were as described before.

    20.2.1 Results of TGF-β1 Effects on Lung Cancer Cells (A549)

    [0732] To investigate the ability of A549 cells to react to TGF-β1 exposure, cells were treated for 48 h with TGF-β1 in two different concentrations (Table 66). Evaluation of real-time RT-PCR revealed for CTGF and TGF-β1 itself a dose-dependent induction of gene expression.

    TABLE-US-00118 TABLE 66 Induced CTGF and TGF-β1 mRNA expression 48 h after stimulation with TGF-β1 in A549 cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA levels after 48 h TGF-β1 treatment CTGF TGF-β1 Target 48 h, 48 h, Time point n = 3 n = 3 A    .sup. 1.00 ± 0.23 1.00 ± 0.31 E 2 ng/ml   .sup. 2.44* ± 0.18 1.60 ± 0.34 E 10 ng/ml 11.35**++ ± 0.52 2.37 ± 0.36 A = untreated control, E = TGF-β1. ± = SEM, *p < 0.05 and **p < 0.01 in reference to A, ++p < 0.05 in reference to E 2 ng/ml. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparison.

    Conclusion

    [0733] A549 cells showed a dose-dependent and significant mRNA upregulation of CTGF upon TGF-β1 exposure. In addition, self-induction of TGF-β1 was observed. Taken together, A549 cells are a good model to examine questions addressing TGF-β effects in lung and lung cancer.

    20.2.2 Results for Seq. ID No. 218b

    20.2.2.1 Results for Effects of Gymnotic Transfer

    [0734] Gymnotic transfer of ASO Seq. ID No. 218b causes a dose-dependent and highly significant reduction of CTGF gene expression (Table 67). FN mRNA level was also affected by tested ASO but not dose-dependently. In contrast, staining against FN revealed a dose-dependent reduction of FN in comparison to scrambled control (FIG. 260A). Furthermore, ASO and TGF-β impact on actin-cytoskeleton was examined. FIG. 26B showed an induction of actin-fibers including stress-fiber formation after TGF-β1 treatment in A549 cells in doss-dependent manner, whereas signal after gymnotic transfer of ASO Seq. ID No. 218b in A549 cells was significantly downregulated parallel to recognized reversion of TGF-β1-mediated effects. For protein analysis a proper downregulation of CTGF parallel to an inhibition of pErk1/2 by which CTGF mediates its fibrotic effects could have been shown (Table 68). Furthermore, 72 h after gymnotic transfer of ASO Seq. ID No. 218b a decrease of both ECM main components FN and ColIV was remarkable (Table 68).

    TABLE-US-00119 TABLE 67 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in A549 cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA levels after gymnotic transfer CTGF FN Target 72 h, 72 h, Time point n = 3 n = 3 A 1.00 ± 0.08 1.00 ± 0.07 B 2.5 μM 0.87 ± 0.06 1.08 ± 0.02 B 10 μM 0.80 ± 0.03 0.87 ± 0.08 C 2.5 μM 0.60** ± 0.04  0.77 ± 0.17 C 10 μM 0.39** ± 0.03  0.74 ± 0.16 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. ± = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    TABLE-US-00120 TABLE 68 Densitometric analysis after CTGF, FN, ColIV and pErk11/2 Western Blot: 72 h after gymnotic transfer with ASO Seq. ID No 218b in A549. Protein level was determined relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Cell line A549 protein levels after gymnotic transfer CTGF FN ColIV pErk1/2 Target 72 h 72 h 72 h 72 h Time point n = 1 n = 1 n = 1 n = 2 A 1.00 1.00 1.00 1.00 ± 0.00 B 2.5 μM 0.91 0.89 1.19 1.00 ± 0.14 B 10 μM 1.31 0.76 0.87 0.98 ± 0.02 C 2.5 μM 0.05 0.81 1.16 0.67 ± 0.26 C 10 μM 0.09 0.46 0.65 0.61 ± 0.13 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

    Conclusion

    [0735] Gymnotic transfer of Seq. ID No. 218b was efficient in modulating factors which are involved in ECM deposition and actin-cytoskeleton reorganization in human lung cells.

    20.2.2.2 Results for Effects of Gymnotic Transfer after TGF-β1 Pre-Incubation

    [0736] Results for gymnotic transfer of ASO Seq. ID 218b following TGF-β1 pre-incubation verified an effective blockage of strong TGF-β1 induced effects on CTGF and FN mRNA levels (Table 69). Immunocytochemical staining against CTGF (FIG. 27A) and FN (FIG. 27B) confirmed mRNA detection on protein level.

    TABLE-US-00121 TABLE 69 CTGF and FN mRNA level after TGF-β1-pre-incubation following gymnotic transfer of Seq. ID No. 218b and parallel TGF-β1 treatment in A549 cells. Data confirmed an effective blocking of TGF-β1 induced effects on CTGF and FN mRNA levels by ASO Seq. ID No. 218b in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point A549 mRNA levels 48 h TGF-β1 −> 72 h TGF-β1 + ASOs/single treatment CTGF FN Cell line n = 5 n = 3 A 1.00 ± 0.22 1.00 ± 0.45 B 10 μM 0.89 ± 0.19 1.02 ± 0.37 C 10 μM 0.52 ± 0.05 0.35 ± 0.06 E 10 ng/ml 6.92* ± 2.32  2.92 ± 1.02 E 10 ng/ml + B 10 μM 8.79** ± 2.72  2.90 ± 0.56 E 10 ng/ml + C 10 μM 2.53 ± 0.59 1.18 ± 0.28 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-β1. ± = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion

    [0737] ASO Seq. ID No. 218b was efficient in mediating anti-fibrotic effects in A549 cells under artificial pathological conditions mimicked excessive concentrations of TGF-β1.

    20.2.3 Results for Seq. ID No. 218c

    20.2.3.1 Results for Effects of Gymnotic Transfer

    [0738] Gymnotic transfer of ASO Seq. ID No. 218c mediates a strong dose-dependent and significant reduction of CTGF mRNA 72 h after gymnotic transfer in A549 cells (Table 70).

    TABLE-US-00122 TABLE 70 Downregulation of CTGF mRNA 72 h after gymnotic transfer of Seq. ID No. 218c in A549 cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA level after gymnotic transfer CTGF Target 72 h Time point n = 4 A 1.00 ± 0.08 B 2.5 μM 0.97 ± 0.07 B 10 μM 0.85 ± 0.06 D 2.5 μM 0.49** ± 0.05  D 10 μM 0.31** ± 0.03  A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. ± = SEM, **p < 0.01 in reference to A. Statistics were calculated using the Ordinary-one-way-ANOVA followed by “Dunnett's” post hoc comparisons.

    Conclusion

    [0739] Gymnotic transfer of ASO Seq. ID No. 218c was efficient in reducing mRNA of TGF-β downstream-mediator CTGF.

    20.2.2.2 Results for Effects of Gymnotic Transfer after TGF-β Pre-Incubation

    [0740] Results for gymnotic transfer for ASO Seq. ID No. 218c following TGF-β1 pre-incubation verified an effective blockage of strong TGF-β1 induced effects on CTGF mRNA levels (Table 71). Immunocytochemical staining against CTGF confirmed these findings on protein level (FIG. 28).

    TABLE-US-00123 TABLE 71 CTGF mRNA levels after TGF-β1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218c and parallel TGF-β1 treatment in A549. Data verified an effective blockage of TGF-β1 induced effects on CTGF mRNA levels by ASO Seq. ID No. 218c in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT- PCR and then normalized to untreated control. Target Time point A549 48 h TGF-β1 −> 72 h TGF-β1 + ASOs/single treatment CTGF Cell line n = 3 A  1.00 ± 0.05 B 10 μM  0.86 ± 0.11 D 10 μM 0.53 ±0.10 E 10 ng/ml 4.71 ±1.76 E 10 ng/ml + B 10 μM 5.89* ±2.16  E 10 ng/ml + D 10 μM 0.86++ ± 0.06.sup.  A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-β1. ± = SEM, **p < 0.01 in reference to A, ++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” post hoc comparisons.

    Conclusion

    [0741] ASO Seq. ID 218c was potent in mediating anti-fibrotic effects in A549 cells under artificial pathological conditions mimicked by excessive TGF-β1 concentrations.

    [0742] Taken together, ASO Seq. ID 218c is an effective therapeutic agent, because pathology of lung fibrosis could be slowed down by reducing CTGF, FN and ColIV. In addition, stress fiber formation can be reduced effectively by TGF-R.sub.II specific ASO, making inventive ASOs ideal therapeutic agents.

    20.3 Effects on Several Cancer Cells

    Description of Methods

    [0743] For investigation of ASO effects addressing ECM (CTGF, FN, ColIV) cells were used and cultured as described before in standard protocol (Table 10). For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) and were incubated overnight at 37° C. and 5% CO.sub.2. To analyze mRNA expression and influence on CTGF, FN and ColIV mRNA and protein levels cells were treated with Ref.1 (Scrambled control) or ASO Seq. ID No. 218b at concentrations of 2.5 and 10 μM and were incubated for 72 h at 37° C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) or protein isolation (6-well dishes). Protocols for RNA and protein isolation as well as used antibodies and dilutions were performed as described above.

    20.3.1 Results for Seq. ID No. 218b

    [0744] Anti-fibrotic effects were detected by analysis of CTGF, FN, ColIV mRNA and protein levels. CTGF mRNA (Table 72) was dose-dependently reduced by Seq. ID No. 218b in HT-29, HTZ-19, MCF-7 and THP-1 cells. For KG-1 cells downregulation of TGF-β downstream-mediator was recognized for 2.5 μM ASO Seq. ID No. 218b. For A549, Panc-1 and CaCo2 cells a decrease of FN was demonstrated (Table 73) in accordance to a dose-dependently decline of ColIV mRNA (Table 74) in THP-1, HTZ-19 and L3.6p1 cells (Table 65). Western Blot analysis revealed a strong reduction of CTGF protein in HT-29, MCF-7, TMK-1 and L3.6p1 cells. Result for MCF-7 was significant (Table 75). In addition, phosphorylation of Erk1/2 in A549 and TMK-1 cells was inhibited by ASO Seq. ID No. 218b. pErk1/2 is normally activated by CTGF to induce TGF-β mediated fibrotic effects (Table 76). For FN (A549, MCF-7, HT-29, HTZ-19, HPAFII) and Col IV (A549, HTZ-19, HPAFII, PC3M) (Table 77 and 78), the two main components of ECM, protein levels were minimized by about 50%.

    TABLE-US-00124 TABLE 72 mRNA expression of CTGF 12 days after gymnotic transfer of Seq. ID No. 218b in HT-29, HTZ-19, KG1, MCF-7 and THP-1 cells. CTGF mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT- PCR and then normalized to untreated control. Target CTGF mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) HT-29 HTZ-19 KG-1 MCF-7 THP-1 Cell line n = 2 n = 1 n = 1 n = 1 n = 2 A 1.00 ± 0.28 1.00 1.00 1.00 1.00 ± 0.28 B 2.5 μM 0.68 ± 0.11 1.30 0.93 0.99 ± 0.68 B 10 μM 0.65 ± 0.03 1.20 0.88 0.91 1.15 ± 0.34 C 2.5 μM 0.40 ± 0.20 0.64 0.24 0.98 ± 0.11 C 10 μM 0.33 ± 0.19 0.55 0.26 0.22 0.09 ± 0.03 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00125 TABLE 73 mRNA expression of FN 12 days after gymnotic transfer of Seq. ID No. 218b in A549, Panc-1 and CaCo2 cells. FN mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target FN mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 Panc-1 CaCo2 Cell line n = 2 n = 1 n = 2 A 1.00 ± 0.39 1.00 1.00 ± 0.30 B 2.5 μM 0.83 ± 0.08 1.29 0.55 ± 0.13 B 10 μM 1.00 ± 0.76 C 2.5 μM 0.35 ± 0.20 0.15 0.73 ± 0.54 C 10 μM 0.18 ± 0.17 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00126 TABLE 74 mRNA expression of ColIV 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HTZ-19, THP-1, L3.6pl, Panc-1 and CaCo2 cells. ColIV mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Target Col IV mRNA levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 THP-1 HTZ-19 L3.6pl Panc-1 CaCo2 Cell line n = 2 n = 2 n = 1 n = 2 n = 1 n = 2 A 1.00 ± 0.00 1.00 ± 0.22 1.00 1.00 ± 0.20 1.00 1.00 ± 0.71 B 2.5 μM 1.18 ± 0.31 0.71 ± 0.25 0.94 0.83 ± 0.09 0.98 1.37 ± 0.19 B 10 μM 1.11 ± 0.60 0.61 ± 0.03 0.91 ± 0.29 0.57 2.61 ± 0.01 C 2.5 μM 0.84 ± 0.02 0.65 ± 0.19 0.51 1.14 ± 0.13 0.59 1.30 ± 0.03 C 10 μM 0.75 ± 0.02 0.30 ± 0.13 0.69 ± 0.05 0.30 0.57 ± 0.14 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, ± = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00127 TABLE 75 Densitometric analysis after Western Blotting in HT-29, MCF-7, L3.6pl and TMK-1 cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of CTGF protein by ASO Seq. ID No. 218b could be recognized. Protein levels were determined relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Target CTGF protein levels 12 days after repeated gymnotic transfer (4 × 72 h) HT-29 MCF-7 TMK-1 L3.6pl Cell line n = 1 n = 2 n =1 n = 1 A 1.00   .sup. 1.00 ± 0.0 1.00 1.00 B 10 μM 1.19   .sup. 1.12 ± 0.11 0.85 0.93 C 10 μM 0.50 0.22**++ ± 0.03 0.38 0.22 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00128 TABLE 76 Densitometric analysis after Western Blotting in A549 and TMK-1 cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of pErk1/2 protein by ASO Seq. ID No. 218b was determined. Quantification of protein level was done relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Target pErk1/2 protein levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 TMK-1 Cell line n = 1 n =1 A 1.00 1.00 B 10 μM 1.21 1.14 C 10 μM 0.58 0.76 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00129 TABLE 77 Densitometric analysis after Western Blotting in A549, MCF-7, HT- 29, HTZ-19 and HPAFII cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of FN protein by ASO Seq. ID No. 218b was determined. Quantification of protein level was done relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Target FN protein levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 MCF-7 HT-29 HTZ-19 HPAFII Cell line n = 1 n = 2 n = 1 n = 1 n = 1 A 1.00 1.00 ± 0.22 1.00 1.00 1.00 B 10 μM 1.10 1.08 ± 0.25 0.81 1.20 1.12 C 10 μM 0.56 0.69 ± 0.18 0.40 0.83 0.56 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    TABLE-US-00130 TABLE 78 Densitometric analysis after Western Blotting in A549, MCF-7, HT-29, HTZ-19 and HPAFII cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of FN protein by ASO Seq. ID No. 218b was determined. Protein levels were analyzed relative to housekeeping gene alpha-Tubulin using Image Studio ™ Lite Software and was then normalized to untreated control. Target Col IV protein levels 12 days after repeated gymnotic transfer (4 × 72 h) A549 HTZ-19 HPAFII PC3M Cell line n = 1 n = 1 n = 1 n = 1 A 1.00 1.00 1.00 1.00 B 10 μM 1.31 1.01 1.05 1.07 C 10 μM 0.61 0.36 0.76 0.43 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by “Tukey's” multiple post hoc comparisons.

    Conclusion

    [0745] Increased deposition of ECM mediated by TGF-β1, through its downstream-mediator CTGF, could be efficiently reversed by TGF-R.sub.II specific inventive ASOs in different tumor cell lines. A reduced level of ECM components could contribute to a less aggressive in tumor progression. Taken together, tested ASOs may demonstrate a new therapeutic strategy in different fibrosis-associated diseases.

    Example 21: Threshold for Toxicity of Inventive ASOs by Chronic Intracerebroventricular Administration Using a Dose-Escalation Paradigm in Cynomolgus

    [0746] To evaluate the ideal dose range for the GLP-toxicity study, a pre-experiment using chronic intracerebroventricular (icv) antisense-oligonucleotide (ASO) administration with escalating doses was performed in Cynomolgus monkeys. During the administration paradigm animals were monitored for immunological, hematological and physiological alterations.

    Description of Method:

    [0747] For chronic central ASO infusion in male and female Cynomolgus monkeys, a gas-pressure pump (0.25 ml/24 h, Tricumed-IP 2000V®) connected to a silicone catheter, targeting the right lateral ventricle was implanted subcutaneously under ketamine/xylacin anesthesia and semi-sterile conditions. A single male and a single female monkey were used for each treatment condition (Seq. ID No. 218b, Seq. ID No. 218c, concentrations given in Table 79). Each pump was implanted subcutaneously in the abdominal region via a 10 cm long skin incision at the neck of the monkey and was connected with the icy cannula by a silicone catheter. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, monkeys were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 1 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing and the resp. pump was filled with the respective treatment solution. ASO infusion periods (1 week for each dose) were interrupted by a one-week wash out period with 0.9% NaCl being administered exclusively. During the entire administration paradigm body weight development and food consumption were monitored. Further, blood and CSF samples were taken once a week to determine hematological as well as immunological alterations but also systemic ASO concentrations. On the last day, animals were sacrificed, and organs (liver, kidneys, brain) were removed, and analyzed for proliferation, apoptosis, mRNA knock down, and tumor formation.

    TABLE-US-00131 TABLE 79 Experimental design and the doses of ASOs given during the 7-week administration paradigm. Week Week Week Week Week Week Week Treatment condition 1 2 3 4 5 6 7 Seq. ID No. 218b 0.048 0.9% 0.24 0.9% 1.2 0.9% 6 mM NaCl mM NaCl mM NaCl mM Seq. ID No 218c 0.048 0.9% 0.24 0.9% 1.2 0.9% 6 mM NaCl mM NaCl mM NaCl mM

    Conclusion:

    [0748] All tested, inventive ASOs were at least non-toxic in weeks 1-6 and were therefore used for further research and toxicological examination. However, infusion of antisense-oligonucleotides Seq. ID No. 214, Seq. ID No. 138b, Seq. ID No. 172b as well as Ref. 0 and Ref. 5. resulted in toxic effects early in the above scheme. Therefore, these antisense-oligonucleotides are not suitable as therapeutic agent and were not used for further studies.

    Example 22: Determination of Behavioral and Physiological Abnormalities Following Central Antisense-Oligonucleotide Administration

    [0749] The goal of this study was to investigate the effects of a single intracerebroventricular (icv) antisense-oligonucleotide administration on neurological and resulting behavioral parameters in rats.

    Description of Method:

    [0750] Stereotaxic procedures were performed under ketamine/xylacin anesthesia and semi-sterile conditions. Following surgery, rats had two days for recovery.

    Implantation of Icv Guide Cannula

    [0751] Animals were placed into a stereotaxic frame, and the guide cannula (12 mm) was implanted 2 mm above the left lateral ventricle (coordinates relative to bregma: 1.0 mm posterior, −1.6 mm lateral to midline, 1.8 mm beneath the surface of the skull. The guide cannula was anchored to two stainless steel screws using dental acrylic cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany) and was closed with a dummy cannula. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany).

    ICV Infusion

    [0752] Slightly restrained rats received an icy infusion of either ASO (2 μM/5 μl, 10 μM/5 μl, 50 μM/5 μl, 250 μM/5 μl) or vehicle (5 μl, 0.9% NaCl, pH 7.4, Braun) using a 27-gauge cannula, which extended 2 mm beyond the guide cannula and remained in place for 30 s to allow diffusion. Rats were monitored 15, 30, 60 and 120 minutes following icy administration for behavioral reactions, motor activity, CNS excitation, posture, motor coordination, muscle tone, reflexes, and body temperature.

    Verification of Cannula and Microdialysis Probe Placement

    [0753] After scarification, brains were removed, snap frozen and stored at −80° C. until analyzation. Histological verification of the icy implantation sites was performed at 40-μm coronal, cresyl violet-stained brain sections.

    [0754] The present results demonstrate a single ASO (for both sequences Seq. ID No. 218b, Seq. ID No. 218c) icy administration, for different doses, to be a safe and secure technique in rats due to no effects on neurological parameters.

    Example 23: Determination of the Ideal Dose Range for the Cynomolgus GLP-Toxicity Study (Pre-Toxicity Experiment in Rats)

    [0755] To investigate any general toxicological effects of a daily intravenous (iv) antisense-oligonucleotide (ASO) administration, and to localize the perfect dose-range for the GLP-pre-toxicity study in rats, a pre-toxicity experiment in rats was performed.

    Description of Method:

    [0756] For repeated intravenous ASO injection 20 male and 20 female rats were divided into four treatment groups, a vehicle group, an ASO.sub.low, an ASO.sub.intermediate, and an ASO.sub.high group. This paradigm was performed for Seq. ID No. 218b and Seq. ID No. 218c. Rats received a daily iv bolus ASO injection for 15 consecutive days. Rats were monitored for mortality (twice daily), clinical symptoms (once daily, bod weight development (weekly), food consumption (weekly). On day 15 of the experimental paradigm, animals were sacrificed, organs (liver, kidney, brain) were removed and trunk blood was collected. Afterwards tissues and blood was analyzed for immunological and hematological alterations.

    [0757] The results of the present study demonstrate the two ASOs Seq. ID No. 218b and Seq. ID No. 218c to be a safe medication for a variety of different disorders with no toxic effects when administered at low and intermediate doses.

    Example 24: Determination of any General Toxicological Effects by Repeated Intravenous Antisense-Oligonucleotide Injection

    [0758] The goal of this study was to investigate at which dose a daily intravenous (iv) antisense-oligonucleotide (ASO) administration exerts any general toxicological effects in rats.

    Description of Method:

    [0759] For repeated intravenous ASO injection 80 male and 80 female rats were divided into four treatment groups, a vehicle group, an ASO.sub.low, an ASO.sub.intermediate, and an ASO.sub.high group. Rats received a daily iv bolus ASO injection for 29 consecutive days. Rats were monitored for mortality (twice daily), clinical symptoms (once daily, bod weight development (weekly), food consumption (weekly). On day 29 of the experimental paradigm, animals were sacrificed, organs (liver, kidney, brain) were removed and trunk blood was collected. In addition, bone marrow smears were collected. Afterwards tissues and blood was analyzed for immunological and hematological, and histopathological alterations.

    [0760] The results of the present study demonstrate the two ASOs Seq. ID No. 218b and Seq. ID No. 218c to be a safe medication for a variety of different disorders with no toxic effects when administered at low and intermediate doses.

    Example 25: Determination of the Toxicological Properties of a Chronic Central Antisense-Oligonucleotide Administration in Cynomolgus Monkeys

    [0761] To determine the effective, and to identify the toxic dose, male and female Cynomolgus monkeys received different doses of an inventive antisense-oligonucleotide (ASO) by chronic intracerebroventricular administration. During the administration paradigm, animals were monitored for immunological, hematological and physiological alterations.

    Description of Method:

    [0762] For chronic central ASO infusion in male and female Cynomolgus monkeys, a gas-pressure pump (0.25 ml/24 h, Tricumed IP-2000V®) connected to a silicone catheter, targeting the right lateral ventricle, was implanted subcutaneously under ketamine/xylacin anesthesia and semi-sterile conditions. Three male and three female monkeys were used for each treatment condition (vehicle, ASO.sub.low, ASO.sub.high, concentrations given in Table 79). Further, for investigating the timeframe for recovery, two male and two female monkeys (vehicle, and ASO.sub.high) were sacrificed four weeks after ASO administration was terminated. Each pump was implanted subcutaneously in the abdominal region via a 10 cm long skin incision at the neck of the monkey and connected with the icy cannula by a silicone catheter. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko®-Dr. Speier GmbH, Münster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, monkeys were locally treated with Betaisodona® (Mundipharma GmbH, Limburg, Germany) and received 1 ml antibiotics (sc, Baytril® 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective treatment solution. During the entire administration paradigm body weight development and food consumption was monitored. Further, blood and aCSF samples were taken once a week to determine hematological as well as immunological alterations but also systemic ASO concentrations. On the last day, animals of the main study were sacrificed, and organs (liver, kidneys, brain) were removed, and analyzed for proliferation, apoptosis, mRNA knock down, and tumor formation. After week 57, the additional animals used for investigating recovery periods were also sacrificed and the same read out parameters were determined.

    TABLE-US-00132 TABLE 80 Treatment conditions and the animals per group for the 4-week GLP- toxicity study and for the additional 4-week recovery period. Treatment Main study 4-week recovery period condition Males [n] Females [n] Males [n] Females [n] Vehicle 3 3 2 2 ASO.sub.low 3 3 / / ASO.sub.high 3 3 2 2

    [0763] The results of the present study demonstrate a chronic intracerebroventricular ASO administration to be a non-toxic and safe medication for the treatment of a variety of different diseases.

    Example 26: Determination of the Stability and the Biological Activity of an Antisense-Oligonucleotide in Different Vehicle Solutions

    [0764] To investigate, whether there are any interaction effects of the antisense-oligonucleotides (Seq. ID No. 218b, Seq. ID No. 218c) and the infusion solution, a 29-day pre-experiment was performed. Therefore, the two ASOs were reconstituted in different endotoxin-free vehicle solutions (PBS, water for injection [WFI], 0.9% NaCl) and stored at different conditions, respectively. Samples were collected every single week and were analyzed for pH-value, ASO stability, content, and integrity by AEX-HPLC. Any change in efficacy conditions were tested by proving the potency of TGF-RII mRNA knockdown in cell-culture assay with each sample, respectively.

    Description of Method:

    [0765] The lyophilized ASOs were diluted with the respective vehicle solution (Water for injection, 0.9% NaCl, PBS) under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience®, 51 conditions). The 1.5 ml Eppendorf Cups were labeled and filled with 100 μl (AEX-HPLC) or 250 μl (target knock down) of the respective ASO solution (all steps under laminar flow, BIOWIZARD Golden GL-170 Ergoscience®, 51 conditions, see pipetting/labeling scheme table 81). In the next step, all samples were stored at their respective storing conditions and samples were collected every single week (see sampling scheme table 82) and stored at −80° C. until analyzation.

    TABLE-US-00133 TABLE 81 Labeling scheme for the ASO-vehicle-stability study. The labeling scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 10 μM and 0.24 mM) and for all three vehicles WFI, 0.9% NaCl, and PBS (=>12 different schemes). Day Vehicle (WFI, 0.9% NaCL Label or PBS) Condition 0 6 12 18 24 29 ASO X Baseline ASO [10 μM] [10 X_Baseline μM] ASO X −20° C. ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] [10 X_−20° X_−20° X_−20° X_−20° X_−20° μM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X  +4° C. ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] [10 X_+4° X_+4° X_+4° X_+4° X_+4° μM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +20° C. ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] [10 X_+20° X_+20° X_+20° X_+20° X_+20° μM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +37° C. ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] [10 X_+37° X_+37° X_+37°_Day X_+37°_Day X_+37° μM] C._Day 6 C._Day 12 18 24 C._Day 29 ASO X +40° C. ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] ASO [10 μM] [10 X_40° X_40° X_40° X_40° X_40° μM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X pH value ASO [10 μM] ASO [10 μM] [10 X_pH X_pH μM] value_Day 0 value_Day 29 ASO X Baseline ASO [0.24 mM] [0.24 X_Baseline mM] ASO X −20° C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_−20° X_−20° X_−20° X_−20° X_−20° mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X  +4° C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+4° X_+4° X_+4° X_+4° X_+4° mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +20° C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+20° X_+20° X_+20° X_+20° X_+20° mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +37° C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+37° X_+37° X_+37°_Day X_+37°_Day X_+37° mM] C._Day 6 C._Day 12 18 24 C._Day 29 ASO X +40° C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_40° X_40° X_40° X_40° X_40° mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X pH value ASO [0.24 mM] ASO [0.24 mM] [0.24 X_pH X_pH_value_Day mM] value Day 0 29

    TABLE-US-00134 TABLE 82 Collection scheme for the ASO-vehicle-stability study. The collection scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 10 μM and 0.24 mM) and for all three vehicles WFI, 0.9% NaCl, and PBS (=>12 different schemes). Sample Day Condition 0 6 12 18 24 29 Baseline X −20° C. X X X X X  +4° C. X X X X X +20° C. X X X X X +37° C. X X X X X +40° C. X X X X X pH value X X

    [0766] Since there were no effects of any of the vehicle solutions on stability, content, and integrity of Seq. ID No. 218b and Seq. ID No. 218c, 0.9% NaCl was used for the ASO-in use-stability experiment.

    Example 27: Determination of the In-Use Stability and the Biological Activity of Inventive Antisense-Oligonucleotides (ASOs) in Vehicle Solution

    [0767] To investigate, whether there are any interaction effects of the antisense oligonucleotides (ASO) (Seq. ID No. 218b, Seq. ID No. 218c) and a gas pressure pump or a catheter, a 29-day pre-experiment was performed. Therefore, the two ASOs were reconstituted in 0.9% NaCl and the pump and the catheter were filled according to manufacturer's description. Samples were collected every single week and were analyzed for pH-value, microbiology, and oligo stability, content, and integrity by AEX-HPLC. Any change in efficacy conditions were also tested by proofing the potency to knockdown TGF-R.sub.II mRNA in cell-culture assay with every sample, respectively.

    Description of Method:

    [0768] The lyophilized ASOs were diluted with 0.9% NaCl under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience®, 51 conditions). The 5 ml Eppendorf Cups were labeled according to the labeling scheme (see table 83) under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience, 51 conditions). The two gas pressure pumps (Tricumed Model IP-2000 V®) and the catheter (spinal catheter set 4000) were filled according to manufacturer's description with the respective ASO solution (all steps under laminar flow, BIOWIZARD Golden GL-170 Ergoscience®, 51 conditions, see pipetting/labeling scheme table 83). In the next step, the pump connected to the catheter which was connected to the lid of a 5 ml Eppendorf Cup and the remaining Cups were stored in a storage box with all openings being closed with Parafilm®, to avoid any contamination. Every single week the samples were collected, stored at −80° C. until analysis and the catheter connected to the lid of a 5 ml Eppendorf Cup was transferred to the following Cup to continue the sampling procedure. In addition, one sample was taken directly from the pump via the bolus port and stored at -80° C. On the last day, an additional sample for microbiological analysis was collected.

    TABLE-US-00135 TABLE 83 Labeling scheme for the ASO in-use-stability study. The labeling scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 0.24 mM). Day Sample Con- Oligo Cup dition 0 6 12 18 24 29 Seq. ID No. 5 ml PS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218b [0.24 No. 218b No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. mM] [10 μM] PS_Day 6 PS_Day 12 PS_Day 18 PS_Day 24 PS_Day 29 Baseline Seq. ID No. 5 ml AS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218b [0.24 No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. No. 218b_+37° C. mM] AS_Day 6 AS_Day 12 AS_Day 18 AS_Day 24 AS_Day 29 Seq. ID No. 5 ml MB Seq. ID 218b [0.24 No. 218b_+37° C. mM] MB_Day 29 Seq. ID No. 5 ml pH Seq. ID Seq. ID 218b [0.24 value No. 218b No. 218b mM] pH value pH value Day 0 Day 29 Seq. ID No. 5 ml PS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218c [0.24 No. 218c No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. mM] Baseline PS_Day 6 PS_Day 12 PS_Day 18 PS_Day 24 PS_Day 29 Seq. ID No. 5 ml AS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218c [0.24 No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. No. 218c_+37° C. mM] AS_Day 6 AS_Day 12 AS_Day 18 AS_Day 24 AS_Day 29 Seq. ID No. 5 ml MB Seq. ID 218c [0.24 No. 218c_+37° C. mM] MB_Day 29 Seq. ID No. 5 ml pH Seq. ID Seq. ID 218c [0.24 value No. 218c No. 218c mM] pH value pH value Day 0 Day 29 PS: (PumpSample: sample directly from the catheter), AS: (AdditionalSample: sample directly from the reservoir inside the pump via bolus port, MB: (MicroBiology: 500 μM from PS and AS)

    TABLE-US-00136 TABLE 84 Collection scheme for the ASO in-use-stability study. The collection scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (0.24 mM). Sample Day Cup Condition 0 6 12 18 24 29 5 ml Baseline X 5 ml PS X X X X X 5 ml AS X X X X X 5 ml MB X 5 ml pH value X X PS: (PumpSample: sample directly from the catheter), AS: (AdditionalSample: sample directly from the reservoir inside the pump via bolus port, MB: (MicroBiology: 500 μM from PS and AS)

    [0769] Since there were no effects of the pump and the catheter on the stability, content, and integrity of Seq. ID No. 218b and Seq. ID No. 218c, and there were also no noticeable microbiological problems, this application paradigm represents the optimal technique for the intrathecal and intracerebroventricular administration in Cynomolgus monkeys and humans.

    Chemical Synthesis

    Abbreviations

    [0770] Pybop: (Benzotriazol-1-yl-oxy)tripyrrolidinophosphonium-hexafluorophosphat

    DCM: Dichloromethane

    DMF: Dimethylformamide

    DMAP: 4-Dimethylaminopyridine

    [0771] DMT: 4,4′-dimethoxytrityl

    LCAA: Long Chain Alkyl Amino

    [0772] TRIS: Tris(hydroxymethyl)-aminomethan
    TRIS-HCl: Tris(hydroxymethyl)-aminomethan hydrochloride
    DEPC: Diethyl dicarbonate

    Gapmer Antisense-Oligonucleotide Synthesis and Purification

    [0773] The antisense-oligonucleotides in form of gapmers were assembled on an ABI 3900 or on an ABI 394 synthesizer, or on an Expedite™ (Applied Biosystems) according to the phosphoramidite oligomerization chemistry. On the ABI3900, the solid support was polystyrene loaded with UnySupport (purchased from Glen Research, Sterling, Va., USA) to give a synthesis scale of 0.2 μmol. On the ABI 394 the solid support was 500 A controlled pore glass (CPG) loaded with Unylinker™ purchased from Chemgenes (Wilmington, Mass., USA) to give a 3 μmol synthesis scale.

    [0774] Ancillary synthesis reagents such as “Deblock”, “Oxidizer”, “CapA” and “CapB” as well as DNA phosphoramidites were obtained from SAFC Proligo (Hamburg, Germany). Specifically, 5′-O-(4,4′-dimethoxytrityl)-2′-O,3′-O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite monomers of deoxy thymidine (dT), 4-N-benzoyl-2′-deoxy-cytidine (dC.sup.Bz), 6-N-benzoyl-2′-deoxy-adenosine (dA.sup.Bz) and 2-N-isobutyryl-2′-deoxy-guanosine (dG.sup.iBu) were used as DNA building-units. 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethylformamidine-guanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (LNA-G.sup.DMF), 5′-O-DMT-2′-O,4′-C-methylene-thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (LNA-Tb), 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (LNA-A.sup.Bz), 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (LNA-C*.sup.Bz) were used as LNA-building-units. The LNA phosphoramidites were purchased from Exiqon (Vebaek, Denmark).

    [0775] As shown by the examples of the LNAs in table 85, the phosphoramidites were dissolved in dry acetonitrile to give 0.07 M-oligonucleotide except LNA-C*.sup.Bz which was dissolved in a mixture of THF/acetonitrile (25/75 (v/v)).

    TABLE-US-00137 TABLE 85 To obtain Molecular a 0.07M weight solution g/mole CAS No. Solvent 100 mg LNA-A.sup.Bz 885.9 [206055-79-0] Anhydrous 1.6 ml Acetonitrile LNA-C*.sup.Bz 875.9 [206055-82-5] THF/Acetonitrile 1.6 ml 25/75 (v/v) LNA-G.sup.DMF 852.9 [709641-79-2] Anhydrous 1.7 ml Acetonitrile LNA-T 772.8 [206055-75-6] Anhydrous 1.8 ml Acetonitrile

    [0776] The β-D-thio-LNAs 5′-O-DMT-2′-deoxy-2′-mercapto-2′-S,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite, 5′-O-DMT-2′-deoxy-2′-mercapto-2′-S,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites, 5′-O-DMT-2′-deoxy-2′-mercapto-2′-S,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-O-DMT-2′-deoxy-2′-mercapto-2′-S,4′-C-methylene-thymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5′-O-DMT-2′-deoxy-2′-amino-2′-N,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites were synthesized as described in J. Org. Chem. 1998, 63, 6078-6079.

    [0777] The synthesis of the β-D-amino-LNA 5′-O-DMT-2′-deoxy-2′-amino-2′-N,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidites, 5′-O-DMT-2′-deoxy-2′-amino-2′-N,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-O-DMT-2′-deoxy-2′-amino-2′-N,4′-C-methylene-thymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-O-DMT-2′-deoxy-2′-methylamino-2′-N,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite, and 5′-O-DMT-2′-deoxy-2′-methylamino-2′-N,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites, 5′-O-DMT-2′-deoxy-2′-methylamino-2′-N,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite 5′-O-DMT-2′-deoxy-2′-methylamino-2′-N,4′-C-methylene-thymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were carry out according to the literature procedure (J. Org Chem. 1998, 63, 6078-6079).

    [0778] The α-L-oxy-LNAs α-L-5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite, α-L-5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite, α-L-5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and α-L-5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were performed similar to the procedures described in the literature (J. Am. Chem. Soc. 2002, 124, 2164-2176; Angew. Chem. Int. Ed. 200, 39, 1656-1659).

    [0779] The (β-benzoylmercapto)ethyl)pyrrolidinolthiophosphoramidites for the synthesis of the oligonucleotide with phosphorothioate backbone were prepared in analogy to the protocol reported by Caruthers (J. Org. Chem. 1996, 61, 4272-4281).

    [0780] The “phosphoramidites-C3” (3-(4,4′-Dimethoxytrityloxy)propyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and the T-Spacer “3 CPG” (1-Dimethoxytrityloxy-propanediol-3-succinoyl)-long chain alkylamino-CPG were purchased from Glen Research.

    General Procedure

    Preparation of the LNA-Solid Support:

    1) Preparation of the LNA Succinyl Hemiester (WO2007/112754)

    [0781] 5′-O-DMT-3′-hydroxy-nucleoside monomer, succinic anhydride (1.2 eq.) and DMAP (1.2 eq.) were dissolved in 35 ml dichloromethane (DCM). The reaction was stirred at room temperature overnight. After extractions with NaH.sub.2PO.sub.4 0.1 M pH 5.5 (2×) and brine (1×), the organic layer was further dried with anhydrous NaSO.sub.4 filtered and evaporated. The hemiester derivative was obtained in 95% yield and was used without any further purification.

    2) Preparation of the LNA-Support (WO2007/112754)

    [0782] The above prepared hemiester derivative (90 μmol) was dissolved in a minimum amount of DMF, DIEA and pyBOP (90 μmol) were added and mixed together for 1 min. This pre-activated mixture was combined with LCAA-CPG (500 Å, 80-120 mesh size, 300 mg) in a manual synthesizer and stirred. After 1.5 hours at room temperature, the support was filtered off and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 μmol/g (see Tom Brown, Dorcas J. S. Brown. Modern machine-aided methods of oligodeoxyribonucleotide synthesis. In: F. Eckstein, editor. Oligonucleotides and 35 Analogues A Practical Approach. Oxford: IRL Press, 1991: 13-14).

    Elongation of the Oligonucleotide (Coupling)

    [0783] 5-ethylthio-1H-tetrazole (ETT) as activator (0.5 M in acetonitrile) was employed for the coupling of the phosphoramidites. Instead of ETT other reagents such as 4,5-dicyanoimidazole (DCI) as described in WO2007/112754, 5-benzylthio-1H-tetrazole or saccharin-1-methylimidazol can be used as activator. 0.25 M DCI in acetonitrile was used for the coupling with LNA.

    Capping

    [0784] 10% acetic anhydride (Ac.sub.2O) in THF (HPLC grade) and 10% N-methylimidazol (NMI) in THF/pyridine (8:1) (HPLC grade) were added and allowed to react.

    Oxidation

    [0785] Phosphorous(III) to Phosphorous(V) is normally done with e.g. iodine/THF/pyridine/H.sub.2O using 0.02 M iodine in THF/Pyridine/H.sub.2O purchased from Glen Research or 0.5 M 1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO) in anhydrous acetonitrile from Glen Research.

    [0786] In the case that a phosphorthioate internucleoside linkage is prepared, a thiolation step is performed using a 0.05 M solution of 3-((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (1:1 v/v). In case LNAs are used, the thiolation was carried out using 0.2 M 3,H-1,2-benzothiole-3-one 1,1-dioxide (Beaucage reagent) in anhydrous acetonitrile.

    [0787] In general, the thiolation can also be carried out by using xanthane chloride (0.01 M in acetonitrile/pyridine 10%) as described in WO2007/112754.

    [0788] Alternative, other reagents for the thiolation step such as xanthane hydride (5-imino-(1,2,4)dithiazolidine-3-thione), phenylacetyl disulfide (PADS) can be applied.

    [0789] In the case that a phosphordithioate was synthesized, the resulting thiophosphite triester was oxidized to the phosphorothiotriester by addition of 0.05 M DDTT (3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione) in pyridine/acetonitrile (4:1 v/v).

    Cleavage from the Solid Support and Deprotection

    [0790] At the end of the solid phase synthesis, the antisense-oligonucleotide can either be cleaved “DMT-on” or “DMT-off”. “DMT off” means that the final 5′-O-(4,4′-dimethoxytrityl) group was removed on the synthesizer using the “Deblock” reagent and DMT-on means that the group is present while the oligonucleotide is cleaved from the solid support. The DMT groups were removed with trichloroacetic acid.

    “DMT-Off”

    [0791] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone. Subsequently, the antisense-oligonucleotides were cleaved from the solid support and deprotected using 1 to 5 mL concentrated aqueous ammonia (obtained from Sigma Aldrich) for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0792] If the oligonucleotides contain phosphorodithioate triester, the thiol-groups were deprotected with thiophenol:triethylamine:dioxane, 1:1:2, v/v/v for 24 h, then the oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature, and further deprotected for 4 hours at 65° C.

    “DMT-On”

    [0793] The oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature, and further deprotected for 4 hours at 65° C. The oligonucleotides were purified by reverse phase HPLC (RP-HPLC), and then the DMT-group is removed with trichloroacetic acid.

    [0794] If the oligonucleotides contain phosphorodithioate triester, the cleavage from the solid-support and the deprotection of the thiol-group were performed by the addition of 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h.

    Terminal Groups

    Terminal Groups at the 5′-End of the Antisense Oligonucleotide

    [0795] The solid supported oligonucleotide was treated with 3% trichloroacetic acid in dichloromethane (w/v) to completely remove the 5′-DMT protection group. Further, the compound was converted with an appropriate terminal group with cyanoethyl-N,N-diisopropyl)phosphoramidite-moiety. After the oxidation of the phosphorus(III) to phosphorus(V), the deprotection, detachment from the solid support and deprotection sequence were performed as described above.

    Purification

    [0796] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. Analytics

    [0797] Identity of the antisense-oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS) and purity was by analytical OligoPro Capillary Electrophoresis (CE).

    [0798] The purification of the dithioate was performed on an Amersham Biosciences P920 FPLC instrument fitted with a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 28

    [0799]

    TABLE-US-00138 (Seq. ID No. 209y) Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1s C*b.sup.1 

    [0800] 5′-O-DMT-2′-O,4′-C-methylene-5-methyl-N.sup.4-benzoxylcytidine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0801] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0802] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0803] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0804] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0805] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0806] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0807] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0808] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0809] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0810] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0811] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0812] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0813] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0814] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0815] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [0816] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0817] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. The antisense oligonucleotide was received with a purity of 93.7%. ESI-MS: experimental: 5387.3 Da; calculated: 5387.80 Da.

    Example 29

    [0818]

    TABLE-US-00139 (Seq. ID No. 209u) Gb.sup.1Tb.sup.1dAdGdTdGdTdTdTdAdGdGdGAb.sup.1Gb.sup.1C*b.sup.1

    [0819] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 28. After the capping step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 95.3%. ESI-Ms: experimental: 5146.80 Da; calculated: 5146.4 Da.

    Example 30

    [0820]

    TABLE-US-00140 (Seq. ID No. 209v) /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsA b.sup.1sGb.sup.1sC*b.sup.1

    [0821] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 28. After purification, the antisense oligonucleotide was received with a purity of 97.4%. HRMS (ESI): experimental: 5540.70 Da; calculated: 5541.4 Da.

    Example 31

    [0822]

    TABLE-US-00141 (Seq. ID No. 209w) Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1s C*b.sup.1/3SpC3s/

    [0823] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 28. After purification, the antisense oligonucleotide was received with a purity of 92.7%. ESI-sMS: experimental: 5541.70 Da; calculated: 5541.4 Da.

    Example 32

    [0824]

    TABLE-US-00142 (Seq. ID No. 209an) Gb.sup.1ssTb.sup.1ssAb.sup.1ssdGssdTssdGssdTssdTssdTssdA*ssdGssdGs sdGssAb.sup.1ssGb.sup.1ssC*b.sup.1

    [0825] 5′-O-DMT-2′-O,4′-C-methylene-5-methyl-N.sup.4-benzoxylcytidine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0826] The coupling was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0827] The further elongation of the oligonucleotide was performed in the same way.

    [0828] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [0829] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 33

    [0830]

    TABLE-US-00143 (Seq. ID No. 209az) Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsGbsAb.sup.1sGb.sup.1s C*b.sup.1

    [0831] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 90.5%. ESI-MS: experimental: 5442.9 Da; calculated: 5443.3 Da.

    Example 34

    [0832]

    TABLE-US-00144 (Seq. ID No. 209ba) Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.1sAb.sup.1sG b.sup.1sC*b.sup.1

    [0833] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 89.4%. ESI-MS: experimental: 5469.9 Da; calculated: 5471.3 Da.

    Example 35

    [0834]

    TABLE-US-00145 (Seq. ID No. 209bb) Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGb.sup.1s C*b.sup.1

    [0835] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 88.4%. ESI-MS: experimental: 5386.5 Da; calculated: 5387.3 Da.

    Example 36

    [0836]

    TABLE-US-00146 (Seq. ID No. 209s) Gb.sup.1Tb.sup.1dAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1Gb.sup.1C*b.sup.1

    [0837] The compound was synthesized according to the procedure as described in example 28 and example 29 with the appropriate DNA, DNA-derivatives and the LNA building units. After purification, the antisense oligonucleotide was received with a purity of 96.8%. ESI-MS: experimental: 5323.30 Da; calculated: 5323.0 Da.

    Example 37

    [0838] Gb.sup.1sTb.sup.1sdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*b.sup.1 (Seq. ID No. 209t) The compound was synthesized according to the general procedure and as described in example 28 with the appropriate DNA and LNA building units. After purification, the antisense oligonucleotide was received with a purity of 91.4%. ESI-MS: experimental: 5416.30 Da; calculated: 5417.3 Da.

    Example 38

    [0839]

    TABLE-US-00147 (Seq. ID No. 209x) /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsA b.sup.1sGb.sup.1sC*b.sup.1/3SpC3s/

    [0840] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28, example 30 and example 31. After purification, the antisense oligonucleotide was received with a purity of 95.1%. ESI-MS: experimental: 5696.30 Da; calculated: 5695.5 Da.

    Examples 39-132

    [0841] The other oligonucleotides of Table 6 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    Example 133

    [0842]

    TABLE-US-00148 (Seq. ID No. 210q) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1sT b.sup.1sTb.sup.1

    [0843] 5′-O-DMT-2′-O,4′-C-methylene thymidine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0844] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0845] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0846] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0847] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0848] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0849] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0850] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0851] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0852] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0853] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0854] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0855] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0856] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0857] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0858] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [0859] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 ml concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0860] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

    [0861] The antisense oligonucleotide was received with a purity of 87.1%. ESI-MS: experimental: 5384.30 Da; calculated: 5384.3 Da.

    Example 134

    [0862]

    TABLE-US-00149 (Seq. ID No. 210r) Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTdTdTdGdGdTdA*dGdTGb.sup.1Tb.sup.1Tb.sup.1

    [0863] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 133. After the capping step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 95.3%.

    Example 135

    [0864]

    TABLE-US-00150 (Seq. ID No. 210v) /5SpC3s/Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsd TsGb.sup.1sTb.sup.1sTb.sup.1

    [0865] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 133. After purification, the antisense oligonucleotide was received with a purity of 93.9%.

    Example 136

    [0866]

    TABLE-US-00151 (Seq. ID No. 210w) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1sT b.sup.1sTb.sup.1/3SpC3s/

    [0867] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 133. After purification, the antisense oligonucleotide was received with a purity of 89.7%.

    Example 137

    [0868]

    TABLE-US-00152 (Seq. ID No. 2100) Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1Tb.sup.1Tb.sup.1

    [0869] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133 and example 134. After purification, the antisense oligonucleotide was received with a purity of 83.8%. ESI-MS: experimental: 5288.10 Da; calculated: 5287.9 Da.

    Example 138

    [0870]

    TABLE-US-00153 (Seq. ID No. 210p) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTdGsdGsdTsdA*sdGsdTsGb.sup.1sT b.sup.1sTb.sup.1

    [0871] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133. After purification, the antisense oligonucleotide was received with a purity of 80.7%. ESI-MS: experimental: 5398.40 Da; calculated: 5399.3 Da.

    Example 139

    [0872]

    TABLE-US-00154 (Seq. ID No. 210af) Gb.sup.1ssC*b.sup.1ssTb.sup.1ssdAssdTssdTssdTssdGssd GssdTssdA*ssdGssdTssGb.sup.1ssTb.sup.1ssTb.sup.1

    [0873] 5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0874] The coupling was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0875] The further elongation of the oligonucleotide was performed in the same way.

    [0876] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [0877] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 140-233

    [0878] The other oligonucleotides of Table 7 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    Example 234

    [0879]

    TABLE-US-00155 (Seq. ID No. 218b) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    5′-O-DMT-2′-O,4′-C-methylene-N.SUP.6.-benzoyladenosine-3′-O-succinate

    [0880] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine (500 mg, 0.73 mmol), 95 mg succinic anhydride (0.95 mmol, 1.2 eq.) and 116 mg DMAP (0.95 mmol, 1.2 eq.) were dissolved in 35 ml dichloromethane. The reaction was stirred at room temperature overnight. The reaction solution was washed 2 times with 10 ml NaH.sub.2PO.sub.4 (0.1 M, pH 5.5) and one time with 10 ml brine. The organic phase was dried under anhydrous NaSO.sub.4, filtered and concentrated to dryness in vacuo. The hemiester derivative was obtained in 95% yield and was used without further purification for the next step.

    5′-O-DMT-2′-O,4′-C-methylene-N.SUP.6.-benzoyladenosine-3′-O-succinoyl-linked LCAA CPG

    [0881] 70 mg hemiester derivative (90 μmol) was dissolved in 0.3 ml DMF, 11.6 μl DIEA (90 μmol) and pyBOP (90 μmol) were added and mixed together for 1 min. This mixture was combined with LCAA-CPG (500 Å, 80-120 mesh size, 300 mg) in a manual synthesizer and stirred for 1.5 hours at room temperature. The support was filtered off and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 μmol/g.

    Elongation

    [0882] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0883] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0884] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0885] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0886] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0887] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0888] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0889] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0890] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0891] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0892] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0893] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0894] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0895] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0896] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0897] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [0898] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0899] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. The antisense oligonucleotide was received with a purity of 94.8%. ESI-MS: experimental: 5365.80 Da; calculated: 5365.30 Da.

    Example 235

    [0900]

    TABLE-US-00156 (Seq. ID No. 218r) C*b.sup.1Ab.sup.1Tb.sup.1dGdAdAdTdGdGdAdCdCAb.sup.1Gb.sup.1Tb.sup.1Ab.sup.1

    [0901] The LNA was bound to CPG according the general procedure. The coupling reaction and capping step were also carried out as described in example 234. After the capping step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 97.8%. ESI-MS: experimental: 5125.10 Da.; calculated: 5124.4 Da.

    Example 236

    [0902]

    TABLE-US-00157 (Seq. ID No. 218t) /5SpC3s/C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsd GsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0903] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.2%. ESI-MS: experimental: 5519.60 Da; calculated: 5519.4 Da.

    Example 237

    [0904]

    TABLE-US-00158 (Seq. ID No. 218u) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1s/3SpC3/

    [0905] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.3%. ESI-MS: experimental: 5519.10 Da; calculated: 5519.4 Da.

    Example 238

    [0906]

    TABLE-US-00159 (Seq. ID No. 218aa) C*b.sup.1ssAb.sup.1ssTb.sup.1ssdGssdAssdAssdTssdGssd GssdAssdCssdCssAb.sup.1ssGb.sup.1ssTb.sup.1ssAb.sup.1

    [0907] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0908] The coupling was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0909] The further elongation of the oligonucleotide was performed in the same way.

    [0910] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [0911] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 239

    [0912]

    TABLE-US-00160 (Seq. ID No. 218m) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd C*sdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0913] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 93.8%. ESI-MS: experimental: 5394.00 Da; calculated: 5393.3 Da.

    Example 240

    [0914]

    TABLE-US-00161 (Seq. ID No. 218n) C*b.sup.1Ab.sup.1Tb.sup.1dGsdAsdAsdTsdGsdGsdAsdC* sdC*sAb.sup.1Gb.sup.1Tb.sup.1Ab.sup.1

    [0915] The compound was synthesized according to the general procedure with the appropriate DNA building units and LNA building units as exemplified in example 234 and example 235. After purification, the antisense oligonucleotide was received with a purity of 94.7%. ESI-MS: experimental: 5297.30 Da; calculated: 5297.0 Da.

    Example 241

    [0916]

    TABLE-US-00162 (Seq. ID No. 218o) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsd A*sdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0917] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 92.8%. ESI-MS: experimental: 5410.40 Da; calculated: 5410.3 Da.

    Example 242

    [0918]

    TABLE-US-00163 (Seq. ID. No. 218p) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsd A*sdC*sdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0919] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 95.3%. ESI-MS: experimental: 5437.40 Da; calculated: 5438.4 Da.

    Example 243

    [0920]

    TABLE-US-00164 (Seq. ID No. 218q) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdA sdC*sdCsAbsGb.sup.1sTb.sup.1sAb.sup.1

    [0921] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 93.9%. ESI-MS: experimental: 5378.80 Da; calculated: 5379.3 Da.

    Example 244

    [0922]

    TABLE-US-00165 (Seq. ID No. 218c) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0923] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 92.9%. ESI-MS: experimental: 5379.10 Da; calculated: 5379.3 Da.

    Example 245

    [0924]

    TABLE-US-00166 (Seq. ID No. 218s) C*b.sup.1sAb.sup.1sTb.sup.1sdGdAdAdTdGdGdAdC*sdC* sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

    [0925] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.5%. ESI-MS: experimental: 5152.70 Da; calculated: 5152.4 Da.

    Example 246

    [0926]

    TABLE-US-00167 (Seq. ID No. 218v) /5SpC3/sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsd GsdGsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1s/3SpC3/

    [0927] The compound was synthesized according to the general procedure with the appropriate DNA building units and LNA building units as exemplified in example 234, example 236 and example 237. After purification, the antisense oligonucleotide was received with a purity of 94.4%. ESI-MS: experimental: 5673.50 Da; calculated: 5673.5 Da

    Example 247-335

    [0928] The other oligonucleotides of Table 8 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    Example 336

    [0929]

    TABLE-US-00168 (Seq. ID No. 152h) C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsd CsdCsAb.sup.1sC*b.sup.1sAb.sup.1

    [0930] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0931] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0932] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0933] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s. The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0934] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0935] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0936] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0937] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0938] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0939] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0940] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0941] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0942] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0943] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0944] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [0945] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0946] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

    Example 337

    [0947]

    TABLE-US-00169 (Seq. ID No. 152q) C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1dAdCdGdC*dGdTdCdC*Ab.sup.1C*b.sup.1Ab.sup.1

    [0948] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 336. After the coupling step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. After the oxidation step, the system was flushed with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 93.1%.

    Example 338

    [0949]

    TABLE-US-00170 (Seq. ID. No. 152s) /5SpC3s/C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGs dC*sdGsdTsdCsdCsAb.sup.1sC*b.sup.1sAb.sup.1

    [0950] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 336. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 336. After purification, the antisense oligonucleotide was received with a purity of 96.5%.

    Example 339

    [0951]

    TABLE-US-00171 (Seq. ID No. 152t) C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdCsdGsd TsdCsdC*sAb.sup.1sC*b.sup.1sAb.sup.1/3SpC3s/

    [0952] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 336. After purification, the antisense oligonucleotide was received with a purity of 92.1%.

    Example 340

    [0953]

    TABLE-US-00172 (Seq. ID No. 152aa) C*b.sup.1ssGb.sup.1ssAb.sup.1ssdTssdAssdC*ssdGssdC ssdGssdTssdCssdC*ssAb.sup.1ssC*b.sup.1ssAb.sup.1

    [0954] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0955] The coupling was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0956] The further elongation of the oligonucleotide was performed in the same way.

    [0957] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [0958] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 341-433

    [0959] The other oligonucleotides of Table 5 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    Example 434

    [0960]

    TABLE-US-00173 (Seq. ID No. 143h) C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGs dAsC*b.sup.1sC*b.sup.1sGb.sup.1

    [0961] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine -3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0962] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0963] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0964] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0965] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0966] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0967] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0968] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0969] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0970] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0971] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0972] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0973] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0974] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [0975] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [0976] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

    Example 435

    [0977]

    TABLE-US-00174 (Seq. ID No. 143ad) C*b.sup.1Tb.sup.1dC*dGdTdCdAdTdAdGdAC*b.sup.1C*b.sup.1Gb.sup.1

    [0978] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 434. After the capping step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 88.7%.

    Example 436

    [0979]

    TABLE-US-00175 (Seq. ID No. 143af) /5SpC3s/C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*d TdAdGdA*sC*b.sup.1sC*b.sup.1sGb.sup.1

    [0980] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 434 and example 435. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 434 and example 435. After purification, the antisense oligonucleotide was received with a purity of 94.4%.

    Example 437

    [0981]

    TABLE-US-00176 (Seq. ID No. 143ag) C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*dTdAdGdA*s C*b.sup.1sC*b.sup.1sGb.sup.1/3SpC3s/

    [0982] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-diemthyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 434 and example 435. After purification, the antisense oligonucleotide was received with a purity of 91.6%.

    Example 438

    [0983]

    TABLE-US-00177 (Seq. ID No. 143t) C*b.sup.1ssTb.sup.1ssC*b.sup.1ssdGssdTssdC*ssdAssd TssdAssdGssdAssC*b.sup.1ssC*b.sup.1ssGb.sup.1

    [0984] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0985] The coupling was carried out with 38 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0986] The further elongation of the oligonucleotide was performed in the same way.

    [0987] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [0988] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Example 439-534

    [0989] The other oligonucleotides of Table 4 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    Example 535

    [0990]

    TABLE-US-00178 (Seq. ID No. 213k) C*b1sAb1sGb1sdGsdCsdAsdTsdTsdAsdAsd TsdAsdAsdAsGb1sTb1sGb1

    [0991] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-T-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene thymidine 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0992] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0993] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0994] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0995] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0996] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0997] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0998] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [0999] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1000] The coupling was carried out with 80 μl 5′-O-DMT-2′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1001] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.6-benzoyl-2′-deoxyadenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1002] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.4-benzoyl-2′-deoxycytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1003] The coupling was carried out with 80 μl 5′-O-DMT-N.sup.2-isobutyryl-2′-deoxyguanosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1004] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1005] The coupling was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.6-benzoyladenosine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s. The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1006] The coupling was carried out with 80 μl 5′-O-DMT-2′-O-,4′-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3′-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1007] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

    [1008] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55° C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

    [1009] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

    Example 536

    [1010]

    TABLE-US-00179 (Seq. ID No. 213n) C*b.sup.1Ab.sup.1Gb.sup.1dGdC*dAdTdTdAdAdTdAdAdAGb.sup.1Tb.sup.1Gb.sup.1

    [1011] The LNA was bound to CPG according to general procedure. The coupling reaction and capping step were also carried out as described in example 535. After the capping step, the system was flushed out with 800 μl acetonitrile, and 400 μl of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 μl acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 91.4%.

    Example 537

    [1012]

    TABLE-US-00180 (Seq. ID No. 213o) /5SpC3s/C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAs dAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1

    [1013] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 535. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 μl of phosphoramidite-C3 (0.07 M) and 236 μl DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile. The subsequent steps were performed as described in example 535. After purification, the antisense oligonucleotide was received with a purity of 87.1%.

    Example 538

    [1014]

    TABLE-US-00181 (Seq. ID No. 213p) C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTs dAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1/3SpC3s/

    [1015] 3′-Spacer C3 CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 80 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-diemthyformamidineguanosine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 640 μl of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. The subsequent reactions were performed as described in example 535. After purification, the antisense oligonucleotide was received with a purity of 95.7%.

    Example 539

    [1016]

    TABLE-US-00182 (Seq. ID No. 213ae) C*b.sup.1ssAb.sup.1ssGb.sup.1ssdGssdC*ssdAssdTssdTs sdAssdAssdTssdAssdAssAb.sup.1ssGb.sup.1ssTb.sup.1s sGb.sup.1

    [1017] 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-O-succinoyl-linked LCAA CPG (0.2 μmol) was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group. After several washes with a total amount of 800 μl acetonitrile, the coupling reaction was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-thymidine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1018] The coupling was carried out with 38 μl 5′-O-DMT-2′-O,4′-C-methylene-N.sup.2-dimethyformamidineguanosine-3′-[(β-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 μl DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 μl acetonitrile, and 900 μl of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 μl acetonitrile. For the capping step, 448 μl of acetic anhydride in THF (1:9 v/v) and 448 μl N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 μl acetonitrile. The compound was treated with 1400 μl 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5′-DMT protection group.

    [1019] The further elongation of the oligonucleotide was performed in the same way.

    [1020] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 μl ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55° C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

    [1021] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

    Examples 540-640

    [1022] The other oligonucleotides of Table 9 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including β-D-thio-LNA, α-L-oxy-LNA, β-D-(NH)-LNA, or β-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing β-D-oxy-LNA units.

    TABLE-US-00183 Sequence Listing Seq. ID No. 1: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, (antisense; DNA code) TTTAGCTACT AGGAATGGGA ACAGGAGGCA GGATGCTCAC CTGAGTATTT TGCTTTATTC 60 AATCTAATAA ACATTTTATT TATGTAAAAG ACAAACAATG CATAGAATAA AAATAAGTGC 120 TTGAGACTTT TGATATAAAA AGAGTATATA GCATTCACAT TCCTATTTTA ATACATGAGT 180 ACAGCTGAAG TGTTCCATAA AAGAATAAAA CTTTCCCTTT ATGTATAGTA GTGAAAAAAG 240 TCAGTATTTT TAGGAACTAC AGAATGTTAT TCCTTGGTCT TTTTTCTTGA ATAAGAAAAA 300 AAAACATAAA CAAAACAAGC CACAGTATCC TCTGACACTA CATTCCAGTT TATGCTGATA 360 ACCCAGAAGT GAGAATACTC TTGAATCTTG AATATCTCAT GAATGGACCA GTATTCTAGA 420 AACTCACCAC TAGAGGTCAA TGGGCAACAG CTATTGGGAT GGTATCAGCA TGCCCTACGG 480 TGCAAGTGGA ATTTCTAGGC GCCTCTATGC TACTGCAGCC ACACTGTCTT TAACTCTCAG 540 CCCACCCACA CTGAGGAGGG TGCCTAGAGG TTCTATTTCC AAACCTTTGC ATGTATCTTA 600 AAAATCTCAA TAAAATGAGA CCTTCCACCA TCCAAACAGA GCTGATATTC TCACTACCAG 660 TCCCTCTCTA ATATTCCTAT TTGGCTGAAA ATAAGTAGCT TCAAAAAGTT TTAAAAAAGA 720 GATTACTTGC AGCATTAACA CTTCTTTGTT GATTAACAAG TTTCCTATGG AGTTTTAAAG 780 CTCATACTTT GTTCTTGTCC TTGTGGACAC AAATTTTCTA ACTGCAAATG GGACCTTTGT 840 GTCCCACATT CAAATCCTCT CTAGTAATTT CTGCAAAGGT TGAGAAGGCT GGCATGATGG 900 AGAGAACGGT AACCATGAGG AAAGCTTCTT GGAGTAAAGC ACTCCTCTCT CCAATGCAGA 960 GGGTAAAACT ATTAACATAT AAGCAAAAGA AACTTGGGCT AACTGAGACC CTTAAAGGAG 1020 TTCCCCTTTA GTCCAATAAA AGGCCAACTT CAAATCTTAA CACCAGATAA GGTAGTCAAA 1080 ATCATATTAT ATACCCAGAG AATGACTGCT TGAATGGACA TTTCTTACAA GGGACCTTGG 1140 TTAGGTGCAG ATTTAATTCC TAGACTGGGG TCCAGGTAGG CAGTGGAAAG AGCTAATGTT 1200 TACAGTGAGA AGTGAGGCAG CTTTGTAAGT GTCTCCACAC CTTCACATTT TGTGAACGTG 1260 GACTGGAGAT AACTGAAAAC CATCTGCTAT CCTTACCTGG GGATCCAGAT TTTCCTGCAA 1320 AATCTCCAAA TATTTATAAA GTGGCTTCAC TTTTTGAAAC GCTGTGCTGA CCAAACAAAA 1380 CATATGTTTA GAGTGCCTGA GGTCATAGTC CTGACAATGA TAGTATTGTG TAGTTGAAAT 1440 CCTCTTCATC AGGCCAAACT GTGCTTGAGC AATCAGGAGC CCAGAAAGAT GGAACCCATT 1500 GGTGTTTGTA TAGAAAACTA GAAAATCAAG TCAAGTGTAA TGAAAAAGTA AACACGATAA 1560 AGCCTAGAGT GAGAATTTGC TCCTTTTTAG AAAAGGATGA AGGCTGGGAG CAGAGAATAG 1620 TAACATAAGT GCAGGGGAAA GATGAAAAAA AGAACAATTT TTCATTAGTA GATGGTGGGG 1680 CAATCGCATG GATGGGGACA TCTGTTCTGA TTTTTCTGCA ACCCATGAAG GTAAAAAGTG 1740 GGGTTCAAAA CATTCAAGGT ATTAAAGATG GGGTAGAGTT TCTAAACTAG GTTGAGGGAG 1800 AGTTTCTAAA CTAGCCCCCC AGATTTGGGG CTTGGAGCTT AAATGAAAAG TCCAGGAGAA 1860 ATAAGGGCAC ACAGGAACCC CGGGAACACT GGTCCTCAAA CAGTGCCACT GTACTTAGTT 1920 CCATGGCCAG AAGAGAAGTG CTAGGCAGGG AATGATTATT TTGCAAAAGC AAGTGCAATG 1980 TGGTCATAGC TGGCTGTGAG ACATGGAGCC TCTTTCCTCA TGCAAAGTTC ACTGTTTTAC 2040 AGTCAGAGAA CCACTGCATG TGTGATTGTC AAATGCTAAT GCTGTCATGG GTCCCTTCCT 2100 TCTCTGCTTG GTTCTGGAGT TCTCCAATAA AACCAATTTC CTGGGAATAT TTGATGTTTT 2160 TCCTTGTCTC TTTTCAAGGT ATGGCTATAT ATATAGAGCT ATAGACATAT ATAGATATAT 2220 ATATATATAT ATAAAACATA GCTATTCATA TTTATATACA GGCATTAATA AAGTGCAAAT 2280 GTTATTGGCT ATTGTAAAAA TCAATCTCAT TTCCTGAGGA AGTGCTAACA CAGCTTATCC 2340 TATGACAATG TCAAAGGCAT AGAATGCTCT ATGTCACCCA CTCCCTGCTG CTGTTGTTTC 2400 TGCTTATCCC CACAGCTTAC AGGGAGGGGA GTGACCCCCT TGGTTTTCCA GGAAGCATCA 2460 GTTCAGGGGC AGCTTCCTGC TGCCTCTGTT CTTTGGTGAG AGGGGCAGCC TCTTTGGACA 2520 TGGCCCAGCC TGCCCCAGAA GAGCTATTTG GTAGTGTTTA GGGAGCCGTC TTCAGGAATC 2580 TTCTCCTCCG AGCAGCTCCT CCCCGAGAGC CTGTCCAGAT GCTCCAGCTC ACTGAAGCGT 2640 TCTGCCACAC ACTGGGCTGT GAGACGGGCC TCTGGGTCGT GGTCCCAGCA CTCAGTCAAC 2700 GTCTCACACA CCATCTGGAT GCCCTGGTGG TTGAGCCAGA AGCTGGGAAT TTCTGGTCGC 2760 CCTCGATCTC TCAACACGTT GTCCTTCATG CTTTCGACAC AGGGGTGCTC CCGCACCTTG 2820 GAACCAAATG GAGGCTCATA ATCTTTTACT TCTCCCACTG CATTACAGCG AGATGTCATT 2880 TCCCAGAGCA CCAGAGCCAT GGAGTAGACA TCGGTCTGCT TGAAGGACTC AACATTCTCC 2940 AAATTCATCC TGGATTCTAG GACTTCTGGA GCCATGTATC TTGCAGTTCC CACCTGCCCA 3000 CTGTTAGCCA GGTCATCCAC AGACAGAGTA GGGTCCAGAC GCAGGGAAAG CCCAAAGTCA 3060 CACAGGCAGC AGGTTAGGTC GTTCTTCACG AGGATATTGG AGCTCTTGAG GTCCCTGTGC 3120 ACGATGGGCA TCTTGGGCCT CCCACATGGA GTGTGATCAC TGTGGAGGTG AGCAATCCCC 3180 CGGGCGAGGG AGCTGCCCAG CTTGCGCAGG TCCTCCCAGC TGATGACATG CCGCGTCAGG 3240 TACTCCTGTA GGTTGCCCTT GGCGTGGAAG GCGGTGATCA GCCAGTATTG TTTCCCCAAC 3300 TCCGTCTTCC GCTCCTCAGC CGTCAGGAAC TGGAGTATGT TCTCATGCTT CAGATTGATG 3360 TCTGAGAAGA TGTCCTTCTC TGTCTTCCAA GAGGCATACT CCTCATAGGG AAAGATCTTG 3420 ACTGCCACTG TCTCAAACTG CTCTGAAGTG TTCTGCTTCA GCTTGGCCTT ATAGACCTCA 3480 GCAAAGCGAC CTTTCCCCAC CAGGGTGTCC AGCTCAATGG GCAGCAGCTC TGTGTTGTGG 3540 TTGATGTTGT TGGCACACGT GGAGCTGATG TCAGAGCGGT CATCTTCCAG GATGATGGCA 3600 CAGTGCTCGC TGAACTCCAT GAGCTTCCGC GTCTTGCCGG TTTCCCAGGT TGAACTCAGC 3660 TTCTGCTGCC GGTTAACGCG GTAGCAGTAG AAGATGATGA TGACAGATAT GGCAACTCCC 3720 AGTGGTGGCA GGAGGCTGAT GCCTGTCACT TGAAATATGA CTAGCAACAA GTCAGGATTG 3780 CTGGTGTTAT ATTCTTCTGA GAAGATGATG TTGTCATTGC ACTCATCAGA GCTACAGGAA 3840 CACATGAAGA AAGTCTCACC AGGCTTTTTT TTTTCCTTCA TAATGCACTT TGGAGAAGCA 3900 GCATCTTCCA GAATAAAGTC ATGGTAGGGG AGCTTGGGGT CATGGCAAAC TGTCTCTAGT 3960 GTTATGTTCT CGTCATTCTT TCTCCATACA GCCACACAGA CTTCCTGTGG CTTCTCACAG 4020 ATGGAGGTGA TGCTGCAGTT GCTCATGCAG GATTTCTGGT TGTCACAGGT GGAAAATCTC 4080 ACATCACAAA ATTTACACAG TTGTGGAAAC TTGACTGCAC CGTTGTTGTC AGTGACTATC 4140 ATGTCGTTAT TAACCGACTT CTGAACGTGC GGTGGGATCG TGCTGGCGAT ACGCGTCCAC 4200 AGGACGATGT GCAGCGGCCA CAGGCCCCTG AGCAGCCCCC GACCCATGGC AGACCCCGCT 4260 GCTCGTCATA GACCGAGCCC CCAGCGCAGC GGACGGCGCC TTCCCGGACC CCTGGCTGCG 4320 CCTCCGCGCC GCGCCCTCTC CGGACCCCGC GCCGGGCCGG CAGCGCAGAT GTGCGGGCCA 4380 GATGTGGCGC CCGCTCGCCA GCCAGGAGGG GGCCTGGAGG CCGGCGAGGC GCGGGGAGGC 4440 CCCCGGCGGC CGAGGGAAGC TGCACAGGAG TCCGGCTCCT GTCCCGAGCG GGTGCACGCG 4500 CGGGGGTGTC GTCGCTCCGT GCGCGCGAGT GACTCACTCA ACTTCAACTC AGCGCTGCGG 4560 GGGAAACAGG AAACTCCTCG CCAACAGCTG GGCAGGACCT CTCTCCGCCC GAGAGCCTTC 4620 TCCCTCTCC 4629 Seq. ID No. 2: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, mRNA (sense; written in DNA code) GGAGAGGGAG AAGGCTCTCG GGCGGAGAGA GGTCCTGCCC AGCTGTTGGC GAGGAGTTTC 60 CTGTTTCCCC CGCAGCGCTG AGTTGAAGTT GAGTGAGTCA CTCGCGCGCA CGGAGCGACG 120 ACACCCCCGC GCGTGCACCC GCTCGGGACA GGAGCCGGAC TCCTGTGCAG CTTCCCTCGG 180 CCGCCGGGGG CCTCCCCGCG CCTCGCCGGC CTCCAGGCCC CCTCCTGGCT GGCGAGCGGG 240 CGCCACATCT GGCCCGCACA TCTGCGCTGC CGGCCCGGCG CGGGGTCCGG AGAGGGCGCG 300 GCGCGGAGGC GCAGCCAGGG GTCCGGGAAG GCGCCGTCCG CTGCGCTGGG GGCTCGGTCT 360 ATGACGAGCA GCGGGGTCTG CCATGGGTCG GGGGCTGCTC AGGGGCCTGT GGCCGCTGCA 420 CATCGTCCTG TGGACGCGTA TCGCCAGCAC GATCCCACCG CACGTTCAGA AGTCGGTTAA 480 TAACGACATG ATAGTCACTG ACAACAACGG TGCAGTCAAG TTTCCACAAC TGTGTAAATT 540 TTGTGATGTG AGATTTTCCA CCTGTGACAA CCAGAAATCC TGCATGAGCA ACTGCAGCAT 600 CACCTCCATC TGTGAGAAGC CACAGGAAGT CTGTGTGGCT GTATGGAGAA AGAATGACGA 660 GAACATAACA CTAGAGACAG TTTGCCATGA CCCCAAGCTC CCCTACCATG ACTTTATTCT 720 GGAAGATGCT GCTTCTCCAA AGTGCATTAT GAAGGAAAAA AAAAAGCCTG GTGAGACTTT 780 CTTCATGTGT TCCTGTAGCT CTGATGAGTG CAATGACAAC ATCATCTTCT CAGAAGAATA 840 TAACACCAGC AATCCTGACT TGTTGCTAGT CATATTTCAA GTGACAGGCA TCAGCCTCCT 900 GCCACCACTG GGAGTTGCCA TATCTGTCAT CATCATCTTC TACTGCTACC GCGTTAACCG 960 GCAGCAGAAG CTGAGTTCAA CCTGGGAAAC CGGCAAGACG CGGAAGCTCA TGGAGTTCAG 1020 CGAGCACTGT GCCATCATCC TGGAAGATGA CCGCTCTGAC ATCAGCTCCA CGTGTGCCAA 1080 CAACATCAAC CACAACACAG AGCTGCTGCC CATTGAGCTG GACACCCTGG TGGGGAAAGG 1140 TCGCTTTGCT GAGGTCTATA AGGCCAAGCT GAAGCAGAAC ACTTCAGAGC AGTTTGAGAC 1200 AGTGGCAGTC AAGATCTTTC CCTATGAGGA GTATGCCTCT TGGAAGACAG AGAAGGACAT 1260 CTTCTCAGAC ATCAATCTGA AGCATGAGAA CATACTCCAG TTCCTGACGG CTGAGGAGCG 1320 GAAGACGGAG TTGGGGAAAC AATACTGGCT GATCACCGCC TTCCACGCCA AGGGCAACCT 1380 ACAGGAGTAC CTGACGCGGC ATGTCATCAG CTGGGAGGAC CTGCGCAAGC TGGGCAGCTC 1440 CCTCGCCCGG GGGATTGCTC ACCTCCACAG TGATCACACT CCATGTGGGA GGCCCAAGAT 1500 GCCCATCGTG CACAGGGACC TCAAGAGCTC CAATATCCTC GTGAAGAACG ACCTAACCTG 1560 CTGCCTGTGT GACTTTGGGC TTTCCCTGCG TCTGGACCCT ACTCTGTCTG TGGATGACCT 1620 GGCTAACAGT GGGCAGGTGG GAACTGCAAG ATACATGGCT CCAGAAGTCC TAGAATCCAG 1680 GATGAATTTG GAGAATGTTG AGTCCTTCAA GCAGACCGAT GTCTACTCCA TGGCTCTGGT 1740 GCTCTGGGAA ATGACATCTC GCTGTAATGC AGTGGGAGAA GTAAAAGATT ATGAGCCTCC 1800 ATTTGGTTCC AAGGTGCGGG AGCACCCCTG TGTCGAAAGC ATGAAGGACA ACGTGTTGAG 1860 AGATCGAGGG CGACCAGAAA TTCCCAGCTT CTGGCTCAAC CACCAGGGCA TCCAGATGGT 1920 GTGTGAGACG TTGACTGAGT GCTGGGACCA CGACCCAGAG GCCCGTCTCA CAGCCCAGTG 1980 TGTGGCAGAA CGCTTCAGTG AGCTGGAGCA TCTGGACAGG CTCTCGGGGA GGAGCTGCTC 2040 GGAGGAGAAG ATTCCTGAAG ACGGCTCCCT AAACACTACC AAATAGCTCT TCTGGGGCAG 2100 GCTGGGCCAT GTCCAAAGAG GCTGCCCCTC TCACCAAAGA ACAGAGGCAG CAGGAAGCTG 2160 CCCCTGAACT GATGCTTCCT GGAAAACCAA GGGGGTCACT CCCCTCCCTG TAAGCTGTGG 2220 GGATAAGCAG AAACAACAGC AGCAGGGAGT GGGTGACATA GAGCATTCTA TGCCTTTGAC 2280 ATTGTCATAG GATAAGCTGT GTTAGCACTT CCTCAGGAAA TGAGATTGAT TTTTACAATA 2340 GCCAATAACA TTTGCACTTT ATTAATGCCT GTATATAAAT ATGAATAGCT ATGTTTTATA 2400 TATATATATA TATATCTATA TATGTCTATA GCTCTATATA TATAGCCATA CCTTGAAAAG 2460 AGACAAGGAA AAACATCAAA TATTCCCAGG AAATTGGTTT TATTGGAGAA CTCCAGAACC 2520 AAGCAGAGAA GGAAGGGACC CATGACAGCA TTAGCATTTG ACAATCACAC ATGCAGTGGT 2580 TCTCTGACTG TAAAACAGTG AACTTTGCAT GAGGAAAGAG GCTCCATGTC TCACAGCCAG 2640 CTATGACCAC ATTGCACTTG CTTTTGCAAA ATAATCATTC CCTGCCTAGC ACTTCTCTTC 2700 TGGCCATGGA ACTAAGTACA GTGGCACTGT TTGAGGACCA GTGTTCCCGG GGTTCCTGTG 2760 TGCCCTTATT TCTCCTGGAC TTTTCATTTA AGCTCCAAGC CCCAAATCTG GGGGGCTAGT 2820 TTAGAAACTC TCCCTCAACC TAGTTTAGAA ACTCTACCCC ATCTTTAATA CCTTGAATGT 2880 TTTGAACCCC ACTTTTTACC TTCATGGGTT GCAGAAAAAT CAGAACAGAT GTCCCCATCC 2940 ATGCGATTGC CCCACCATCT ACTAATGAAA AATTGTTCTT TTTTTCATCT TTCCCCTGCA 3000 CTTATGTTAC TATTCTCTGC TCCCAGCCTT CATCCTTTTC TAAAAAGGAG CAAATTCTCA 3060 CTCTAGGCTT TATCGTGTTT ACTTTTTCAT TACACTTGAC TTGATTTTCT AGTTTTCTAT 3120 ACAAACACCA ATGGGTTCCA TCTTTCTGGG CTCCTGATTG CTCAAGCACA GTTTGGCCTG 3180 ATGAAGAGGA TTTCAACTAC ACAATACTAT CATTGTCAGG ACTATGACCT CAGGCACTCT 3240 AAACATATGT TTTGTTTGGT CAGCACAGCG TTTCAAAAAG TGAAGCCACT TTATAAATAT 3300 TTGGAGATTT TGCAGGAAAA TCTGGATCCC CAGGTAAGGA TAGCAGATGG TTTTCAGTTA 3360 TCTCCAGTCC ACGTTCACAA AATGTGAAGG TGTGGAGACA CTTACAAAGC TGCCTCACTT 3420 CTCACTGTAA ACATTAGCTC TTTCCACTGC CTACCTGGAC CCCAGTCTAG GAATTAAATC 3480 TGCACCTAAC CAAGGTCCCT TGTAAGAAAT GTCCATTCAA GCAGTCATTC TCTGGGTATA 3540 TAATATGATT TTGACTACCT TATCTGGTGT TAAGATTTGA AGTTGGCCTT TTATTGGACT 3600 AAAGGGGAAC TCCTTTAAGG GTCTCAGTTA GCCCAAGTTT CTTTTGCTTA TATGTTAATA 3660 GTTTTACCCT CTGCATTGGA GAGAGGAGTG CTTTACTCCA AGAAGCTTTC CTCATGGTTA 3720 CCGTTCTCTC CATCATGCCA GCCTTCTCAA CCTTTGCAGA AATTACTAGA GAGGATTTGA 3780 ATGTGGGACA CAAAGGTCCC ATTTGCAGTT AGAAAATTTG TGTCCACAAG GACAAGAACA 3840 AAGTATGAGC TTTAAAACTC CATAGGAAAC TTGTTAATCA ACAAAGAAGT GTTAATGCTG 3900 CAAGTAATCT CTTTTTTAAA ACTTTTTGAA GCTACTTATT TTCAGCCAAA TAGGAATATT 3960 AGAGAGGGAC TGGTAGTGAG AATATCAGCT CTGTTTGGAT GGTGGAAGGT CTCATTTTAT 4020 TGAGATTTTT AAGATACATG CAAAGGTTTG GAAATAGAAC CTCTAGGCAC CCTCCTCAGT 4080 GTGGGTGGGC TGAGAGTTAA AGACAGTGTG GCTGCAGTAG CATAGAGGCG CCTAGAAATT 4140 CCACTTGCAC CGTAGGGCAT GCTGATACCA TCCCAATAGC TGTTGCCCAT TGACCTCTAG 4200 TGGTGAGTTT CTAGAATACT GGTCCATTCA TGAGATATTC AAGATTCAAG AGTATTCTCA 4260 CTTCTGGGTT ATCAGCATAA ACTGGAATGT AGTGTCAGAG GATACTGTGG CTTGTTTTGT 4320 TTATGTTTTT TTTTCTTATT CAAGAAAAAA GACCAAGGAA TAACATTCTG TAGTTCCTAA 4380 AAATACTGAC TTTTTTCACT ACTATACATA AAGGGAAAGT TTTATTCTTT TATGGAACAC 4440 TTCAGCTGTA CTCATGTATT AAAATAGGAA TGTGAATGCT ATATACTCTT TTTATATCAA 4500 AAGTCTCAAG CACTTATTTT TATTCTATGC ATTGTTTGTC TTTTACATAA ATAAAATGTT 4560 TATTAGATTG AATAAAGCAA AATACTCAGG TGAGCATCCT GCCTCCTGTT CCCATTCCTA 4620 GTAGCTAAA 4629 Seq. ID No. 3: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, mRNA (sense; written in RNA code) GGAGAGGGAG AAGGCUCUCG GGCGGAGAGA GGUCCUGCCC AGCUGUUGGC GAGGAGUUUC 60 CUGUUUCCCC CGCAGCGCUG AGUUGAAGUU GAGUGAGUCA CUCGCGCGCA CGGAGCGACG 120 ACACCCCCGC GCGUGCACCC GCUCGGGACA GGAGCCGGAC UCCUGUGCAG CUUCCCUCGG 180 CCGCCGGGGG CCUCCCCGCG CCUCGCCGGC CUCCAGGCCC CCUCCUGGCU GGCGAGCGGG 240 CGCCACAUCU GGCCCGCACA UCUGCGCUGC CGGCCCGGCG CGGGGUCCGG AGAGGGCGCG 300 GCGCGGAGGC GCAGCCAGGG GUCCGGGAAG GCGCCGUCCG CUGCGCUGGG GGCUCGGUCU 360 AUGACGAGCA GCGGGGUCUG CCAUGGGUCG GGGGCUGCUC AGGGGCCUGU GGCCGCUGCA 420 CAUCGUCCUG UGGACGCGUA UCGCCAGCAC GAUCCCACCG CACGUUCAGA AGUCGGUUAA 480 UAACGACAUG AUAGUCACUG ACAACAACGG UGCAGUCAAG UUUCCACAAC UGUGUAAAUU 540 UUGUGAUGUG AGAUUUUCCA CCUGUGACAA CCAGAAAUCC UGCAUGAGCA ACUGCAGCAU 600 CACCUCCAUC UGUGAGAAGC CACAGGAAGU CUGUGUGGCU GUAUGGAGAA AGAAUGACGA 660 GAACAUAACA CUAGAGACAG UUUGCCAUGA CCCCAAGCUC CCCUACCAUG ACUUUAUUCU 720 GGAAGAUGCU GCUUCUCCAA AGUGCAUUAU GAAGGAAAAA AAAAAGCCUG GUGAGACUUU 780 CUUCAUGUGU UCCUGUAGCU CUGAUGAGUG CAAUGACAAC AUCAUCUUCU CAGAAGAAUA 840 UAACACCAGC AAUCCUGACU UGUUGCUAGU CAUAUUUCAA GUGACAGGCA UCAGCCUCCU 900 GCCACCACUG GGAGUUGCCA UAUCUGUCAU CAUCAUCUUC UACUGCUACC GCGUUAACCG 960 GCAGCAGAAG CUGAGUUCAA CCUGGGAAAC CGGCAAGACG CGGAAGCUCA UGGAGUUCAG 1020 CGAGCACUGU GCCAUCAUCC UGGAAGAUGA CCGCUCUGAC AUCAGCUCCA CGUGUGCCAA 1080 CAACAUCAAC CACAACACAG AGCUGCUGCC CAUUGAGCUG GACACCCUGG UGGGGAAAGG 1140 UCGCUUUGCU GAGGUCUAUA AGGCCAAGCU GAAGCAGAAC ACUUCAGAGC AGUUUGAGAC 1200 AGUGGCAGUC AAGAUCUUUC CCUAUGAGGA GUAUGCCUCU UGGAAGACAG AGAAGGACAU 1260 CUUCUCAGAC AUCAAUCUGA AGCAUGAGAA CAUACUCCAG UUCCUGACGG CUGAGGAGCG 1320 GAAGACGGAG UUGGGGAAAC AAUACUGGCU GAUCACCGCC UUCCACGCCA AGGGCAACCU 1380 ACAGGAGUAC CUGACGCGGC AUGUCAUCAG CUGGGAGGAC CUGCGCAAGC UGGGCAGCUC 1440 CCUCGCCCGG GGGAUUGCUC ACCUCCACAG UGAUCACACU CCAUGUGGGA GGCCCAAGAU 1500 GCCCAUCGUG CACAGGGACC UCAAGAGCUC CAAUAUCCUC GUGAAGAACG ACCUAACCUG 1560 CUGCCUGUGU GACUUUGGGC UUUCCCUGCG UCUGGACCCU ACUCUGUCUG UGGAUGACCU 1620 GGCUAACAGU GGGCAGGUGG GAACUGCAAG AUACAUGGCU CCAGAAGUCC UAGAAUCCAG 1680 GAUGAAUUUG GAGAAUGUUG AGUCCUUCAA GCAGACCGAU GUCUACUCCA UGGCUCUGGU 1740 GCUCUGGGAA AUGACAUCUC GCUGUAAUGC AGUGGGAGAA GUAAAAGAUU AUGAGCCUCC 1800 AUUUGGUUCC AAGGUGCGGG AGCACCCCUG UGUCGAAAGC AUGAAGGACA ACGUGUUGAG 1860 AGAUCGAGGG CGACCAGAAA UUCCCAGCUU CUGGCUCAAC CACCAGGGCA UCCAGAUGGU 1920 GUGUGAGACG UUGACUGAGU GCUGGGACCA CGACCCAGAG GCCCGUCUCA CAGCCCAGUG 1980 UGUGGCAGAA CGCUUCAGUG AGCUGGAGCA UCUGGACAGG CUCUCGGGGA GGAGCUGCUC 2040 GGAGGAGAAG AUUCCUGAAG ACGGCUCCCU AAACACUACC AAAUAGCUCU UCUGGGGCAG 2100 GCUGGGCCAU GUCCAAAGAG GCUGCCCCUC UCACCAAAGA ACAGAGGCAG CAGGAAGCUG 2160 CCCCUGAACU GAUGCUUCCU GGAAAACCAA GGGGGUCACU CCCCUCCCUG UAAGCUGUGG 2220 GGAUAAGCAG AAACAACAGC AGCAGGGAGU GGGUGACAUA GAGCAUUCUA UGCCUUUGAC 2280 AUUGUCAUAG GAUAAGCUGU GUUAGCACUU CCUCAGGAAA UGAGAUUGAU UUUUACAAUA 2340 GCCAAUAACA UUUGCACUUU AUUAAUGCCU GUAUAUAAAU AUGAAUAGCU AUGUUUUAUA 2400 UAUAUAUAUA UAUAUCUAUA UAUGUCUAUA GCUCUAUAUA UAUAGCCAUA CCUUGAAAAG 2460 AGACAAGGAA AAACAUCAAA UAUUCCCAGG AAAUUGGUUU UAUUGGAGAA CUCCAGAACC 2520 AAGCAGAGAA GGAAGGGACC CAUGACAGCA UUAGCAUUUG ACAAUCACAC AUGCAGUGGU 2580 UCUCUGACUG UAAAACAGUG AACUUUGCAU GAGGAAAGAG GCUCCAUGUC UCACAGCCAG 2640 CUAUGACCAC AUUGCACUUG CUUUUGCAAA AUAAUCAUUC CCUGCCUAGC ACUUCUCUUC 2700 UGGCCAUGGA ACUAAGUACA GUGGCACUGU UUGAGGACCA GUGUUCCCGG GGUUCCUGUG 2760 UGCCCUUAUU UCUCCUGGAC UUUUCAUUUA AGCUCCAAGC CCCAAAUCUG GGGGGCUAGU 2820 UUAGAAACUC UCCCUCAACC UAGUUUAGAA ACUCUACCCC AUCUUUAAUA CCUUGAAUGU 2880 UUUGAACCCC ACUUUUUACC UUCAUGGGUU GCAGAAAAAU CAGAACAGAU GUCCCCAUCC 2940 AUGCGAUUGC CCCACCAUCU ACUAAUGAAA AAUUGUUCUU UUUUUCAUCU UUCCCCUGCA 3000 CUUAUGUUAC UAUUCUCUGC UCCCAGCCUU CAUCCUUUUC UAAAAAGGAG CAAAUUCUCA 3060 CUCUAGGCUU UAUCGUGUUU ACUUUUUCAU UACACUUGAC UUGAUUUUCU AGUUUUCUAU 3120 ACAAACACCA AUGGGUUCCA UCUUUCUGGG CUCCUGAUUG CUCAAGCACA GUUUGGCCUG 3180 AUGAAGAGGA UUUCAACUAC ACAAUACUAU CAUUGUCAGG ACUAUGACCU CAGGCACUCU 3240 AAACAUAUGU UUUGUUUGGU CAGCACAGCG UUUCAAAAAG UGAAGCCACU UUAUAAAUAU 3300 UUGGAGAUUU UGCAGGAAAA UCUGGAUCCC CAGGUAAGGA UAGCAGAUGG UUUUCAGUUA 3360 UCUCCAGUCC ACGUUCACAA AAUGUGAAGG UGUGGAGACA CUUACAAAGC UGCCUCACUU 3420 CUCACUGUAA ACAUUAGCUC UUUCCACUGC CUACCUGGAC CCCAGUCUAG GAAUUAAAUC 3480 UGCACCUAAC CAAGGUCCCU UGUAAGAAAU GUCCAUUCAA GCAGUCAUUC UCUGGGUAUA 3540 UAAUAUGAUU UUGACUACCU UAUCUGGUGU UAAGAUUUGA AGUUGGCCUU UUAUUGGACU 3600 AAAGGGGAAC UCCUUUAAGG GUCUCAGUUA GCCCAAGUUU CUUUUGCUUA UAUGUUAAUA 3660 GUUUUACCCU CUGCAUUGGA GAGAGGAGUG CUUUACUCCA AGAAGCUUUC CUCAUGGUUA 3720 CCGUUCUCUC CAUCAUGCCA GCCUUCUCAA CCUUUGCAGA AAUUACUAGA GAGGAUUUGA 3780 AUGUGGGACA CAAAGGUCCC AUUUGCAGUU AGAAAAUUUG UGUCCACAAG GACAAGAACA 3840 AAGUAUGAGC UUUAAAACUC CAUAGGAAAC UUGUUAAUCA ACAAAGAAGU GUUAAUGCUG 3900 CAAGUAAUCU CUUUUUUAAA ACUUUUUGAA GCUACUUAUU UUCAGCCAAA UAGGAAUAUU 3960 AGAGAGGGAC UGGUAGUGAG AAUAUCAGCU CUGUUUGGAU GGUGGAAGGU CUCAUUUUAU 4020 UGAGAUUUUU AAGAUACAUG CAAAGGUUUG GAAAUAGAAC CUCUAGGCAC CCUCCUCAGU 4080 GUGGGUGGGC UGAGAGUUAA AGACAGUGUG GCUGCAGUAG CAUAGAGGCG CCUAGAAAUU 4140 CCACUUGCAC CGUAGGGCAU GCUGAUACCA UCCCAAUAGC UGUUGCCCAU UGACCUCUAG 4200 UGGUGAGUUU CUAGAAUACU GGUCCAUUCA UGAGAUAUUC AAGAUUCAAG AGUAUUCUCA 4260 CUUCUGGGUU AUCAGCAUAA ACUGGAAUGU AGUGUCAGAG GAUACUGUGG CUUGUUUUGU 4320 UUAUGUUUUU UUUUCUUAUU CAAGAAAAAA GACCAAGGAA UAACAUUCUG UAGUUCCUAA 4380 AAAUACUGAC UUUUUUCACU ACUAUACAUA AAGGGAAAGU UUUAUUCUUU UAUGGAACAC 4440 UUCAGCUGUA CUCAUGUAUU AAAAUAGGAA UGUGAAUGCU AUAUACUCUU UUUAUAUCAA 4500 AAGUCUCAAG CACUUAUUUU UAUUCUAUGC AUUGUUUGUC UUUUACAUAA AUAAAAUGUU 4560 UAUUAGAUUG AAUAAAGCAA AAUACUCAGG UGAGCAUCCU GCCUCCUGUU CCCAUUCCUA 4620 GUAGCUAAA 4629