Resistance in plants of <i>Solanum lycopersicum </i>to the tobamovirus tomato brown rugose fruit virus

Abstract

The invention relates to a Solanum lycopersicum plant resistant to Tomato Brown Rugose Fruit virus comprising in its genome the combination of the Tm-1 resistance gene on chromosome 2, and at least one quantitative trait locus (QTL) chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, that independently confer to the plant foliar and/or fruit tolerance to TBRFV, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758. The combination of at least one of these QTLs with the Tm-1 gene delays, reduces or inhibits the replication or multiplication of the virus in the plants of the invention. The invention is also directed to parts of these plants with TBRFV resistance phenotype, as well as progeny, to the use of these plants for introgressing the resistance in another genetic background, as well as to different methods for obtaining tomato plants or seeds with increased resistance to Tomato Brown Rugose Fruit virus.

Claims

1. A Solanum lycopersicum plant resistant to Tomato Brown Rugose Fruit virus (TBRFV) comprising in its genome the combination of: a) the Tm-1 resistance gene on chromosome 2, and b) at least one quantitative trait locus (QTL) chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, that independently confer to the plant foliar and/or fruit tolerance to TBRFV, wherein said QTLs are present in the genome of a plant, seeds of which designated HAZTBRFVRES1 have been deposited with NCIMB under accession number 42758, wherein said QTLs are to be found, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

2. A S. lycopersicum plant according to claim 1 comprising in its genome the combination of: a) the Tm-1 resistance gene on chromosome 2, b) said QTL3 on chromosome 11 homozygously, and c) said QTL2 on chromosome 9 heterozygously.

3. A S. lycopersicum plant according to claim 1 comprising in its genome the combination of the Tm-1 resistance gene and at least two QTLs chosen from QTL1, QTL2 and QTL3, wherein at least one of said QTLs is heterozygous.

4. A S. lycopersicum plant according to claim 1 comprising homozygously in its genome the combination of: a) the Tm-1 resistance gene on chromosome 2, and b) said QTL3 on chromosome 11.

5. A S. lycopersicum plant according to claim 1, wherein said plant delays, reduces or inhibits the replication or multiplication of the virus or reduces the virus titer in the plant.

6. A S. lycopersicum plant according to claim 1, wherein said TBRFV virus is the Israeli strain of TBRFV.

7. A S. lycopersicum plant according to claim 1, further comprising the Tm-2 resistance gene.

8. The S. lycopersicum plant according to claim 1, characterized by the presence in the genome of said S. lycopersicum plant of at least one of the following alleles: a) allele T of TO-0005197 and/or b) allele C of TO-0145581 for QTL1, c) allele G of TO-0180955 and/or d) allele C of TO-0196724 and/or e) allele G of TO-0145125 and/or f) allele G of TO-0196109 for QTL2, g) allele T of TO-0122252 and/or h) allele C of TO-0144317 and/or i) allele T of TO-0142270 and/or j) allele G of TO-0142294 and/or k) allele A of TO-0142303 and/or, l) allele A of TO-0142306 and/or m) allele G of TO-0182276 and/or n) allele G of TO-0181040 and/or o) allele G of TO-0123057 and/or p) allele A of TO-0125528 and/or q) allele C of TO-0162432 and/or r) allele T of TO-0162427 for QTL3, in combination with allele A of SNP marker TO-0200838 (SEQ ID No: 21).

9. The plant according to claim 1, wherein said plant is a progeny of an hybrid between a plant grown from the seeds of HAZTBRFVRES1 (NCIMB accession number 42758) and a S. lycopersicum plant bearing the Tm-1 gene.

10. A cell of a S. lycopersicum plant according to claim 1, comprising in its genome the combination of the Tm-1 gene and at least one QTL chosen from said QTL1 on chromosome 6, said QTL2 on chromosome 9 and said QTL3 on chromosome 11, wherein said combination confers the resistance to TBRF virus.

11. A plant part of a S. lycopersicum plant according to claim 1, in particular seeds, explants, reproductive material, scion, cutting, seed, fruit, root, rootstock, pollen, ovule, embryo, protoplast, leaf, anther, stem, petiole or flowers, wherein said plant part comprises cells according to claim 10.

12. A seed of a S. lycopersicum plant, which develops into a plant resistant to TBRFV according to claim 1.

13. A tissue culture of cells of the plant according to claim 1, wherein the cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons, and/or hypocotyls, and contain in their genome said QTL1 on chromosome 6, and/or said QTL2 on chromosome 9 and/or said QTL3 on chromosome 11 independently conferring fruit or foliar tolerance to TBRF virus, in combination with the Tm-1 gene.

14. A method for detecting S. lycopersicum plants according to claim 1, inhibiting, reducing or delaying the replication of the virus, comprising the steps of: a) detecting at least one of the following markers: allele T of TO-0122252, allele C of TO-0144317, allele T of TO-0142270, allele G of TO-0142294, allele A of TO-0142303, allele A of TO-0142306, allele G of TO-0182276, allele G of TO-0181040, allele G of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and allele T of TO-0162427, and b) detecting the homozygous presence of the Tm-1 gene.

15. A method for selecting S. lycopersicum plants according to claim 1, inhibiting, reducing or delaying the replication of the virus, said method comprising the steps of: a) assaying tomato plants for the combination in its genome of i) the Tm-1 resistance gene on chromosome 2, and ii) at least one genetic marker genetically linked to a QTL chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, independently conferring to the plant foliar and/or fruit tolerance to TBRFV, and b) selecting a plant comprising the Tm-1 gene and the genetic marker and the chosen QTL conferring foliar and/or fruit tolerance to TBRFV, wherein the chosen QTL and the genetic marker are to be found, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

16. A method for breeding S. lycopersicum plants having resistance to TBRFV, comprising the steps of crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof bearing QTL1 and/or QTL2 and/of QTL3 conferring TBRFV tolerance, with a S. lycopersicum plant bearing the Tm-1 gene, wherein said QTL1, if present, is to be found on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), said QTL2, if present, is to be found on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and said QTL3, if present, is to be found on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

17. A method according to claim 16, comprising the steps of: a) crossing a plant grown from the deposited seeds NCIMB 42758, or progeny thereof, bearing QTL1 and/or QTL2 and/or QTL3 conferring TBRFV tolerance, and a S. lycopersicum plant, preferably devoid of said QTL(s), and bearing the Tm-1 gene, b) selecting a plant in the progeny thus obtained, bearing one, two or three of the QTL1, QTL2 and QTL3 in combination with the Tm-1 gene; c) self-pollinating one or several times the plant obtained at step b) and selecting in the progeny thus obtained a plant having resistance to TBRFV, wherein said resistance delays, reduces or inhibits the replication or multiplication of the virus.

18. A method according to claim 16, comprising the steps of: a1) crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof, bearing QTL1 and/or QTL2 and/or QTL3 conferring TBRFV tolerance, and a S. lycopersicum plant, preferably devoid of said QTL(s), and bearing the Tm-1 gene, thus generating F1 hybrids, a2) selfing the F1 hybrids to create F2 population, b) selecting individuals in the progeny thus obtained having resistance to TBRFV, wherein said resistance delays, reduces or inhibits the replication of the virus.

19. The method of claim 17, wherein SNPs markers are used in steps b) and/or c) for selecting plants bearing QTL1 and/or QTL2 and/or QTL3 conferring TBRFV tolerance and/or for selecting plants bearing the Tm-1 gene.

20. A S. lycopersicum plant obtained by the method according to claim 16, wherein said QTL1, if present, is to be found on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), said QTL2, if present, is to be found on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and said QTL3, if present, is to be found on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

Description

LEGEND OF FIGURES

(1) FIG. 1: Results of the first ELISA tests conducted at 45 DPI (“Microlab” 1.sup.st scoring at 45 DPI) illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

(2) This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

(3) FIG. 2: Results of the ELISA tests conducted at 75 DPI (“Microlab” 2.sup.nd scoring at 75 DPI) illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

(4) This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

(5) FIG. 3: Results of the ELISA tests conducted at around 110 DPI illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

(6) This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

(7) FIG. 4: Results of the ELISA tests conducted at 70 DPI on different QTLs combinations, illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

(8) FIG. 5: Results of the ELISA tests conducted at 91 DPI on different QTLs combinations, illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

EXAMPLES

Example A: Identification of Resistance

(9) The inventors have screened their tomato breeding genetic material in a naturally infected greenhouse in the Southern part of Israel, in the Bsor region, which is the major tomato crop production area in Israel. About 443 different tomatoes were screened. Each tomato was planted in two repeats, 10 plant per repeat in different locations in the greenhouse.

(10) Each row in the greenhouse contained 120 plants. At each row, a susceptible line control of 10 plants was planted. In order to spread the controls in the different places in the greenhouse, the controls were positioned in diagonal along the different rows in the greenhouse.

(11) In this screening, a few tomatoes showed no foliar TBRFV symptoms and very little fruit symptoms. Out of these, two symptomless tomatoes and two susceptible tomatoes were chosen for the next stage.

(12) The results of these experiments are shown in table. A. The 2 susceptible tomatoes that have been chosen are representative of the 441 susceptible tomatoes in the sense that they are considered susceptible to the Tomato Brown Rugose fruit virus.

(13) Hazera no. 1 (or HAZ1) is an indeterminate tomato of the loose type with regular, round and dark red fruits of about 170 gr. The plant has a dark green foliage and is resistant to Verticillium dahlia, Meloidogyne incognita, Tomato yellow leaf curl virus and Stemphylium solani.

(14) Hazera no. 2 (or HAZ2) is an indeterminate tomato of the beef type with regular and intermediate flat, dark intense red fruits of about 280 gr. The plant is resistant to Verticillium dahlia, Fusarium oxysporum f.sp. lycopersici 1,2, Tomato mosaic virus, Fulvia fulva, Meloidogyne incognita, Tomato spotted wilt virus.

(15) Hazera no. 3 (or HAZ3) is an indeterminate tomato of the beef type with intermediate flat red fruits of about 270 gr. The plant is resistant to Tomato spotted wilt virus, Verticillium dahlia Fusarium oxysporum f.sp. lycopersici 1,2 and Stemphylium solani.

(16) Hazera no. 4 (or HAZ4) is an indeterminate tomato of the minibeef type with round red fruits of about 180 gr. The plant is resistant to Tobacco mosaic virus, Tomato yellow leaf curl virus, Cladosporium fulvum (C F9) Verticillium dahlia and Fusarium oxysporum f.sp. lycopersici 1,2.

(17) TABLE-US-00002 TABLE A plants tested for resistance to TBRFV: Nb of plants Nb of plants without with Total TBRFV significant number foliar and TBRFV of fruit foliar and fruit Tomato plants symptoms symptoms Conclusion Hazera no. 1 20 20 0 Tolerant/Resistant Hazera no. 2 20 0 20 Susceptible Hazera no. 3 20 20 0 Tolerant/Resistant Hazera no. 4 20 0 20 Susceptible

Example B: Confirmation of Resistance

(18) In order to better understand the genetics underlying the tolerance/resistance phenotype as well as to validate the leads identified during the first screening, the present inventors have made a second screening under similar conditions as the ones of the first screening: each row in the greenhouses under natural infection contained 120 plants and at each row, a susceptible control (10 plants) was planted. In order to spread the controls in the different places in the greenhouse, the controls were positioned in diagonal along the different rows in the greenhouse.

(19) In addition to the resistant tomatoes identified during the first screening, their F1 obtained from the cross of a resistant plant with a susceptible line were also included in the trial, as well as their F2s:

(20) Table B shows the result of the second screening regarding the foliar evaluation: plants were considered as susceptible as soon as they had some mosaic and distortions in the apex of the shoots. Tolerant/Resistant plants have no symptoms in the apex of the shoots.

(21) TABLE-US-00003 TABLE B Foliar evaluation of second screening Number of Number of plants Total plants without with significant number TBRFV foliar TBRFV foliar Tomato of plants symptoms symptoms Conclusion Hazera no. 1 20 20 0 Tolerant/ Resistant Hazera no. 2 20 0 20 Susceptible F1 Hazera no. 20 0 20 Susceptible 1 × Hazera no. 2 F2 Hazera no. 247 60 187 Segregating 1 × Hazera no. 2 Hazera no. 3 20 20 0 Tolerant/ Resistant Hazera no. 4 20 0 20 Susceptible F1 Hazera no. 20 0 20 Susceptible 3 × Hazera no. 4 F2 Hazera no. 248 63 185 Segregating 3 × Hazera no. 4

(22) The phenotyping data of the F1 and F2 plants tend to demonstrate that the foliar tolerance and or resistance to the Tomato Brown Rugose fruit virus is controlled in a recessive manner by one single gene or QTL.

(23) Table C shows the result of the second screening regarding the fruit evaluation: plants are scored on a 1 to 4 scale whereby plants with 1 to 3 scores will be considered as susceptible, having for the plants graded 1 severe symptom of typical fruit lesions and some fruit deformation, for the plants graded 2 moderate lesions in some of the fruits only and 3 light symptoms. Only plants having 3.5 and 4, i.e. without symptoms on the fruits would be considered as resistant.

(24) TABLE-US-00004 TABLE C Fruit evaluation of second screening Total Number of plants number With a fruit rating of symptoms Line of plants 1 1.5 2 2.5 3 3.5 Conclusion Hazera no. 1 20 0 0 0 0 0 20 Tolerant Hazera no. 2 20 20 0 0 0 0 0 Susceptible F2 238 101 28 21 12 21 55 Segregating Haz1 × Haz2

(25) The phenotyping data of the F2 plants tend to demonstrate that the fruit tolerance and/or resistance to the Tomato Brown Rugose fruit virus is controlled in a recessive manner by a few, one or two QTLs.

Example C: Association Analysis for Gene Mapping

(26) The tomato plants Hazera no. 1 and Hazera no. 2 were used to build an F2 bi-parental mapping population. The tomato plant Hazera no. 1 showing a resistant phenotype (fruit and foliar) to Tomato Brown Rugose Fruit virus was crossed with the susceptible plant in order to create an F1 which was used later to generate an F2 segregating population. Additional bi-parental population used for validation (foliar QTL) based on Hazera no. 3 and Hazera no. 4 was developed in the same manner (see example E).

(27) DNA Extraction: DNA was extracted from leaves ground using NucleoMag® Plant kit (Macherey-Nagel) according to the manufacturer's procedures. DNA purification was based on Magnetic-bead technology for the isolation of genomic DNA from plant tissue. DNA concentrations were quantified with a NanoDrop spectrophotometer.

(28) The genotyping of the F2 population (based on Hazera no. 1 and Hazera no. 2) was done using a custom made Affymetrix Axium chip array containing approximatively 9500 SNPs for tomatoes (multiplex genotyping technology).

(29) Tomatoes SNP markers were selected and discovered from different sources including public domain, LVS projects and collaborations. All SNPs were validated in pre-screen (previous experience on other technologies) and were selected according the following: Polymorphic/Allele frequency Representing world wide variation SNP clusters removal SNPs placed evenly according to physical map distance Lower representation in heterochromatin (pericentromeric) regions—high LD

(30) Genotyping with the Affymetrix Axiom chip array was made using the standard protocol recommended by the manufacturer. The procedure includes the following steps: DNA amplification, fragmentation, precipitation, resuspension and hybridization preparation, hybridization to chip, wash, ligation, stain and scan. Two last steps are performed by Affymetrix's GeneTitan instrument. The analysis is performed by an automatic algorithm of clustering developed by Affymetrix.

(31) A mixed linear model association was used independently for both fruit and foliar symptoms.

(32) The mapping results revealed one candidate QTL associated with the foliar tolerance and/or resistance to Tomato Brown rugose Fruit virus located on chromosome 11 and two candidate QTLs associated with fruit tolerance and/or resistance to Tomato Brown rugose Fruit virus located on chromosomes 6 and chromosome 9.

(33) Markers significantly linked with the various QTLs for foliar and/or fruit tolerance/resistance to Tomato Brown rugose Fruit virus and their position on the tomato genome are summarized in Table D. The sequence of the SNPs, including the flanking sequences are reported in table 4 and accompanying sequence listing part of the application.

(34) Results showed that one QTL (QTL1 of the present invention) responsible for the fruit tolerance and or resistance to Tomato Brown rugose Fruit virus was located on chromosome 6, between position 33 932 438 and position 33 933 905, and that the second QTL (QTL2 of the present invention) responsible for the fruit tolerance and/or resistance to Tomato Brown rugose Fruit virus was located on chromosome 9, between position 4 800 680 and position 59 014 540, such physical positions on the genome being based on the version 2.40 of the tomato genome (Bombarely 2011). The region of chromosome 9 is a region of low recombination rate.

(35) The region of chromosome 6 is a region prone to introgression and several genes of interest have already been mapped in this region, inter alia introgression of genes involved in salt tolerance from S. lycopersicoides, S. pennellii and S. pimpinellifolium (Li et al, Euphytica (2011) 178: 403), introgression of genes involved in powdery mildew resistance from S. habrochaites and S. neorickii (Seifi et al, Eur J Plant Pathol (2014) 138: 641) and introgression of genes involved in Pepino Mosaic Virus (WO2013/064641).

(36) Results showed that the QTL responsible for the foliar tolerance and/or resistance to Tomato Brown rugose Fruit virus was located on chromosome 11, between position 9 548 029 and position 10 015 478, such physical position on the genome being based on the version 2.40 of the tomato genome (Bombarely 2011).

(37) A further analysis was conducted with additional markers in order to better characterize the QTL on chromosome 11 responsible for the foliage resistance. The results are presented in table E and the sequences of the SNPs are reported in table 4.

(38) These additional results allow to define, on the basis of the p-value and R.sup.2 values, and on the variation of these values along chromosome 11, that the QTL responsible for the foliar tolerance to Tomato Brown rugose Fruit virus was broadly located on chromosome 11, between the SNPs TO-0122252 and TO-0162427, i.e. between position 8 090 264 and position 10 018 811, such physical positions on the genome being based on the version 2.40 of the tomato genome. The SNPs TO-0122252 and TO-0162427 flanking the broader definition of the QTL locus are mentioned by an asterisk (*) in table E. A narrower definition of the location of the QTL on chromosome 11 is the region defined by the SNPs TO-0142270 and TO-0162432. These flanking markers of the narrower definition of the locus are mentioned by (**) in table E. The SNPs having the more significant association with the QTL conferring foliar resistance/tolerance are mentioned by “+” in table E, namely TO-0181040, TO-0123057 and TO 60/125,528.

(39) TABLE-US-00005 TABLE D list of SNPs, their position and the alleles found in susceptible plants (1.sup.st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele). Position S/T SNP R2 Pvalue Chromosome SL2.40 allele TO-0005197 0.33402601 5.61E−08  6 33932438 C/T TO-0145581 0.33402601 5.61E−08  6 33933905 T/C TO-0180955 0.33863743 1.68E−11  9 4800680 A/G TO-0196724 0.351965936 4.96E−12  9 5203457 T/C TO-0145125 0.347544015 6.03E−12  9 40025769 A/G TO-0196109 0.33402601 2.09E−11  9 59014540 T/G TO-0182276 11 9548029 A/G TO-0181040 0.848753 2.35E−50 11 9797143 A/G TO-0123057 0.8477487 5.33945E−51 11 9825111 T/G TO-0125528 0.8477487 5.33945E−51 11 9837711 G/A TO-0162432 0.7216998 8.88E−34 11 10015478 T/C

(40) TABLE-US-00006 TABLE E additional flanking markers - association analysis mapping foliage resistance based on F2 population of HAZ1. The alleles found in susceptible plants (S allele) and the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele) are reported. Position on chromosome 11 Flanking SNP R.sup.2 Pvalue SL2.40 markers S/T allele TO-0122252 0.7758002 1.16E-40 8090264 * A/T TO-0144325 0.8101493 9.62E-45 8140310 TO-0144322 0.8001583 1.10E-42 8163278 TO-0144317 0.8051598 2.07E-44 8334467 TO-0101684 0.8051598 2.07E-44 8345699 TO.0197358 0.8051598 2.07E-44 8357644 TO-0144313 0.8051598 2.07E-44 8410749 TO-0144309 0.8249175 1.65E-46 8412924 TO-0144308 0.8051598 2.07E-44 8414574 TO-0144303 0.8051598 2.07E-44 8419932 TO-0121816 0.797688 2.30E-42 8626324 TO-0142268 0.7613548 5.39E-39 8631287 TO-0142270 0.8064465 1.37E-44 8633469 ** C/T TO-0142294 0.8474345 6.066-51 8764030 TO-0142299 0.8474345 6.066-51 8891489 TO-0142301 0.8474345 6.06E-51 8900707 TO-0142302 0.8474345 6.06E-51 8902922 TO-0142303 0.8474345 6.06E-51 8903092 TO-0142305 0.8474345 6.06E-51 8963512 TO.0142306 0.8474345 6.06E-51 9318832 TO-0142307 0.8474345 6.06E-51 9318930 TO-0162436 0.7855676 7.54E-41 9789608 TO-0181040 0.848753 2.35E-50 9797143 + A/G TO-0123057 0.8477487 5.34E-51 9825111 + T/G TO-0125528 0.8477487 5.34E-51 9837711 + G/A TO-0162432 0.7216998 8.88E-34 10015478 ** T/C TO-0162427 0.7459438 2.53E-37 10018811 * C/T

Example D: Further Marker Validation

(41) One most associated marker to foliar tolerance to TBRF virus was defined at the edge of the QTL3 region to be the candidate marker close to the resistance gene. This SNP was designed to SNP monoplex KASPar technology: KASPar assay used for validation was preformed based on KASP method from KBioscience (LGC Group, Teddington, Middlesex, UK).

(42) Primers for the KASP SNP assays were designed using LGC's primer picker software. Due to a SNP, two allele-specific forward primers and one common reverse primer per SNP assay were designed. KASP genotyping assays are based on competitive allele-specific PCR and enable bi-allelic scoring of SNPs at specific loci. To summarize, the SNP-specific KASP assay mix and the universal KASP Master mix were added to DNA samples, a thermal cycling reaction was then performed, followed by an end-point fluorescent read. Biallelic discrimination was achieved through the competitive binding of two allele-specific forward primers, each with a unique tail sequence that corresponded with two universal FRET (fluorescence resonant energy transfer) cassettes, one of which was labelled with FAM™ dye and the other of which was labelled with VIC™ dye (LGC, www.lgcgroup.com).

(43) A volume of 3 μl of DNA was pipetted into black 384 well hard shell PCR plates and dried down at room temperature. When the genotyping was performed, the DNA was suspended by adding a 3 μl PCR mix, according to the manufacturer's protocol (KBioscience). Genotyping PCR results were analyzed using the software KlusterCaller (KBioscience). The marker used in this study is the TO-0182276 (SEQ ID NO:13).

(44) HAZ3×HAZ4 F2 population (table B) was used for this marker validation. The F2 plants were genotyped using this marker and also phenotyped for foliar symptoms as described in example B. The association was 100% based on a data of 251 plants.

(45) The summary data of phenotyping foliar symptoms and candidate marker genotyping is presented in table F:R marker means homozygous to resistance/tolerance allele, S marker means homozygous to susceptible allele, H marker means heterozygous comprising of the two alleles:

(46) TABLE-US-00007 TABLE F Number of plants Number of plants Number with foliar TBRFV with foliar TBRFV of tolerance or resistance susceptibility plants symptoms symptoms R marker 67 67 0 S marker 62 0 62 H marker 122 0 122

Example E: Association Analysis for Gene Mapping

(47) The tomato plants Hazera no. 3 and Hazera no. 4 were used to build an F2 bi-parental mapping population. The tomato plant Hazera no. 3 showing a foliar resistance phenotype to Tomato Brown Rugose Fruit virus was crossed with the susceptible plant Hazera no. 4 in order to create an F1 which was used later to generate an F2 segregating population.

(48) Crosses, phenotyping and associations were performed as described in example C, with HAZ1 and HAZ2.

(49) The QTL for foliar resistance and the most significant associated markers were identified on chromosome 11, as detailed in table G.

(50) As in example C, the broader definition of the locus comprising the QTL is defined by flanking markers with an asterisk in table G, namely SNPs TO-012252 and TO0162427. These SNPs are the same as those flanking the broader definition of the QTL position as deduced from the results obtained with the other tolerance source, namely HAZ1. This point strongly corroborates the conclusion that the QTL for foliar tolerance is the same for HAZ1 and HAZ3.

(51) HAZ1 corresponds to the seeds HAZTBRFVRES1 deposited at the NICMB under the accession number 42758.

(52) A narrower definition of the locus of the QTL, as deduced from the results on HAZ3 population is defined by the flanking makers TO-0144317 and TO-0125528 on chromosome 11 (markers ** in table G). The markers with the most significant association to TBRFV foliar tolerance/resistance are the markers mentioned with (+), namely TO-0142303, TO-0142306 and TO60142294.

(53) TABLE-US-00008 TABLE G list of additional SNPs, their position and the alleles found in susceptible plants (1.sup.st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele) Position chromosome 11 Flanking S/T SNP R.sup.2 Pvalue SL2.40 markers allele TO-0122252 0.81927235 1.55E-60 8090264 * A/T TO-0144317 0.854230073 6.90E-69 8334467 ** T/C TO-0142303 0.884698061 3.46E-77 8903092 + C/A TO-0142305 0.884698061 3.468-77 8963512 TO-0142306 0.884698061 3.46E-77 9318832 + G/A TO-0142307 0.884698061 3.46E-77 9318930 TO-0142294 0.884698061 3.46E-77 8764030 + A/G TO-0142299 0.884698061 3.468-77 8891489 TO-0142301 0.884698061 3.46E-77 8900707 TO.0142302 0.884698061 3.46E-77 8902922 TO-0144308 0.854199247 7.02E-69 8414574 TO-0144303 0.854199247 7.02E-69 8419932 TO-0142268 0.854144413 7.24E-89 8631287 TO-0142270 0.854144413 7.24E-69 8633469 TO-0121816 0.854144413 7.24E-69 8626324 TO-0144313 0.853890923 2.18E-68 8410749 TO-0181040 0.851931696 2.47E-68 9797143 TO-0123057 0.851931696 2.47E-68 9825111 TO-0125528 0.851931696 2.47E-68 9837711 ** G/A TO-0144309 0.853578274 6.78E-68 8412924 TO-0162436 0.851618235 7.62E-68 9789608 TO-0197358 0.848638959 9.808-67 8357644 TO-0101684 0.831991299 7.32E-64 8345699 TO-0144325 0.821665121 9.468-62 8140310 TO-0144322 0.822371998 1.62E-61 8163278 TO-0162427 0.789778057 6.28E-56 10018811 * C/T

(54) Taken together, these results confirm the presence of a QTL conferring foliar tolerance, broadly located within the chromosomal region delimited by TO-012252 and TO0162427 and more precisely by TO-0144317 and TO-0125528.

(55) In view of the results of example C, these results thus demonstrate that the location of this QTL can advantageously been defined as between TO-0142270 and TO-0125528.

Example 1: Material and Methods

(56) Lines Description:

(57) Line Haz-Tm1:

(58) This line is a commercial indeterminate tomato of loose type with regular round and red fruits of about 120 g. The plant has light green foliage and is resistant to TMV race 0.

(59) Test resistance: Line Haz-Tm1 was tested in 2 repeats of 10 plants each (total of 20 plants) for TBRFV resistance. The susceptible controls used were as follow (table 2):

(60) TABLE-US-00009 TABLE 2 Susceptible control name Rep. No. of plants Foliar symptoms Fruit symptoms HA-29628 1 10 Severe Light HA-29628 2 10 Severe Light HA-29406 1 10 Severe Severe HA-29406 2 10 Severe Severe “Rep” is the number of the repeat “No. of plants” is the number of plants in the repeat.
Line NB2: Used to Make the Population

(61) This line is an indeterminate tomato of loose type with globe and intense red fruits of about 160 gr. The plant has dark green foliage and is resistant to Stemphylium, Verticillium, Nematode, Fol race 1 race 2, TMV race 2.

(62) Symptoms:

(63) The symptoms of TBRFV infection are as follows:

(64) Mild foliar symptoms: usually mosaic which is not severe, without significant distortion of the leaflets shape.

(65) Severe foliar symptoms: leaflets are distorted, in many cases there is also “shoestrings” symptoms, almost always mosaic is severe.

(66) Mild fruit symptoms: some yellow lesions (sometimes looks like “blotchy” symptoms), but no misshapen, distorted fruits.

(67) Severe fruit symptoms: typical misshapen fruits, sometimes also “chocolate spots”.

(68) TBRFV symptoms Scoring: 4 scoring values, as described in WO2018/219941, with 4 corresponding to the absence of symptoms and 1 corresponding to severe symptoms.

(69) ELISA Protocol:

(70) Each sample containing 1-2 tomato leaves is crushed with homogenizer. 3 ml buffer SEB (Sample Extraction Buffer) were added and the sample is homogenized with bag mixer for 30 seconds.

(71) The ToMV prime ELISA protocol of PrimeDiagnostics was then followed; this diagnostic test was chosen as it allows the detection of ToBRFV infection, although designed for ToMV infection.

(72) Student's t-Test

(73) The t-test is used to determine if the means of two sets of data are significantly different from each other.

(74) In the comparison circles graph (see Figures), the position of the circles corresponds to the means of the various groups. The distance between the circles' centers represents the actual difference.

(75) The outside angle of intersection of the comparison circles is informative about whether the group means are significantly different.

(76) Circles for means that are significantly different either do not intersect, or intersect slightly, so that the outside angle of intersection is less than 90 degrees.

(77) Markers:

(78) The SNP markers suitable for detection of tolerance QTLs are disclosed below.

(79) Table 3: list of SNPs, their position and the alleles found in susceptible plants (1.sup.st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance (2.sup.nd nucleotide mentioned: T allele). Table 4: sequences of the SNPs.

(80) TABLE-US-00010 TABLE 3 SNP Chromosome Position SL2.40 S/T allele TO-0005197 6 33932438 C/T TO-0145581 6 33933905 T/C TO-0180955 9 4800680 A/G TO-0196724 9 5203457 T/C TO-0145125 9 40025769 A/G TO-0196109 9 59014540 T/G TO-0122252 11 8090264 A/T TO-0144317 11 8334467 T/C TO-0142270 11 8633469 C/T TO-0142294 11 8764030 A/G TO-0142303 11 8903092 C/A TO-0142306 11 9318832 G/A TO-0182276 11 9548029 A/G TO-0181040 11 9797143 A/G TO-0123057 11 9825111 T/G TO-0125528 11 9837711 G/A TO-0162432 11 10015478 T/C TO-0162427 11 10018811 C/T

(81) TABLE-US-00011 TABLE 4 Sequences of the SNPs linked to the tolerance QTLs Sequence of the SNPs: the allele associated with the SEQ Tomato Brown rugose Fruit virus tolerance is mentioned ID second in the bracket TO-0005197  1 GTCGGACCAAGAAACCATATTTGGTAACGGGTTCGAGTTGCTGCCTGAAC CTTTTAGCCC[C/T]TTGCAATATTTGTGAAGTGATATTCCTTTGTGTTATTAA TAATTTTTCGTTTTGAGTTTT TO-0145581  2 TTCAGAGAGCAACACTCCTGCAAGACCAACTCGGAGTAATTCAGTAACT CGACCTTCCAT[T/C]TCTAGCTCTCAGTATAGTACTTACTCAAATAAATCA GGCTCTATTCTAAACACAAGCTCT TO-0180955  3 TTCCGAAATGAGGACGATCCATCAGCTTCTTCAGCTGAGAGCCCCTGG TC[A/G]ACATACCAGAATTCTGTTTTTCTAAAACTGTCCAAAATCTCCTGT AAAGA TO-0196724  4 GATTTGAATGCCTTGCCACAGCCAGAGGATGACGA[T/C]GAGATTTTT GGACAACAATTAGAAGATGAACCACA TO-0145125  5 AGAGAATGATATCACTGCCTTAGTTTCTCAATTAAAAGTTGTGCAAAA ACAAAACACACA[A/G]CTAGATGAAGAAAACAGAGCATTCGCCTCAA AGCTTCAGACAAAAGAAGTTGAGAACAAC TO-0196109  6 TACAATACCTTCTGGCATCCCTTTCCGCAAAACGA[T/G]AGATCTTTAG TATCAAAACCGAGAGCACTGTCACC TO-0122252  7 ATGGCAATAGTGAACTGCAGATACAACTGAAATTGCAGAACACCCTTAAA [A/T]ATAGAATCAATAGAAAGTTGCAACAATATTTGAATGATGAAGCAACAAAG TO-0144317  8 AGCCATTGTGATTGTGTCTGTTGTACATTACCAAAATTCTCTAGAGAAAG [T/C]GATACACATGCCAGCCCTATCGATATAAAGCAACGCAAGGTGGATTCTGC TO-0142270  9 AACACCAGGTAGAGAGCACAGCGAAACAATGGCCTCAGGAAGATCTACTT[C/T] GCGAAGTGCAGCAAGCCACTCCATACCTCCACCAGGCTTTGATTTCAGTG TO-0142294 10 TCAACTGCAACTTTAACAGCTGATTCAACTTCTTCTTCTTTCGAAACATC [A/G]CATTGAATGTAACGACCTCCAATAGATTCAGCTAAACTTGTACCTACTTC TO-0142303 11 GAGGAGCTATCAACTTCATAGTCAGATTCAGAAAATGATTCAGATGAGGA [C/A]GTGGCTGATTCTTCTTGTTTTCTTTTCTTCCTTCTGCTCGAACTCTCTCC TO-0142306 12 CAGAAATAATAGAAAATCAGAAAGAAAAATCAGCTTTCTAAATGGAAAAG [G/A]CGATGGCACTATGTTTGAAGTTTTAAGCAACTTTTCTGAAGTCCCAAAAG TO-0182276 13 CTCCTATTGAACATCCTGAAAACTTGTGTCTACATCATGAGAAGATGCA GGCCAATTC[A/G]CTCAGTACATGGAATGCACGAGCATGTTAGGGGA ATTCTAACGCAAAGCATAAGCTTGATACTTGAATAAAAGATGAAACAT ACTTACTTCTTCTCAAACT TO-0181040 14 CTCTTGGTGACAAACCACTGGCTCAATTTCTTCGCGAAGCTAAAG CTATC[A/G]CTGATGAGCTTGTCACGGCAGGCACACGTGTCTCCTGATG AATTCAATGC TO-0123057 15 CATTACTGTTGAGATATCTCATCGGCAACCCCTGGAGCTTGCCCAC CCGC[T/G]TGTCCTCCAGGATCTGATTTCAGAAAGGATGAATAGTAACTGT GTTTCAG TO-0125528 16 CAAGAACCCAACGACTTCTTCTTCTTTGCTTATTGAAAAACTTGGT TTTGAAATGAAAGG[G/A]ATCGAGAAATTGGATACTCAGTGGTTCTCTAC TACTAAACCTTCTCCTGATTTTAAGAAA TO-0162432 17 TGATCGACAATTCTTGTTGTTGTTGAAACTCTGCAAGTGAGAGAGGGATG [T/C]ATATAG AGAAAGGATATTGGTAAAGGACAATTCTAGAAGGGTCTA GGGAA TO-0162427 18 GCACCAGTTATAGTAATGTCCTGCTTCTTTCCTGTACCCTTATCAGTAGC [C/T]GTGACAGAAAGAATACCGTTGGTGTCAATGTCGAACTTCACTTCAATCTG

(82) For Tm-1, a marker was developed based on information of Ishibashi et al, 2007:

(83) Four in-gene SNPs were defined, KASPar assays were developed and only one was found to be suitable.

(84) Marker code: TO-0200838

(85) Sequence of the SNP: the allele associated with the virus resistance is mentioned first (i.e. A) in the bracket:

(86) TABLE-US-00012 (SEQ ID No: 21) CAAAGCTCTT/GGAAACTTTCCTAAGTAT/AAGCTAATG[A/G]TGAACA GAATCTTGCTGGAGTA/GATTGGCCTTGGGGGTAGTGGAGGAACA. KASPar Marker primers: Primer forward Fam: (SEQ ID No: 22) GAAGGTGACCAAGTTCATGCTCAATYACTCCAGCAAGATTCTGTTCAT Primer forward Vic: (SEQ ID No: 23) GAAGGTCGGAGTCAACGGATTACTCCAGCAAGATTCTGTTCAC Primer reverse common: ((SEQ ID No: 24) CAAAGCTCTKGAAACTTTCCTAAGTA

Example 2: Resistance Sources

(87) First Resistance Source

(88) The inventors have first identified a cultivated tomato (Solanum lycopersicum) line—line Haz-Tm1 as having high level of foliar resistance to TBRFV. This line was also known to contain the gene Tm-1.

(89) According to the literature and known to the skilled breeder, the Tm-1 was initially introgressed from a wild tomato species Solanum habrochaites P1126445 into the cultivated tomato species Solanum lycopersicum view a view to imparting ToMV/TMV resistance. Resistance by this gene to ToMV was however broken within a year of its introduction to commercial tomato cultivars in 1960s. Therefore, this gene is rarely, if any, found in the currently commercial varieties and can no longer be considered as a resistance gene to ToMV or TMV.

(90) A marker for Tm-1 gene (on chromosome 2) was developed based on the public gene sequence. Four SNPs were defined, KASPar assays were developed and only one was found to be suitable.

(91) The inventors first found that line Haz-Tm1 was highly resistant to TBRFV, in two trials under artificial laboratory test.

(92) The inventors then later also screened the line Haz-Tm1 for fruit resistance under field conditions in greenhouse trial (natural infection). The trial was transplanted in a 4 dunam (corresponding to 4,000 m.sup.2) greenhouse. The results showed that line Haz-Tm1 exhibited mild symptoms of TBRFV on the fruits, mostly at the latest stages of the plant growth. It was concluded that line Haz-Tm1 probably has high resistance to foliar symptoms and mild and insufficient resistance to fruit symptoms.

(93) Line Haz-Tm1 was then re-tested in tests, including ELISA test, which included: (1) sowing in “54” trays, (2) mechanical inoculation of young seedlings (3) scoring—observation of Tobamoviruses symptoms (4) Checking presence/absence of the virus with an Immunostrip kit (AGDIA) and with an ELISA test in three-point times (5) plantlets planted in the greenhouse to full growing cycle.

(94) Sowing in nursery trays on 9.sup.th October

(95) Mechanical inoculation: on 31.sup.st October

(96) Transplanting part of the trial in Brurim (greenhouses GH 3 and 4): 5.sup.th November

(97) Transplanting part of the trial in Mivtahim greenhouse: 13.sup.th November

(98) 1.sup.st Scoring and sampling for ELISA test: 16.sup.th and 17.sup.th December

(99) 2.sup.nd Scoring and sampling for ELISA test: 14.sup.th January

(100) 3.sup.rd Scoring and sampling for ELISA test: 19.sup.th February.

(101) The results of the 1.sup.st scoring, around 45 days post inoculation (DPI) are detailed in table 5. At this stage, there are no fruits, thus only the foliar resistance is assayed.

(102) TABLE-US-00013 TABLE 5 1.sup.st scoring of foliar symptoms at 45 DPI Total no. Healthy mild symptoms Severe symptoms No. Line name Location of plants (score 4) (score 2 or 3) (score 1) Remarks 1 Haz. Tm-S GH.3 5 5 Typical GH.4 5 5 “shoestrings” Mivtahim 10 10 4 Haz. Tm-1 GH.3 5 5 GH.4 5 5 Mivtahim 10 9 1 5 Haz. Tm-22 GH.3 5 5 Typical severe GH.4 5 5 mosaic Mivtahim 10 10

(103) The results of the ELISA test are illustrated in FIG. 1.

(104) 2.sup.nd Scoring

(105) The phenotypic scoring of the 2.sup.nd scoring gave similar results as obtained in the 1.sup.st scoring. The results of the ELISA test are illustrated in FIG. 2.

(106) 3rd Scoring

(107) The results of the 3.sup.rd scoring, around 110 DPI are detailed in table 6. At this stage, there are fruits, thus foliar and fruit resistance are scored.

(108) TABLE-US-00014 TABLE 6 3.sup.rd scoring of foliar symptoms at 110 DPI Foliar symptoms Fruit symptoms Mild Mild Total symp. Severe symp. Severe no. of No symp. (score 2 symp. No symp. (score 2 symp. No. Line name Location plants (score 4) or 3) (score 1) (score 4) or 3) (score 1) 1 Haz. Tm-S GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10 4 Haz. Tm-1 GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10 5 Haz. Tm-22 GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10

(109) The results of the ELISA test are illustrated in FIG. 3.

(110) The ELISA results suggest that line Haz. Tm-1 has a defense mechanism that delays the virus reproduction in the plant.

(111) Second Resistance Source

(112) WO2018219941 discloses tolerance QTL to TBRFV, essentially a foliar tolerance QTL, QTL3, on chromosome 11 and two fruit tolerance QTLs, QTL1 and 2, on chromosomes 6 and 9 respectively.

Example 3: Combining by Crossing the Two Sources

(113) Population Creation:

(114) A cross between line Haz-Tm1 and line-NB2 was done to produce F1 seeds, the F1 was later self pollinated to produce F2 seeds. F2 seeds were sown in trays and selection for homozygous to tolerance QTL3 (i.e. QTL on chromosome 11) was done using one representative marker such as TO-0142306; these plants were advanced to produce F3 seeds, which are referred in the examples as population 1 (see table 7).

(115) Plant Genotyping and Selection:

(116) F3 seeds (population 1) were sown in trays, around 500 plantlets were obtained. From each F3 plantlet a leaf disc was sampled for DNA extraction and DNA was used for molecular marker analysis.

(117) For selection, two molecular markers were used, one for the TM-1 gene on chromosome 2 and the 10 second representative of the QTL on chromosome 9 (QTL2), QTL for chromosome 11 (tolerance QTL3) was already fixed in the F2 as homozygote resistant (see population creation).

(118) Results:

(119) Crosses were made between line Haz. Tm-1 and one breeding line NB2 that contains the QTLs on chromosome 11 and QTL on chromosome 9. F3 seeds were obtained as disclosed above.

(120) F3 plants were preselected in the tray using molecular markers linked to the tolerance QTLs and Tm-1 gene and the selected plants were mechanically inoculated at young seedlings level, plantlets were planted in the greenhouse in Bsor and grown in greenhouse.

(121) Molecular marker analysis included one marker per QTL.

(122) Tables 7 and 9 present different F3 plants from the population 1 containing different genotypes at the 3 loci (QTL2, QTL3 and Tm-1), the resistance based on phenotypic scoring and ELISA results of each plant. Controls are also indicated. The healthy controls were not infected.

(123) Table 7 presents the results at 70 DPI and table 9 at 91 DPI.

(124) Some of the foliar symptoms reported in the tables might have been increased due to the presence of pepinovirus in the greenhouse as well as severe temperature conditions. It is indeed well known that symptoms of tobamovirus infection are increased when temperature is increased. This means that the medium to severe symptoms observed in this assay, could, in milder conditions, be considered as mild symptoms only. This assay was indeed designed to be discriminative between resistant plants on one side and tolerant or susceptible plants on the other side, and not between resistant/tolerant plants and susceptible plants.

(125) TABLE-US-00015 TABLE 7 ELISA results at 70 DPI, and symptoms scoring of F3 plants. R stands for Resistant homozygote genotype, i.e. marker allele which is linked to resistance (or tolerance for the tolerance QTLs), S stands for “susceptible homozygote genotype”. O.D.1 and O.D.2 correspond to the results of two distinct assays. Chr11 QTL refers to tolerance QTL3; Chr9 QTL refers to tolerance QTL2. Chr11 Tm-1 Chr9 O.D (405 O.D (405 ELISA foliar Code Detail QTL Gene QTL nm) 1 nm) 2 result symptoms Blank ELISA control 0.093 0.095 Positive ELISA control 1.475 2.196 control Negative ELISA control 0.096 0.110 control Cut-off Calculation 0.192 0.219 (2*NegCntr) H-1 Healthy control 0.092 0.105 negative N.A. H-2 Healthy control 0.091 0.095 negative N.A. H-3 Healthy control 0.102 0.115 negative N.A. H-4 Healthy control 0.089 0.101 negative N.A. H-5 Healthy control 0.133 0.166 negative N.A H-6 Healthy control 0.128 0.156 negative N.A. H-7 Healthy control 0.099 0.116 negative N.A. H-8 Healthy control 0.116 0.141 negative N.A. 6305 population 1 R R R 0.172 0.227 Slightly no positive 6328 population 1 R R R 0.112 0.127 negative no 6381 population 1 R R R 0.088 0.100 negative no 6415 population 1 R R R 0.131 0.154 negative no 6429 population 1 R R R 0.093 0.105 negative no 6450 population 1 R R R 0.120 0.149 negative no 6464 population 1 R R R 0.116 0.143 negative no 6470 population 1 R R R 0.112 0.136 negative no 6472 population 1 R R R 0.111 0.134 negative no 6317 population 1 R R S 0.342 0.502 slightly no positive 6338 population 1 R R S 0.311 0.443 slightly no positive 6339 population 1 R R S 0.401 0.576 slightly no positive 6344 population 1 R R S 0.254 0.352 slightly no positive 6368 population 1 R R S 0.514 0.742 slightly no positive 6373 population 1 R R S 0.289 0.393 slightly no positive 6386 population 1 R R S 0.200 0.279 slightly no positive 6414 population 1 R R S 0.175 0.262 slightly no positive 6432 population 1 R R S 0.226 0.327 slightly no positive 6314 population 1 R S S 1.365 2.030 positive mild 6321 population 1 R S S 1.307 1.930 positive mild 6324 population 1 R S S 1.444 2.153 positive mild 6327 population 1 R S S 1.689 2.488 positive mild 6300 population 1 R S R 1.462 2.171 positive Medium- severe 6333 population 1 R S R 1.402 2.126 positive Medium- severe 6378 population 1 R S R 1.405 2.091 positive Medium- severe 6380 population 1 R S R 1.397 2.099 positive Medium- severe 1409--1 population 1 S S R 1.389 2.086 positive severe 1409--2 population 1 S S R 1.434 2.099 positive severe 1409--3 population 1 S S R 1.369 2.084 positive severe 1409--4 population 1 S S R 1.642 2.441 positive severe Blank ELISA control 0.148 0.185 Positive ELISA control 1.504 2.228 control Negative ELISA control 0.127 0.162 control Cut-off Calculation 0.254 0.324 (2*NegCnrl) Haz Tm-S-1 Susceptible 1.328 2.007 positive severe control Haz Tm-S-2 Susceptible 1.421 2.142 positive severe control Haz Tm-S-3 Susceptible 1.457 2.168 positive severe control Haz Tm-S-4 Susceptible 1.394 2.094 positive severe control Haz Tm-S-5 Susceptible 1.375 2.094 positive severe control Haz Tm-S-6 Susceptible 1.386 2.109 positive severe control

(126) TABLE-US-00016 TABLE 8 ELISA means of the reads at 70 DPI for the different QTLs combination and controls: Genotype No of Plants Mean Std Error Lower 95% Upper 95% Haz Tm-S control 6 2.10233 0.04735 2.0064 2.1983 Healthy control 8 0.12438 0.04101 0.0413 0.2075 chr11-R; Tm-1-R; chr9-R 9 0.14167 0.03866 0.0633 0.2200 chr11-R; Tm-1-R; chr9-S 9 0.43067 0.03866 0.3523 0.5090 chr11-R; Tm-1-S; chr9-R 4 2.12175 0.05799 2.0042 2.2393 chr11-R; Tm-1-S; chr9-S 4 2.15025 0.05799 2.0327 2.2678 chr11-S; Tm-1-S; chr9-R 4 2.17750 0.05799 2.0600 2.2950

(127) FIG. 4 illustrates the results of the ELISA test for the different QTLs combinations and controls, at 70 DPI.

(128) It can be deduced that the combination of the Tm-1 gene and at least one of the tolerance QTL gives rise to a large decrease in the detection level of ToBRFV virus coat protein in the plants, and that the combination of the Tm-1 gene with two tolerance QTLs gives a ToBRFV detection level as low as the level found in non-infected healthy plants (Chr1-R, Tm-1-R, Chr9-R).

(129) TABLE-US-00017 TABLE 9 ELISA results at 91 DPI, and symptoms scoring of F3 plants. R stands for Resistant homozygote genotype, i.e. marker allele which is linked to resistance (or tolerance for the tolerance QTLs), S stands for “susceptible homozygote genotype”. O.D.1 and O.D.2 correspond to the results of two distinct assays. Chr11 QTL refers to tolerant QTL3; Chr9 QTL refers to tolerant QTL2. Chr11 Tm-1 Chr9 O.D (405 O.D (405 ELISA foliar Fruit Code Detail QTL Gene QTL nm) 1 nm) 2 result symptoms symptoms Remarks Blank ELISA control 0.097 0.110 Positive control ELISA control 1.717 2.711 Negative control ELISA control 0.117 0.137 Cut-off (2*NegCntr) Calculation 0.232 0.271 H-1 Healthy control 0.128 0.165 negative na na Control for ELISA H-2 Healthy control 0.154 0.209 negative na na Control for ELISA H-3 Healthy control 0.111 0.139 negative na na Control for ELISA H-4 Healthy control 0.107 0.129 negative na na Control for ELISA H-5 Healthy control 0.118 0.146 negative na na Control for ELISA H-6 Healthy control 0.131 0.166 negative na na Control for ELISA H-7 Healthy control 0.119 0.147 negative na na Control for ELISA H-8 Healthy control 0.117 0.146 negative na na Control for ELISA 6305 population 1 R R R 0.385 0.608 Slightly no no No clear symptoms but positive has some blotchy 6328 population 1 R R R 0.327 0.507 Slightly no no No clear symptoms but positive has some blotchy 6381 population 1 R R R 0.229 0.342 Slightly no no No clear symptoms but positive has some blotchy 6415 population 1 R R R 0.193 0.275 Slightly no no No clear symptoms but positive has some blotchy 6429 population 1 R R R 0.264 0.388 Slightly no no No clear symptoms but positive has some blotchy 6450 population 1 R R R 0.156 0.209 Slightly no no No clear symptoms but positive has some blotchy 6464 population 1 R R R 0.214 0.308 Slightly no no No clear symptoms but positive has some blotchy 6470 population 1 R R R 0.216 0.316 Slightly no no No clear symptoms but positive has some blotchy 6472 population 1 R R R 0.407 0.633 Slightly no no No clear symptoms but positive has some blotchy 6317 population 1 R R S 0.543 0.856 Slightly no no No clear symptoms but positive has some blotchy 6338 population 1 R R S 0.260 0.400 Slightly no no No clear symptoms but positive has some blotchy 6339 population 1 R R S 0.263 0.396 Slightly no no No clear symptoms but positive has some blotchy 6344 population 1 R R S 0.206 0.293 Slightly no no No clear symptoms but positive has some blotchy 6368 population 1 R R S 0.346 0.526 Slightly no no No clear symptoms but positive has some blotchy 6373 population 1 R R S 0.251 0.377 Slightly no no No clear symptoms but positive has some blotchy 6386 population 1 R R S 0.195 0.286 Slightly no no No clear symptoms but positive has some blotchy 6414 population 1 R R S 0.280 0.439 Slightly no no No clear symptoms but positive has some blotchy 6432 population 1 R R S 0.296 0.453 Slightly no no No clear symptoms but positive has some blotchy 6314 population 1 R S S 0.801 1.259 positive severe Medium Some distortion on fruit with pointed blossom end 6321 population 1 R S S 0.631 0.982 positive severe Medium Some distortion on fruit with pointed blossom end 6324 population 1 R S S 0.760 1.203 positive severe Medium Some distortion on fruit with pointed blossom end 6327 population 1 R S S 0.978 1.558 positive severe Medium Some distortion on fruit with pointed blossom end 6300 population 1 R S R 0.978 1.593 positive severe Mild No significant distortion, no pointed blossom end 6333 population 1 R S R na na na na na Dead plant 6378 population 1 R S R 0.985 1.594 positive severe Mild No significant distortion, no pointed blossom end 6380 population 1 R S R 1.083 1.751 positive severe Mild No significant distortion, no pointed blossom end 1409--1 population 1 S S R 1.012 1.623 positive severe No 1409--2 population 1 S S R 0.803 1.278 positive severe No 1409--3 population 1 S S R 0.754 1.180 positive severe No 1409--4 population 1 S S R na na na na na Dead plant Blank ELISA control 0.109 0.128 Positive control ELISA control 1.919 2.830 Negative control ELISA control 0.131 0.161 Cut-off (2*NegCnrl) Calculation 0.263 0.321 Haz Tm-S-1 Susceptible control 1.144 1.698 positive severe Mild-Med. Sym Haz Tm-S-2 Susceptible control 1.280 1.890 positive severe Mild-Med. Sym Haz Tm-S-3 Susceptible control 1.148 1.709 positive severe Mild-Med. Sym Haz Tm-S-4 Susceptible control 1.049 1.560 positive severe Mild-Med. Sym Haz Tm-S-5 Susceptible control 0.929 1.399 positive severe Mild-Med. Sym Haz Tm-S-6 Susceptible control 0.953 1.428 positive severe Mild-Med. Sym

(130) TABLE-US-00018 TABLE 10 ELISA means of the reads for the different QTLs combination and controls (91DPI) Genotype No of Plants Mean Std Error Lower 95% Upper 95% Haz Tm-S control 6 1.61400 0.06391 1.4845 1.7435 Healthy control 8 0.15588 0.05535 0.0437 0.2680 chr11-R, Tm-1-R, chr9-R 9 0.39844 0.05218 0.2927 0.5042 chr11-R, Tm-1-R, chr9-S 9 0.44733 0.05218 0.3416 0.5531 chr11-R, Tm-1-S, chr9-R 4 1.64550 0.07827 1.4869 1.8041 chr11-R, Tm-1-S, chr9-S 4 1.25050 0.07827 1.0919 1.4091 chr11-S, Tm-1-S, chr9-R 4 1.40075 0.07827 1.2422 1.5593

(131) FIG. 5 illustrates the results of the ELISA test for the different QTLs combinations and controls, at 91 DPI.

(132) Results presented in table 9 and table 10 confirm the resistance of the plants comprising Tm-1 and at least one tolerance QTL, and demonstrates that this resistance is still present 3 months after infection, thus protecting the plants from foliar and fruit damages.

Example 4: Genetic Modification of Tomato Seeds by Ethyl Methane Sulfonate (EMS)

(133) Seeds of a tomato varieties are to be treated with EMS by submergence of approximately 2000 seeds per variety into an aerated solution of either 0.5% (w/v) or 0.7% EMS for 24 hours at room temperature.

(134) Approximately 1500 treated seeds per variety per EMS dose are germinated and the resulting plants are grown, preferably in a greenhouse, for example, from May to September, to produce seeds.

(135) Following maturation, M2 seeds are harvested and bulked in one pool per variety per treatment. The resulting pools of M2 seeds are used as starting material to identify the individual M2 seeds and the plants with a fruit and/or a foliar tolerance to Tomato Brown Rugose Fruit virus.