Compositions and Methods for increasing Reproduction Performance in Non Human Mammals Using Recombinant Luteinizing Hormone

Abstract

The present invention relates to methods and compositions for increasing reproduction performance in non-human mammals using recombinant luteinizing hormone (rLH) in a low dose. The invention also relates to methods for increasing follicle growth rates at later stages of synchronization programs, improving ovulation results, corpus luteum (CL) development after ovulation, or pregnancies in non-human mammal using rLH in a low dose. The invention is preferably used in ungulates such as bovine, in association to synchronization programs for timed ovulation.

Claims

1. A method of increasing reproductive performance in a non-human mammal, the method comprising administering recombinant luteinizing hormone or a composition comprising recombinant luteinizing hormone to a non-human mammal at a dose range of between about 50 and about 300 micrograms.

2. The method of claim 1, wherein recombinant luteinizing hormone is administered in one single administration.

3. The method of claim 1, wherein said recombinant luteinizing hormone is administered by an injection.

4. The method of claim 1, wherein recombinant luteinizing hormone is administered simultaneously with prostaglandin.

5. The method of claim 1, wherein recombinant luteinizing hormone is administered simultaneously with estradiol compound and prostaglandin.

6. The method of claim 1, wherein, prior to recombinant luteinizing hormone administration, estrogen and progesterone are administered to the non-human mammal.

7. The method of claim 6, wherein estrogen is administered by injection.

8. The method of claim 5, wherein progesterone is administered intravaginally via a device.

9. The method of claim 1, further comprising inseminating said non-human mammal near the time of ovulation.

10. The method of claim 1, comprising: (a) providing a non-human mammal or a group of non-human mammals, which has been treated to synchronize follicles; (b) administering to said non-human mammal or group of non-human mammals recombinant luteinizing hormone at a dose range comprised between about 50 and about 300 micrograms; and (c) optionally inseminating the non-human mammal or group of non-human mammals, or collecting oocytes from the non-human mammal or group of non-human mammals.

11. The method of claim 1, comprising: (a) treating a non-human mammal, or a group of non-human mammals, to synchronize follicles; (b) administering to said non-human mammal or group of non-human mammals recombinant luteinizing hormone at a dose range comprised between about 50 and about 300 micrograms; and (c) optionally inseminating the non-human mammal or group of non-human mammals, or collecting oocytes from the non-human mammal or group of non-human mammals.

12. The method of claim 10, wherein follicle synchronization is obtained by hormonal treatment of the non-human mammal.

13. The method of claim 1, wherein the non-human mammal is an ungulate.

14. The method of claim 1, wherein the reproductive performance is increased by increasing pregnancy in the non-human mammal.

15. The method of claim 1, wherein the reproductive performance is increased by increasing ovulation rate in said non-human mammal.

16. The method of claim 1, wherein the recombinant bovine luteinizing hormone analog (rbLH), comprises a single polypeptide chain in which the alpha and beta subunits from bovine LH are covalently linked via a peptide linker.

17. The method of claim 1, wherein the method further comprises a simultaneous co-administration of estradiol and/or PGF2alpha compound.

18. The method of claim 2, wherein the method further comprises a simultaneous co-administration of estradiol benzoate and/or PGF2alpha compound.

19. The method of claim 3, wherein the injection is an intramuscular or a subcutaneous injection.

20. The method of claim 19, wherein the injection is an intramuscular injection.

Description

LEGEND TO THE FIGURES

[0031] FIG. 1: Synchronization Protocol used to evaluate different doses of rbLH on follicle dynamics (Study 1).

[0032] FIG. 2: Synchronization Protocol used to evaluate lower doses of rbLH on follicle dynamics (Study 2)

[0033] FIG. 3: Proportion of cows having premature ovulations following the use of differing gonadotropins. Premature ovulation was assumed for cows ovulating within 48 h after progesterone device removal. (Study 1)

[0034] FIG. 4: Dominant follicle growth rate (mm) measured by ultrasound from device removal to 24 h (Control, eCG 300 IU and 150 or 300 micrograms of rbLH. (Study 1)

[0035] FIG. 5: Area in mm.sup.2 of the formed corpus luteum (CL) at 7 days after ovulation in cows treated with differing gonadotropins (Control, eCG 300 IU and 150 or 300 micrograms of rbLH). (Study 1)

[0036] FIG. 6: Proportion of cows having premature ovulations following the use of differing gonadotropins. Premature ovulation was assumed for cows ovulating within 48 h after progesterone device removal. (Study 2)

[0037] FIG. 7: Dominant follicle growth rate (mm) measured by ultrasound from device removal to 24 h (Control, eCG 300 IU and 50 or 100 micrograms of rbLH). (Study 2)

[0038] FIG. 8: Area in mm.sup.2 of the formed corpus luteum (CL) at 7 days after ovulation in cows treated with differing gonadotropins (Control, eCG 300 IU and 50 or 100 micrograms of rbLH). (Study 2)

[0039] FIG. 9: Dominant follicle growth rate (mm) measured by ultrasound from device removal to 24 h (Control, eCG 300 IU and 50, 100, 150 or 300 micrograms of rbLH). (Studies 1 and 2)

[0040] FIG. 10: Ovulation rate at 72 h in cows treated with differing gonadotropins (Control, eCG 300 IU and 50, 100, 150 or 300 micrograms of rbLH). (Studies 1 and 2)

[0041] FIG. 11: Area in mm.sup.2 of the formed corpus luteum (CL) at 7 days after ovulation in cows treated with differing gonadotropins (Control, eCG 300 IU and 50, 100, 150 or 300 micrograms of rbLH). (Studies 1 and 2)

DETAILED DESCRIPTION OF THE INVENTION

[0042] The present invention provides methods to increase reproductive performance in non-human mammals, and preferably ungulates, even more preferably cattle. In particular, rLH is used at an efficient dose to stimulate fertility and/or fecundity in non-human mammal females, as illustrated by an increase of follicle growth rates. rLH is also effective to stimulate the growth and the maturation of follicles, to improve the ovulation rate, and to increase the size of corpora lutea (CL).

[0043] rLH can be used in synchronization protocols and/or treatments for fixed-time artificial insemination and/or embryo transfer. The invention may be used with any ungulate, preferably bovine.

Definitions

[0044] Within the context of the present invention, the term “increasing reproductive performance” or “increased reproductive performance” refers to increasing the likelihood that a non-human mammal, or a plurality of non-human mammals, will be fertile and conceive.

[0045] Increasing reproductive performance includes a stimulation of the growth and/or maturation of follicles, or an improvement in the size (such as its surface area) of corpora lutea.

[0046] Increased reproductive performance also includes an increased likelihood that a non-human mammal, or a plurality of non-human mammals, which has been inseminated will become pregnant, will deliver a live offspring, or develop viable embryos.

[0047] Increasing reproductive performance also includes increasing the number of viable embryos. A non-human mammal or a plurality of non-human mammals can produce embryos in utero and/or in vitro. Increased reproductive performance includes increasing fertility, fecundity, superovulation, oocyte rate, ovulation rate, embryo production and/or pregnancies. An increase is preferably by approximately at least 1% as compared to non-treated non-human mammals, more preferably by at least 2%, 3%, 4%, 5%, 10% or more.

[0048] The term “fertility” or “fertile” refers, within the context of this invention, to the ability to produce fertilizable oocytes.

[0049] The term “fecund”, “conceive” or “fecundity” refers, within the context of this invention, to the ability to complete a pregnancy.

[0050] The term “superovulation” refers, within the context of this invention, to an increase in the number of ovulated follicles and/or in the creation of fertile ova.

[0051] The term “pregnant” refers to a non-human mammal or to a group of non-human mammals some of which being currently pregnant or that has been inseminated and may be pregnant.

[0052] As used herein, the term “estrus” refers to the period during which a non-human mammal is most likely to become pregnant. Estrus may be detected or monitored by behavioral demonstration that a non-human mammal is in heat, including showing standing heat.

[0053] “Insemination” refers to introducing semen by any method known in the art, including, but not limited to, natural and Artificial Insemination (AI) and in vitro fertilization (IVF).

[0054] A “group” of animals designates any group of at least 2 non-human mammals, such as a herd or flock.

[0055] An “ungulate” refers to any animal with hooves and especially the two taxonomic orders Perissodactyla and Cetartiodactyla.

[0056] The term “administration” refers to all route of administration such as oral, enteral mucosal, parenteral or percutaneous. Preferably the administration route is an injection, in particular intramuscular (IM) or subcutaneous (SC) injection.

[0057] As used herein, the term “about” or “around” will be understood by a person of ordinary skill in the art and will vary to some extent on the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” or “around” will mean up to plus or minus 20%, preferably 10% or 5%, of the particular term.

Recombinant Luteinizing Hormone and Use Thereof

[0058] The rLH may be produced in a baculovirus or mammalian or other expression system. In one embodiment, recombinant LH is recovered from the milk or egg whites of a transgenic animal. Methods of producing recombinant proteins in transgenic animals are well known and have been described in U.S. Pat. Nos. 4,873,316; 5,322,775; 6,111, 165; 6,472,584 and 6,528, 699 and other means known in the art.

[0059] Recombinant LH can be made using cloned and mutated LH genes that encode peptides identical to native LH, or having at least about 80% homology thereto, more preferably having at least about 90% homology thereto, and most preferably having at least about 95% homology thereto and also being able to induce ovulation in a mammal. Recombinant LH can also be made using cloned and mutated LH genes that encode peptides that are not identical to native LH, of the selected species, providing that the recombinant LH produced has a similar activity as native LH.

[0060] Recombinant LH can also be made in accordance with the methods known to the art, e. g., as described in US Patent Application No. 20030059898 assigned to Genzyme, and U.S. Pat. Nos. 6,635,256; 6,242,580; 6,238,890; 6,225,449; 6,103,501; 6,028,177; 5,985,611; 5,958,737; 5,883,073; 5,792,460; 5,759,818; 5,733,735; 5,712,122; 5,705,478; 5,585,345; 5,405,945; 5,338,835 and 5,177,193, and U.S. Patent Applications No. 20020160944, and 20010007757, and other means known to the art.

[0061] Production of recombinant bovine LH (rbLH) is described in WO 90/02757, U.S. Pat. Nos. 6,455,282; 5,639,639, 5,767,251, Nilson (1987) J. Reprod. Fertil. Suppl. 34: 227-36, Boime et al. (1992) Seminars in Reprod. Endocrin. 10: 45-50, and Kaetzel (1985) PNAS USA 82: 7280-7283. A process for the purification of recombinant LH is described in WO 01/62774. U.S. Pat. No. 5,929,028 describes liquid gonadotropin containing formulations that may include LH. Otieno et al. (2002 Reproduction 123 (1): 155-162) describes expression of LH genes in bovine conceptuses.

[0062] According to a preferred embodiment, the recombinant bovine luteinizing hormone analog (rbLH), comprises, or preferably consists of, a single polypeptide chain in which the alpha and beta subunits from bovine LH are covalently linked via a peptide linker. The peptide linker may be any peptide linker which does not affect the conformation or activity of LH. In a preferred embodiment, the linker is a CTP linker, e.g., a linker which comprises a sequence of the carboxy terminal peptide of human chorionic gonadotropin (hCG), as described in U.S. Pat. No. 6,242,580 and US2008/0312151. The rbLH used in the present invention are preferably as described in WO2004/078061. Single-chain recombinant bovine LH can be made in accordance with the methods described in U.S. Pat. No. 6,242,580, which discloses recombinant LH wherein the beta subunit is covalently linked to the alpha subunit. Alternatively, a linker is present between the beta and alpha subunits. Single-chain forms need only a single gene to be transcribed during recombinant production and are advantageous over the dimeric forms in terms of stability of the protein. Expression vectors where the C-terminus of the bovine beta subunit is preferably linked to the N-terminus of the bovine alpha subunit are transfected into CHO cells for expression.

[0063] According to a particular embodiment, rbLH comprises or consists of the SEQ ID NO: 2 or 3. SEQ ID NO: 1 presents a nucleotide expression sequence for rbLH SEQ ID NO: 3.

[0064] Recombinant LH is preferably used in essentially pure form, optionally in association with one or several pharmaceutically acceptable excipients or carriers. In a preferred embodiment, rLH is administered in a composition comprising a suitable pharmaceutical formulation. The pharmaceutical formulation may comprise one or several excipients or carriers.

[0065] The rLH is administered according to the invention at a dose range comprised between about 50 and about 300 micrograms per animal. More preferably the administered dose per animal is 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, and 300 micrograms.

[0066] The rLH is preferably administered in one dose, i.e. in one single administration.

[0067] According to a particular embodiment, rLH is administered by injection, preferably by intramuscular or subcutaneous injection, and more preferably by intramuscular injection.

Treatment

[0068] As previously indicated, the invention relates to novel methods for increasing reproductive performance in non-human mammals using rLH at a low dose. The invention may be used in insemination and/or embryo transfer synchronization programs particularly ungulates, e.g., to improve ovulation rate and/or follicle growth and/or the size of corpora lutea in the treated animals; as well as synchronization programs for embryo recipients, e.g., to improve pregnancy rate in recipients animals.

[0069] The invention is particularly suitable for timed-artificial insemination and/or embryo transfer protocols and/or treatments of non-human mammals, especially female beef and dairy cattle, including heifers.

[0070] More particularly, an object of the invention relates to rLH for use to increase reproductive performance in non-human mammals, wherein rLH is administered to said non-human mammals at a dose range comprised between about 50 and about 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0071] Another object of the invention resides in a method for increasing reproductive performance or embryo production in non-human mammals, comprising administering to said non-human mammals, rLH at a dose range comprised between about 50 and about 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0072] Another object of the invention resides in a method for increasing pregnancy rate in non-human mammals, comprising administering to said non-human mammal rLH at a dose range comprised between about 50 and about 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0073] Another object of the invention resides in a method for increasing follicle growth and ovulation rate in non-human mammals, comprising administering to non-human mammals, rLH at a dose range comprised between about 50 and about 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0074] In a particular object, the invention resides in a method for increasing follicle growth and ovulation rate in non-human mammals, comprising administering to non-human mammals, rLH at a dose range comprised between about 50 and about 100 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound

[0075] A further object of the invention is a method for improving corpus luteum quality in non-human mammals, comprising administering to a non-human mammal rLH at a dose range comprised between 50 and 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0076] In a particular object, the invention resides in a method for improving corpus luteum quality in non-human mammals, comprising administering to a non-human mammal rLH at a dose range comprised between 100 and 150 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound.

[0077] In a preferred embodiment, the method comprises:

[0078] (a) treating a non-human mammal (such as an ungulate) or a group of non-human mammals (such as a group of ungulates) for a timed-artificial insemination protocol and/or treatment, or providing a non-human mammal (such as an ungulate) or a group of non-human mammals (such as a group of ungulates) which has been treated for a timed-artificial insemination protocol and/or treatment;

[0079] (b) administering to the treated non-human mammal(s) rLH at a dose range comprised between about 50 and about 300 micrograms, in one single dose, and preferably with a simultaneous administration of estradiol and/or PGF2a compound; and

[0080] (c) optionally, inseminating the non-human mammal(s), preferably 1 to 4 days, or even more preferably 36 to 48 hours after administration step (b).

[0081] As mentioned before, utilization of synchronization programs, including the called “timed-artificial insemination” (TAI) protocols, comprise steps to synchronize ovulation in females, growth and ovulation of follicles in a synchronized fashion allowing the fixed-time artificial insemination, avoiding the necessity of estrus detection. As a first treatment step of synchronization programs, emergence of a new follicular wave is synchronized.

[0082] Follicular growth is not continuous in non-human mammals such as bovine, but occurs in waves (2 to 4 waves per cycle). Each wave begins approximately when the dominant follicle in the previous wave gains maximal size, at which time numerous small follicles begin a period of rapid growth. From this group of follicles, one follicle is allowed to grow to a much larger size than the others. This large follicle is called the dominant follicle, because it has the ability to regulate and restrict the growth of the smaller follicles, called subordinate follicles. A few days after reaching maximum size, the dominant follicle begins to regress and die. As the dominant follicle degenerates, its ability to restrict the other follicles is reduced; therefore, a new follicular wave is initiated. A consequence of this dynamic process is that follicles of all sizes, including at least one large follicle, exist on each day of the estrous cycle.

[0083] Follicle wave synchronization gives the opportunity to treat all non-human mammals in a limited period of time and, therefore, to capture the economic benefits of the insemination. Upon synchronization of the estrous cycle, a high percentage of treated females show a fertile, closely synchronized estrus and ovulation.

[0084] The synchronization of ovulation or timed-AI protocols refers to methods and/or protocols that artificially stimulate follicle growth and timed ovulation, so that ovulation is initiated at a predetermined time with no need to monitor estrus behavior. A review of common methods and protocol applied in bovine are described in the article of Bo et al in the 28.sup.th Annual meeting AETE-Saint Malo, France, 7-8 Sep. 2012 (Recent advances in the control of follicular development and superovulation protocols in cattle).

[0085] A new follicle wave emergence can be synchronized by hormonal or physical treatment. Hormonal treatment comprises the administration of suitable hormones, such as estrogens and other hormones including progesterone or GnRH. Physical treatment includes follicle ablation.

[0086] In a preferred embodiment, prior to rLH administration according to the invention, ovulation synchronization (or step a) is carried out and comprises a hormonal treatment of the non-human mammal(s), preferably by administration of GnRH and/or estrogen-progesterone combination.

[0087] In a preferred embodiment, step a is carried out by implementing the following treatment: simultaneous administration of estrogen compound and progesterone. Preferably, estrogen is administered by injection, preferably by intramuscular injection. Preferably, progesterone is administered intravaginally via a device, such as an implant (also called P4 device in the following examples).

[0088] According to a particular embodiment, the progesterone device is maintained from 5 to 10 days, preferably from 7 to 9 days, and is removed thereafter, and more particularly from 8 to 9 days (e.g. the device is removed 8.5 days after insertion).

[0089] Specific dosages and/or protocols are disclosed in the art such as, e.g., in Thatcher et al., 2001 (American Association of Bovine Practitioner, AABP, Vancouver, 95-105); Diskin et al., 2001 (occasional publication n° 26, p175, British society of Animal Science); or Pursley et al., 1995 (Theriogenology 44 p915).

[0090] According to a particular embodiment, rLH is administered according to the invention at the device removal.

[0091] In a preferred embodiment, the invention relates to a method comprising:

[0092] (a) treating a non-human mammal (such as an ungulate) or a group of non-human mammals (such as ungulates) with a GnRH and/or progesterone-estrogen combination to synchronize follicles; or providing a non-human mammal (such as an ungulate) or a group of non-human mammals (such as ungulates) which has been treated with a GnRH and/or progesterone-estrogen combination to synchronize follicles;

[0093] (b) administering to the treated non-human mammals (such as ungulates) rLH at a dose range comprised between about 50 and about 300 micrograms, preferably with a simultaneous administration of estradiol and/or PGF2a compound; and

[0094] (c) optionally, inseminating a treated non-human mammal (such as ungulate) of (b) and/or collecting oocytes from a treated non-human mammal (such as ungulate) of (b), preferably near the time of ovulation and, more preferably, within 1 to 4 days, even more preferably 36 to 48 hours after administration step (b).

[0095] In step (b), rLH can be administered using any means or techniques known per se in the art including, without limitation, systemic administration, such as intramuscular, intravenous, subcutaneous, etc. Preferred administration route is intramuscular injection.

[0096] In a preferred embodiment, rLH is administered in one single dose.

[0097] In a preferred embodiment, estrogen is an estradiol compound. The estradiol compound is preferably an estradiol ester, including estradiol cypionate, valerate or benzoate. According to a more preferred embodiment, the estradiol ester is estradiol benzoate. According to a particular embodiment, rLH is administered at a dose range comprised between about 50 and about 300 micrograms, with a simultaneous administration of estradiol benzoate (EB) or estradiol cypionate.

[0098] According to a particular embodiment, rLH is administered simultaneously with prostaglandin, more specifically prostaglandin F2alpha (PGF2a). According to a more particular embodiment, rLH is administered simultaneously with estradiol compound (preferably estradiol benzoate) and prostaglandin (preferably PGF2a).

[0099] In a preferred embodiment, the method further comprises a step (c) of inseminating said ungulate, preferably near the time of ovulation and, more preferably, within 1 to 4 days, even more preferably 36 to 48 hours after rLH administration.

[0100] The prostaglandin, as well as estradiol compound, are administered typically by injection, as a single or multiple dose(s), more preferably each as a single dose.

[0101] The invention may be used in any ungulate, such as bovine, sheep, goats, cervids, yaks, water buffaloes, bison, antelopes, gazelles, elk, reindeer, moose, bighorn sheep, giraffes, camelids, swine, equine, alpacas, and vicunas. It is particularly suited for treating female beef and dairy cattle, including heifers.

TABLE-US-00001 SEQUENCE LISTING SEQ ID NO 1 atggagatgttccagggactgctgctgtggctgctgctgggcgtggccggggtg  M  E  M  F  Q  G  L  L  L  W  L  L  L  G  V  A  G  V tgggcttccagggggccactgcggccgctgtgccagcccatcaacgccaccctg  W  A  S  R  G  P  L  R  P  L  C  Q  P  I  N  A  T  L gcggctgagaaggaggcctgccctgtctgtatcactttcaccaccagcatctgc  A  A  E  K  E  A  C  P  V  C  I  T  F  T  T  S  I  C gccggctactgccccagcatgaagcgggtgctgcctgtcatcctgccgcccatg  A  G  Y  C  P  S  M  K  R  V  L  P  V  I  L  P  P  M ccccagcgggtgtgcacctaccatgagctgcgcttcgcctccgttcggctcccc  P  Q  R  V  C  T  Y  H  E  L  R  F  A  S  V  R  L  P ggctgcccacctggagtggacccaatggtctccttccccgtggccctcagctgt  G  C  P  P  G  V  D  P  M  V  S  F  P  V  A  L  S  C cactgtggaccctgccgcctcagcagcactgactgcgggggtcccagaacccaa  H  C  G  P  C  R  L  S  S  T  D  C  G  G  P  R  T  Q cccttggcctgtgaccaccccccgtcctcttcctcaaaggcccctcccccgagc  P  L  A  C  D  H  P  P  S  S  S  S  K  A  P  P  P  S cttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaa  L  P  S  P  S  R  L  P  G  P  S  D  T  P  I  L  P  Q tttcctgatggagagtttacaatgcagggctgtcctgaatgcaagctaaaagaa  F  P  D  G  E  F  T  M  Q  G  C  P  E  C  K  L  K  E aacaaatacttctccaagccagatgctccaatctatcagtgcatggggtgctgc  N  K  Y  F  S  K  P  D  A  P  I  Y  Q  C  M  G  C  C ttctccagggcataccccactccagcgaggtctaagaagacaatgttggtcccc  F  S  R  A  Y  P  T  P  A  R  S  K  K  T  M  L  V  P aagaacatcacctcggaagctacatgctgtgtggccaaagcatttaccaaggcc  K  N  I  T  S  E  A  T  C  C  V  A  K  A  F  T  K  A acagtgatgggaaatgtcagagtggagaaccacaccgagtgccactgcagcact  T  V  M  G  N  V  R  V  E  N  H  T  E  C  H  C  S  T tgttattatcacaaatcctaa  C  Y  Y  H  K  S  * 1st bold sequence: signal peptide 1st non-bolded sequence: Beta subunit 2nd bold sequence: CTP linker 2nd non-bolded sequence: Alpha subunit SEQ ID NO 2 S R G P L R P L C Q P I N A T L A A E K E A C P V C I T F T T S I C A G Y C P S M K R V L P V I L P P M P Q R V C T Y H E L R F A S V R L P G C P P G V D P M V S F P V A L S C H C G P C R L S S T D C G G P R T Q P L A C D H P P S S S S K A P P P S L P S P S R L P G P S D T P I L P Q F P D G E F T M Q G C P E C K L K E N K Y F S K P D A P I Y Q C M G C C F S R A Y P T P A R S K K T M L V P K N I T S E A T C C V A K A F T K A T V M G N V R V E N H T E C H C S T C Y Y H K S SEQ ID NO 3 M E M F Q G L L L W L L L G V A G V W A S R G P L R P L C Q P I N A T L A A E K E A C P V C I T F T T S I C A G Y C P S M K R V L P V I L P P M P Q R V C T Y H E L R F A S V R L P G C P P G V D P M V S F P V A L S C H C G P C R L S S T D C G G P R T Q P L A C D H P P S S S S K A P P P S L P S P S R L P G P S D T P I L P Q F P D G E F T M Q G C P E C K L K E N K Y F S K P D A P I Y Q C M G C C F S R A Y P T P A R S K K T M L V P K N I T S E A T C C V A K A F T K A T V M G N V R V E N H T E C H C S T C Y Y H K S

[0102] Further aspects and advantages of the invention will be disclosed in the following experimental section, which illustrates the claimed invention.

EXAMPLES

Methods

[0103] A series of several studies were performed by implementing rbLH (in particular rbLH comprising SEQ ID NO: 2) during timed AI protocols in Bos indicus (Nelore) cattle, and comparison with a control or eCG treatment.

Study 1—Evaluation of Different Doses of rbLH on Follicle Dynamics.

[0104] Thirty-nine healthy postpartum anestrus Nelore cows, weighing between 400 to 600 kg and ages of 2 to 8 years old were included in the trial. Cows were kept in Brachiaria pastures and were identified by ear tag number. All animals received a progesterone device (P4 device—loaded with 750 mg of natural progesterone) on DO plus 2 mg of estradiol benzoate (EB). Eight days later, at device removal, all animals received a PGF2a (PGF) treatment simultaneously to 1 mg of estradiol cipionate (ECP), and at the same time were randomized (CRD—complete randomized design) to receive one of the 4 treatments, as follows: eCG (300 IU of eCG, n=11); Negative Control (no gonadotropin treatment, n=9); rbLH15 (150 micrograms of rbLH, n=9) and rbLH30 (300 micrograms of rbLH, n=10). This group of cows undergoing the follicular dynamics evaluations received frequent ultrasound scannings (US) throughout the synchronization protocol to evaluate primarily the proportion of cows ovulating within 48 h after device removal as well as follicle growth following the differing treatments. FIG. 1

Study 2—Evaluation of a Lower Dose of rbLH on Follicle Dynamics.

[0105] Sixty-two healthy postpartum anestrus Nelore cows, weighing between 400 to 600 kg and ages of 2 to 8 years old were included in the trial. Cows were kept in Brachiaria pastures and were identified by ear tag number. All animals received a progesterone device on DO plus 2 mg of estradiol benzoate (EB). Eight days later, at device removal, all animals received a PGF2a treatment simultaneously to 1 mg of estradiol cypionate (ECP), and at the same time were randomized (CRD—complete randomized design) to receive one of the 4 treatments, as follows: eCG (300 IU of eCG, n=12); Negative Control (no gonadotropin treatment, n=14); rbLH5 (50 micrograms of rbLH, n=16) and rbLH10 (100 micrograms of rbLH, n=20). This group of cows undergoing the follicular dynamics evaluations received frequent ultrasound scanning throughout the synchronization protocol to evaluate primarily the proportion of cows ovulating within 48 h after device removal as well as follicle growth following the differing treatments. FIG. 2

Measurements

[0106] Initial body condition scores, days post-partum and parity number of the cows; [0107] Ultrasound examinations on DO, D 8 to D10 at 12 h intervals to evaluate follicular dynamics during the synchronization protocol; [0108] Follicle growth, follicle size at 48 h and time of ovulation after device removal.

Statistics

[0109] Data were analyzed by logistic regression using the GLIMMIX procedure of SAS (version 9.4). The final logistic regression model removed variables by a backward elimination based on the Wald statistics criterion when p>0.20. Statistical significance was assumed when P-value was lower than 0.05 and statistical differences are indicated with differing superscript letters. All values are presented as LSmeans extracted from the ILINK option from the GLIMMIX procedure of the SAS software.

Results

[0110] When testing different doses of rbLH as alternative to eCG in a synchronization protocol for TAI, the results from Study 1 showed a large proportion of cows ovulating prematurely following the use of rbLH compared to eCG and Control groups (FIG. 3). Also the growth rate of the dominant follicle from device removal to 24 h was much lower for cows receiving rbLH compared to Control cows and cows receiving 300 IU of eCG (FIG. 4). However, the results presented in FIG. 5 show an equivalent CL area for cows treated with 300 IU of eCG and 150 or 300 micrograms of rbLH, and both groups produced CL structures that were significantly greater than untreated Control cows.

[0111] Based on the satisfactory results on CL areas for cows treated with 150 or 300 micrograms of rbLH, it was decided to repeat Study 1 using a lower dose of rbLH (50 and 100 micrograms) in the attempt to replace eCG. As shown in FIG. 6, the dose of 50 micrograms of rbLH did not induce premature ovulations, and only 7% of cows receiving 50 micrograms of rbLH ovulated before 48 h after device removal, whereas, at the dose of 100 micrograms of rbLH, 30% of cows had premature ovulation.

[0112] Dominant follicle growth rate from device removal to 24 h was higher for cows receiving 50 and 100 micrograms of rbLH compared to Control cows and cows receiving 300 IU of eCG (FIG. 7), whereas CL area for cows treated with 300 IU of eCG and 100 micrograms of rbLH was significantly greater than untreated Control cows and for cows receiving 50 micrograms of rbLH.

[0113] When combining the two experiments, although the greater incidence of premature ovulation rate compared to eCG, cows treated with rbLh at the dose of 100 and 150 micrograms achieved similar follicular growth (FIG. 9), similar ovulation rate at 72 h (FIG. 10) and CL area (FIG. 11) as cows treated with eCG and significantly higher than negative Control group cows.

[0114] An additional study is planned to test follicular growth and ovulation time using the dose of 100 and/or 150 micrograms of rbLH with estradiol benzoate used to induce ovulations that match the circulating half-life (˜30 h) of rbLH. After testing the best rbLH dose on follicular growth, a large field study will be conducted to test fertility outcomes of rbLH as a replacement to eCG in a synchronization protocol for timed artificial insemination (TAI) in cattle.

CONCLUSIONS

[0115] The use of rbLH, in particular 100 or 150 micrograms rbLH, at final stages of the synchronization protocol for timed-AI: [0116] Improved follicle growth rates comparable to eCG; [0117] Increased CL area 7 days after ovulation, which is critical for embryo development.