MODIFIED IMMUNE EFFECTOR CELLS WITH INCREASED RESISTANCE TO CELL DEATH

20220143089 · 2022-05-12

    Inventors

    Cpc classification

    International classification

    Abstract

    Immune effector cells and immune effector cell lines are modified to have increased resistance to TRAIL-induced cell death, by knockout of a TRAIL receptor or by linking a TRAIL receptor to an immune effector cell co-stimulatory domain, or both.

    Claims

    1-26. (canceled)

    27. An immune effector cell or immune effector cell line that has been modified to have increased resistance to TRAIL-induced cell death, characterized in that: a) the modification is to knockdown or knockout expression of one or more TRAIL receptor genes; and/or b) the modification is to express a TRAIL receptor linked to a co-stimulatory domain.

    28. The immune effector cell or immune effector cell line of claim 27, wherein the immune effector cell is a NK cell.

    29. The immune effector cell or immune effector cell line of claim 27, wherein the immune effector cell is a T cell.

    30. The immune effector cell or immune effector cell line of claim 27, wherein the increased resistance to TRAIL-induced cell death is by at least 10%, relative to wildtype immune effector cells.

    31. The immune effector cell or immune effector cell line of claim 27, wherein the TRAIL receptor is selected from DR4 and DR5.

    32. The immune effector cell or immune effector cell line of claim 27, wherein the co-stimulatory domain is selected from the group consisting of 4-1BB, CD28, 2B4, DAP-10, DAP-12, CD278 (ICOS) and OX40.

    33. The immune effector cell or immune effector cell line of claim 27, which expresses or is modified to express a mutant TRAIL ligand.

    34. The immune effector cell or immune effector cell line of claim 33, wherein the mutant TRAIL ligand has an increased affinity for one or more TRAIL receptors, e.g. DR4 and/or DR5.

    35. The immune effector cell or immune effector cell line of claim 27, wherein the cell line is NK-92 or KHYG-1, or a derivative thereof.

    36. A method of treating a cancer in a patient, the method comprising administering to the patient the immune effector cell or immune effector cell line of claim 27.

    37. The method of claim 36, wherein the immune effector cell is a NK cell.

    38. The method of claim 36, wherein the immune effector cell is a T cell.

    39. The method of claim 36, wherein the increased resistance to TRAIL-induced cell death is by at least 10%, relative to wildtype immune effector cells.

    40. The method of claim 36, wherein the co-stimulatory domain is selected from the group consisting of 4-1BB, CD28, 2B4, DAP-10, DAP-12, CD278 (ICOS) and OX40.

    41. The method of claim 36, wherein the immune effector cell or immune effector cell line further expresses or is modified to express a mutant TRAIL ligand.

    42. The method of claim 41, wherein the mutant TRAIL ligand has an increased affinity for one or more TRAIL receptors, e.g. DR4 and/or DR5.

    43. The method of claim 36, wherein the cancer is a blood cancer.

    44. The method of claim 43, wherein the blood cancer is acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CIVIL), Hodgkin's lymphoma, non-Hodgkin's lymphoma, including T-cell lymphomas and B-cell lymphomas, multiple myeloma (MM), asymptomatic myeloma, smoldering multiple myeloma (SMM), active myeloma or light chain myeloma.

    45. An immune effector cell or immune effector cell line that has been modified to have increased resistance to TRAIL-induced cell death, characterized in that: a) the cell is an NK cell and the modification is to knockdown or knockout expression of one or more TRAIL receptor genes; or b) the cell is selected from an NK cell and a T cell and the modification is to express a TRAIL receptor linked to a co-stimulatory domain.

    46. A method of treating a cancer in a patient, the method comprising administering to the patient the immune effector cell or immune effector cell line of claim 45.

    Description

    [0127] FIG. 1 shows mitigation of NK cell fratricide by knocking down DR5 expression;

    [0128] FIG. 2 shows DR5 expression on T cells;

    [0129] FIG. 3 shows transfection of T cells with the DR5-41BB chimera;

    [0130] FIG. 4 shows mitigation of TRAIL-induced T cell death through expression of the DR5-41 BB chimera;

    [0131] FIG. 5 shows DR5 expression on NK cells; and

    [0132] FIG. 6 shows transfection of NK cells with the DR5-41BB chimera.

    [0133] DNA, RNA and amino acid sequences are referred to below, in which: [0134] SEQ ID NO: 1 is an example gRNA for DR5; [0135] SEQ ID NO: 2 is an example gRNA for DR4; [0136] SEQ ID NO: 3 is a second example gRNA for DR4; and [0137] SEQ ID NO: 4 is the DR5-41BB chimera DNA sequence.

    EXAMPLES

    [0138] The present invention is now described in more and specific details in relation to the production of immune effector cells, modified to exhibit reduced sensitivity to TRAIL-induced cell death and/or more cytotoxic activity and hence improved ability to cause cancer cell death in humans.

    [0139] For related examples of knockout/knockdown of checkpoint inhibitory receptor function and knock in of mutant TRAIL we refer to WO 2017/017184.

    Example 1—Knockout of NK Cell TRAIL Receptors DR4 and DR5

    [0140] NK Cells are prepared as follows, having death receptor 5 (DR5) and/or death receptor 4 (DR4) function removed.

    [0141] gRNA constructs targeting TRAIL-R2 (DR5) and TRAIL-R1 (DR4) are designed

    TABLE-US-00001 (e.g. SEQ ID NO: 1:  CCCAUCUUGAACAUACCAG (DR5), SEQ ID NO: 2:  AACCGGUGCACAGAGGGUGU (DR4) and SEQ ID NO: 3:  AUUUACAAGCUGUACAUGGG (DR4))

    [0142] and prepared to target endogenous genes encoding DR5 and DR4 gene(s) in NK cells. CRISPR/Cas9 genome editing is then used to knock out the DR5 and/or DR4 target genes.

    [0143] A total of 3 gRNA candidates are selected for the DR5 gene and their cleavage efficacies in RPMI8226 cells determined. A total of 3 gRNA candidates are selected for the DR4 gene and their cleavage efficacies in HL60 cells determined. RPMI8226 cells and HL60 are electroporated with the gRNA:Cas9 ribonucleoprotein (RNP) complex using Maxcyte® GT and subsequently knockout of DR5 and/or is analyzed by flowcytometry. The cleavage activity of the gRNA is also determined using an in vitro mismatch detection assay. T7E1 endonuclease recognizes and cleaves non-perfectly matched DNA, allowing the parental DR5 gene/DR4 gene to be compared to the mutated gene following CRISPR/Cas9 transfection and non-homologous end joining (NHEJ).

    [0144] The gRNA with highest KO efficiency is selected to further experiments to knockout DR5/DR4 in primary NK cells, NK cell lines or CD34+ progenitors (for subsequent differentiation and expansion to NK cells). Knockout of DR4/DR5 is determined by flowcytometry based assays.

    Example 2—Knockdown of TRAIL Receptors DR4 and DR5 in NK Cells

    [0145] siRNA knockdown of DR4 and/or DR5 in NK-92 cells, KHYG-1 cells and primary NK cells is performed by electroporation. The Nucleofection Kit T can be used, in conjunction with the Amaxa Nucleofector II, from Lonza, as it is appropriate for use with NK cells and can successfully transfect both dividing and non-dividing cells and achieves transfection efficiencies of up to 90%.

    [0146] The Nucleofector solution is warmed to room temperature (100 ul per sample). An aliquot of culture medium containing serum and supplements is also pre-warmed at 37° C. in a 50 ml tube. 6-well plates are prepared by adding 4 ml of culture medium containing serum and supplements. The plates are pre-incubated in a humidified 37° C./5% CO.sub.2 incubator.

    [0147] 2×10.sup.6 cells in 100 μl Nucleofection solution are mixed gently with 20 μM siRNA solution to achieve a final concentration of 2 μM. Air bubbles are avoided during mixing. The mixture is transferred into Amaxa certified cuvettes and placed into the Nucleofector cuvette holder.

    [0148] The program is run and allowed to finish, and the samples in the cuvettes removed immediately. 500 μl pre-equilibrated culture medium is then added to each cuvette. The sample in each cuvette is then gently transferred to a corresponding well of the prepared 6-well plate, in order to establish a final volume of 5 ml per well.

    [0149] The cells are then incubated in a humidified 37° C./5% CO.sub.2 incubator until transfection analysis is performed. Flow cytometry analysis is performed 72 hours after electroporation, in order to measure DR4 and/or DR5 expression levels. This electroporation protocol is found to reliably result in DR4 and DR5 knockdown in KHYG-1 cells, NK-92 cells and primary NK cells.

    Example 3—DR4-CD28/DR5-CD28 Fusion Proteins

    [0150] The immunomodulatory fusion proteins (IFPs) may comprise the extracellular domain of DR4 or DR5, or a portion thereof, and an intracellular signaling domain of CD28, or a portion thereof. The hydrophobic component may be comprised of the transmembrane domain of either DR4/DR5 or CD28, or portions thereof. In some DR4-CD28 or DR5-CD28 fusion proteins, the hydrophobic component comprises the transmembrane domain of CD28 and the extracellular component further comprises an extracellular portion of CD28, specifically an extracellular cysteine residue adjacent to the hydrophobic component. The extracellular component may comprise all or a portion of the extracellular domain of DR4 or DR5.

    [0151] The extracellular component may comprise the entire extracellular domain of DR4/DR5. The DR4-CD28 or DR5-CD28 constructs thus have the capacity to convert what would typically be an inhibitory signal from the binding of either DR4 or DR5 to TRAIL into a positive signal generated by the CD28 intracellular signaling domain.

    [0152] An exemplary nucleic acid molecule encoding a DR4-CD28 fusion protein or a DR5-CD28 fusion protein comprises the following elements (5′ to 3′): Extracellular Component (DR4/DR5)-Multimerization Domain (CD28 Cysteine)-Hydrophobic Component (CD28 transmembrane)-Intracellular Component (CD28 intracellular).

    [0153] Nucleic acids encoding the constructs can be generated in-house by PCR then directionally TOPO-cloned into the pENTR™/DTOPO® vector (Invitrogen), and transferred into the retroviral vector pMP71-attR using Gateway® technology (Invitrogen). In some cases, the nucleic acid molecules encoding IFPs are codon optimized before cloning into the pMP71-attR retroviral vector.

    Example 4—Modified TRAIL Receptor Knockin in NK Cells

    [0154] NK-92 cells, KHYG-1 cells and primary expanded NK cells are transfected with a gene encoding DR5 or DR4 linked to co-stimulatory domain CD28 (as above) or 4-1BB.

    [0155] A panel of genes encoding immunomodulatory fusion proteins (IFPs) that contain the DR5 or DR4 extracellular binding domain fused to a 4-1BB or CD28 co-stimulatory domain, rather than the natural death domain, is generated. Specifically, a gene of choice can encode an IFP comprising a DR5 backbone containing 4-1BB or CD28 and CD3zeta endodomains and the transmembrane and stalk region of CD8a. The gene construct is delivered as mRNA for transient expression and using SB vectors for establishing stable long term expression.

    [0156] After transfection (Nucleofection Kit T used as above) of NK cells with the IFPs, the successfully transfected cells are selected based on their IFP functionality. The selected cells are then incubated and passaged as previously described.

    [0157] The resulting IFPs expressed in NK cells compete with wildtype DR5 for binding of TRAIL but, unlike wildtype DR5, produce activating signals upon binding, leading to a more cytotoxic NK cell phenotype.

    Example 5—Increased Resistance of Modified NK Cells to TRAIL-Induced Killing

    [0158] Wildtype NK cells are compared to the genetically modified NK cells of Examples 1, 2, 3 and 4.

    [0159] Experimental Design I:

    [0160] The sensitivity of each cell type to TRAIL induced cell death is assessed by flowcytometry upon co-culture with RPMI-8226, MM1S, HL60, Panc-1 and BxPC3. Briefly, (1) wildtype NK cells, (2) NK cells expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H, (3)) NK cells with DR4.sup.KO or DR5.sup.KO and (4) NK cells with DR4.sup.KO or DR5.sup.KO expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H are tested against each cancer target cell type.

    [0161] Experimental Design II:

    [0162] The sensitivity of each cell type to TRAIL induced cell death is assessed by flowcytometry upon co-culture with RPMI-8226, MM1S, HL60, Panc-1 and BxPC3. Briefly, (1) wildtype NK cells, (2) NK cells expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H, (3) NK cells with DR4.sup.KI-IFP or DR5.sup.KI-IFP and (4) NK cells with NK cells with DR4.sup.KI-IFP or DR5.sup.KI-IFP expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H are tested against each cancer target cell type.

    [0163] Experimental Design III:

    [0164] The sensitivity of each cell type to TRAIL induced cell death is assessed by flowcytometry upon co-culture with RPMI-8226, MM1S, HL60, Panc-1 and BxPC3. Briefly, (1) wildtype NK cells, (2) NK cells expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H, (3) NK cells with DR4.sup.KO or DR5.sup.KO, (4) NK cells with DR4.sup.KI-IFP or DR5.sup.KI-IFP (5) NK cells with NK cells with DR4.sup.KO and DR4.sup.KI-IFP or DR5.sup.KO and DR5.sup.KI-IFP expressing high affinity membrane bound TRAIL ligand DR4.sup.4C9 or DR5.sup.E195R;D269H are tested against each cancer target cell type.

    Example 6—Knockout of T Cell TRAIL Receptors DR4 and DR5

    [0165] T Cells are prepared as follows, having death receptor 5 (DR5) and/or death receptor 4 (DR4) function removed.

    [0166] gRNA constructs targeting TRAIL-R2 (DR5) and TRAIL-R1 (DR4) are designed

    TABLE-US-00002 (e.g. SEQ ID NO: 1: CCCAUCUUGAACAUACCAG (DR5), SEQ ID NO: 2: AACCGGUGCACAGAGGGUGU (DR4) and SEQ ID NO: 3: AUUUACAAGCUGUACAUGGG (DR4))

    [0167] and prepared to target endogenous genes encoding DR5 and DR4 gene(s) in T cells. CRISPR/Cas9 genome editing is then used to knock out the DR5 and/or DR4 target genes.

    [0168] A total of 3 gRNA candidates are selected for the DR5 gene and their cleavage efficacies in RPMI8226 cells determined. A total of 3 gRNA candidates are selected for the DR4 gene and their cleavage efficacies in HL60 cells determined. RPMI8226 cells and HL60 are electroporated with the gRNA:Cas9 ribonucleoprotein (RNP) complex using Maxcyte® GT and subsequently knockout of DR5 and/or is analyzed by flowcytometry. The cleavage activity of the gRNA is also determined using an in vitro mismatch detection assay. T7E1 endonuclease recognizes and cleaves non-perfectly matched DNA, allowing the parental DR5 gene/DR4 gene to be compared to the mutated gene following CRISPR/Cas9 transfection and non-homologous end joining (NHEJ).

    [0169] The gRNA with highest KO efficiency is selected to further experiments to knockout DR5/DR4 in primary T cells, T cell lines or progenitor cells (for subsequent differentiation and expansion to T cells). Knockout of DR4/DR5 is determined by flowcytometry based assays.

    Example 7—NK Cell Fratricide Resistance

    [0170] As illustrated in FIG. 1, NK cell fratricide in the following cells was assessed: (1) primary NK cells, otherwise referred to as mock or wildtype NK cells, (2) primary NK cells expressing high affinity membrane-bound TRAIL ligand DR5.sup.E195R;D269H, (3) primary NK cells with a DR5.sup.KD via siRNA and (4) primary NK cells with a DR5.sup.KD via siRNA and also expressing high affinity membrane-bound TRAIL ligand DR5.sup.E19R5R;D269H.

    [0171] Primary NK cells receiving the DR5 knockdown were electroporated with the DR5 siRNA on day 9 of the expansion, whereas primary NK cells receiving the DR5 TRAIL variant were electroporated with the variant mRNA on day 12 of the expansion.

    [0172] It was observed that after prolonged expansion of the primary NK cells in IL-2 containing growth media that DR5 expression became upregulated, leading to increased fratricide when the DR5 TRAIL variant was expressed.

    [0173] The data clearly indicate that knocking down DR5 expression using siRNA protects primary expanded NK cells from fratricide, regardless of whether those NK cells express wildtype TRAIL or the high-affinity DR5 TRAIL variant.

    Example 8—DR5 Expression on T Cells

    [0174] TRAIL death receptor 5 (DR5) expression was measured on Jurkat T cells.

    [0175] Jurkat T cells were cultured in the presence of RPMI-1640, 10% FBS and 1% Penicillin-Streptomycin. Cells were harvested during the logarithmic growth phase and immune-phenotyped for the expression of TRAIL-DR5/CD262 cell surface expression according to standard operating protocols.

    [0176] In brief, the cells were washed with buffer containing PBS, Sodium Azide and 2% FBS. Subsequently, cells were re-suspended in an appropriate volume and stained with anti-DR5 antibody (Clone: DJR2-4, Source: Biolegend, Cat: 307406). Cells were then incubated with 2 μl of the antibody for 20 minutes on ice. Post-incubation, cells were washed twice to remove unbound antibody with a buffer containing PBS, Sodium Azide and 2% FBS. Cells were finally re-suspended in 200 μl buffer containing PBS, Sodium Azide and 2% FBS and measured by flow cytometry on a BD FACS Canto II using the 488 nm blue laser and detecting the signal emitted using a 585/42 band pass filter. Results were analysed by FlowJo software (version X).

    [0177] FIG. 2 shows the expression of DR5 on Jurkat T cells in both an FMO control sample (1.29%) and the anti-DR5 stained sample (86.8%).

    [0178] It is clear that Jurkat T cells highly express the TRAIL death receptor 5 (DR5) on their surface.

    Example 9—Expression of DR5-41BB Chimera on T Cells

    [0179] A DR5-41BB fusion protein (SEQ ID NO: 4) was expressed in Jurkat T cells, in order to convert the apoptotic DR5 signal cascade into an active, stimulatory T cell response.

    [0180] Jurkat T cells were cultured in the presence of RPMI-1640, 10% FBS and 1% Penicillin-Streptomycin. Cells were harvested during the logarithmic growth phase and transfected using mRNA electroporation under standard electroporation protocol. DR5-41BB mRNA was used at a concentration of 1 μg/μl in citrate buffer. Cells were washed once in buffer solution and subsequently concentrated at a density of 2×10.sup.6 cells/100 μl. Cells were either mock electroporated or electroporated with the DR5-41BB chimera at a final concentration of 10 μg/100 μl. Cells were immediately recovered post-electroporation in a 6 well plate and allowed to recover for 20 minutes at 37° C. After the incubation, cells were supplemented with media containing RPMI-1640 and 10% FBS. Cells were allowed to recover and incubated at 37° C. for another 24 hours before the expression of the DR5-41BB chimera was analysed by flow cytometry.

    [0181] In brief, cells were washed with buffer containing PBS, Sodium Azide and 2% FBS. Subsequently, cells were re-suspended in an appropriate volume and stained with anti-DR5 antibody (Clone: DJR2-4, Source: Biolegend, Cat: 307406). Cells were then incubated with 2 μl of the antibody for 20 minutes on ice. Post-incubation, cells were washed twice to remove unbound antibody with buffer containing PBS, Sodium Azide and 2% FBS. Cells were finally re-suspended in 500 μl buffer containing PBS, Sodium Azide and 2% FBS and measured by flow cytometry on a BD FACS Canto II using the 488 nm blue laser and detecting the signal emitted using a 585/42 band pass filter. Results were analysed by FlowJo version X.

    [0182] FIG. 3 shows the expression of the DR5-41BB chimera on Jurkat T cells. DR5 expression in the mock electroporated Jurkat T cells showed a mean MFI value of 698. DR5 expression and DR5-41BB expression on the transfected Jurkat T cells showed a mean MFI value of 2073. Upon normalising the mock electroporated T cells to a background MFI=0, it can be seen that the DR5-41BB specific expression is equal to a mean MFI value of 1375.

    [0183] It was thus shown that the DR5-41 BB chimera can be successfully expressed in T cells.

    Example 10—Protective Effect of the DR5-41BB Chimera

    [0184] Wildtype Jurkat T cells and Jurkat T cells expressing the DR5-41BB chimera from Example 9 were assessed for their vulnerability when exposed to TRAIL ligand.

    [0185] Jurkat T cells were cultured in the presence of RPMI-1640, 10% FBS and 1% Penicillin-Streptomycin. The cells were harvested during the logarithmic growth phase, and transfected using mRNA electroporation under standard electroporation protocol. DR5-41BB mRNA was used at a concentration of 1 μg/μl in citrate buffer. Cells were washed once in buffer solution and subsequently concentrated at a density of 2×10.sup.6 cells/100 μl. Cells were either mock electroporated or electroporated with the DR5-41BB chimera at a final concentration of 10 μg/100 μl. Cells were immediately recovered post-electroporation in 6 well plate and allowed to recover for 20 minutes at 37° C. After the incubation, cells were supplemented with media containing RPMI-1640 and 10% FBS.

    [0186] Cells were allowed to recover and incubated at 37° C. for another 4 hours before they were used in a functional assay in a 96 well plate to assess the toxicity of TRAIL ligand on (a) mock electroporated or (b) DR5-41BB mRNA electroporated Jurkat T cells.

    [0187] As can be seen in FIG. 4, the T cells were cultured separately either in the absence or the presence of soluble TRAIL ligand at a final concentration of 100 ng/ml. Each plot represents n=3. The assay was performed for a duration of 16 hours and cell death in T cells was assessed by Propidium Iodide using Flow cytometry in a BD FACS Canto II based assay platform. While the presence of TRAIL ligand clearly had a toxic effect (˜37.5% cell death) on the T cells, this TRAIL-induced cell death could circumvented (˜15% cell death) by expressing the DR5-41 BB chimeric receptor.

    [0188] It was thus shown that expression of the DR5-41BB chimera provides T cells with resistance against TRAIL-induced cell death.

    Example 11—Expression of DR5-41BB Chimera on NK Cells

    [0189] A DR5-41BB fusion protein (SEQ ID NO: 4) was expressed in primary expanded NK cells, in order to convert the apoptotic DR5 signal cascade into an active, stimulatory NK cell response.

    [0190] Primary expanded NK cells were cultured in the presence of NK cell expansion media from Miltenyi Biotec according to manufacturer guidelines for 12 days in the presence of 10% human AB serum. Cells were harvested during the logarithmic growth phase and transfected using mRNA electroporation under standard electroporation protocol. DR5-41BB mRNA was used at a concentration of 1 μg/μl in citrate buffer. Cells were washed once in buffer solution and subsequently concentrated at a density of 2×10.sup.6 cells/100 μl. Cells were either mock electroporated or electroporated with the DR5-41BB chimera at a final concentration of 7.5 μg/100 μl.

    [0191] Cells were immediately recovered post-electroporation in a 6 well plate and allowed to recover for 20 minutes at 37° C. After the incubation, cells were supplemented with NK cell MACS media (Miltenyi Bioctec) containing 10% human AB serum. Cells were allowed to recover and incubated at 37° C. for another 24 hours before the expression of the DR5-41BB chimera was analysed by flow cytometry.

    [0192] In brief, cells were washed with buffer containing PBS, Sodium Azide and 2% FBS. Subsequently, cells were re-suspended in an appropriate volume and stained with anti-DR5 antibody (Clone: DJR2-4, Source: Biolegend, Cat: 307406). Cells were then incubated with 2 μl of the antibody for 20 minutes on ice. Post-incubation, cells were washed twice to remove unbound antibody with buffer containing PBS, Sodium Azide and 2% FBS. Cells were finally re-suspended in 500 μl buffer containing PBS, Sodium Azide and 2% FBS and measured by flow cytometry on a BD FACS Canto II using the 488 nm blue laser and detecting the signal emitted using a 585/42 band pass filter. Results were analysed by FlowJo version X.

    [0193] FIG. 5 shows DR5 receptor expression (Mean MFI value: 208) in the mock electroporated NK cells, whereas FIG. 6 shows DR5 receptor expression (Mean MFI value: 608) in the DR5-41BB chimeric mRNA electroporated NK cells. Upon normalising the mock electroporated NK cells to a background MFI=0, it can be seen that the DR5-41BB specific expression (608 minus 208) is equal to 400 MFI units.

    [0194] It was thus shown that the DR5-41BB fusion protein can be successfully expressed in NK cells as well as T cells.

    [0195] The invention thus provides immune effector cells and cell lines that are resistant to TRAIL-induced cell death, and production thereof, for use in cancer therapy. This approach involves a combination of knocking down/out TRAIL receptors on immune effector cells to prevent fratricide by neighboring genetically modified immune effector cells expressing high affinity membrane bound TRAIL ligand. Furthermore, the knock-in of TRAIL receptors linked to co-stimulatory domains allows the immune effector cells to convert the fratricide inducing signals from neighboring immune effector cells into the activating signal transduction necessary for highly potent immune effector cell cytotoxicity.