SYNTHETIC PEPTIDE BRAP AND APPLICATION IN PREPARATION OF ANTI-INFLAMMATORY DRUG FOR COVID-19 THEREOF

Abstract

A synthetic peptide brap can be used in preparing an anti-inflammatory drug for COVID-19. The amino acid sequence of the synthetic peptide brap is as shown in SEQ ID No. 1. The synthetic peptide brap has significant target-docking and inhibiting effects on G-protein-coupled bradykinin B1 and B2 receptors; the intranasal administration of brap has local effects on allergic nasal inflammation, and has systemic pharmacodynamic effect on pulmonary leakage, lung injury and LPS-induced cytokine storm. The intravenous injection of brap has an obvious inhibiting effect on the excessive inflammation, oxidative stress response and serious lung injury emerging in LPS-induced mice; and has an obvious inhibiting effect on the excessive release of proinflammatory factors IL-6 and TNF-α, overexpression of IL-6 mRNA, and massive generation of reactive oxygen species (ROS) in the LPS-induced inflammatory factor storm.

Claims

1. A synthetic peptide brap, having an amino acid sequence of SEQ ID No: 1.

2. Application of the synthetic peptide brap according to claim 1, comprising: (1) preparation of a drug for inhibiting G-protein-coupled bradykinin (BK) B1 and B2 receptors; (2) preparation of an anti-acute lung injury drug; (3) preparation of an anti-inflammatory drug for COVID-19; and (4) preparation of an anti-allergic rhinitis drug.

3. The application according to claim 2, wherein the drug in any one of (1) to (4) is administered intravenously or intranasally.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIGS. 1A-1B show analysis on the amino acid composition of a synthetic peptide brap; FIG. 1A shows a graph of the amino acid composition of the synthetic peptide brap drawn by an amino acid analyzer; FIG. 1B is a diagram showing amino acid components of a standard used in amino acid detection of the synthetic peptide brap.

[0016] FIG. 2 shows a HPLC result of the synthetic peptide brap.

[0017] FIG. 3 shows an MS result of the synthetic peptide brap.

[0018] FIG. 4 shows a target-docking test of the synthetic peptide brap to a G-protein-coupled bradykinin B2 receptor.

[0019] FIGS. 5A-5B show the inhibit effect of the synthetic peptide brap on the bradykinin B2 receptor; FIG. 5A is the dose-response curve of the positive control bradykinin B2 receptor inhibitor HOE-140 of the synthetic peptide brap; FIG. 5B is the dose-response curve of the inhibitory effect of the synthetic peptide brap on the bradykinin B2 receptor.

[0020] FIGS. 6A and 6B show pharmacodynamic effect of the synthetic peptide brap in rate allergic nasal inflammation by intranasal administration; FIG. 6A is the score of allergic rhinitis, and B is the change of score before and after treatment.

[0021] FIGS. 7A-7B show significant inhibition of the synthetic peptide brap on BK-induced pulmonary microvascular leakage in guinea pigs through intranasal administration; FIG. 7A is the standard curve of OD value-EB concentration, and FIG. 7B is the EB content of lung tissue.

[0022] FIG. 8 shows the target docking of the synthetic peptide brap to the G-protein-coupled bradykinin B1 receptor.

[0023] FIGS. 9A-9B show the inhibitory effect of the synthetic peptide brap on the bradykinin B1 receptor; FIG. 9A is the dose-response curve of the bradykinin B1 receptor antagonist R892, and FIG. 9B is the dose-response curve of the inhibitory effect of the synthetic peptide brap on the bradykinin B1 receptor.

[0024] FIG. 10 shows that brap obviously decreases the remarkable increase of LPS-induced endotoxin level in blood.

[0025] FIG. 11 shows that brap obviously decreases the overexpression of LPS-induced IL-6 mRNA in lung tissue.

[0026] FIGS. 12A-12C show that brap obviously decreases the increase of the LPS-induced IL-6 level in blood; FIG. 12A is that LPS promotes the release of inflammatory factor IL-6; FIG. 12B shows an influence of the synthetic peptide brap on the release of the inflammatory factor IL-6 induced by LPS (5 mg/kg i.p.) for 6 h; FIG. 12C shows an influence of the synthetic peptide brap on the release of the inflammatory factor IL-6 induced by LPS for 12 h.

[0027] FIGS. 13A-13C show that brap obviously decreases the increase of TNF-α in the blood induced by LPS; FIG. 13A shows that LPS promotes a remarkable increase of inflammatory factor TNF-α content; FIG. 13B is the effect of the synthetic peptide brap on the release of an inflammatory factor TNF-α induced by LPS for 6 h; FIG. 13C is the effect of the synthetic peptide brap on the release of inflammatory factor TNF-α induced by LPS for 12 h.

[0028] FIGS. 14A-14G show a qualitative analysis of brap obviously reducing the increase in ROS content in lung tissues induced by LPS for 6 h.

[0029] FIG. 15 is a qualitative analysis of brap obviously reducing the increase in ROS content in lung tissue induced by LPS for 12 h.

[0030] FIGS. 16A-16H show that brap obviously protects lung injury induced by LPS; FIG. 16A is the normal control group; FIG. 16B is the LPS model group; FIG. 16C is the sp2 group; FIG. 16D is the brap intravenous administration high-dose group; FIG. 16E is the brap intravenous administration-middle-dose group; FIG. 16F is the brap intravenous administration low-dose group; FIG. 16G is the brap intranasal administration group; and FIG. 16H is dexamethasone model group (a positive control group).

DETAILED DESCRIPTION OF THE INVENTION

[0031] The non-limiting examples below can render a person skilled in the art to understand the present invention more comprehensively, but cannot be used to limit the present invention in any way.

Example 1 Test on the Amino Acid Composition of the Synthetic Peptide Brap

[0032] 10 mg sample was accurately weighed and put in a hydrolysis tube, and 20 ml of 6 mol/L hydrochloric acid was added, which was treated in vacuum for degasification, then nitrogen was loaded and the tube was sealed. Hydrolysis was performed for 22-24 h at 110° C., and after cooling, the solution was adjusted to a constant volume by deionized water, and mixed evenly. 1 mL hydrolysate was taken accurately and dried in vacuum, and 1 mL deionized water was added for drying by distillation, then 1 mL deionized water was then added for drying by distillation, and 1 mL 0.02 mol/L hydrochloric acid was added accurately for redissolving. The obtained product was filtered by a 0.22 μm filter membrane and tested on an analyzer (HITACHI L-8900 amino acid analyzer).

[0033] The test results are showed in Table 1 and FIGS. 1a and 1b.

TABLE-US-00001 TABLE 1 The amino acid composition and content of the synthetic peptide brap Sample Test item Test result unit Test method Synthetic ASP (aspartic  8.58 g/100 g amino acid analyzer peptide acid) brap THR not detected g/100 g amino acid analyzer (threonine) SER (serine) not detected g/100 g amino acid analyzer GLU (glutamic  9.39 g/100 g amino acid analyzer acid) GLY (glycine)  5.10 g/100 g amino acid analyzer ALA (alanine) 12.09 g/100 g amino acid analyzer CYS (cystine) not detected g/100 g amino acid analyzer VAL (valine)  7.30 g/100 g amino acid analyzer MET not detected g/100 g amino acid analyzer (methionine) ILE not detected g/100 g amino acid analyzer (isoleucine) LEU (leucine)  8.69 g/100 g amino acid analyzer TYR (tyrosine) not detected g/100 g amino acid analyzer PHE not detected g/100 g amino acid analyzer (phenylalanine) LYS (lysine) not detected g/100 g amino acid analyzer HIS (histidine) not detected g/100 g amino acid analyzer ARG (arginine) 12.25 g/100 g amino acid analyzer PRO (proline) 18.36 g/100 g amino acid analyzer

[0034] It can be seen from Table 1 and FIG. 1 that the synthetic peptide brap is-composed of 8 amino acids.

Example 2 Synthetic Process, HPLC Purification and Mass Spectrum Identification of the Synthetic Peptide Brap

[0035] The technique was provided by China Peptides Co., Ltd.

[0036] Synthetic procedure: from C-terminal to N-terminal of the sequence, steps were as follows:

[0037] a. n equivalents of resin (solid-phase synthesis carrier) was weighed and put in a reactor, and DCM (dichloromethane) was added for swelling for half an hour, then DCM was removed; 2n equivalent first amino acid in the sequence was added, and 2n equivalent DIEA, a proper amount of DMF and DCM (a proper amount refers to bubbling the resin fully); DIEA (diisopropylethylamine), DMF (dimethylformamide), DCM and N.sub.2 were added for bubbling reaction for 60 min; then, about 5n equivalent methyl alcohol was added for reacting for half an hour, and reaction liquid was removed; and the obtained product was cleaned by DMF and MEOH;

[0038] b. a second amino acid in the sequence (namely, 2n equivalent), 2n equivalent HBTU (1-hydroxy, benzo, trichloroazole tetramethyl hexafluorophosphate), DIEA, and N.sub.2 were added for bubbling reaction for half an hour; then liquid was washed out, and ninhydrin was used to test, then end-capping was performed by pyridine and acetic anhydride; finally, the obtained product was cleaned, a proper amount of de-capping solution was added to remove a Fmoc (9-fluorenylmethoxycarbonyl) protecting group, and the obtained product was cleaned and detected by ninhydrin;

[0039] c. different amino acids in the sequence were successively added according to the way of step b;

[0040] d. a resin was blown-dried by N2 and taken from a reaction column, then poured into a flask, then a certain amount of (a ratio of the cutting fluid to the resin was about 10 ml/g) cutting fluid (composed of 95% TFA, 2% dithioglycol, 2% triisopropylsilane and 1% water) was added to the flask, and vibrated to filter out the resin;

[0041] e. a filtrate was obtained, and then a large amount of ether were added to the filtrate to precipitate the crude product, then to centrifuge and wash to obtain the crude product of the sequence shown in SEQ ID No: 1;

[0042] The obtained crude product was purified by HPLC, the peptide was lyophilized and detected; and then product identification was performed by mass spectrum. HPLC was shown in FIG. 2; the synthetic peptide brap has a purity of 99.72%; mass spectrum was shown in FIG. 3; the synthetic peptide brap has a theoretical molecular weight of 1023.17; that is, the molecular weight was correct by mass spectrum identification.

Example 3 Docking and Binding Modes of a Bradykinin B2 Receptor (B2R) Target to Brap

[0043] The technique was provided by Nanjing OGPharmaceutical.CO., Ltd.

[0044] NCBI Blast was used for PDB library-based sequence alignment to a B2 receptor (B2R) of Bradykinin (BK); 5UNF having a good sequence similarity and percentage of coverage was selected as a template. A homologous modeling block Prime of Schrodinger software package was used for 3D structure modeling of B2R. Based on the modeling parameters, different files capable of obtaining two B2R structures were set; and to ensure the rationality and repeatability of the subsequent docking, they were a knowledge-based receptor structure and an energy-based receptor structure. Further, MDockPeP was used to dock the synthetic peptide brap onto the two receptor structures; and two docking tests were performed in total. In the docking test, the binding positions of the synthetic peptide brap were distributed in the middle of an open pocket composed of transmembrane helixes of a receptor protein (FIG. 4).

Example 4 Detection of an Inhibiting Effect of the Brap to Bradykinin B2 Receptor by an Intracellular Calcium Ion Fluorescent Technique

[0045] The technique was provided by Wuhan Heyan Biotech Co., Ltd.

[0046] HEK293/G15/Bradykinin2 (B2R) Experimental Method: Detection of an Inhibiting Effect of the Synthetic Peptide Brap to Bradykinin B2 Receptor by an Intracellular Calcium Ion Fluorescence Technique

[0047] Step 1. the HEK293/G15/Bradykinin2 cells whose growth confluence reached 80% were digested with trypsin and counted; the cell were plated at density of 2×10.sup.4/mL per well on a transparent black-edging 384-well cell culture plate coated with matrigel in advance;

[0048] Step 2. the paved 384-well cell culture plate was put in a 5% CO.sub.2 37° C. incubator for overnight culture;

[0049] Step 3. the compound synthetic peptide brap was dissolved by HBSS into a 30 mM stock solution on the day of the experiment;

[0050] Step 4. 10 μL 4 X no-wash Fluo8 dye was added per well for incubation for 1 h at room temperature;

[0051] Step 5. during cell incubation, the compound to be detected was diluted 5 folds by HBSS containing 0.1% BSA; a positive inhibitor has an initial concentration of 10 μM.

[0052] Step 6. EC10, EC20 and EC80 represented different stimulus intensity to the B2 receptor;

[0053] Step 7. the prepared compound to be detected was added to a cell culture plate, and put in FLIPR for data recording.

[0054] As shown in FIGS. 5a and 5b, results show that the test curve is smooth and is a distinct s-curve; and IC50 is at 1 mM around.

Example 5 Test on Pharmacodynamic Effect of the Synthetic Peptide Brap on Rat Allergic Nasal Inflammation by Intranasal Administration

[0055] The technique was provided by Shanghai Meixuan Biological Science and Technology Co., Ltd.

[0056] I. Preparation of an Animal Model

[0057] 1. Modeling Method:

[0058] SD rat modeling: two stages of intraperitoneal injection for sensitization and intranasal dripping for stimulation. Ovalbumin was injected intraperitoneally, and 1 mg ovalbumin (V-class Sigma, USA) was dissolved in 1 ml normal saline, and 30 mg of aluminum hydroxide was added as an immunologic adjuvant. Each rat was intraperitoneally injected 1 ml ovalbumin suspension prepared above with 1 ml/time every other day and for 7 times in total; and stimulated intranasally with ovalbumin on the 15.sup.th day; 20 mg ovalbumin (V-class Sigma, USA) were dissolved in 1 ml normal saline to be prepared into a 2% solution; and the 2% ovalbumin solution was used for stimulation by nasal dripping; and 50 ul nasal drips were administered in each of the nasal cavities of each rat for 7 consecutive days.

[0059] Blank control group: 30 mg of aluminum hydroxide+1 ml of normal saline were mixed evenly, and then injected intraperitoneally; and the method was the same as the above.

[0060] Normal saline was dripped into nasal cavities on the 15.sup.th day.

[0061] 2. Symptom Assessment

[0062] After the final nasal dripping was performed, each rat was observed and evaluated according to a scoring table: Sneezing, nose scratching, gasping and nasal secretions

[0063] II. Animal Model Treatment and Evaluation

[0064] 1. Administration way: a drug was administered with a micro-sampling gun, bilateral nasal cavities of a rat were administered with 50 μL/side, after being administered for 20 min, a 2% ovalbumin solution was administered to bilateral nasal cavities of the rat; 50 μL/side nasal dripping was administered for provocation; the above treatment was performed for 4 consecutive weeks to observe the pharmacodynamic effect.

[0065] 2. Medicament Preparation

[0066] High-dose synthetic peptide brap: a synthetic peptide brap freeze-dried powder (5 mg/bottle) was taken, and 1.63 ml sterile saline solution was added for dissolving;

[0067] medium-dose synthetic peptide brap: a synthetic peptide brap freeze-dried powder (5 mg/bottle) was taken, and 4.89 ml sterile saline solution was added for dissolving;

[0068] low-dose synthetic peptide brap: a synthetic peptide brap freeze-dried powder (5 mg/bottle) was taken, and 14.67 ml sterile saline solution was added for dissolving;

[0069] meanwhile, high-dose synthetic peptide sp2 group and medium-dose synthetic peptide sp2 group were configured as control groups; the high-dose synthetic peptide sp2 group had a concentration the same as that of the high-dose synthetic peptide brap group; and the medium-dose synthetic peptide sp2 group had a concentration the same as that of the medium-dose synthetic peptide brap group. The synthetic peptide sp2 had an amino acid sequence as shown in SEQ ID No: 2.

[0070] 3. Symptom Assessment

[0071] After being challenged by the final OVA, the rat was scored. Experimental results were as shown in FIGS. 6A and 6B; FIG. 6A shows pharmacodynamic effect scoring of the synthetic peptide brap on allergic rhinitis rats; and the experiment results show that compared with the model group, the high, medium and low-dose synthetic peptide brap can improve the OVA-induced allergic rhinitis symptoms; moreover, the scoring has significance of difference, which hints that the synthetic peptide brap has a good therapeutic effect on allergic rhinitis. FIG. 6B shows scoring changes on rats before and after treatment; rats in the model group were continuously stimulated by OVA, the scoring rises sharply; and the rat mortality increases continually (the mortality is 2/54=3.7% during modeling, and the mortality is 2/8=25% in the therapeutic period of the later administration); after receiving the treatment of the medium-dose group and high-dose group of the synthetic peptide sp2, the scoring thereof increases as well, which hints that the synthetic peptide sp2 cannot completely counteract the negative effects from the OVA simulation; after receiving the treatment of the high, medium, and low-dose group of the synthetic peptide brap, the scoring thereof decreases, which hints that the synthetic peptide brap completely counteracts the OVA simulation effect during the period of treatment, and has a certain effect on the recovery of the rat.

Example 6 Influence of Nasal Administration of Synthetic Peptide Brap on BK-Induced Pulmonary Microvascular Leakage in Guinea Pigs

[0072] The technique was provided by Shanghai Meixuan Biological Science and Technology Co., Ltd.

I. Animal Grouping and Treatment

[0073] Male guinea pigs weighing 400 g±5% were randomly divided into 6 groups, 6 per group.

[0074] 1. normal control group: an equal volume of normal saline was injected intravenously on the lateral foot vein, for 3 days;

[0075] 2. model group: an equal volume of normal saline was injected intravenously on the lateral foot vein, for 3 days;

[0076] 3. positive control group: 1.25 mg/3 ml/kg BW dexamethasone was injected intravenously on the lateral foot vein, for 3 days;

[0077] 4. high-dose synthetic peptide brap group: bilateral nasal cavities of the guinea pig were injected the synthetic peptide brap having a concentration of 3.0 mM/L by a micro-sampling gun with 50 μL/side/day for 3 days;

[0078] 5. medium-dose synthetic peptide brap group: bilateral nasal cavities of the guinea pig were injected the synthetic peptide brap having a concentration of 1.0 mM/L by a micro-sampling gun with 50 μL/side/day for 3 days;

[0079] 6. low-dose synthetic peptide brap group: bilateral nasal cavities of the guinea pig were injected the synthetic peptide brap having a concentration of 0.33 mM/L by a micro-sampling gun with 50 μL/side/day for 3 days.

II. Detection of Guinea Pig Pulmonary Leak

[0080] 1. The guinea pig was administered for 3 days, and 20 min after the last administration, 1% EB (20 mg/kg) and 15 nmoL/kg bradykinin (diluted to 10 nmoL/mL by normal saline, namely, 15 nmoL/kg based on 1.5 mL/kg weight) were successively injected intravenously on the lateral side of foot; and the guinea pig in the normal group were not injected with EB and bradykinin.

[0081] 2. Measurement of EB in lung tissue: after bradykinin was injected for 30 min, an animal was narcotized and killed by taking blood on the carotid artery for blood routine examination; thoracic cavity was opened to cut ventriculus dexter and left atrium; pulmonary artery intubation was performed; 30 mL normal saline was used for guinea pig pulmonary circulation till effluent was clear. Inferior lobe of right lung was taken out, and blood on the surface thereof was washed by normal saline to suck water dry by a filter paper; 100 mg were taken and cut into pieces; placed in a 2 mL formamide solution for incubation in a water bath for 24 h at 45° C. The solution was centrifuged for 5 min at 1500 rpm/min; supernatant was taken to measure the absorbance with a wavelength of 620 nm. The content of EB in lung tissues was obtained by an EB standard curve (as shown in FIG. 7A), as shown in FIG. 7B.

[0082] 3. Preparation of an EB standard curve: 0.1 mL 0.1% EB solution was taken accurately and added 0.9 mL normal saline to be prepared into 1 mL 0.01% EB standard solution; 0.1 mL EB standard solution was taken and added formamide to 2 mL with a final concentration of 5 mg/L; then the solution was diluted by formamide to 4, 2, 1, and 0.5 mg/L. An absorbancy OD value was measured at a wavelength of 620 nm; OD value was denoted y-coordinate; EB concentration was denoted by x-coordinate; then a standard curve of OD value-EB concentration was drawn, as shown in FIG. 7A.

III. Experimental Analysis

[0083] 1. Evans blue (EB) may be combined with albumin; EB exudation reflects the exudation condition of a protein; the content of EB leaking from lung tissues is measured to reflect the degree of the pulmonary microvascular permeability and the degree of pulmonary microvascular leakage. Compared with the normal control group, the content of EB lung tissues of the model group increases significantly (** indicates P<0.01); the content of EB in lung tissues of the low, medium, and high-dose groups of the synthetic peptide brap is obviously lower than that in the model group (P<0.01); and there is a dose-response relationship. Compared with the positive control group, there is no significant difference ({circumflex over ( )}{circumflex over ( )}indicates P>0.05) except for the low-dose group.

[0084] 2. Compared with the normal control group, the content of EB in lung tissues of the model group increases significantly (** indicates P<0.001); the content of EB in lung tissues of the low-, medium-, and high-dose groups of the synthetic peptide brap is obviously lower than that in the model group (P<0.01); there is a dose-response relationship. Compared with the positive control group, there is no significant difference ({circumflex over ( )}{circumflex over ( )} indicates P>0.05).

Example 7 Docking and Binding Modes of a Bradykinin B1 Receptor Target to the Brap

[0085] The technique was provided by Nanjing OGPharmaceutical. Co., Ltd.

[0086] 1. NCBI Blast was used to select a B1 receptor (B1R) template of Bradykinin (BK); and based on the sequence alignment of PDB library, 5UNF having a good sequence similarity and percentage of coverage was selected as a template.

[0087] 2. A homologous modeling block Prime of Schrodinger software package was used for 3D structure modeling of B1.

[0088] Based on the modeling parameters, different files capable of obtaining two B2R structures were set; they were a knowledge-based receptor structure and an energy-based receptor structure.

[0089] 3. MDockPeP was used to dock the synthetic peptide brap onto the two receptor structures; and two docking tests were performed in total.

[0090] 4. The optimal binding mode in the docking test was subjected to interactive brap-receptor energy decomposition, which reveals the energy contribution of amino acid residues in the synthetic peptide brap and the binding mode to the B1 receptor.

[0091] {circle around (1)} Homology modeling of a B1 receptor structure of Bradykinin (BK)

[0092] The sequence of the B1 receptor was downloaded from a uniprot library to obtain the sequence of the B1 receptor in homologous modeling, as shown in SEQ ID No: 7.

[0093] {circle around (2)} Molecular docking of a Bradykinin (BK) B1 receptor to the synthetic peptide brap:

[0094] MDockPeP was used for the docking of a B1 receptor protein with a structure of brap.

[0095] brap is a 10-peptide compound composed of 8 kinds of amino acids.

[0096] In the diagram, green denotes receptor protein molecules, and blue denotes molecules of the synthetic peptide brap.

[0097] {circle around (3)} Energy contribution of each residue on the synthetic peptide brap was calculated in Model to further study interacting residues between

[0098] B1 (a receptor) and brap (a ligand); for each residue on brap, the receptor residue within a range of distance less than 4 Å was defined as a contact residue. Based on this, energy contribution of each residue on brap was calculated.

[0099] In the diagram, green denotes receptor protein molecules, and light blue denotes brap molecules.

[0100] The synthetic peptide brap is bonded into a receptor pocket in U-shaped.

Example 8 Inhibitory Effect of the Synthetic Peptide Brap on a Bradykinin B1 Receptor

[0101] The technique was provided by Wuhan Heyan Biotech Co., Ltd.

[0102] 1. Experimental method of HEK293/G15/Bradykinin1:

[0103] Cell Resuscitation:

[0104] HEK293/Ga15/B cells to be resuscitated were rapidly taken from a liquid nitrogen container and thawed in a water bath at 37° C. A cell suspension was rapidly added to a preheated DMEM+10% FBS culture medium, and the medium was put to a centrifugal machine for centrifugation for 5 min at 1000 rpm. A centrifugal tube was removed, and supernate was discarded; a fresh preheated culture medium was added to the centrifugal tube to resuspend cells, and a cell suspension was added to a petri dish for culture at 37° C. under the condition of 5% CO.sub.2.

[0105] Cell passage HEK293/Ga15/B1 cells stably expressing the B1 receptor were cultured in DMEM+10% FBS; cell culture conditions: routine culture of HEK293/Ga15/B1 cell line, cells were subcultured on a medium containing 10% fetal calf serum and DMEM.

[0106] The cells were digested by 0.25% trypsin when grew 80-90% of the petri dish; and cells were resuspended by a new culture medium and subcultured in a proper proportion for once about 2-3 d.

Experimental Procedure

[0107] 1. HEK293/G15/Bradykinin1 cells whose growth confluence up to 80% were digested by trypsin and counted; then paved onto a transparent black-edging 384-well cell culture plate coated by matrigel in advance according to a density of 2×10.sup.4/mL per well.

[0108] 2. The paved 384-well cell culture plate was put in a 5% CO.sub.2 37° C. incubator for culturing, staying over the night.

[0109] 3. On the day of the experiment, the compound synthetic peptide brap was dissolved into a 30 mM stock solution with HBSS.

[0110] 4. 10 μL 4 X no-wash Fluo8 dye was added per 384-well plate for incubation for 1 h at room temperature.

[0111] 5. During cell incubation, the compound to be detected was diluted 5 folds by HBSS containing 0.1% BSA. A positive inhibitor has an initial concentration of 10 μM.

[0112] 6. EC10 had a final stimulation concentration of 0.3 nM; EC20 had a final stimulation concentration of 0.6 nM; and EC80 irritant had a final concentration of 18 nM.

[0113] 7. The prepared compound was added to a cell culture plate for data recording in FLIPR.

[0114] Experimental results were as shown in FIGS. 9A and 9B. A Bradykinin mixed solution (brap+Vehicle, brap+EC10 and brap+EC20) was added to a cell line, and then continuously incubated for 15 min, then an EC80 irritant was added to test the inhibitory activity of the compound.

[0115] The results show that brap and EC80 work together, and there is an obvious S-shaped curve, indicating that the excessive activation of the B1 receptor is obviously inhibited; the compound both acting together with EC10 and EC20 has no obvious effect; it is speculated that the previous reaction has released too many calcium ions, which cannot cause a secondary signal within a short period of time.

Example 9 Protective Effect of the Synthetic Peptide Brap on LPS-Induced Acute Lung Injury in Mice

[0116] The technique was provided by Shanghai Meixuan Biological Science and Technology Co., Ltd.

I. Animal Grouping and Treatment

[0117] 1. Grade-SPF male Balb/C mice, body weight: 20±2 g, and n=48

[0118] 2. Feeding conditions: mice were fed in SPF aseptic conditions, alternatively illuminated for 12 h and supplied adequate food and water in a constant-temperature environment at 25° C.

[0119] 3. Grouping and treatment: mice were randomly divided into 8 groups (A-H), 6 pcs./group;

[0120] 3-1: 3 different treatments were given for 3 consecutive days respectively before modeling:

[0121] A. normal control group: normal saline was injected via the tail vein for once/day;

[0122] B. LPS model group: normal saline was injected via the tail vein for once/day;

[0123] C. model sp2 administration group: sp2 (16 mg/kgBW) was injected via the tail vein for once/day;

[0124] D. model high-dose brap administration group: brap (16 mg/kgBW) was injected via the tail vein for once/day;

[0125] E. model medium-dose brap administration group: brap (8 mg/kgBW) was injected via the tail vein for once/day;

[0126] F. model low-dose brap administration group: brap (4 mg/kgBW) was injected via the tail vein for once/day;

[0127] G. model brap intranasal administration group: brap (3 mM) was administered nasal administration on both sides, 15 μl/each side; once a day;

[0128] H. model dexamethasone administration group (a positive control group): dexamethasone, DEX, 5 mg/kg was injected intraperitoneally for once a day.

[0129] 3-2. The day of the experiment, that is, the day of modeling:

[0130] Animals from groups A-H were continuously administered the above treatments for 30 min respectively, then group A was intraperitoneally injected isopyknic normal saline, and other groups were intraperitoneally injected LPS 5 mg/kgBW.

II. Pathological Examination for HE Dyeing of Lung Tissues

Experimental Steps

[0131] 1. Tissue section and extending

[0132] 2. Tissues were dewaxed and hydrated.

[0133] 3. Tissues were dyed with a hematoxylin stain for 5-20 min (adjusted according to different tissues and experimental requirements), and washed by tap water.

[0134] 4. Then, tissues were differentiated by a differentiation solution for 30 s.

[0135] 5. Tissues were soaked by tap water for 15 min or warm water (about 50° C.) for 5 min.

[0136] 6. Tissues were put in an Eosin stain for 2 min (adjusted according to different tissues and experimental requirements), and washed by tap water.

[0137] 7. Then, the tissues were soaked by tap water for 5 min.

[0138] 8. Dehydration by gradient alcohol: Tissues were dehydrated by 95%, 100% I, and 100% II for 1 min each;

[0139] 9. Transparency by xylene: tissues were subjected to xylene I and II for 10 min.

[0140] 10. Neutral balsam mounting.

[0141] 11. Then, it was put and dried in an oven at 60° C., and observed under microscope.

[0142] Experimental results were as shown in FIGS. 16A-16H.

[0143] Result Analysis:

[0144] Model group: thickened pulmonary septum, inflammatory cell infiltration, and focal fusion of pulmonary septum were seen. No abnormality can be seen in the high-dose brap intravenous administration group (D) and brap intranasal administration group (G).

[0145] FIG. 16B shows a comparison between an LPS model group and a normal control group (FIG. 16A); thickened pulmonary septum, inflammatory cell infiltration, and focal fusion of pulmonary septum were seen. FIG. 16C is an LPS+synthetic peptide sp2 group, and inflammatory cell infiltration is obvious; FIG. 16D is a high-dose LPS+brap group, no thickened pulmonary septum and no obvious inflammatory cell infiltration are found; groups E and F are respectively medium and low-dose groups of LPS+brap; with the decrease of the brap dose, inflammatory cell infiltration begins to appear; group G is an intranasal administration group which is similar to group D, no obvious abnormality is found; group H is a dexamethasone positive control group, inflammatory cell infiltration is more obvious, and no focal fusion of pulmonary septum is found.

Example 10 Detection of Endotoxin Content in a Blood Sample

[0146] Detection of Endotoxin Content in a Blood Sample

[0147] 1. Instrument

TABLE-US-00002 Instrument Manufacturers Item No. multifunctional microplate Beijing Perlong DNM-9602 reader

[0148] 2. Reagent

TABLE-US-00003 Reagent Manufacturers Item No. Endotoxin test LAL kit Xiamen Bioendo Technology Co., EC80545 Ltd

Experimental Steps

[0149] The detection was performed according to the specification of the endotoxin test LAL (Limulus Amebocyte Lysate) kit:

[0150] (1) anticoagulant venous blood of each group of mice constructed in example 9 was taken and centrifuged for 2 min at 3000 rpm/min; 100 ul supernate was taken and added to a 0.9 ml sample treating fluid;

[0151] (2) the above sample was put in a 70° C. dry-heat sterilization box for 10 min, then cooled by running water;

[0152] (3) concentration gradient of an endotoxin standard was 1.0, 0.5, 0.25 and 0.1 EU/ml;

[0153] (4) several endotoxin-free test tubes were taken, and 100 ul water for detecting bacterial endotoxin, an endotoxin standard and a test product were added respectively;

[0154] (6) 100 ul TAL solution was added, mixed evenly, and covered by a silver paper, and incubated for 10 min at 37° C.;

[0155] (7) 100 ul developing-matrix solution was added, mixed evenly, and incubated for 6 min at 37° C.;

[0156] (8) 500 ul azo reagent 1 was added and mixed evenly;

[0157] (9) 500 ul azo reagent 2 was added and mixed evenly;

[0158] (10) 500 ul azo reagent 3 was added, mixed evenly, standing for 5 min;

[0159] (11) OD value was measured at 545 nm.

[0160] Experimental results were as shown in FIG. 10. Compared with the normal group, after LPS 5 mg/kg BW were intraperitoneally injected for 6 h, the endotoxin level in mice blood increases significantly; and there was significance of difference; and compared with the model group, the blood endotoxin level in low, medium and high-dose synthetic peptide brap groups was obviously below that in the model group; and there was a dose-response relationship.

Example 11 Detection of IL6 mRNA Expression in Lung Tissues with qPCR

Experimental Steps

[0161] Reagent

TABLE-US-00004 Reagent Manufacturers Item No. RNA Extraction kits Shanghai Meixuan Biological MX0015 (magnetic bead method) Science and Technology Ltd RT reagent Kit Takara RR047A SYBR Premix Ex Taq Shanghai Meixuan Biological MX200017 Science and Technology Ltd Nuclease-free water Ambion cat#AM99386 Ethyl alcohol Sinopharm Chemical Reagent AR10009218 Co., Ltd (analytically pure) Trichloromethane Shanghai Chemical Reagent Reagent 2006- Factory No.1 06-08

[0162] 1. Sample preparation

[0163] 1.1 Lung tissue sample: a fresh lung tissue sample from each group of mice constructed in example 9 was taken and quick-frozen by liquid nitrogen as quickly as possible, and kept at −8° C.

[0164] 2. Extraction of total RNA (a total RNA extraction kit via a paramagnetic particle method was used)

[0165] 2.1 The tissue sample was cut into small pieces, and ground (50 mg) to powder via liquid nitrogen, and transferred to a 1.5 ml tube free of RNA enzyme (cell sample and other liquid samples required no grinding, and were directly put to the next step).

[0166] 2.2 Total RNA extraction

[0167] 3. qPCR reaction

[0168] Using the operational method of Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System and StepOnePlusTMReal-Time PCR System

[0169] 1. Preparation of a PCR reaction liquid

TABLE-US-00005 Reagent Use amount SYBR ® Premix Ex Taq 10.0 μl Enzyme mixture  2.5 μl PCR Forward Primer (10 μM)   1 μl PCR Reverse Primer (10 μM)   1 μl PCR reverse transcription Primer (10 uM)  0.5 μl RNA template  2.0 μl dH.sub.2O (sterile purified water)  3.0 μl Total 20.0 μl

[0170] 2. Real Time PCR reaction was performed.

[0171] 3. Experimental result analysis.

[0172] At the end of the reaction, an amplification curve and dissociation curve of Real Time

[0173] PCR were confirmed, and 2.sup.−ΔΔct and the like were calculated.

TABLE-US-00006 4. Primer sequence Gene Forward primer Reverse primer IL6 SEQ ID No: 3: SEQ ID No: 4: CCACCGGGAACGAAAGAGAA GAGAAGGCAACTGGACCGAA GAPDH SEQ ID No: 5: SEQ ID No: 6: GACAGCCGCATCTTCTTGTG AATCCGTTCACACCGACCTT

[0174] Experimental results were as shown in FIG. 11, and the results show that either intravenous injection or intranasal administration of the synthetic peptide brap can obviously decrease the overexpression of the IL-6 mRNA in LPS-induced mice lung issues.

Example 12 Detection of Cytokine Content in Blood Serum

[0175] Reagent

TABLE-US-00007 Reagent Manufacturers Item No. Mouse TNFa elisa kit MEXN M0047 Mouse IL6 elisa kit MEXN M0042

Experimental Steps

[0176] 1. A reagent was taken out of a kit and balanced for 30 min at room temperature;

[0177] 2. standard wells and sample wells were set, and 50 ul standards at different concentrations were respectively added to each standard well.

[0178] 3. 50 ul sample to be tested (blood sample from each group of mice model constructed in example 9) was first added to the wells of the sample to be tested;

[0179] 4. 100 ul HRP-labeled detection antibody was respectively added to each standard well and well to be tested;

[0180] 5. reaction wells were sealed by a microplate membrane for incubation for 60 min at 37° C.;

[0181] 6. liquid was discarded, water was dried by an absorbent paper, each well was filled with scrubbing solution, standing for 1 min;

[0182] 7. a culture solution was discarded, water was dried by an absorbent paper, and steps 2-6 were operated repeatedly for 5 times;

[0183] 8. 50 ul substrate A/B was respectively added to each well for incubation for 15 min at 37° C.;

[0184] 9. 50 ul stop buffer was added to each well to detect an OD value at 450 nm by an microplate reader within 15 min.

[0185] Experimental results were as shown in FIGS. 12A-12C and 13A-13C:

[0186] 1. Compared with the normal group, TNF-a and IL-6 level in the LPS (5 mg/kg BW, intraperitoneal injection)-induced mice serum enhance significantly, and there is significance of difference (** denotes p<0.01);

[0187] 2. compared with the model group, there is a dose-response relationship ({circumflex over ( )}{circumflex over ( )}denotes p<0.01) in the TNF-a and IL-6 level in serum of low, medium and high-dose brap intravenous injection groups; brap nasal dripping group can decrease the TNF-a and IL-6 level in LPS-induced blood at 12 h, P<0.05.

Example 13 Detection of ROS Fluorescence Intensity in Each Lung Tissue by a Flow Cytometry

Experimental Steps

[0188] 1. About 100 mg fresh left lung tissue from each group of mice constructed in example 9 was taken and washed for three times with PBS to remove blood;

[0189] 2. the tissue was put in a nylon net, ground by a grinding rod, and washed by PBS;

[0190] 3. a cell suspension was collected, and filtered by a 200-mesh sieve to remove tissue blocks;

[0191] 4. the cell suspension was collected and centrifuged for 5 min at 1000 rpm/min;

[0192] 5. cellular supernatant was removed and PBS was added for resuspending;

[0193] 6. 10 μmol/L DCFH-DA was prepared with a serum-free culture solution;

[0194] 7. cells were centrifuged to remove PBS, and the above probe diluent was added to make the cell concentration being 10.sup.6/ml;

[0195] 8. the cells were incubated for 30 min at 37° C., and shaken off for once every 3 min;

[0196] 9. the cells were centrifuged for 5 min at 1000 rpm/min, and cell precipitates were resuspended on a serum-free culture medium;

[0197] 10. step 9 was repeated for twice;

[0198] 11. 500 μL PBS was added to resuspend cells, and flow cytometry was used to detect mean fluorescence intensity.

[0199] Experimental results were as shown in FIGS. 14A-14G, and FIG. 14A denotes a normal control group, FIG. 14B denotes an LPS model group (5 mg/kg BW, intraperitoneal injection); FIG. 14C denotes LPS+16 mg/kg BW synthetic peptide brap, FIG. 14D denotes LPS+8 mg/kg BW synthetic peptide brap, FIG. 14E denotes LPS+4 mg/kg BW synthetic peptide brap; FIG. 14F denotes LPS+synthetic peptide brap (intranasal injection on both sides for 15 μL/side/day); and FIG. 14G denotes a positive control group (LPS+dexamethasone 5 mg/kg, intraperitoneal injection).

[0200] FIG. 15 denotes detection of ROS mean fluorescence intensity in each group of mice lung tissue by a flow cytometry

Example 14 Limit Test on Intravenous Injection of Brap with 2000 mg/kg BW Dose Level

[0201] The technique was provided by Shanghai Meixuan Biological Science and Technology Co., Ltd.

I. Test Animal (Subject): Konmin Mouse: Healthy, Adult, Male, Weight≤20 g, and n=5 pcs

II. Test Sample: Synthetic Peptide Brap

[0202] 1. Lot No.: 04010039572, and synthesized by China Peptides Co., Ltd.

[0203] 2. Content: The sample was sub-packaged accurately into 5 mg/bottle× 8 bottles (for the first mouse), and 8 mg/bottle×20 bottles (for the other 4 mice), and not weighed any more;

[0204] 3. Storage condition: The sample was kept at −20° C.;

[0205] 4. Sample purity: Purity was detected >99.49% by HPLC.

[0206] 5. Preparation method: a synthetic peptide freeze-dried powder was taken out at −20° C., and put for recovery at room temperature, and then 1.5 ml normal saline was added for oscillation to be dissolved fully.

III. Administration Route and Dose: 2000 mg/kg BW was Injected Via a Tail Vein

IV. Administration Mode

[0207] Administration capacity: the maximum injection capacity of the mice tail vein was 0.5 ml/once, slow injection

[0208] Dose and mode of administration: 40 mg/1.5 ml working solution was administered for 3 times within 9 h.

V. Experimental Steps

[0209] 1) a test substance (synthetic peptide brap) having a dose of 2000 mg/kg was injected to the first Konmin mouse via tail vein;

[0210] 2) whether of causing toxic responses (initial symptom, starting time, namely, time period after administration, severity and duration) was observed and recorded;

[0211] 3) if the animal died, the response before being at death's door and the occurrence time of death were recorded.

TABLE-US-00008 TABLE 2 Limit test on intravenous injection of the synthetic peptide brap with a 2000 mg/kg BW dose level The volume (ml) of the synthetic peptide brap was Death calculated by mice body situation/survival weight: animals Dose: 2000 mg/kg BW, Toxic Response before Dissolving by 40 mg/1.5 Times of response reaction: ml/20 g BW, administration manifestation Occurrence time The administration volume as Administration Occurrence of death after Animal calculated by body weight: for 3 times time of the administration: Body The administration volume within 24 h (at symptoms: 72 h after Animal weight per day (ml) = 0.075 ml/g * intervals of 3-4 Severity: administering the No. (g) body weight (g) h); Duration: survival animals: 1 19.4 g 5 mg*8 bottles were diluted At 9:00, 13:00 No abnormal No death to 1.5 ml. and 16:00 response Injection 3 times for 1.455 ml, and 0.485 ml/times. 2 20.3 g 8 mg*8 bottles were diluted At 9:00, 13:00 No abnormal No death to 6 ml. and 16:00 response Injection 3 times for 1.523 ml, and 0.508 ml/times. 3 20.5 g 8 mg*20 bottles were diluted At 9:00, 13:00 No abnormal No death to 6 ml. and 16:00 response Injection 3 times for 1.538 ml, and 0.513 ml/times. 4 20.0 g 8 mg*20 bottles were diluted At 9:00, 13:00 No abnormal No death to 6 ml. and 16:00 response Injection 3 times for 1.50 ml, and 0.50 ml/times. 5 19.7 g 8 mg*20 bottles were diluted At 9:00, 13:00 No abnormal No death to 6 ml. and 16:00 response Injection 3 times for 1.50 ml, and 0.50 ml/times.

[0212] Result judgment: if the number of the survival animals is ≥3, LD50 is greater than 2000 mg/kg.

[0213] Conclusion: no toxicity was found in the limit test on the intravenous injection of 2000 mg/kg BW dose level.