Method AMD strains for reducing byproduct fumaric acid in fermentation process of L-malic acid and use thereof
11732279 · 2023-08-22
Inventors
Cpc classification
C12P7/46
CHEMISTRY; METALLURGY
International classification
C12P7/46
CHEMISTRY; METALLURGY
Abstract
The disclosure discloses an Aspergillus niger engineered strain for reducing byproduct fumaric acid in a fermentation process of L-malic acid. The Aspergillus niger engineered strain is an Aspergillus niger engineered strain in which a fumarate hydratase gene fum is knocked out. The disclosure overcomes the defects in the prior art, in the current process of producing malic acid through fermentation of Aspergillus niger, byproduct fumaric acid can be accumulated with the generation of malic acid so as to cause the improved cost of the subsequent malic acid purification process. The disclosure provides an Aspergillus niger engineered strain in which a fum gene is knocked out and a method for greatly reducing byproduct fumaric acid in the fermentation production of Aspergillus niger.
Claims
1. A method of constructing an Aspergillus niger engineered strain for reducing byproduct fumaric acid in a fermentation process of L-malic acid, wherein a fumarate hydratase gene fum is knocked out from the Aspergillus niger engineered strain; the amino acid sequence encoded by the fumarate hydratase gene fum is SEQ NO:2; the gene sequence of the fumarate hydratase gene fum is NCBI-locus_tagANI_1_952104; the method comprises: (1) respectively amplifying upstream and downstream sequence fragments of a gene fum through PCR reaction with a wild type Aspergillus niger ATCC1015 genome as a template, and recovering PCR products to respectively obtain target fragments; and cloning the upstream and downstream sequence fragments of the gene fum onto a vector pLH594, so as to construct a fumarate hydratase gene fum knockout vector pLH804; wherein the upstream sequence of the gene fum is SEQ NO:3, and the downstream sequence of the gene fum is SEQ NO: 4; (2) transferring the vector pLH804 into an Aspergillus niger malic acid high-yield strain S1149, and conducting transformant screening and hygromycin resistance gene recombination to obtain an Aspergillus niger fumarate hydratase gene fum knockout strain M1, wherein the Aspergillus niger engineered strain is obtained by knocking out only the gene sequence of the fumarate hydratase gene fum.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
(9) To better understand the disclosure, the disclosure will be further described in detail in combination with embodiments. However, the scope claimed by the disclosure is not limited to the scope represented by embodiments.
(10) Raw materials used in the disclosure, unless otherwise noted, are all conventional commercially available products. The methods used in the disclosure, unless otherwise noted, are all conventional methods in the art. The masses of various substances used in the disclosure are conventional use masses.
(11) An Aspergillus niger engineered strain for reducing byproduct fumaric acid in a fermentation process of L-malic acid is an Aspergillus niger engineered strain in which a fumarate hydratase gene fum is knocked out.
(12) Preferably, the gene sequence of the fumarate hydratase gene fum is SEQ NO:1, and the amino acid sequence of the fumarate hydratase gene fum is SEQ NO:2.
(13) Preferably, the fumarate hydratase gene fum is NCBI-locus_tagANI_1_952104.
(14) A method for constructing the Aspergillus niger engineered strain for reducing byproduct fumaric acid in a fermentation process of L-malic acid as described above comprises the following steps:
(15) (1) Construction of a Fumarate Hydratase Gene fum Knockout Vector
(16) respectively amplifying upstream and downstream sequence fragments of a gene fum through PCR reaction with a wild type Aspergillus niger ATCC1015 genome as a template, and recovering PCR products to respectively obtain target fragments; and cloning the upstream and downstream sequence fragments of the gene fum onto a vector pLH594, so as to construct a fumarate hydratase gene fum knockout vector pLH804;
(17) wherein the upstream sequence of the gene fum is SEQ NO:3, and the downstream sequence of the gene fum is SEQ NO: 4;
(18) (2) Obtaining of an Aspergillus niger Fumarate Hydratase Gene fum Knockout Strain:
(19) transferring the vector pLH804 into an Aspergillus niger malic acid high-yield strain S1149, and conducting transformant screening and hygromycin resistance gene recombination to obtain an Aspergillus niger fumarate hydratase gene fum knockout strain M1.
(20) A method for fermenting L-malic acid by utilizing the Aspergillus niger engineered strain as described above comprises the following steps:
(21) inoculating the Aspergillus niger engineered strain into a PDA culture medium to be cultured for 5 days at 28° C. until conidia are generated, collecting the conidia and inoculating a conidium suspension into a fermentation culture medium, wherein the concentration of the conidia is 1*10.sup.8 conidia/50 ml, and then culturing for 5 days at a constant temperature of 28° C. at 200 rpm to obtain L-malic acid.
(22) Preferably, the components and a formulation method of the fermentation culture medium are as follows:
(23) 100 g/L of glucose, 6 g/L of bacterial peptone, 0.15 g/L of anhydrous potassium dihydrogen phosphate, 0.15 g/L of anhydrous dipotassium hydrogen phosphate, 0.1 g/L of calcium chloride dihydrate, 0.1 g/L of magnesium sulfate heptahydrate, 0.005 g/L of sodium chloride, 0.005 g/L of ferrous sulfate heptahydrate and 0.001 g/L of anhydrous citric acid, a solvent is water, and autoclaving is performed for 20 min at 115° C.
(24) Preferably, the yield of the L-malic acid obtained by the method is 93.56-98.16 g/L which is improved by 1.97% compared with a starting strain, and the yield of the fumaric acid is 0.07-0.14 g/L which is reduced by 93.9% compared with the starting strain.
(25) Provided is use of the Aspergillus niger engineered strain as described above in production of L-malic acid.
(26) Specifically, relevant preparation and detection are as follows:
Example 1: Construction of an Aspergillus niger fum Gene Knockout Strain
(27) This example includes the following steps:
(28) (1) Construction of a fum Gene Knockout Vector
(29) To amplify the upstream sequence fragment of the fum gene, an Aspergillus niger ATCC1015 genome was used as a template to design amplification primers fum-F-F and fum-F-R, the upstream sequence fragment of the fum gene was recovered by PCR amplification, subjected to EcoR I and Sac I double digestion and glue recovery and then linked to a vector pLH594 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was transformed into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(30) To amplify the downstream sequence fragment of the fum gene, an Aspergillus niger genome was used as a template to design amplification primers fum-R-F and fum-R-R, the downstream sequence fragment of the fum gene was recovered by PCR amplification, subjected to Xba I and Spe I double digestion and glue recovery and then linked to a vector pLH803 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was transformed into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(31) A protein functional domain of a fum gene is shown in
(32) Amplification primers are seen in Table 1.
(33) TABLE-US-00001 TABLE 1 Primer sequence Primer name Primer sequence (5′.fwdarw.3′).sup.a fum-F-F GCTCCGTAACACCCAGAATTCCCCAGCCAA GTATGCCATTG fum-F-R CGAAGTTATGGATCCGAGCTCGGATGTGTG CAAGGGATTGG fum-R-F GCTATACGAAGTTATTCTAGAGCTTGGAGG AGTCATCTAGCG fum-R-R TGCCTGCAGGGGCCCACTAGTTCTCCAATC CAGCACGCTTG P1 CCACTTCACAACAGCATCCC P2 CATCATCACGCGCGTTAGT P3 CTCTGAGCGAGGAGGACTT P4 CAGATTACCTCCAGCCATCC P641 CAATATCAGTTAACGTCGAC P642 GGAACCAGTTAACGTCGAAT .sup.aUnderline sequence represents restriction enzyme sites
(34) The gene sequence of the gene fum is SEQ NO:1, with a length of 2384 bp; the amino acid sequence of the gene fum is SEQ NO:2, with 547 amino acids; the functional domain of a protein is shown in
(35) The upstream sequence of the fum gene is SEQ NO:3, with a length of 1443 bp;
(36) The downstream sequence of the fum gene is SEQ NO:4, with a length of 1379 bp;
(37) The LB solid culture medium containing kanamycin resistance comprises the following components: 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of sodium chloride and 15 g/L of agar powder. Sterilization was performed for 20 min at 121° C. Kanamycin was added when sterilizing and cooling to about 50° C. until a final concentration was 100 μg/mL.
(38) (2) Obtaining of an Aspergillus niger fum Gene Knockout Strain
(39) The vector pLH804 was electroporated into agrobacterium, then this agrobacterium containing a corresponding vector and an Aspergillus niger host strain S489 were co-cultured in an TIM culture medium for agrobacterium-mediated transformation, the culture product was evenly coated in a CM culture medium after culturing for 2.5 days to be cultured until transformants were grown, and then the transformants were screened, the phenotypes of the transformants are insensitive to hygromycin resistance and sensitive to glufosinate-ammonium. Such the transformants were subjected to genome validation and validation primers were designed (Table 1). Amplification results satisfy that the amplification of left and right homology arms is negative (
(40) The transformation method of the gene knockout is an agrobacterium-mediated method.
(41) The electrotransformation conditions of the agrobacterium-mediated method are as follows: Capacitance: 25 uF, Voltage: 2.5 kV, Resistance: 200Ω, Pulse: 5 msec.
(42) The Agrobacterium strain is an AGL-1 strain.
(43) A method for formulating the IM culture medium comprises: water was added into 15 g of agar so that a 905.7 mL volume was reached, sterilization was performed at 121° C. for 20 min, 0.8 mL of sterile K buffer, 20 mL of MN buffer, 1 mL of 1% CaCl.sub.2).Math.2H.sub.2O, 10 mL of 0.01% FeSO.sub.4, 5 mL of IM Trace elements, 2.5 mL of 20% NH.sub.4NO.sub.3, 10 mL of 50% glycerol, 40 mL of IM MES and 5 mL of 20% glucose which were prepared in advance were added, kanamycin was added when the temperature was reduced to about 50° C. so that a final concentration was 100 μg/mL, acetosyringone was added so that the final concentration was 200 μM.
(44) A method for formulating the CM culture medium comprises: water was added into 20 g of agar so that a 897 mL volume was reached, sterilization was performed at 121° C. for 20 min, 20 mL of aseptic ASP+N, 20 mL of 50% glucose, 2 mL of 1M MgSO.sub.4, 1 mL of CM Trace elements, 10 mL of 10% casein hydrolyzate and 50 mL of 10% yeast extract which were prepared in advance were added, hygromycin was added when the temperature was reduced to about 50° C. so that the final concentration was 250 μg/mL, streptomycin was added so that the final concentration was 100 μg/mL, cefotaxime sodium was added so that the final concentration was 100 μg/mL, and ampicillin was added so that the final concentration was 100 μg/mL.
(45) The validation primer sequences are seen in Table 1.
(46) The induction and recombination method of the resistance marker comprises: spores of about 400 fum gene knockout clones were evenly coated onto an MM culture medium containing 30 μg/mL tetracycline, cultured at 28° C. until monoclones were grown, and 100 monoclones were randomly picked and transferred to a PDA culture medium to be cultivated at 28° C. for 24 h, and then the clones were transferred to a PDA medium containing hygromycin for 24 h at 28° C. one by one, and finally the phenotypes were observed to screen the transformants induced and recombined by resistance markers, that is, the transformants which can be normally grown in the PDA culture medium but cannot be normally grown in the PDA culture medium containing hygromycin were successfully induced and recombined transformants
Example 2: Use of an Engineered Strain in Production of L-Malic Acid Via Fermentation
(47) A method for producing malic acid by utilizing the Aspergillus niger fum gene knockout engineered strain M1 constructed in the disclosure in a shaker via fermentation specifically comprises the following steps:
(48) First, the obtained engineered strain M1 was inoculated into a PDA culture medium and subjected to inverted culture in a 28° C. incubator for 5 days until enough conidia were generated;
(49) a method for formulating the PDA culture medium comprises: 200 g of peeled potatoes were accurately weighed and cut into about 1 cm.sup.3 of small pieces, distilled water was added, the resulting mixture was boiled for 30 min under the condition of continuous stirring and filtered with double-layer gauze, filtrate was collected, 20 g of glucose was stirred until it was completely dissolved, the volume was adjusted to 1 L with distilled water, the resulting mixture was packaged into a jar, 1.5% agar was added, and the jar was autoclaved at 121° C. for 20 min. 1.5% of agar was added in the solid culture medium.
(50) Then, the conidia of strains M1 were collected and inoculated into a malic acid fermentation culture medium, wherein the final concentration of the conidia was 1*10.sup.8 conidia/50 mL, and the shaker was placed under the conditions of 28° C. and at 200 rpm for 5 days of culture.
(51) The malic acid fermentation culture medium comprises the compositions: 100 g/L of glucose, 6 g/L of bacterial peptone, 0.15 g/L of anhydrous potassium dihydrogen phosphate, 0.15 g/L of anhydrous dipotassium hydrogen phosphate, 0.1 g/L of calcium chloride dihydrate, 0.1 g/L of magnesium sulfate heptahydrate, 0.005 g/L of sodium chloride, 0.005 g/L of ferrous sulfate heptahydrate and 0.001 g/L of anhydrous citric acid. Autoclaving was performed for 20 min at 115° C.
(52) Finally, the fermentation product was collected to prepare a test sample, and the content of the main organic acid in the sample was determined by HPLC. The results showed that the main organic acid was malic acid, the content of the byproduct fumaric acid was significantly reduced. The results are shown in
(53) A method for preparing the detection sample comprises: 2 mL of evenly vibrated fermentation broth was sucked, an equal volume of 2 M HCl was added, the above materials fully reacted, the reaction product was centrifuged to take supernatant, the supernatant was diluted by 50 folds, and the diluted supernatant was filtered via a 0.22 μm filter membrane and then stored in a liquid vial for future HPLC analysis.
(54) A method for detecting an organic acid via HPLC comprises: Agilent high performance liquid chromatograph UV detector, AminexHPX-87H chromatographic column (300 mm*7.8 mm), 5 mM H.sub.2SO.sub.4 mobile phase, 0.6 mL/min flow rate, the column temperature was 65° C., the detection wavelength was 210 nm, and the injection volume was 20 μL.
(55) According to research results of the disclosure, the byproduct fumaric acid accumulated in the production process of malic acid through fermentation of Aspergillus niger is greatly reduced, the cost in the process of downstream separation and purification malic acid was reduced, and good strains are provided for industrialized production of malic acid via fermentation.
(56) The sequences used in the disclosure are as follows:
(57) TABLE-US-00002 SEQ NO: 1: ttgccgtcccccaggttttgggtagaattggaatatcattagatctgtcgtcttatattgtttattttagagagataaagtacg accaatcccttgcacacatcctcgacaggatgtgaattgtttcccaaaaaatggcaccattggttagccagccacacacagtgactaa cgcgcgtgatgatgaatagatccagaagccggtcgtcatgttgacatctgcccacacttcccgagccgcggtgcgctcgatggcct ccttgacacatgctgcatctcgagcttcggcttcccccgcagttgcccgcactgccgtcgctttcacccccgcctcgttcagttgccgt cgtcttctgagctccaatagccgacctgttcaacacttcccccgtcttcagaccttgacttccacctccagcaagagagcctttggcac caccgtcaagatggtatgctctatcctttccattgaatcgcatctatcatatggatgacttcgctatggggaaagagccccaactgcga gacgttgctaatcggttattgttttagtcttcggctacccgcattgagaccgatgccttcggtgagatcgaggtatgtgctacactgatg cacacgatgcgtatagaatgcgaatgctgactgcttttcttttctaggtccccgccgacaagtactggggtgcccagacccagcggt aagaccccgatttcaacaatcgctgccacactgcaaactggctatgcgaccgatacacgaagtgagcagatgctgactggcgcga caatagctccctgggcaacttcgacatcaaccagccccaggaccgcatgcctgagcccgttgtcaaggctttcggtatcctcaagg gtgctgctgctgaagtgaacatgaagttcggccttggtaagccgctatcgattaaagcagcacagctccggcgaagttaacaccag gaaattagaccccaagatcggcgaggccatcaagcaggctgccgccgaggttgcggagggcaagctgatggaccacttccccct cgtcgtctggcagaccggttccggtacccagtccaacatgaactcgaacgaggtcatctccaaccgcgccattgagatcctgggcg gcgagaagggctccaagaagcccgtccaccccaacgaccacgtcaacatgtccgcctcctccaatgactccttcccgaccgctat gcacattgctgccgttgtggagctggagaacaccctcctgccttccctgaggagcctgcgcgatgctctccaggtcaaggttgaga agttcgacaagatcatcaagatcggtcgtactcacctgcaggacgccacccctctcaccctcggtcaggagttctccggctacgtcg ctcagctcgaccgcaacattgagcgtgtcgagactagcatcccccacctccgctacctggctcagggtggtaccgccgtcggtact ggtctgaacaccttcaagggcttcgacgaggctatcgctgctgaggtcaccaagttgaccggcaccgagttcaagactgcccccaa caagttcgaggttctggccgcccacgactcgattgtcgaggcttccggtgccctgaacaccctggcctgctctctgttcaagattgcc caggacatccgttaccttggatccggtccccgctgcggtcttggtgaactggtcctccccgagaacgagcctggctcttccatcatg cccggcaaggttaaccccactcagtgcgagtcccttaccatggtctgctcccaggtcatgggtaaccacgtcgctgccactgtcgg cggcatgaacggtcagttcgagctcaacgtgttcaagcccctcatgatccgcaacctgctgcacagcgtgcgcatcctggccgatg gcatggccagcttcgagaagaacctggtgcacggtctggaggccaacgagccccgcatcaactctctcctccacgagaggtatgt atttccctaaaaaatcggacctttgtaaagaagacaactaacggtggtgtagtctgatgttggtcacctgcctgaaccccgtcattggc tacgacatggcctccaaggtcgccaagaacgcccacaagaagggcctcactctgaagcagagtgctatggagctgaaggctctg agcgaggaggactttgacaagtacgtccgcccggagctgatgctgagccccaaggagaagaaataaatgtatagcgggacgag agatgttttggcttagcttggaggagtcatctagcgaagactagcttttgcctaggagatatttgtatactcaggaatactactgtacta ttcttcttgttcagcttattgcttggatagagttcttcgctgtacgg SEQ NO: 2: MetLeuThrSerAlaHisThrSerArgAlaAlaValArgSerMetAlaSerLeuThrHisAlaAlaSer ArgAlaSerAlaSerProAlaValAlaArgThrAlaValAlaPheThrProAlaSerPheSerCysArg ArgLeuLeuSerSerAsnSerArgProValGlnHisPheProArgLeuGlnThrLeuThrSerThrSer SerLysArgAlaPheGlyThrThrValLysMetSerSerAlaThrArgIleGluThrAspAlaPheGly GluIleGluValProAlaAspLysTyrTrpGlyAlaGlnThrGlnArgSerLeuGlyAsnPheAspIle AsnGlnProGlnAspArgMetProGluProValValLysAlaPheGlyIleLeuLysGlyAlaAlaAla GluValAsnMetLysPheGlyLeuAspProLysIleGlyGluAlaIleLysGlnAlaAlaAlaGluVal AlaGluGlyLysLeuMetAspHisPheProLeuValValTrpGlnThrGlySerGlyThrGlnSerAsn MetAsnSerAsnGluValIleSerAsnArgAlaIleGluIleLeuGlyGlyGluLysGlySerLysLys ProValHisProAsnAspHisValAsnMetSerAlaSerSerAsnAspSerPheProThrAlaMetHis IleAlaAlaValValGluLeuGluAsnThrLeuLeuProSerLeuArgSerLeuArgAspAlaLeuGln ValLysValGluLysPheAspLysIleIleLysIleGlyArgThrHisLeuGlnAspAlaThrProLeu ThrLeuGlyGlnGluPheSerGlyTyrValAlaGlnLeuAspArgAsnIleGluArgValGluThrSer IleProHisLeuArgTyrLeuAlaGlnGlyGlyThrAlaValGlyThrGlyLeuAsnThrPheLysGly PheAspGluAlaIleAlaAlaGluValThrLysLeuThrGlyThrGluPheLysThrAlaProAsnLys PheGluValLeuAlaAlaHisAspSerIleValGluAlaSerGlyAlaLeuAsnThrLeuAlaCysSer LeuPheLysIleAlaGlnAspIleArgTyrLeuGlySerGlyProArgCysGlyLeuGlyGluLeuVal LeuProGluAsnGluProGlySerSerIleMetProGlyLysValAsnProThrGlnCysGluSerLeu ThrMetValCysSerGlnValMetGlyAsnHisValAlaAlaThrValGlyGlyMetAsnGlyGlnPhe GluLeuAsnValPheLysProLeuMetIleArgAsnLeuLeuHisSerValArgIleLeuAlaAspGly MetAlaSerPheGluLysAsnLeuValHisGlyLeuGluAlaAsnGluProArgIleAsnSerLeuLeu HisGluSerLeuMetLeuValThrCysLeuAsnProValIleGlyTyrAspMetAlaSerLysValAla LysAsnAlaHisLysLysGlyLeuThrLeuLysGlnSerAlaMetGluLeuLysAlaLeuSerGluGlu AspPheAspLysTyrValArgProGluLeuMetLeuSerProLysGluLysLys SEQ NO: 3: CCCAGCCAAGTATGCCATTGCCTACGGCCGTGCTCAAGGTCCTGATGTC TTCCGCATCACGGAGCAGAAATGTCCCGTGCAAGGGGGCGAGATAACCATCCG TATCTTCGAGCCTGCCCCGAAAGCGGATGAGCATGGCAAGGCCAAAAAGAGGG CTGCGTTTGTCAACTTCCATGGGGGAGGCTGGGTGTTCGGCGATCTCTCAGTTG ATCACGATTTCTGCAAGACACTCGTCGATGGCCTGGACGGGCACTTGGTCGCGT TTGATGTCGACTACCGGCTAGCTCCTGAGCACAAGTACCCGATCCCCGTTGACG ACTGCTGGACCGCTTTCAATTGGGTCAGCTACAACTCCCTGTCTACATCGACCG GTATGGTCAATACTAACTGACATCCCGTGCAGATCCGCTCCCAGAAAGCAGAG GAGTTCAACGTTGACCCGAATCGAATAGCTGTTGGAGGTTGTTCGGCCGGAGG CCACCTGTCAGCCGTGGTCGCTCATCTCTGCCGTAATGGCGGCATTCCGTTGCG CCTGCAGGTGCTGAACGTGCCCGTATGTGATCTACATAGCGGCTACACTCCGGA TGGTGAATTCGATCGGGAGAACTGTCCCTATGAGTCCTACAGAGAGATGGAGT TCACCGCAGCTCTTCCGGTAGCACGGATGGCTTATTTCCATCGACACTTTTTGG GGGTTCCCCGGCCAGCACGTTCAGAAGAGGTAAGTAGTACCGTAATTGCTGCA GCCGGAGCTGCACACAACTGCAAGATGCTGATGTGATCCATAGGACTGGAAGA TCTCCCCCATATTTGCGCCTGACTTTTCTGGACTAGCACCTGCGTTGGTCTTCAC CGCCGAAATGGATCCTCTGCGGGACGAAGGGGAGGCCTACGCTGCCAAATTGA AAGCTGGCGGTTGTCGAGTGGAAATGATGCGTATGGCAGGAGCACCCCACACA TTTGCCATGTTGGATGGCATCTTAGAGAGCGGCCGTATATATACCGAGAAGGTC ATCGAAGCGATGAAACGGGAACTAACAGGGTAAATAATCAATTGGTTCGGTTG AAGGGATATCGAAGATGGAGAGCAGTGTTAGTGCAGAGCGACTAGAAGATGG AAATGCGGAGAGACAGCAGGATCATGGTTTATCCGACGAGAATCTTTACCGTA TGATACCATTTAGGCCGGGCAGCGAAGGTGTGGCAGACGGGTAACCGGCGTCC TGAACATTACCGGGCCGGGAGATTTCGGCAGGCGGTATCGGAAACAGTTGGGG TGGATTAAATATGCGCGGCTGCTGCTGCTCTTCTTCTTCCCTTCTTTTCTGCGTG GTTTGTTTGCCGTCCCCCAGGTTTTGGGTAGAATTGGAATATCATTAGATCTGTC GTCTTATATTGTTTATTTTAGAGAGATAAAGTACGACCAATCCCTTGCACACAT CC SEQ NO: 4: GCTTGGAGGAGTCATCTAGCGAAGACTAGCTTTTGCCTAGGAGATATTT GTATACTCAGGAATACTACTGTACTATTCTTCTTGTTCAGCTTATTGCTTGGATAG AGTTCTTCGCTGTACGGAGTATAGAATTTTCTCGGGCTGATGACGGGGCTGACCC CGGGGTGTGCTATTTTTGGACCACCAAAGCGGTCCCGCCCACCGATCGAATAGT TCAAGATGCACGGATAGCAACGACTGACGGTGTGTTGCTGAGGGCCAGTCAAG TGGTGTTAAATTTAGGCATACTAACTAGTAACGTTGCTGCGCCAGTCAGGCTTGG AGGGTGATCGGCTTGACCAGTGCCAGTCGGAAAGAACCGTATGTAGTGGTAAGT AGTAAGTAGTCAGGGGCGGATTTCCAAAGTGTTTGGTGTTTCAGGCAAACCGTG GGCCCTTCTCTTACTGCTTGTTTATTACCTCCGCCTGGCCCTTTCTTTTCCATCAC CGACTGACCGACTGACTCGATTGACCTGTCCTTTTTTTCCCTTCATCCCTTTCCC CCTCAAATACTCACCTTCGTTGGAAATACTCTGTCTTTCGTTCAAACACTCACTA TCACTGAAGAAATCCTTCATTCCAGCGTTTCAATAATTCCCATCCGTTTTCACCA CTCAATTGAACCCCGCCACTAACCAGGGGCCCTTCCTCCCTTAACTAAACTACC AAACAACCTCTTCACGAAACTCCTCAAAGCCTTTTTCTCCTCTCCAGCAAAAAG TTCAAGACGGACAAAAAACATACCACCGCCAACATGACCAACGCCTCCACCCT CACCCAACCCCCCGCCGAATCCAAGGACGACGCCCCCCTCTTCCCTACGACCCT CATCTCCCCCTCCGTCGCCGCCGAACTGCCCGAAGGCTACAAGATCCGTCCCGT CCGTCGCTCCGACTACAGCCGCGGCTACCTGGACGTGTTGCGCGTGCTGACGAC CGTCGGCACCATCACCGAGGAGCAGTGGAACAAGCGCTACGACTGGATCTCGT CGCGCAATGACGAGTACTACCTGCTTGTTATCTGTGACGGGGAGGATCGTGTCG TGGGCACGGGCAGCTTGATTGTTGAGCGCAAGTTCATTCATGAGTTGGGTCTTG TGGGCCATATTGAGGACATTGCCGTCGAGAAGGGCCAGCAGGGGAAGAGGCTC GGGCTGAGGCTTATTCAGGCGTTGGATTATGTTGCGGCGCAGGTGGGATGCTAC AAGGTATGTCTTCTACTTCTTATTATGGGAGTGGTGGTCGTCATGATGCTAATGGT CAATGCAGAGTATTCTCGATTGCTCCGAGGCGAATGAGGGATTCTACCTCAAGT GCGGCTTCAAGCGTGCTGGATTGGAGA
(58) Although the embodiments of the disclosure have been disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the disclosure and the appended claims, and therefore the scope of the disclosure is not limited to the contents disclosed in the embodiments.
SEQUENCE LISTING
(59) TABLE-US-00003 <110> Nanjing Haohe Biotechnology Co., Ltd <120> METHOD AND STRAINS FOR REDUCING BYPRODUCT FUMARIC ACID IN A FERMENTATION PROCESS OF L-MALIC ACID, AND USE THEREOF. <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2384 <212> DNA <213> Gene sequence of fumaric acid hydratase gene fum (Unknown) <400> 1 ttgccgtccc ccaggttttg ggtagaattg gaatatcatt agatctgtcg tcttatattg 60 tttattttag agagataaag tacgaccaat cccttgcaca catcctcgac aggatgtgaa 120 ttgtttccca aaaaatggca ccattggtta gccagccaca cacagtgact aacgcgcgtg 180 atgatgaata gatccagaag ccggtcgtca tgttgacatc tgcccacact tcccgagccg 240 cggtgcgctc gatggcctcc ttgacacatg ctgcatctcg agcttcggct tcccccgcag 300 ttgcccgcac tgccgtcgct ttcacccccg cctcgttcag ttgccgtcgt cttctgagct 360 ccaatagccg acctgttcaa cacttccccc gtcttcagac cttgacttcc acctccagca 420 agagagcctt tggcaccacc gtcaagatgg tatgctctat cctttccatt gaatcgcatc 480 tatcatatgg atgacttcgc tatggggaaa gagccccaac tgcgagacgt tgctaatcgg 540 ttattgtttt agtcttcggc tacccgcatt gagaccgatg ccttcggtga gatcgaggta 600 tgtgctacac tgatgcacac gatgcgtata gaatgcgaat gctgactgct tttcttttct 660 aggtccccgc cgacaagtac tggggtgccc agacccagcg gtaagacccc gatttcaaca 720 atcgctgcca cactgcaaac tggctatgcg accgatacac gaagtgagca gatgctgact 780 ggcgcgacaa tagctccctg ggcaacttcg acatcaacca gccccaggac cgcatgcctg 840 agcccgttgt caaggctttc ggtatcctca agggtgctgc tgctgaagtg aacatgaagt 900 tcggccttgg taagccgcta tcgattaaag cagcacagct ccggcgaagt taacaccagg 960 aaattagacc ccaagatcgg cgaggccatc aagcaggctg ccgccgaggt tgcggagggc 1020 aagctgatgg accacttccc cctcgtcgtc tggcagaccg gttccggtac ccagtccaac 1080 atgaactcga acgaggtcat ctccaaccgc gccattgaga tcctgggcgg cgagaagggc 1140 tccaagaagc ccgtccaccc caacgaccac gtcaacatgt ccgcctcctc caatgactcc 1200 ttcccgaccg ctatgcacat tgctgccgtt gtggagctgg agaacaccct cctgccttcc 1260 ctgaggagcc tgcgcgatgc tctccaggtc aaggttgaga agttcgacaa gatcatcaag 1320 atcggtcgta ctcacctgca ggacgccacc cctctcaccc tcggtcagga gttctccggc 1380 tacgtcgctc agctcgaccg caacattgag cgtgtcgaga ctagcatccc ccacctccgc 1440 tacctggctc agggtggtac cgccgtcggt actggtctga acaccttcaa gggcttcgac 1500 gaggctatcg ctgctgaggt caccaagttg accggcaccg agttcaagac tgcccccaac 1560 aagttcgagg ttctggccgc ccacgactcg attgtcgagg cttccggtgc cctgaacacc 1620 ctggcctgct ctctgttcaa gattgcccag gacatccgtt accttggatc cggtccccgc 1680 tgcggtcttg gtgaactggt cctccccgag aacgagcctg gctcttccat catgcccggc 1740 aaggttaacc ccactcagtg cgagtccctt accatggtct gctcccaggt catgggtaac 1800 cacgtcgctg ccactgtcgg cggcatgaac ggtcagttcg agctcaacgt gttcaagccc 1860 ctcatgatcc gcaacctgct gcacagcgtg cgcatcctgg ccgatggcat ggccagcttc 1920 gagaagaacc tggtgcacgg tctggaggcc aacgagcccc gcatcaactc tctcctccac 1980 gagaggtatg tatttcccta aaaaatcgga cctttgtaaa gaagacaact aacggtggtg 2040 tagtctgatg ttggtcacct gcctgaaccc cgtcattggc tacgacatgg cctccaaggt 2100 cgccaagaac gcccacaaga agggcctcac tctgaagcag agtgctatgg agctgaaggc 2160 tctgagcgag gaggactttg acaagtacgt ccgcccggag ctgatgctga gccccaagga 2220 gaagaaataa atgtatagcg ggacgagaga tgttttggct tagcttggag gagtcatcta 2280 gcgaagacta gcttttgcct aggagatatt tgtatactca ggaatactac tgtactattc 2340 ttcttgttca gcttattgct tggatagagt tcttcgctgt acgg 2384 <210> 2 <211> 547 <212> PRT <213> Amino acid sequence of fumaric acid hydratase gene fum (Unknown) <400> 2 Met Leu Thr Ser Ala His Thr Ser Arg Ala Ala Val Arg Ser Met Ala 1 5 10 15 Ser Leu Thr His Ala Ala Ser Arg Ala Ser Ala Ser Pro Ala Val Ala 20 25 30 Arg Thr Ala Val Ala Phe Thr Pro Ala Ser Phe Ser Cys Arg Arg Leu 35 40 45 Leu Ser Ser Asn Ser Arg Pro Val Gln His Phe Pro Arg Leu Gln Thr 50 55 60 Leu Thr Ser Thr Ser Ser Lys Arg Ala Phe Gly Thr Thr Val Lys Met 65 70 75 80 Ser Ser Ala Thr Arg Ile Glu Thr Asp Ala Phe Gly Glu Ile Glu Val 85 90 95 Pro Ala Asp Lys Tyr Trp Gly Ala Gln Thr Gln Arg Ser Leu Gly Asn 100 105 110 Phe Asp Ile Asn Gln Pro Gln Asp Arg Met Pro Glu Pro Val Val Lys 115 120 125 Ala Phe Gly Ile Leu Lys Gly Ala Ala Ala Glu Val Asn Met Lys Phe 130 135 140 Gly Leu Asp Pro Lys Ile Gly Glu Ala Ile Lys Gln Ala Ala Ala Glu 145 150 155 160 Val Ala Glu Gly Lys Leu Met Asp His Phe Pro Leu Val Val Trp Gln 165 170 175 Thr Gly Ser Gly Thr Gln Ser Asn Met Asn Ser Asn Glu Val Ile Ser 180 185 190 Asn Arg Ala Ile Glu Ile Leu Gly Gly Glu Lys Gly Ser Lys Lys Pro 195 200 205 Val His Pro Asn Asp His Val Asn Met Ser Ala Ser Ser Asn Asp Ser 210 215 220 Phe Pro Thr Ala Met His Ile Ala Ala Val Val Glu Leu Glu Asn Thr 225 230 235 240 Leu Leu Pro Ser Leu Arg Ser Leu Arg Asp Ala Leu Gln Val Lys Val 245 250 255 Glu Lys Phe Asp Lys Ile Ile Lys Ile Gly Arg Thr His Leu Gln Asp 260 265 270 Ala Thr Pro Leu Thr Leu Gly Gln Glu Phe Ser Gly Tyr Val Ala Gln 275 280 285 Leu Asp Arg Asn Ile Glu Arg Val Glu Thr Ser Ile Pro His Leu Arg 290 295 300 Tyr Leu Ala Gln Gly Gly Thr Ala Val Gly Thr Gly Leu Asn Thr Phe 305 310 315 320 Lys Gly Phe Asp Glu Ala Ile Ala Ala Glu Val Thr Lys Leu Thr Gly 325 330 335 Thr Glu Phe Lys Thr Ala Pro Asn Lys Phe Glu Val Leu Ala Ala His 340 345 350 Asp Ser Ile Val Glu Ala Ser Gly Ala Leu Asn Thr Leu Ala Cys Ser 355 360 365 Leu Phe Lys Ile Ala Gln Asp Ile Arg Tyr Leu Gly Ser Gly Pro Arg 370 375 380 Cys Gly Leu Gly Glu Leu Val Leu Pro Glu Asn Glu Pro Gly Ser Ser 385 390 395 400 Ile Met Pro Gly Lys Val Asn Pro Thr Gln Cys Glu Ser Leu Thr Met 405 410 415 Val Cys Ser Gln Val Met Gly Asn His Val Ala Ala Thr Val Gly Gly 420 425 430 Met Asn Gly Gln Phe Glu Leu Asn Val Phe Lys Pro Leu Met Ile Arg 435 440 445 Asn Leu Leu His Ser Val Arg Ile Leu Ala Asp Gly Met Ala Ser Phe 450 455 460 Glu Lys Asn Leu Val His Gly Leu Glu Ala Asn Glu Pro Arg Ile Asn 465 470 475 480 Ser Leu Leu His Glu Ser Leu Met Leu Val Thr Cys Leu Asn Pro Val 485 490 495 Ile Gly Tyr Asp Met Ala Ser Lys Val Ala Lys Asn Ala His Lys Lys 500 505 510 Gly Leu Thr Leu Lys Gln Ser Ala Met Glu Leu Lys Ala Leu Ser Glu 515 520 525 Glu Asp Phe Asp Lys Tyr Val Arg Pro Glu Leu Met Leu Ser Pro Lys 530 535 540 Glu Lys Lys 545 <210> 3 <211> 1443 <212> DNA <213> Upstream sequence of fum gene (Unknown) <400> 3 cccagccaag tatgccattg cctacggccg tgctcaaggt cctgatgtct tccgcatcac 60 ggagcagaaa tgtcccgtgc aagggggcga gataaccatc cgtatcttcg agcctgcccc 120 gaaagcggat gagcatggca aggccaaaaa gagggctgcg tttgtcaact tccatggggg 180 aggctgggtg ttcggcgatc tctcagttga tcacgatttc tgcaagacac tcgtcgatgg 240 cctggacggg cacttggtcg cgtttgatgt cgactaccgg ctagctcctg agcacaagta 300 cccgatcccc gttgacgact gctggaccgc tttcaattgg gtcagctaca actccctgtc 360 tacatcgacc ggtatggtca atactaactg acatcccgtg cagatccgct cccagaaagc 420 agaggagttc aacgttgacc cgaatcgaat agctgttgga ggttgttcgg ccggaggcca 480 cctgtcagcc gtggtcgctc atctctgccg taatggcggc attccgttgc gcctgcaggt 540 gctgaacgtg cccgtatgtg atctacatag cggctacact ccggatggtg aattcgatcg 600 ggagaactgt ccctatgagt cctacagaga gatggagttc accgcagctc ttccggtagc 660 acggatggct tatttccatc gacacttttt gggggttccc cggccagcac gttcagaaga 720 ggtaagtagt accgtaattg ctgcagccgg agctgcacac aactgcaaga tgctgatgtg 780 atccatagga ctggaagatc tcccccatat ttgcgcctga cttttctgga ctagcacctg 840 cgttggtctt caccgccgaa atggatcctc tgcgggacga aggggaggcc tacgctgcca 900 aattgaaagc tggcggttgt cgagtggaaa tgatgcgtat ggcaggagca ccccacacat 960 ttgccatgtt ggatggcatc ttagagagcg gccgtatata taccgagaag gtcatcgaag 1020 cgatgaaacg ggaactaaca gggtaaataa tcaattggtt cggttgaagg gatatcgaag 1080 atggagagca gtgttagtgc agagcgacta gaagatggaa atgcggagag acagcaggat 1140 catggtttat ccgacgagaa tctttaccgt atgataccat ttaggccggg cagcgaaggt 1200 gtggcagacg ggtaaccggc gtcctgaaca ttaccgggcc gggagatttc ggcaggcggt 1260 atcggaaaca gttggggtgg attaaatatg cgcggctgct gctgctcttc ttcttccctt 1320 cttttctgcg tggtttgttt gccgtccccc aggttttggg tagaattgga atatcattag 1380 atctgtcgtc ttatattgtt tattttagag agataaagta cgaccaatcc cttgcacaca 1440 tcc 1443 <210> 4 <211> 1379 <212> DNA <213> Downstream sequence of fum gene (Unknown) <400> 4 gcttggagga gtcatctagc gaagactagc ttttgcctag gagatatttg tatactcagg 60 aatactactg tactattctt cttgttcagc ttattgcttg gatagagttc ttcgctgtac 120 ggagtataga attttctcgg gctgatgacg gggctgaccc cggggtgtgc tatttttgga 180 ccaccaaagc ggtcccgccc accgatcgaa tagttcaaga tgcacggata gcaacgactg 240 acggtgtgtt gctgagggcc agtcaagtgg tgttaaattt aggcatacta actagtaacg 300 ttgctgcgcc agtcaggctt ggagggtgat cggcttgacc agtgccagtc ggaaagaacc 360 gtatgtagtg gtaagtagta agtagtcagg ggcggatttc caaagtgttt ggtgtttcag 420 gcaaaccgtg ggcccttctc ttactgcttg tttattacct ccgcctggcc ctttcttttc 480 catcaccgac tgaccgactg actcgattga cctgtccttt ttttcccttc atccctttcc 540 ccctcaaata ctcaccttcg ttggaaatac tctgtctttc gttcaaacac tcactatcac 600 tgaagaaatc cttcattcca gcgtttcaat aattcccatc cgttttcacc actcaattga 660 accccgccac taaccagggg cccttcctcc cttaactaaa ctaccaaaca acctcttcac 720 gaaactcctc aaagcctttt tctcctctcc agcaaaaagt tcaagacgga caaaaaacat 780 accaccgcca acatgaccaa cgcctccacc ctcacccaac cccccgccga atccaaggac 840 gacgcccccc tcttccctac gaccctcatc tccccctccg tcgccgccga actgcccgaa 900 ggctacaaga tccgtcccgt ccgtcgctcc gactacagcc gcggctacct ggacgtgttg 960 cgcgtgctga cgaccgtcgg caccatcacc gaggagcagt ggaacaagcg ctacgactgg 1020 atctcgtcgc gcaatgacga gtactacctg cttgttatct gtgacgggga ggatcgtgtc 1080 gtgggcacgg gcagcttgat tgttgagcgc aagttcattc atgagttggg tcttgtgggc 1140 catattgagg acattgccgt cgagaagggc cagcagggga agaggctcgg gctgaggctt 1200 attcaggcgt tggattatgt tgcggcgcag gtgggatgct acaaggtatg tcttctactt 1260 cttattatgg gagtggtggt cgtcatgatg ctaatggtca atgcagagta ttctcgattg 1320 ctccgaggcg aatgagggat tctacctcaa gtgcggcttc aagcgtgctg gattggaga 1379 <210> 5 <211> 41 <212> DNA <213> fum-F-F (Unknown) <400> 5 gctccgtaac acccagaatt ccccagccaa gtatgccatt g 41 <210> 6 <211> 41 <212> DNA <213> fum-F-R (Unknown) <400> 6 cgaagttatg gatccgagct cggatgtgtg caagggattg g 41 <210> 7 <211> 42 <212> DNA <213> fum-R-F (Unknown) <400> 7 gctatacgaa gttattctag agcttggagg agtcatctag cg 42 <210> 8 <211> 41 <212> DNA <213> fum-R-R (Unknown) <400> 8 tgcctgcagg ggcccactag ttctccaatc cagcacgctt g 41 <210> 9 <211> 20 <212> DNA <213> P1 (Unknown) <400> 9 ccacttcaca acagcatccc 20 <210> 10 <211> 19 <212> DNA <213> P2 (Unknown) <400> 10 catcatcacg cgcgttagt 19 <210> 11 <211> 19 <212> DNA <213> P3 (Unknown) <400> 11 ctctgagcga ggaggactt 19 <210> 12 <211> 20 <212> DNA <213> P4 (Unknown) <400> 12 cagattacct ccagccatcc 20 <210> 13 <211> 20 <212> DNA <213> P641 (Unknown) <400> 13 caatatcagt taacgtcgac 20 <210> 14 <211> 20 <212> DNA <213> P642 (Unknown) <400> 14 ggaaccagtt aacgtcgaat 20