HERBICIDE-RESISTANT ACETYL-CoA CARBOXYLASE (ACC) MUTANT AND USE THEREOF

Abstract

A mutant acetyl-CoA carboxylase (ACC) protein, a nucleic acid encoding the mutant ACC protein, and use thereof are provided. Specifically, compared with a parent ACC protein, the mutant ACC protein has mutations at amino acids corresponding to amino acid 1,879 and/or amino acid 2,186 of SEQ ID NO: 1. An ACC-mutated plant shows high herbicide resistance, and thus the present disclosure has very promising application prospects in the cultivation of an herbicide-resistant plant.

Claims

1. A method for imparting herbicide resistance to a plant, comprising a step of introducing a mutant acetyl-CoA carboxylase (ACC) into a plant cell, a plant seed, a plant tissue, a plant part, or the plant, wherein compared to an amino acid sequence of a parent ACC, the mutant ACC has a mutation at an amino acid corresponding to amino acid 1,879 and/or amino acid position 2,186 of an amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid 1,879 is mutated into valine (V), and the amino acid 2,186 is mutated into arginine (R); and an herbicide resisted by the plant is one or a combination of two or more selected from the group consisting of phenthodim, sethoxydim, and clethodim.

2. The method according to claim 1, wherein the parent ACC is derived from a monocotyledonous plant or a dicotyledonous plant.

3. The method according to claim 2, wherein the parent ACC is derived from Oryza sativa.

4. The method according to claim 1, wherein the method comprises a step of allowing the mutant ACC to express in the plant cell, the plant seed, the plant tissue, the plant part, or the plant.

5. The method according to claim 1, wherein the method comprises a step of allowing endogenous ACC of the plant to mutate to introduce the mutant ACC.

6. The method according to claim 5, wherein the method comprises: introducing the mutant ACC with a gene editing tool.

7. The method according to claim 6, wherein the gene editing tool is one or more selected from the group consisting of clustered regularly interspaced short palindromic repeat (CRISPR), transcription activator-like effector nuclease (TALEN), and zinc-finger nuclease (ZFN).

8. A method for preparing an herbicide-resistant plant, comprising a step of using the mutant ACC according to claim 1, or a nucleic acid encoding the mutant ACC, or a fusion protein comprising the mutant ACC, or a nucleic acid construct comprising the mutant ACC, or a vector comprising the mutant ACC, or a host cell comprising the mutant ACC in the preparation of the herbicide-resistant plant.

9. A method for preparing a reagent or a kit for producing an herbicide-resistant plant, comprising a step of using the mutant ACC according to claim 1, or a nucleic acid encoding the mutant ACC, or a fusion protein comprising the mutant ACC, or a nucleic acid construct comprising the mutant ACC, or a vector comprising the mutant ACC, or a host cell comprising the mutant ACC in the preparation of the reagent or the kit for producing an herbicide-resistant plant.

10. A method for controlling weeds in a farmland, comprising: a) providing the herbicide-resistant plant prepared by the method according to claim 8; and b) applying an effective amount of the herbicide to the herbicide-resistant plant and the weeds nearby to control the weeds near the herbicide-resistant plant.

11. An edit vector system, comprising a guide sequence targeting a parent ACC and a gene editing enzyme; wherein the edit vector system is configured to prepare an herbicide-resistant plant or prepare a reagent or a kit for producing the herbicide-resistant plant, and the edit vector system is configured to produce the mutant ACC according to claim 1 in the plant.

12. The method according to claim 2, wherein the method comprises a step of allowing the mutant ACC to express in the plant cell, the plant seed, the plant tissue, the plant part, or the plant.

13. The method according to claim 3, wherein the method comprises a step of allowing the mutant ACC to express in the plant cell, the plant seed, the plant tissue, the plant part, or the plant.

14. The method according to claim 2, wherein the method comprises a step of allowing endogenous ACC of the plant to mutate to introduce the mutant ACC.

15. The method according to claim 3, wherein the method comprises a step of allowing endogenous ACC of the plant to mutate to introduce the mutant ACC.

16. The method according to claim 8, wherein the parent ACC is derived from a monocotyledonous plant or a dicotyledonous plant.

17. The method according to claim 16, wherein the parent ACC is derived from Oryza sativa.

18. The method according to claim 8, wherein the method comprises a step of allowing the mutant ACC to express in the plant cell, the plant seed, the plant tissue, the plant part, or the plant.

19. The method according to claim 8, wherein the method comprises a step of allowing endogenous ACC of the plant to mutate to introduce the mutant ACC.

20. The method according to claim 19, wherein the method comprises: introducing the mutant ACC with a gene editing tool.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0152] FIG. 1 is a schematic diagram of an ABE-nCas9 base editor, where OsU6 and ZmUbi are promoters; sgRNA is a gRNA; bp-NLS is a nuclear localization signal; and NOS is a terminator.

[0153] FIG. 2 shows the herbicide resistance of a plant with mutation of amino acid 1,879 of ACC relative to the wild-type.

[0154] FIG. 3 shows the herbicide resistance of a plant with mutation of amino acid 2,186 of ACC relative to the wild-type.

[0155] FIG. 4 shows the tolerance of an I1879V edited plant to sethoxydim.

[0156] FIG. 5 shows the tolerance of an I1879V edited plant to phenthodim after phenthodim is sprayed for 20 d.

[0157] FIG. 6 shows the tolerance of I1879V and C2186R edited plants to quizalofop-p and fenoxaprop-p-ethyl.

[0158] FIG. 7 shows the tolerance of an I1879V edited plant to different herbicides.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0159] The present disclosure will be further explained below in conjunction with examples. The following examples are only preferred examples of the present disclosure, and are not intended to limit the present disclosure in other forms. Any technical personnel familiar with the profession may use the technical content disclosed above to derive equivalent examples through equivalent changes. Any simple modification or equivalent change made to the following examples according to the technical essence of the present disclosure without departing from the content of the solutions of the present disclosure shall fall within the protection scope of the present disclosure.

Example 1 Construction of a Gene Editing Vector and Screening of a Mutation Site

[0160] 1. An ABE-nCas9 base editor targeting the Oryza sativa endogenous ACC gene was constructed.

[0161] The ABE base editor could realize A/T->G/C base conversion within a specified sequence window. In the present disclosure, the ABE-nCas9 base editor was used as a vector, and a sgRNA (sgRNA shown in Table 1) was designed in the Oryza sativa endogenous ACC gene and cloned into the ABE-nCas9 vector to form a base editor targeting the Oryza sativa endogenous ACC gene. An amino acid sequence encoded by the Oryza sativa endogenous ACC gene was shown in SEQ ID No: 1.

TABLE-US-00002 TABLE 1 sgRNA sequences (guide sequences)  targeting Oryza sativa ACC sgRNA No. guide-PAM sequence (5′-3′) A-ACC1879 GAGAATATACATGGAAGTGC A-ACC2186 ATAGCACTCAATGCGGTCTG

[0162] 2. Oryza sativa Genetic Transformation and Transgenic Plant Identification

[0163] Multiple Oryza sativa varieties such as Wanzhijing 006, Nanjing 9108, and Jiahe 218 were used as experimental materials. The base editor constructed above was transformed into the Oryza sativa plants by A. tumefaciens to obtain gene-edited plants. Emerging seedlings were screened with a sethoxydim-containing medium at a concentration of SET-2: 2 mg/L. Or, edited seedlings were planted in a cultivation room. The edited seedlings and the control plants were sprayed with sethoxydim at a concentration of 0.5 g/L (corresponding to a field application dosage of 10 g. a.i/mu), and a survival rate of the seedlings was counted 10 d later.

[0164] Through screening cultivation, herbicide-resistant plants were screened out on a sethoxydim-containing medium. As shown in FIG. 2, plants indicated by the arrow were able to tolerate the herbicide and showed resistance to the herbicide compared with other plants. The above herbicide-resistant plants were identified by PCR and sequencing, and it was found that the herbicide-resistant plants had an expected base substitution within a target range and a specific editing type was I1879V. In addition, herbicide-resistant plants were also screened out in the cultivation room. As shown in FIG. 3, edited plants were able to tolerate the herbicide and showed resistance to the herbicide compared with the control plants. The above herbicide-resistant plants were identified by PCR and sequencing, and it was found that the herbicide-resistant plants had an expected base substitution within a target range and a specific editing type was C2186R.

[0165] For I1879V edited Oryza sativa plants, the dosage of sethoxydim was further increased to a corresponding field application dosage of 15 g. a.i/mu. 14 d later, the control was obviously yellow and dead, and the edited material grew normally, as shown in FIG. 4. The dosage of sethoxydim was further increased to 30 g. a.i/mu. After the plants were further cultivated for 20 d, all wild-type plants died, but the edited plants still showed significant herbicide resistance, with phytotoxicity only of about 30%.

Example 2 Resistance to Other Types of Herbicides

[0166] The I1879V and C2186R edited Oryza sativa plants obtained in Example 1 were planted, and the resistance to other types of herbicides was tested, such as phenthodim, quizalofop-p, fenoxaprop-p-ethyl, clethodim, haloxyfop-p-methyl, fenoxaprop, and butyclofen.

[0167] 2.1 Phenthodim:

[0168] Dibble Oryza sativa plants at the seedling stage in the field were selected and sprayed with phenthodim at 20 g.a.i./mu (4 times a recommended dosage), and then results were observed. After the phenthodim was sprayed for 7 d, the wild-type plants showed obvious chlorosis and spots, but the I1879V edited plants showed no visible phytotoxicity. After the phenthodim was applied for 20 d, as shown in FIG. 5, the wild-type plants showed serious phytotoxicity (the arrow in FIG. 5 indicated obvious phytotoxicity), and its growth was also severely affected; and the I1879V edited plants showed little difference in biomass from the control group. That is, even 20 d later, the I1879V edited plants still showed excellent resistance to phenthodim, had no obvious phytotoxicity, and were not affected in growth. However, compared with the wild-type control, the C2186R edited plant showed some resistance. Compared with the I1879V edited plant, the C2186R edited plant showed obvious phytotoxicity at 20 g.a.i./mu of phenthodim, and there were chlorosis and spots at bases of leaves of the edited material, which was not safe enough for practical use.

[0169] 2.2 Quizalofop-p and fenoxaprop-p-ethyl

[0170] Quizalofop-p and fenoxaprop-p-ethyl were each applied at 5 g.a.i./mu to I1879V edited plants and C2186R edited plants, and results were observed 14 d later. As shown in FIG. 6, 14 d later, there was no significant difference between the edited plants and the wild-type control, indicating that the above-mentioned edited plants failed to produce tolerance to quizalofop-p or fenoxaprop-p-ethyl.

[0171] 2.3 Clethodim, haloxyfop-p-methyl, fenoxaprop, and butyclofen:

[0172] The tolerance of the I1879V edited plants to clethodim, haloxyfop-p-methyl, fenoxaprop, and butyclofen was tested, where the clethodim, haloxyfop-p-methyl, and fenoxaprop were each applied at concentrations of 5 g.a.i./mu (1×) and 10 g.a.i./mu (2×); and the butyclofen was applied at concentrations of 10 g.a.i./mu (1×) and 20 g.a.i./mu (2×). After the herbicide was applied for 20 d, the growth of the edited plants was observed and the herbicide resistance of the edited plants was counted. As shown in FIG. 7, the I1879V edited plants showed some phytotoxicity at the above-mentioned 1× herbicide concentration, with a mortality rate of 30% to 50%; and at the above-mentioned 2× herbicide concentration, the edited plants were basically in a non-resistant state, with a mortality rate of 70% to 90%.

[0173] All documents mentioned in the present disclosure are cited as references in the present application, as if each document was individually cited as a reference. In addition, it should be understood that various changes or modifications may be made to the present disclosure by those skilled in the art after reading the above teaching content of the present disclosure, and these equivalent forms also fall within the scope defined by the appended claims of the present disclosure.