USE OF A1CF INHIBITORS FOR TREATING HEPATITIS B VIRUS INFECTION

Abstract

The present invention relates to an A1CF inhibitor for use in treatment of an HBV infection, in particular a chronic HBV infection. The invention in particular relates to the use of A1CF inhibitors for destabilizing cccDNA, such as HBV cccDNA. The invention also relates to nucleic acid molecules which are complementary to A1CF and capable of reducing the level of an A1CF mRNA. Also comprised in the present invention is a pharmaceutical composition and its use in the treatment of a HBV infection.

Claims

1. An A1CF (APOBEC1 complementation factor) inhibitor for use in the treatment of Hepatitis B virus (HBV) infection.

2. The A1CF inhibitor for use according to claim 1, wherein the HBV infection is a chronic infection.

3. The A1CF inhibitor for use according to claim 1 or 2, wherein the A1CF inhibitor is capable of reducing the amount of cccDNA (covalently closed circular DNA) in an HBV infected cell.

4. The A1CF inhibitor for use according to any one of claims 1 to 3, wherein said inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 95% complementary, such as fully complementary, to a mammalian A1CF target sequence, in particular a human A1CF target sequence, and is capable of reducing the expression of A1CF mRNA in a cell which expresses the A1CF mRNA.

5. The A1CF inhibitor for use according to any one of claims 1 to 4, wherein said inhibitor is selected from the group consisting of a single stranded antisense oligonucleotide, an siRNA and a shRNA.

6. The A1CF inhibitor for use according to any one of claims 1 to 5, wherein the mammalian A1CF target sequence is selected from the group consisting of SEQ ID NOs: 1, 4, 5, 6, 7, 8, 9, 10, and 11.

7. The A1CF inhibitor for use according to any one of claims 4 to 6, wherein the contiguous nucleotide sequence is at least 98% complementary, such as fully complementary, to the target sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

8. The A1CF inhibitor for use according to any one of claims 3 to 7, wherein the amount of cccDNA in the HBV infected cell is reduced by at least 60%.

9. The A1CF inhibitor for use according to any one of claims 4 to 7, wherein the A1CF mRNA is reduced by at least 60%.

10. A nucleic acid molecule of 12 to 30 nucleotides in length comprising a contiguous nucleotides sequence of at least 12 nucleotides which is 90% complementary, such as fully complementary, to a mammalian A1CF target sequence, in particular a human A1CF target sequence, wherein the nucleic acid molecule is capable of inhibiting the expression of A1CF mRNA.

11. The nucleic acid molecule according to claim 10, wherein the contiguous nucleotide sequence is fully complementary to a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 5, 6, 7, 8, 9, 10, and 11.

12. The nucleic acid molecule according to claim 10 or 11, wherein the nucleic acid molecule comprises a contiguous nucleotide sequence of 12 to 25, such as 16 to 20 nucleotides in length.

13. The nucleic acid molecule of any one of claims 10 to 12, wherein the nucleic acid molecule is a RNAi molecule, such as a double stranded siRNA or a shRNA.

14. The nucleic acid molecule of any one of claims 10 to 12, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide.

15. The nucleic acid molecule according to 14, wherein the single stranded antisense oligonucleotide is capable of recruiting RNase H.

16. The nucleic acid molecule according to any one of claims 10 to 15, wherein the nucleic acid molecule comprises one or more 2′ sugar modified nucleosides.

17. The nucleic acid molecule according to claim 16, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.

18. The nucleic acid molecule according to any one of claim 16 or 17, wherein the one or more 2′ sugar modified nucleosides are LNA nucleosides.

19. The nucleic acid molecule according to any one of claims 10 to 18, where the contiguous nucleotide sequence comprises at least one phosphorothioate internucleoside linkage.

20. The nucleic acid molecule according to claim 19, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

21. The nucleic acid molecule according to any one of claims 10 to 20, wherein the nucleic acid molecule, or contiguous nucleotide sequence thereof, comprises a gapmer of formula 5′-F-G-F′-3′, wherein regions F and F′ independently comprise 1-4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H, such as a region comprising between 6 and 18 DNA nucleosides.

22. A conjugate compound comprising a nucleic acid molecule according to any one of claims 10 to 21 and at least one conjugate moiety covalently attached to said nucleic acid molecule.

23. The conjugate compound of claim 22, wherein the conjugate moiety is or comprises a GalNAc moiety, such as a trivalent GalNAc moiety, for example a GalNAc moiety selected from one or more of the trivalent GalNAc moieties in FIG. 1.

24. The conjugate compound of claim 22 or 23, wherein the conjugate compound comprises a physiologically labile linker composed of 2 to 5 linked nucleosides comprising at least two consecutive phosphodiester linkages, wherein the physiologically labile linker is covalently bound at the 5′ or 3′ terminal of the nucleic acid molecule.

25. A pharmaceutically acceptable salt of a nucleic acid molecule according to any one of claims 10 to 21, or a conjugate compound according to any one of claims 22 to 24.

26. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, or a pharmaceutically acceptable salt according to claim 25 and a pharmaceutically acceptable excipient.

27. An in vivo or in vitro method for inhibiting A1CF expression in a target cell which is expressing A1CF, said method comprising administering a nucleic acid molecule according to any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, a pharmaceutically acceptable salt according to claim 25, or a pharmaceutical composition according to claim 26 in an effective amount to said cell.

28. A method for treating a disease comprising administering a therapeutically or prophylactically effective amount of a nucleic acid molecule according to any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, a pharmaceutically acceptable salt according to claim 25, or a pharmaceutical composition according to claim 26, to a subject suffering from or susceptible to a disease.

29. A method according to claim 28, wherein the disease is Hepatitis B Virus (HBV) infection, such as a chronic HBV infection.

30. A nucleic acid molecule according any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, a pharmaceutically acceptable salt according to claim 25, or a pharmaceutical composition according to claim 26 for use in medicine.

31. A nucleic acid molecule according any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, a pharmaceutically acceptable salt according to claim 25, or a pharmaceutical composition according to claim 26, for use in the treatment of Hepatitis B Virus (HBV) infection, such as a chronic HBV infection.

32. Use of a nucleic acid molecule according any one of claims 10 to 21, a conjugate compound according to any one of claims 22 to 24, a pharmaceutically acceptable salt according to claim 25, or a pharmaceutical composition according to claim 26, for the preparation of a medicament for the treatment of Hepatitis B Virus (HBV) infection, such as a chronic HBV infection.

Description

BRIEF DESCRIPTION OF FIGURES

[0019] FIG. 1A-L: Illustrates exemplary antisense oligonucleotide conjugates, wherein the oligonucleotide is represented by the term “Oligonucleotide” and the asialoglycoprotein receptor targeting conjugate moieties are trivalent N-acetylgalactosamine moieties. Compounds in FIG. 1A-D comprise a di-lysine brancher molecule, a PEG3 spacer and three terminal GalNAc carbohydrate moieties. In the compounds in FIG. 1A (FIG. 1A-1 and FIG. 1A-2 show two different diastereoisomers of the same compound) and FIG. 1B (FIG. 1B-1 and FIG. 1B-2 show two different diastereoisomers of the same compound) the oligonucleotide is attached directly to the asialoglycoprotein receptor targeting conjugate moiety without a linker. In the compounds in FIG. 10 (FIG. 1C-1 and FIG. 1C-2 show two different diastereoisomers of the same compound) and FIG. 1D (FIG. 1D-1 and FIG. 1D-2 show two different diastereoisomers of the same compound) the oligonucleotide is attached to the asialoglycoprotein receptor targeting conjugate moiety via a C6 linker. The compounds in FIG. 1E-K comprise a commercially available trebler brancher molecule and spacers of varying length and structure and three terminal GalNAc carbohydrate moieties. The compound in FIG. 1L is composed of monomeric GalNAc phosphoramidites added to the oligonucleotide while still on the solid support as part of the synthesis, wherein X=S or O, and independently Y=S or O, and n=1-3 (see WO 2017/178656). FIG. 1B and FIG. 1D are also termed GalNAc2 or GN2 herein, without and with C6 linker respectively.

[0020] The two different diastereoisomers shown in each of FIG. 1A-D are the result of the conjugation reaction. A pool of a specific antisense oligonucleotide conjugate can therefore contain only one of the two different diastereoisomers, or a pool of a specific antisense oligonucleotide conjugate can contain a mixture of the two different diastereoisomers.

DEFINITIONS

[0021] HBV Infection

[0022] The term “hepatitis B virus infection” or “HBV infection” is commonly known in the art and refers to an infectious disease that is caused by the hepatitis B virus (HBV) and affects the liver. A HBV infection can be an acute or a chronic infection. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million individuals worldwide. Approximately 686,000 deaths annually are attributed to HBV-related end-stage liver diseases and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., Lancet. 2015 Oct. 17; 386(10003):1546-55). WHO projected that without expanded intervention, the number of people living with CHB infection will remain at the current high levels for the next 40-50 years, with a cumulative 20 million deaths occurring between 2015 and 2030 (WHO 2016). CHB infection is not a homogenous disease with singular clinical presentation. Infected individuals have progressed through several phases of CHB-associated liver disease in their life; these phases of disease are also the basis for treatment with standard of care (SOC). Current guidelines recommend treating only selected CHB-infected individuals based on three criteria—serum ALT level, HBV DNA level, and severity of liver disease (EASL, 2017). This recommendation was due to the fact that SOC i.e. nucleos(t)ide analogs (NAs) and pegylated interferon-alpha (PEG-IFN), are not curative and must be administered for long periods of time thereby increasing their safety risks. NAs effectively suppress HBV DNA replication; however, they have very limited/no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the main targets of novel drugs aiming for HBV cure. In the plasma of CHB individuals, HBsAg subviral (empty) particles outnumber HBV virions by a factor of 103 to 105 (Ganem & Prince, N Engl J Med. 2004 Mar. 11; 350(11):1118-29); its excess is believed to contribute to immunopathogenesis of the disease, including inability of individuals to develop neutralizing anti-HBs antibody, the serological marker observed following resolution of acute HBV infection.

[0023] In some embodiments, the term “HBV infection” refers to “chronic HBV infection”.

[0024] Further, the term encompasses infection with any HBV genotype.

[0025] In some embodiments, the patient to be treated is infected with HBV genotype A.

[0026] In some embodiments, the patient to be treated is infected with HBV genotype B.

[0027] In some embodiments, the patient to be treated is infected with HBV genotype C.

[0028] In some embodiments, the patient to be treated is infected with HBV genotype D.

[0029] In some embodiments, the patient to be treated is infected with HBV genotype E.

[0030] In some embodiments, the patient to be treated is infected with HBV genotype F.

[0031] In some embodiments, the patient to be treated is infected with HBV genotype G.

[0032] In some embodiments, the patient to be treated is infected with HBV genotype H.

[0033] In some embodiments, the patient to be treated is infected with HBV genotype I.

[0034] In some embodiments, the patient to be treated is infected with HBV genotype J.

cccDNA (Covalently Closed Circular DNA)

[0035] cccDNA is the viral genetic template of HBV that resides in the nucleus of infected hepatocytes, where it gives rise to all HBV RNA transcripts needed for productive infection and is responsible for viral persistence during natural course of chronic HBV infection (Locarnini & Zoulim, Antivir Ther. 2010; 15 Suppl 3:3-14. doi: 10.3851/IMP1619). Acting as a viral reservoir, cccDNA is the source of viral rebound after cessation of treatment, necessitating long term, often lifetime treatment. PEG-IFN can only be administered to a small subset of CHB due to its various side effects.

[0036] Consequently, novel therapies that can deliver a complete cure, defined by degradation or elimination of HBV cccDNA, to the majority of CHB patients are highly needed.

Compound

[0037] Herein, the term “compound” means any molecule capable of inhibition A1CF expression or activity. Particular compounds of the invention are nucleic acid molecules, such as RNAi molecules or antisense oligonucleotides according to the invention or any conjugate comprising such a nucleic acid molecule. For example, herein the compound may be a nucleic acid molecule targeting A1CF, in particular an antisense oligonucleotide or a siRNA.

Oligonucleotide

[0038] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0039] The oligonucleotides referred to in the description and claims are generally therapeutic oligonucleotides below 70 nucleotides in length. The oligonucleotide may be or comprise a single stranded antisense oligonucleotide, or may be another nucleic acid molecule, such as a CRISPR RNA, a siRNA, shRNA, an aptamer, or a ribozyme. Therapeutic oligonucleotide molecules are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. shRNA's are however often delivered to cells using lentiviral vectors from which they are then transcribed to produce the single stranded RNA that will form a stem loop (hairpin) RNA structure that is capable of interacting with the RNA interference machinery (including the RNA-induced silencing complex (RISC)). In an embodiment of the present invention the shRNA is chemically produced shRNA molecules (not relying on cell based expression from plasmids or viruses). When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. Generally, the oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. Although in some embodiments the oligonucleotide of the invention is a shRNA transcribed from a vector upon entry into the target cell. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.

[0040] In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 70 nucleotides in length, such as from 12 to 60, such as from 13 to 50, such as from 14 to 40, such as from 15 to 30, such as from 16 to 25, such as from 16 to 22, such as from 16 to 20 contiguous nucleotides in length. Accordingly, the oligonucleotide of the present invention, in some embodiments, may have a length of 12 to 25 nucleotides. Alternatively, the oligonucleotide of the present invention, in some embodiments, may have a length of 15 to 22 nucleotides.

[0041] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 24 or less nucleotides, such as 22, such as 20 or less nucleotides, such as 18 or less nucleotides, such as 14, 15, 16 or 17 nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if a nucleic acid molecule is said to include from 12 to 25 nucleotides, both 12 and 25 nucleotides are included.

[0042] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length The olignucleotide(s) are for modulating the expression of a target nucleic acid in a mammal. In some embodiments the nucleic acid molecules, such as for siRNAs, shRNAs and antisense oligonucleotides, are typically for inhibiting the expression of a target nucleic acid(s).

[0043] In one embodiment, of the invention oligonucleotide is selected from a RNAi agent, such as a siRNA or shRNA. In another embodiment, the oligonucleotide is a single stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide interacting with RNase H.

[0044] In some embodiments the oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides.

[0045] In some embodiments the oligonucleotide comprises phosphorothioate internucleoside linkages.

[0046] In some embodiments the oligonucleotide may be conjugated to non-nucleosidic moieties (conjugate moieties).

[0047] A library of oligonucleotides is to be understood as a collection of variant oligonucleotides. The purpose of the library of oligonucleotides can vary. In some embodiments, the library of oligonucleotides is composed of oligonucleotides with overlapping nucleobase sequence targeting one or more mammalian A1CF target nucleic acids with the purpose of identifying the most potent sequence within the library of oligonucleotides. In some embodiments, the library of oligonucleotides is a library of oligonucleotide design variants (child nucleic acid molecules) of a parent or ancestral oligonucleotide, wherein the oligonucleotide design variants retaining the core nucleobase sequence of the parent nucleic acid molecule.

Antisense Oligonucleotides

[0048] The term “antisense oligonucleotide” or “ASO” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self complementarity is less than 50% across of the full length of the oligonucleotide.

[0049] Advantageously, the single stranded antisense oligonucleotide of the invention does not contain RNA nucleosides, since this will decrease nuclease resistance.

[0050] Advantageously, the oligonucleotide of the invention comprises one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides. Furthermore, it is advantageous that the nucleosides which are not modified are DNA nucleosides.

RNAi Molecules

[0051] Herein, the term “RNA interference (RNAi) molecule” refers to short double-stranded oligonucleotide containing RNA nucleosides and which mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC), where they interact with the catalytic RISC component argonaute. The RNAi molecule modulates, e g., inhibits, the expression of the target nucleic acid in a cell, e.g. a cell within a subject. such as a mammalian subject. RNAi molecules includes single stranded RNAi molecules (Lima at al 2012 Cell 150: 883) and double stranded siRNAs, as well as short hairpin RNAs (shRNAs). In some embodiments of the invention, the oligonucleotide of the invention or contiguous nucleotide sequence thereof is a RNAi agent, such as a siRNA.

siRNA

[0052] The term “small interfering ribonucleic acid” or “siRNA” refers to a small interfering ribonucleic acid RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. siRNAs typically comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as the guide strand), wherein each strand are of 17 to 30 nucleotides in length, typically 19 to 25 nucleosides in length, wherein the antisense strand is complementary, such as at least 95% complementary, such as fully complementary, to the target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand so that the sense strand and antisense strand form a duplex or duplex region. siRNA strands may form a blunt ended duplex, or advantageously the sense and antisense strand 3′ ends may form a 3′ overhang of e.g. 1, 2 or 3 nucleosides to resemble the product produced by Dicer, which forms the RISC substrate in vivo. Effective extended forms of Dicer substrates have been described in U.S. Pat. Nos. 8,349,809 and 8,513,207, hereby incorporated by reference. In some embodiments, both the sense strand and antisense strand have a 2 nt 3′ overhang. The duplex region may therefore be, for example 17 to 25 nucleotides in length, such as 21 to 23 nucleotide in length.

[0053] Once inside a cell the antisense strand is incorporated into the RISC complex which mediate target degradation or target inhibition of the target nucleic acid. siRNAs typically comprise modified nucleosides in addition to RNA nucleosides. In one embodiment, the siRNA molecule may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA. In particular, 2′fluoro, 2′-O-methyl or 2′-O-methoxyethyl may be incorporated into siRNAs.

[0054] In some embodiments, all of the nucleotides of an siRNA sense (passenger) strand may be modified with 2′ sugar modified nucleosides such as LNA (see WO2004/083430, WO2007/085485 for example). In some embodiments, the passenger stand of the siRNA may be discontinuous (see WO2007/107162 for example). The incorporation of thermally destabilizing nucleotides occurring at a seed region of the antisense strand of siRNAs have been reported as useful in reducing off-target activity of siRNAs (see WO2018/098328 for example). Suitably the siRNA comprises a 5′ phosphate group or a 5′-phosphate mimic at the 5′ end of the antisense strand. In some embodiments, the 5′ end of the antisense strand is a RNA nucleoside.

[0055] In one embodiment, the siRNA molecule further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. The phosphorothioaie or methylphosphonate internucleoside linkage may be at the 3′-terminus one or both strand (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the 5′-terminus of one or both strands (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the both the 5′- and 3′-terminus of one or both strands (e.g., the antisense strand; or the sense strand). In some embodiments, the remaining internucleoside linkages are phosphodiester linkages. In some embodiments, siRNA molecules comprise one or more phosphorothioate internucleoside linkages. In siRNA molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS, it is therefore advantageous that not all internucleoside linkages in the antisense strand are modified.

[0056] The siRNA molecule may further comprise a ligand. In some embodiments, the ligand is conjugated to the 3′ end of the sense strand.

[0057] For biological distribution, siRNAs may be conjugated to a targeting ligand, and/or be formulated into lipid nanoparticles.

[0058] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA, such as siRNA molecules suitable for therapeutic use, and methods of inhibiting the expression of the target gene by administering the dsRNA molecules such as siRNAs of the invention, e.g., for the treatment of various disease conditions as disclosed herein.

shRNA

[0059] The term “short hairpin RNA” or “shRNA” refers to molecules that are generally between 40 and 70 nucleotides in length, such as between 45 and 65 nucleotides in length, such as 50 and 60 nucleotides in length and form a stem loop (hairpin) RNA structure which interacts with the endonuclease known as Dicer which is believed to processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs which are then incorporated into an RNA-induced silencing complex (RISC). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing. shRNA oligonucleotides may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA.

[0060] In some embodiments, shRNA molecule comprises one or more phosphorothioate internucleoside linkages. In RNAi molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS it is therefore advantageous that not al internucleoside linkages in the stem loop of the shRNA molecule are modified. Phosphorothioate internucleoside linkages can advantageously be placed in the 3′ and/or 5′ end of the stem loop of the shRNA molecule, in particular in the part of the molecule that is not complementary to the target nucleic acid. The region of the shRNA molecule that is complementary to the target nucleic acid may however also be modified in the first 2 to 3 internucleoside linkages in the part that is predicted to become the 3′ and/or 5′ terminal following cleavage by Dicer.

Contiguous Nucleotide Sequence

[0061] The term “contiguous nucleotide sequence” refers to the region of the nucleic acid molecule which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments, all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is included in the guide strand of an siRNA molecule. In some embodiments, the contiguous nucleotide sequence is the part of an shRNA molecule which is 100% complementary to the target nucleic acid. In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence, such as a F-G-F′ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group for targeting) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of the antisense oligonucleotide is the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.

Nucleotides and Nucleosides

[0062] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

Modified Nucleoside

[0063] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.

Modified Internucleoside Linkage

[0064] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. The oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages, such as a one or more phosphorothioate internucleoside linkages, or one or more phosphorodithioate internucleoside linkages.

[0065] With the oligonucleotide of the invention it is advantageous to use phosphorothioate internucleoside linkages.

[0066] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments, all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.

[0067] In some advantageous embodiments, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0068] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides may comprise other internucleoside linkages (other than phosphodiester and phosphorothioate), for example alkyl phosphonate/methyl phosphonate internucleoside linkages, which according to EP 2 742 135 may for example be tolerated in an otherwise DNA phosphorothioate gap region.

Nucleobase

[0069] The term “nucleobase” includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0070] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2′thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.

[0071] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.

Modified Oligonucleotide

[0072] The term “modified oligonucleotide” describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term “chimeric oligonucleotide” is a term that has been used in the literature to describe oligonucleotides comprising modified nucleosides and DNA nucleosides. The antisense oligonucleotide of the invention is advantageously a chimeric oligonucleotide.

Complementarity

[0073] The term “complementarity” or “complementary” describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)—thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0074] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pair) between the two sequences (when aligned with the target sequence 5′-3′ and the oligonucleotide sequence from 3′-5′), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5′-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0075] The term “fully complementary”, refers to 100% complementarity.

Identity

[0076] The term “Identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity=(Matches×100)/Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

Hybridization

[0077] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T.sub.m) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T.sub.m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K.sub.d) of the reaction by ΔG°=−RT ln(K.sub.d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔG° is the energy associated with a reaction where aqueous concentrations are 1M, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔG° is less than zero. ΔG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA, 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔG° values below −10 kcal for oligonucleotides that are 10 to 30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔG° values below −10 kcal, such as below −15 kcal, such as below −20 kcal and such as below −25 kcal for oligonucleotides that are 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value in the range of of −10 to −60 kcal, such as −12 to −40, such as from −15 to −30 kcal or −16 to −27 kcal such as −18 to −25 kcal.

Target Nucleic Acid

[0078] According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian A1CF and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as A1CF target nucleic acid.

[0079] Suitably, the target nucleic acid encodes an A1CF protein, in particular mammalian A1CF, such as the human A1CF gene encoding pre-mRNA or mRNA sequences provided herein as SEQ ID NO: 1, 4, 5, 6, 7, 8, 9, 10, or 11.

[0080] The therapeutic oligonucleotides of the invention may for example target exon regions of a mammalian A1CF (in particular siRNA and shRNA, but also antisense oligonucleotides), or may for example target any intron region in the A1CF pre-mRNA (in particular antisense oligonucleotides). The human A1CF gene encodes 10 transcript, eight of which are protein coding and therefore potential nucleic acid targets.

[0081] Table 1 lists predicted exon and intron regions of SEQ ID NO: 1, i.e. of the human A1CF pre-mRNA sequence.

TABLE-US-00001 TABLE 1 Exon and intron regions in the human A1CF pre-mRNA. Exonic regions in the Intronic regions in the human A1CF premRNA human A1CF premRNA (SEQ ID NO: 1) (SEQ ID NO: 1) ID start end ID start end E1 1 95 I1 96 21595 E2 21596 21643 I2 21644 22694 E3 22695 22787 I3 22788 25690 E4 25691 25834 I4 25835 34868 E5 34869 35011 I5 35012 41553 E6 41554 41688 I6 41689 43683 E7 43684 43814 I7 43815 49363 E8 49364 49602 I8 49603 57380 E9 57381 57545 I9 57546 65026  E10 65027 65124  I10 65125 69396  E11 69397 69670  I11 69671 71613  E12 71614 71819  I12 71820 74499  E13 74500 74636  I13 74637 75633  E14 75634 75782  I14 75783 78795  E15 78796 86255

[0082] Suitably, the target nucleic acid encodes an A1CF protein, in particular mammalian A1CF, such as human A1CF (See for example Table 2 and Table 3) which provides an overview on the genomic sequences of human, cyno monkey and mouse A1CF (Table 2) and on pre-mRNA sequences for human, monkey and mouse A1CF and for the mature mRNAs for human A1CF (Table 3).

[0083] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 6, 7, 8, 10, and 11, or naturally occurring variants thereof (e.g. sequences encoding a mammalian A1CF).

TABLE-US-00002 TABLE 2 Genome and assembly information for A1CF across species. Genomic coordinates ensembl Species Chr. Strand Start End Assembly gene_id Human 10 Rv 50799409 50885675 GRCh38.p12 ENSG00000148584 Cyno monkey 9 Fwd 85376801 85454053 Macaca_fascicularis_5.0 ENSMFAG00000035948 Mouse 19 Fwd 31868764 31948995 GRCm38.p5 ENSMUSG00000052595 Fwd = forward strand. Rv = reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence).

[0084] If employing the nucleic acid molecule of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0085] For in vivo or in vitro application, the therapeutic nucleic acid molecule of the invention is typically capable of inhibiting the expression of the A1CF target nucleic acid in a cell which is expressing the A1CF target nucleic acid. In some embodiments, said cell comprises HBV cccDNA. The contiguous sequence of nucleobases of the nucleic acid molecule of the invention is typically complementary to a conserved region of the A1CF target nucleic acid, as measured across the length of the nucleic acid molecule, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides. The target nucleic acid is a messenger RNA, such as a pre-mRNA which encodes mammalian A1CF protein, such as human A1CF, e.g. the human A1CF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 1, the monkey A1CF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 2, or the mouse A1CF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 3, or a mature A1CF mRNA, such as that a human mature mRNA disclosed as SEQ ID NO: 4, 6, 7, 8, 10, or 11. SEQ ID NOs: 1-13 are DNA sequences—it will be understood that target RNA sequences have uracil (U) bases in place of the thymidine bases (T).

[0086] Further information on exemplary target nucleic acids is provided in Tables 2 and 3.

TABLE-US-00003 TABLE 3 Overview on target nucleic acids. Target Nucleic Acid, Species, Reference Sequence ID A1CF Homo sapiens pre-mRNA SEQ ID NO: 1 A1CF Macaca fascicularis pre-mRNA SEQ ID NO: 2 A1CF Mus musculus pre-mRNA SEQ ID NO: 3 A1CF Homo sapiens mature mRNA, SEQ ID NO: 4 variant 1 (ENST00000374001) A1CF Homo sapiens mature mRNA, SEQ ID NO: 5 variant 2 (ENST00000395489) A1CF Homo sapiens mature mRNA, SEQ ID NO: 6 variant 3 (ENST00000282641) A1CF Homo sapiens mature mRNA, SEQ ID NO: 7 variant 4 (ENST00000395495) A1CF Homo sapiens mature mRNA, SEQ ID NO: 8 variant 5 (ENST00000373997) A1CF Homo sapiens mature mRNA, SEQ ID NO: 9 variant 6 (ENST00000373995) A1CF Homo sapiens mature mRNA, SEQ ID NO: 10 variant 8 (ENST00000373993) A1CF Homo sapiens mature mRNA, SEQ ID NO: 11 variant 9 (ENST00000414883)

[0087] In some embodiments, the target nucleic acid is SEQ ID NO: 1.

[0088] In some embodiments, the target nucleic acid is SEQ ID NO: 2.

[0089] In some embodiments, the target nucleic acid is SEQ ID NO: 3.

[0090] In some embodiments, the target nucleic acid is SEQ ID NO: 4.

[0091] In some embodiments, the target nucleic acid is SEQ ID NO: 5.

[0092] In some embodiments, the target nucleic acid is SEQ ID NO: 6.

[0093] In some embodiments, the target nucleic acid is SEQ ID NO: 7.

[0094] In some embodiments, the target nucleic acid is SEQ ID NO: 8.

[0095] In some embodiments, the target nucleic acid is SEQ ID NO: 9.

[0096] In some embodiments, the target nucleic acid is SEQ ID NO: 10.

[0097] In some embodiments, the target nucleic acid is SEQ ID NO: 11.

Target Sequence

[0098] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide or nucleic acid molecule of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid with a nucleobase sequence that is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence or target region. In some embodiments, the target sequence is longer than the complementary sequence of a nucleic acid molecule of the invention, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several nucleic acid molecules of the invention.

[0099] In some embodiments, the target sequence is a sequence selected from the group consisting of a human A1CF mRNA exon, such as an A1CF human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, e7, e8, e9, e10, e11, e12, 13, e14, and e15, (see for example Table 1 above).

[0100] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an exon region of SEQ ID NO: 1, selected from the group consisting of e1-e15 (see Table 1).

[0101] In some embodiments, the target sequence is a sequence selected from the group consisting of a human A1CFmRNA intron, such as an A1CF human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5, i6, i7, i8, i9, i10, i11, i12, i13, and i14 (see for example Table 1 above).

[0102] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an intron region of SEQ ID NO: 1, selected from the group consisting of i1-i14 (see Table 1).

[0103] In some embodiments, the target sequence is selected from the group consisting of SEQ ID NO: 12, 13, 14 and 15. In some embodiments, the contiguous nucleotide sequence as referred to herein is at least 90% complementary, such as at least 95% complementary to a target sequence selected from the group consisting of SEQ ID NO: 12, 13, 14 and 15. In some embodiments, the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NO: 12, 13, 14 and 15.

[0104] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a region on the target nucleic acid, such as a target sequence described herein.

[0105] The target nucleic acid sequence to which the therapeutic oligonucleotide is complementary or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous nucleotide sequence is between 12 to 70 nucleotides, such as 12 to 50, such as 13 to 30, such as 14 to 25, such as 15 to 20, such as 16 to 18 contiguous nucleotides.

[0106] In some embodiments, the oligonucleotide of the present invention targets a region shown in Table 4 or 5.

TABLE-US-00004 TABLE 4 Exemplary target regions Target start SEQ end SEQ region ID NO: 1 ID NO: 1    1A 1 31    2A 33 112    3A 114 137    4A 147 171    5A 196 211    6A 215 238    7A 251 267    8A 269 290    9A 301 388   10A 390 425   11A 428 448   12A 455 470   13A 498 514   14A 516 540   15A 560 594   16A 612 647   17A 671 709   18A 719 777   19A 802 818   20A 833 873   21A 888 929   22A 944 959   23A 963 978   24A 980 998   25A 1023 1057   26A 1103 1132   27A 1146 1171   28A 1175 1201   29A 1203 1303   30A 1305 1330   31A 1333 1351   32A 1353 1435   33A 1450 1473   34A 1481 1512   35A 1515 1538   36A 1540 1559   37A 1562 1588   38A 1591 1613   39A 1615 1649   40A 1634 1648   41A 1678 1723   42A 1725 1741   43A 1742 1788   44A 1803 1848   45A 1856 1871   46A 1873 1887   47A 1896 1941   48A 1943 1961   49A 1970 2010   50A 2012 2034   51A 2038 2053   52A 2072 2098   53A 2137 2164   54A 2160 2179   55A 2181 2211   56A 2213 2230   57A 2232 2264   58A 2266 2308   59A 2310 2357   60A 2374 2392   61A 2394 2413   62A 2419 2437   63A 2439 2454   64A 2471 2524   65A 2526 2554   66A 2556 2576   67A 2581 2597   68A 2599 2620   69A 2646 2737   70A 2739 2754   71A 2766 2786   72A 2788 2822   73A 2823 2882   74A 2884 2951   75A 2953 3051   76A 3053 3067   77A 3070 3118   78A 3121 3166   79A 3179 3196   80A 3200 3215   81A 3257 3278   82A 3279 3300   83A 3334 3366   84A 3354 3368   85A 3391 3412   86A 3392 3410   87A 3400 3420   88A 3414 3430   89A 3435 3452   90A 3435 3450   91A 3465 3480   92A 3473 3508   93A 3473 3502   94A 3477 3500   95A 3477 3499   96A 3487 3501   97A 3520 3535   98A 3520 3538   99A 3540 3591  100A 3593 3620  101A 3655 3711  102A 3717 3735  103A 3737 3761  104A 3773 3802  105A 3804 3829  106A 3838 3860  107A 3862 3878  108A 3880 3899  109A 3926 3965  110A 3973 3987  111A 4001 4021  112A 4023 4039  113A 4051 4086  114A 4094 4108  115A 4121 4154  116A 4191 4242  117A 4244 4294  118A 4397 4416  119A 4442 4475  120A 4442 4459  121A 4505 4529  122A 4514 4529  123A 4515 4529  124A 4542 4556  125A 4544 4561  126A 4563 4577  127A 4585 4599  128A 4603 4623  129A 4627 4643  130A 4687 4706  131A 4721 4746  132A 4756 4770  133A 4772 4812  134A 4814 4845  135A 4847 4886  136A 4896 4934  137A 4950 4978  138A 4980 5003  139A 5006 5022  140A 5057 5079  141A 5109 5154  142A 5177 5192  143A 5194 5216  144A 5235 5249  145A 5264 5315  146A 5317 5353  147A 5369 5387  148A 5389 5409  149A 5411 5425  150A 5434 5491  151A 5505 5523  152A 5525 5551  153A 5565 5581  154A 5628 5644  155A 5674 5689  156A 5730 5750  157A 5755 5778  158A 5780 5810  159A 5812 5864  160A 5869 5889  161A 5891 5915  162A 5952 5971  163A 5986 6020  164A 6128 6164  165A 6166 6187  166A 6192 6215  167A 6240 6257  168A 6259 6283  169A 6331 6392  170A 6394 6423  171A 6434 6470  172A 6472 6497  173A 6499 6533  174A 6535 6556  175A 6558 6593  176A 6612 6631  177A 6631 6647  178A 6649 6671  179A 6673 6719  180A 6730 6746  181A 6804 6833  182A 6835 6853  183A 6895 6915  184A 6917 6931  185A 6933 7001  186A 7017 7042  187A 7059 7074  188A 7076 7096  189A 7098 7115  190A 7129 7151  191A 7153 7181  192A 7197 7260  193A 7262 7280  194A 7296 7421  195A 7463 7483  196A 7489 7509  197A 7525 7539  198A 7533 7548  199A 7550 7567  200A 7569 7590  201A 7607 7629  202A 7624 7638  203A 7640 7660  204A 7648 7674  205A 7663 7682  206A 7680 7707  207A 7696 7717  208A 7719 7737  209A 7739 7778  210A 7778 7795  211A 7780 7795  212A 7845 7898  213A 7900 7916  214A 7918 7938  215A 7940 7960  216A 7971 7990  217A 8003 8046  218A 8058 8075  219A 8086 8173  220A 8201 8218  221A 8220 8252  222A 8278 8314  223A 8322 8340  224A 8357 8372  225A 8389 8414  226A 8416 8432  227A 8446 8472  228A 8504 8526  229A 8528 8543  230A 8570 8587  231A 8603 8637  232A 8665 8687  233A 8689 8722  234A 8773 8793  235A 8795 8814  236A 8836 8851  237A 8854 8906  238A 8921 8993  239A 9019 9047  240A 9053 9101  241A 9103 9121  242A 9123 9159  243A 9171 9185  244A 9187 9211  245A 9213 9229  246A 9231 9249  247A 9251 9276  248A 9282 9326  249A 9374 9390  250A 9407 9426  251A 9460 9476  252A 9507 9525  253A 9535 9590  254A 9607 9628  255A 9636 9683  256A 9685 9703  257A 9705 9733  258A 9735 9818  259A 9820 9837  260A 9839 9896  261A 9898 9915  262A 9917 9939  263A 9960 10000  264A 10002 10020  265A 10031 10066  266A 10082 10166  267A 10208 10228  268A 10230 10257  269A 10259 10278  270A 10289 10321  271A 10325 10340  272A 10355 10369  273A 10374 10396  274A 10406 10421  275A 10459 10510  276A 10512 10573  277A 10592 10610  278A 10612 10635  279A 10658 10714  280A 10716 10764  281A 10770 10818  282A 10820 10838  283A 10858 10873  284A 10905 10928  285A 10930 10949  286A 10959 11037  287A 11045 11077  288A 11084 11107  289A 11109 11125  290A 11135 11190  291A 11207 11256  292A 11269 11314  293A 11316 11334  294A 11336 11366  295A 11388 11445  296A 11472 11496  297A 11507 11542  298A 11567 11598  299A 11613 11648  300A 11664 11685  301A 11687 11740  302A 11748 11802  303A 11810 11840  304A 11842 11861  305A 11863 11878  306A 11885 11914  307A 11922 11940  308A 11944 11975  309A 11978 12009  310A 12011 12029  311A 12032 12053  312A 12070 12101  313A 12107 12126  314A 12132 12162  315A 12165 12180  316A 12240 12256  317A 12270 12292  318A 12309 12346  319A 12348 12367  320A 12381 12403  321A 12412 12428  322A 12442 12456  323A 12446 12467  324A 12492 12512  325A 12501 12517  326A 12532 12560  327A 12548 12563  328A 12549 12563  329A 12557 12571  330A 12575 12593  331A 12594 12611  332A 12599 12635  333A 12619 12633  334A 12639 12657  335A 12640 12656  336A 12645 12701  337A 12645 12659  338A 12668 12683  339A 12702 12721  340A 12703 12721  341A 12704 12722  342A 12705 12723  343A 12706 12724  344A 12707 12725  345A 12708 12726  346A 12709 12727  347A 12710 12728  348A 12711 12729  349A 12711 12730  350A 12715 12732  351A 12735 12795  352A 12815 12835  353A 12857 12873  354A 12875 12900  355A 12902 12937  356A 12972 13033  357A 13035 13056  358A 13090 13123  359A 13173 13219  360A 13245 13275  361A 13301 13316  362A 13318 13342  363A 13344 13400  364A 13402 13433  365A 13455 13547  366A 13566 13580  367A 13582 13607  368A 13614 13628  369A 13622 13667  370A 13669 13694  371A 13716 13757  372A 13759 13804  373A 13806 13840  374A 13863 13897  375A 13899 13917  376A 13919 13934  377A 13936 14008  378A 14010 14049  379A 14086 14100  380A 14103 14118  381A 14124 14163  382A 14174 14258  383A 14288 14319  384A 14367 14412  385A 14422 14447  386A 14463 14480  387A 14483 14546  388A 14548 14574  389A 14626 14641  390A 14643 14668  391A 14673 14691  392A 14747 14767  393A 14783 14803  394A 14820 14841  395A 14849 14871  396A 14862 14877  397A 14899 14927  398A 14956 14974  399A 14982 15007  400A 15017 15055  401A 15057 15087  402A 15089 15104  403A 15104 15138  404A 15141 15180  405A 15196 15239  406A 15241 15265  407A 15273 15291  408A 15293 15318  409A 15325 15363  410A 15365 15385  411A 15392 15424  412A 15426 15460  413A 15462 15476  414A 15478 15501  415A 15521 15570  416A 15573 15587  417A 15598 15631  418A 15649 15664  419A 15665 15690  420A 15721 15753  421A 15755 15782  422A 15784 15838  423A 15840 15857  424A 15859 15880  425A 15885 15928  426A 15930 15949  427A 15977 16020  428A 16022 16039  429A 16041 16120  430A 16131 16145  431A 16162 16199  432A 16210 16234  433A 16240 16283  434A 16299 16345  435A 16371 16391  436A 16393 16408  437A 16435 16481  438A 16483 16520  439A 16522 16540  440A 16535 16552  441A 16554 16574  442A 16581 16645  443A 16647 16672  444A 16701 16744  445A 16746 16761  446A 16763 16793  447A 16795 16818  448A 16820 16853  449A 16856 16874  450A 16884 16914  451A 16916 16946  452A 16948 16968  453A 16970 17043  454A 17046 17077  455A 17095 17116  456A 17119 17157  457A 17171 17189  458A 17213 17233  459A 17272 17320  460A 17322 17338  461A 17340 17356  462A 17358 17385  463A 17389 17446  464A 17448 17483  465A 17485 17506  466A 17584 17604  467A 17606 17638  468A 17659 17676  469A 17687 17741  470A 17743 17758  471A 17760 17777  472A 17779 17794  473A 17807 17826  474A 17836 17862  475A 17880 17910  476A 17914 17930  477A 17932 17956  478A 17958 17976  479A 17978 18005  480A 18009 18052  481A 18054 18075  482A 18102 18128  483A 18150 18201  484A 18203 18240  485A 18242 18279  486A 18331 18354  487A 18351 18365  488A 18374 18406  489A 18404 18419  490A 18408 18439  491A 18441 18471  492A 18473 18524  493A 18526 18566  494A 18568 18617  495A 18624 18640  496A 18642 18658  497A 18648 18697  498A 18699 18763  499A 18723 18739  500A 18777 18792  501A 18808 18825  502A 18827 18850  503A 18858 18920  504A 18923 18974  505A 18976 18993  506A 18995 19058  507A 19060 19087  508A 19089 19180  509A 19254 19273  510A 19292 19308  511A 19326 19350  512A 19352 19395  513A 19410 19488  514A 19507 19530  515A 19559 19585  516A 19587 19607  517A 19614 19632  518A 19634 19678  519A 19688 19739  520A 19741 19783  521A 19807 19821  522A 19859 19876  523A 19878 19908  524A 19910 19949  525A 19951 19969  526A 19972 19997  527A 20022 20044  528A 20046 20069  529A 20088 20106  530A 20108 20140  531A 20142 20169  532A 20174 20216  533A 20242 20259  534A 20271 20304  535A 20427 20448  536A 20436 20458  537A 20446 20460  538A 20481 20499  539A 20512 20531  540A 20540 20555  541A 20555 20569  542A 20557 20572  543A 20600 20619  544A 20631 20645  545A 20638 20655  546A 20647 20661  547A 20683 20716  548A 20719 20738  549A 20747 20766  550A 20780 20796  551A 20784 20805  552A 20837 20868  553A 20839 20856  554A 20870 20895  555A 20883 20900  556A 20912 20932  557A 20930 20966  558A 20936 20954  559A 20970 20987  560A 20986 21000  561A 20990 21022  562A 20998 21014  563A 21006 21020  564A 21008 21022  565A 21010 21030  566A 21018 21040  567A 21018 21035  568A 21065 21105  569A 21107 21135  570A 21139 21154  571A 21161 21224  572A 21233 21258  573A 21266 21293  574A 21295 21328  575A 21330 21357  576A 21373 21393  577A 21395 21434  578A 21436 21454  579A 21456 21522  580A 21529 21580  581A 21582 21612  582A 21652 21666  583A 21667 21685  584A 21671 21685  585A 21720 21738  586A 21740 21754  587A 21763 21800  588A 21811 21839  589A 21837 21877  590A 21902 21942  591A 21944 21960  592A 21975 22012  593A 22014 22032  594A 22049 22089  595A 22110 22143  596A 22145 22159  597A 22161 22188  598A 22190 22210  599A 22229 22260  600A 22275 22334  601A 22360 22406  602A 22408 22422  603A 22424 22440  604A 22442 22472  605A 22491 22531  606A 22559 22579  607A 22584 22677  608A 22695 22734  609A 22736 22765  610A 22767 22787  611A 22812 22826  612A 22849 22864  613A 22866 22886  614A 22933 22998  615A 23014 23046  616A 23082 23101  617A 23114 23146  618A 23168 23190  619A 23192 23225  620A 23286 23309  621A 23314 23422  622A 23419 23440  623A 23424 23438  624A 23428 23464  625A 23475 23499  626A 23505 23522  627A 23505 23526  628A 23505 23520  629A 23541 23561  630A 23549 23572  631A 23549 23571  632A 23575 23592  633A 23624 23648  634A 23650 23672  635A 23678 23699  636A 23685 23699  637A 23779 23794  638A 23921 23939  639A 23966 23997  640A 23993 24027  641A 23994 24008  642A 24029 24046  643A 24053 24068  644A 24095 24109  645A 24103 24163  646A 24103 24133  647A 24198 24218  648A 24201 24218  649A 24223 24240  650A 24258 24272  651A 24274 24294  652A 24356 24370  653A 24364 24394  654A 24423 24438  655A 24454 24474  656A 24454 24495  657A 24457 24474  658A 24497 24530  659A 24532 24555  660A 24562 24576  661A 24578 24604  662A 24617 24662  663A 24665 24698  664A 24697 24725  665A 24727 24746  666A 24777 24815  667A 24818 24835  668A 24843 24880  669A 24904 24924  670A 24926 24944  671A 24954 24970  672A 24995 25014  673A 25044 25059  674A 25061 25080  675A 25082 25098  676A 25108 25129  677A 25131 25193  678A 25226 25251  679A 25276 25296  680A 25368 25383  681A 25397 25412  682A 25414 25436  683A 25438 25483  684A 25475 25499  685A 25501 25529  686A 25547 25561  687A 25564 25590  688A 25598 25627  689A 25629 25776  690A 25778 25844  691A 25842 25873  692A 25875 25894  693A 25898 25942  694A 25944 26000  695A 26002 26027  696A 26037 26053  697A 26055 26086  698A 26088 26116  699A 26131 26186  700A 26190 26211  701A 26225 26246  702A 26249 26265  703A 26276 26321  704A 26334 26355  705A 26357 26386  706A 26398 26415  707A 26426 26455  708A 26469 26510  709A 26544 26580  710A 26582 26602  711A 26612 26655  712A 26671 26691  713A 26711 26725  714A 26736 26754  715A 26760 26780  716A 26788 26831  717A 26833 26850  718A 26860 26898  719A 26920 26936  720A 26938 26965  721A 26984 27050  722A 27065 27107  723A 27118 27177  724A 27187 27226  725A 27228 27243  726A 27271 27311  727A 27330 27364  728A 27382 27407  729A 27430 27450  730A 27446 27477  731A 27479 27517  732A 27519 27534  733A 27549 27582  734A 27584 27634  735A 27636 27663  736A 27682 27705  737A 27723 27745  738A 27771 27834  739A 27899 27921  740A 27923 27980  741A 27994 28080  742A 28097 28120  743A 28122 28139  744A 28142 28156  745A 28176 28214  746A 28217 28232  747A 28234 28270  748A 28272 28299  749A 28309 28341  750A 28343 28370  751A 28372 28395  752A 28409 28423  753A 28412 28436  754A 28457 28482  755A 28495 28513  756A 28530 28550  757A 28552 28574  758A 28585 28600  759A 28626 28681  760A 28693 28739  761A 28741 28763  762A 28774 28817  763A 28819 28833  764A 28882 28900  765A 28888 28914  766A 28931 28949  767A 28964 29011  768A 29037 29084  769A 29086 29101  770A 29097 29134  771A 29150 29202  772A 29206 29251  773A 29253 29285  774A 29296 29316  775A 29318 29337  776A 29346 29404  777A 29406 29424  778A 29455 29494  779A 29499 29553  780A 29555 29579  781A 29586 29636  782A 29638 29696  783A 29703 29758  784A 29754 29812  785A 29814 29843  786A 29850 29915  787A 29917 30096  788A 30094 30108  789A 30114 30130  790A 30132 30153  791A 30234 30275  792A 30305 30321  793A 30338 30352  794A 30359 30392  795A 30425 30446  796A 30463 30478  797A 30480 30520  798A 30526 30555  799A 30567 30583  800A 30585 30602  801A 30604 30634  802A 30636 30652  803A 30648 30664  804A 30654 30677  805A 30690 30741  806A 30743 30759  807A 30826 30852  808A 30878 30897  809A 30885 30899  810A 30887 30907  811A 30909 30952  812A 30973 31031  813A 31037 31052  814A 31044 31073  815A 31086 31109  816A 31111 31125  817A 31127 31161  818A 31196 31242  819A 31266 31294  820A 31296 31320  821A 31322 31350  822A 31349 31376  823A 31378 31408  824A 31463 31529  825A 31531 31548  826A 31585 31601  827A 31594 31621  828A 31626 31642  829A 31644 31727  830A 31729 31752  831A 31777 31834  832A 31846 31862  833A 31892 31925  834A 31908 31924  835A 31913 31939  836A 31913 31928  837A 31998 32017  838A 32022 32055  839A 32068 32089  840A 32111 32134  841A 32136 32180  842A 32182 32226  843A 32228 32247  844A 32261 32289  845A 32332 32354  846A 32371 32385  847A 32404 32442  848A 32461 32477  849A 32485 32504  850A 32520 32548  851A 32569 32597  852A 32607 32621  853A 32638 32659  854A 32661 32693  855A 32700 32715  856A 32717 32755  857A 32757 32789  858A 32791 32813  859A 32815 32831  860A 32826 32864  861A 32870 32894  862A 32904 33042  863A 33047 33098  864A 33110 33134  865A 33136 33158  866A 33169 33203  867A 33205 33234  868A 33241 33266  869A 33275 33302  870A 33312 33343  871A 33356 33416  872A 33418 33433  873A 33453 33482  874A 33498 33521  875A 33523 33537  876A 33539 33556  877A 33556 33570  878A 33615 33629  879A 33639 33656  880A 33658 33672  881A 33674 33693  882A 33697 33714  883A 33716 33731  884A 33730 33780  885A 33791 33829  886A 33831 33845  887A 33852 33870  888A 33882 33948  889A 33959 34003  890A 34020 34039  891A 34050 34066  892A 34088 34121  893A 34135 34175  894A 34170 34185  895A 34194 34216  896A 34221 34250  897A 34252 34272  898A 34274 34299  899A 34313 34375  900A 34391 34406  901A 34411 34455  902A 34479 34495  903A 34497 34531  904A 34533 34555  905A 34560 34592  906A 34607 34632  907A 34648 34695  908A 34697 34717  909A 34752 34766  910A 34775 34802  911A 34818 34843  912A 34866 34911  913A 34913 34928  914A 34930 34944  915A 34958 34987  916A 34992 35025  917A 35073 35117  918A 35100 35116  919A 35125 35147  920A 35137 35153  921A 35168 35233  922A 35259 35289  923A 35291 35309  924A 35305 35319  925A 35311 35334  926A 35339 35354  927A 35372 35412  928A 35414 35440  929A 35452 35489  930A 35505 35576  931A 35579 35662  932A 35690 35705  933A 35707 35722  934A 35711 35725  935A 35732 35747  936A 35802 35818  937A 35823 35843  938A 35826 35842  939A 35864 35883  940A 35865 35883  941A 35866 35884  942A 35867 35885  943A 35868 35886  944A 35869 35887  945A 35870 35888  946A 35871 35889  947A 35871 35890  948A 35878 35892  949A 35900 35921  950A 35952 35967  951A 35969 35987  952A 35989 36039  953A 36056 36070  954A 36095 36123  955A 36185 36205  956A 36239 36255  957A 36268 36287  958A 36294 36364  959A 36366 36384  960A 36386 36445  961A 36457 36471  962A 36525 36542  963A 36570 36587  964A 36589 36659  965A 36661 36675  966A 36690 36718  967A 36735 36767  968A 36782 36802  969A 36804 36832  970A 36869 36890  971A 36903 36923  972A 36927 36982  973A 36995 37010  974A 37012 37029  975A 37031 37074  976A 37076 37136  977A 37172 37237  978A 37247 37280  979A 37292 37316  980A 37315 37337  981A 37339 37384  982A 37398 37413  983A 37415 37443  984A 37487 37535  985A 37553 37595  986A 37614 37644  987A 37676 37692  988A 37727 37761  989A 37763 37782  990A 37784 37809  991A 37837 37854  992A 37879 37906  993A 37908 37947  994A 37935 37950  995A 37949 37988  996A 38003 38073  997A 38075 38107  998A 38128 38160  999A 38162 38184 1000A 38193 38215 1001A 38221 38264 1002A 38266 38296 1003A 38295 38311 1004A 38313 38327 1005A 38329 38343 1006A 38342 38414 1007A 38429 38446 1008A 38448 38477 1009A 38479 38566 1010A 38576 38615 1011A 38628 38649 1012A 38651 38706 1013A 38708 38759 1014A 38761 38786 1015A 38821 38852 1016A 38886 38900 1017A 38902 38926 1018A 38985 39003 1019A 39045 39062 1020A 39082 39098 1021A 39124 39156 1022A 39173 39191 1023A 39267 39304 1024A 39306 39343 1025A 39346 39371 1026A 39377 39391 1027A 39447 39463 1028A 39465 39484 1029A 39515 39539 1030A 39558 39595 1031A 39605 39628 1032A 39668 39685 1033A 39687 39710 1034A 39707 39740 1035A 39794 39814 1036A 39802 39834 1037A 39841 39861 1038A 39868 39892 1039A 39868 39884 1040A 39870 39884 1041A 39874 39892 1042A 39880 39901 1043A 39889 39908 1044A 39896 39916 1045A 39904 39921 1046A 39917 39932 1047A 39957 39986 1048A 39961 39984 1049A 39961 39983 1050A 39971 39985 1051A 40010 40035 1052A 40053 40067 1053A 40092 40136 1054A 40157 40175 1055A 40177 40201 1056A 40212 40230 1057A 40263 40281 1058A 40347 40382 1059A 40389 40406 1060A 40432 40451 1061A 40453 40480 1062A 40487 40516 1063A 40568 40587 1064A 40655 40670 1065A 40699 40723 1066A 40723 40744 1067A 40746 40772 1068A 40774 40804 1069A 40838 40853 1070A 40855 40891 1071A 40894 40915 1072A 40935 40961 1073A 40964 40978 1074A 40999 41032 1075A 41085 41111 1076A 41114 41129 1077A 41133 41172 1078A 41175 41207 1079A 41209 41234 1080A 41247 41274 1081A 41285 41310 1082A 41290 41305 1083A 41316 41381 1084A 41383 41405 1085A 41407 41437 1086A 41439 41459 1087A 41474 41490 1088A 41527 41591 1089A 41593 41615 1090A 41617 41698 1091A 41700 41722 1092A 41724 41740 1093A 41742 41772 1094A 41819 41837 1095A 41842 41900 1096A 41916 41961 1097A 41963 41979 1098A 42008 42030 1099A 42058 42079 1100A 42108 42128 1101A 42147 42176 1102A 42210 42225 1103A 42218 42234 1104A 42239 42256 1105A 42258 42281 1106A 42317 42332 1107A 42345 42381 1108A 42391 42430 1109A 42434 42448 1110A 42455 42478 1111A 42495 42538 1112A 42551 42587 1113A 42586 42623 1114A 42667 42688 1115A 42690 42708 1116A 42710 42725 1117A 42727 42765 1118A 42767 42786 1119A 42788 42802 1120A 42804 42820 1121A 42822 42836 1122A 42839 42864 1123A 42879 42915 1124A 42917 42950 1125A 42966 42995 1126A 42997 43029 1127A 43059 43132 1128A 43094 43108 1129A 43137 43161 1130A 43166 43203 1131A 43174 43193 1132A 43205 43221 1133A 43211 43227 1134A 43213 43227 1135A 43215 43230 1136A 43215 43233 1137A 43223 43280 1138A 43282 43297 1139A 43291 43310 1140A 43299 43337 1141A 43312 43326 1142A 43339 43394 1143A 43415 43453 1144A 43455 43474 1145A 43485 43582 1146A 43584 43601 1147A 43603 43647 1148A 43663 43757 1149A 43769 43822 1150A 43824 43849 1151A 43865 43896 1152A 43905 43930 1153A 43942 43976 1154A 43978 43998 1155A 43999 44066 1156A 44076 44117 1157A 44123 44160 1158A 44167 44210 1159A 44212 44230 1160A 44232 44258 1161A 44260 44329 1162A 44344 44375 1163A 44377 44396 1164A 44418 44446 1165A 44476 44490 1166A 44494 44545 1167A 44602 44641 1168A 44648 44682 1169A 44685 44716 1170A 44756 44771 1171A 44774 44793 1172A 44800 44815 1173A 44817 44846 1174A 44875 44940 1175A 44942 45041 1176A 44993 45007 1177A 45043 45060 1178A 45066 45092 1179A 45094 45134 1180A 45177 45193 1181A 45209 45235 1182A 45237 45302 1183A 45277 45292 1184A 45304 45325 1185A 45326 45368 1186A 45387 45402 1187A 45411 45441 1188A 45473 45501 1189A 45503 45519 1190A 45521 45557 1191A 45563 45584 1192A 45586 45614 1193A 45650 45681 1194A 45698 45722 1195A 45707 45721 1196A 45710 45726 1197A 45715 45732 1198A 45734 45783 1199A 45746 45771 1200A 45774 45795 1201A 45793 45808 1202A 45796 45815 1203A 45813 45833 1204A 45848 45875 1205A 45877 45891 1206A 45893 45920 1207A 45935 45955 1208A 45965 45990 1209A 46020 46040 1210A 46044 46064 1211A 46072 46122 1212A 46124 46151 1213A 46153 46184 1214A 46197 46222 1215A 46224 46256 1216A 46287 46304 1217A 46306 46336 1218A 46388 46402 1219A 46404 46424 1220A 46426 46469 1221A 46484 46504 1222A 46520 46559 1223A 46572 46623 1224A 46631 46667 1225A 46669 46721 1226A 46723 46751 1227A 46753 46767 1228A 46787 46822 1229A 46825 46849 1230A 46864 46881 1231A 46883 46899 1232A 46901 46930 1233A 46957 46991 1234A 47005 47020 1235A 47036 47088 1236A 47090 47122 1237A 47149 47179 1238A 47155 47172 1239A 47209 47260 1240A 47262 47286 1241A 47296 47320 1242A 47351 47383 1243A 47385 47404 1244A 47446 47506 1245A 47563 47578 1246A 47580 47620 1247A 47635 47649 1248A 47651 47687 1249A 47691 47723 1250A 47725 47751 1251A 47753 47771 1252A 47773 47796 1253A 47827 47843 1254A 47828 47843 1255A 47845 47868 1256A 47884 47914 1257A 47939 47979 1258A 47994 48018 1259A 48020 48035 1260A 48050 48066 1261A 48080 48130 1262A 48132 48199 1263A 48179 48193 1264A 48207 48281 1265A 48283 48302 1266A 48336 48372 1267A 48374 48394 1268A 48405 48423 1269A 48427 48452 1270A 48464 48493 1271A 48511 48529 1272A 48540 48567 1273A 48569 48586 1274A 48588 48616 1275A 48625 48653 1276A 48655 48703 1277A 48744 48768 1278A 48770 48786 1279A 49133 49149 1280A 49133 49159 1281A 49173 49192 1282A 49194 49233 1283A 49235 49258 1284A 49260 49287 1285A 49298 49546 1286A 49548 49570 1287A 49584 49611 1288A 49613 49630 1289A 49640 49656 1290A 49658 49686 1291A 49710 49735 1292A 49714 49728 1293A 49737 49769 1294A 49768 49791 1295A 49793 49807 1296A 49809 49845 1297A 49859 49884 1298A 49886 49926 1299A 49928 49963 1300A 49965 49991 1301A 49993 50081 1302A 50098 50143 1303A 50156 50175 1304A 50177 50205 1305A 50242 50282 1306A 50293 50308 1307A 50312 50340 1308A 50342 50382 1309A 50384 50407 1310A 50409 50451 1311A 50453 50471 1312A 50478 50502 1313A 50504 50524 1314A 50552 50566 1315A 50577 50622 1316A 50648 50671 1317A 50673 50697 1318A 50699 50714 1319A 50719 50767 1320A 50769 50803 1321A 50805 50820 1322A 50822 50840 1323A 50842 50911 1324A 50913 50975 1325A 50991 51007 1326A 50995 51070 1327A 51089 51105 1328A 51110 51196 1329A 51200 51235 1330A 51244 51281 1331A 51315 51331 1332A 51333 51376 1333A 51378 51422 1334A 51465 51505 1335A 51517 51534 1336A 51550 51567 1337A 51663 51699 1338A 51752 51809 1339A 51811 51894 1340A 51901 51945 1341A 51954 51978 1342A 51994 52014 1343A 52016 52050 1344A 52046 52078 1345A 52080 52111 1346A 52119 52148 1347A 52153 52188 1348A 52223 52255 1349A 52268 52300 1350A 52302 52326 1351A 52329 52361 1352A 52363 52406 1353A 52408 52437 1354A 52439 52462 1355A 52469 52531 1356A 52535 52639 1357A 52641 52662 1358A 52664 52681 1359A 52683 52718 1360A 52721 52756 1361A 52758 52796 1362A 52812 52831 1363A 52842 52861 1364A 52865 52887 1365A 52889 52904 1366A 52913 52933 1367A 52935 52950 1368A 52952 52998 1369A 53000 53022 1370A 53024 53054 1371A 53065 53087 1372A 53089 53107 1373A 53161 53176 1374A 53183 53230 1375A 53232 53260 1376A 53262 53306 1377A 53330 53358 1378A 53365 53398 1379A 53400 53437 1380A 53452 53486 1381A 53503 53551 1382A 53511 53526 1383A 53553 53571 1384A 53573 53602 1385A 53610 53625 1386A 53627 53662 1387A 53656 53676 1388A 53680 53694 1389A 53696 53752 1390A 53761 53775 1391A 53777 53834 1392A 53856 53879 1393A 53882 53924 1394A 53936 54023 1395A 54020 54040 1396A 54028 54054 1397A 54034 54054 1398A 54042 54087 1399A 54057 54078 1400A 54062 54076 1401A 54099 54117 1402A 54105 54126 1403A 54105 54136 1404A 54177 54198 1405A 54178 54198 1406A 54186 54208 1407A 54196 54210 1408A 54209 54223 1409A 54237 54254 1410A 54256 54283 1411A 54287 54314 1412A 54316 54340 1413A 54336 54363 1414A 54366 54392 1415A 54399 54441 1416A 54443 54464 1417A 54478 54496 1418A 54507 54534 1419A 54554 54569 1420A 54585 54604 1421A 54615 54642 1422A 54644 54668 1423A 54670 54688 1424A 54730 54751 1425A 54758 54788 1426A 54794 54809 1427A 54824 54878 1428A 54880 54945 1429A 54966 54984 1430A 55001 55035 1431A 55037 55084 1432A 55086 55110 1433A 55112 55143 1434A 55156 55183 1435A 55185 55232 1436A 55234 55263 1437A 55277 55299 1438A 55305 55345 1439A 55359 55384 1440A 55393 55453 1441A 55465 55479 1442A 55484 55505 1443A 55514 55547 1444A 55549 55592 1445A 55608 55633 1446A 55671 55690 1447A 55701 55725 1448A 55727 55744 1449A 55798 55816 1450A 55818 55839 1451A 55851 55878 1452A 55931 55951 1453A 55953 55975 1454A 55997 56020 1455A 56049 56081 1456A 56090 56138 1457A 56150 56183 1458A 56185 56202 1459A 56212 56252 1460A 56274 56290 1461A 56317 56343 1462A 56345 56373 1463A 56375 56404 1464A 56416 56437 1465A 56447 56472 466A 56474 56489 1467A 56491 56543 1468A 56552 56575 1469A 56596 56620 1470A 56637 56682 1471A 56706 56747 1472A 56755 56772 1473A 56775 56817 1474A 56819 56848 1475A 56872 56887 1476A 56899 56922 1477A 56963 57001 1478A 57046 57074 1479A 57076 57090 1480A 57092 57106 1481A 57108 57141 1482A 57185 57206 1483A 57221 57242 1484A 57253 57294 1485A 57296 57311 1486A 57322 57342 1487A 57345 57362 1488A 57364 57403 1489A 57406 57586 1490A 59248 59300 1491A 59302 59320 1492A 59343 59388 1493A 59399 59420 1494A 59427 59452 1495A 59454 59491 1496A 59487 59511 1497A 59537 59575 1498A 59580 59594 1499A 59600 59663 1500A 59665 59686 1501A 59688 59710 1502A 59716 59747 1503A 59755 59788 1504A 59790 59808 1505A 59815 59830 1506A 59832 59857 1507A 59855 59875 1508A 59887 59908 1509A 59925 59949 1510A 59957 59979 1511A 59992 60007 1512A 60009 60048 1513A 60061 60102 1514A 60134 60150 1515A 60152 60182 1516A 60184 60208 1517A 60226 60244 1518A 60314 60351 1519A 60353 60400 1520A 60423 60438 1521A 60454 60473 1522A 60475 60501 1523A 60503 60526 1524A 60528 60571 1525A 60580 60607 1526A 60617 60634 1527A 60638 60664 1528A 60668 60713 1529A 60731 60761 1530A 60763 60795 1531A 60797 60832 1532A 60847 60867 1533A 60881 60897 1534A 60899 60919 1535A 60935 60966 1536A 60979 61025 1537A 61051 61068 1538A 61070 61098 1539A 61110 61127 1540A 61152 61200 1541A 61205 61241 1542A 61243 61308 1543A 61307 61323 1544A 61325 61369 1545A 61376 61390 1546A 61392 61406 1547A 61408 61423 1548A 61427 61441 1549A 61480 61522 1550A 61537 61580 1551A 61596 61615 1552A 61607 61623 1553A 61631 61659 1554A 61671 61688 1555A 61686 61738 1556A 61764 61805 1557A 61807 61829 1558A 61838 61863 1559A 62301 62315 1560A 62357 62396 1561A 62398 62419 1562A 62429 62452 1563A 62454 62482 1564A 62492 62532 1565A 62540 62560 1566A 62564 62608 1567A 62631 62645 1568A 62647 62695 1569A 62697 62717 1570A 62719 62739 1571A 62753 62768 1572A 62768 62784 1573A 62795 62824 1574A 62827 62863 1575A 62903 62920 1576A 62922 62937 1577A 62939 62976 1578A 62978 63026 1579A 63028 63070 1580A 63087 63131 1581A 63141 63175 1582A 63181 63223 1583A 63225 63242 1584A 63244 63278 1585A 63280 63306 1586A 63310 63340 1587A 63344 63371 1588A 63373 63439 1589A 63444 63458 1590A 63460 63494 1591A 63510 63527 1592A 63529 63544 1593A 63548 63576 1594A 63588 63607 1595A 63609 63624 1596A 63642 63680 1597A 63682 63713 1598A 63759 63778 1599A 63788 63822 1600A 63849 63863 1601A 63851 63869 1602A 63894 63911 1603A 63913 63941 1604A 63920 63937 1605A 63933 63947 1606A 63935 63989 1607A 63964 63981 1608A 63992 64011 1609A 63999 64015 1610A 64004 64030 1611A 64022 64050 1612A 64065 64079 1613A 64079 64113 1614A 64093 64113 1615A 64101 64118 1616A 64161 64179 1617A 64194 64208 1618A 64214 64285 1619A 64300 64327 1620A 64338 64373 1621A 64375 64413 1622A 64433 64460 1623A 64480 64494 1624A 64501 64523 1625A 64525 64540 1626A 64556 64573 1627A 64603 64635 1628A 64645 64665 1629A 64667 64701 1630A 64729 64751 1631A 64792 64808 1632A 64810 64858 1633A 64860 64875 1634A 64882 64906 1635A 64939 64956 1636A 64958 64978 1637A 64992 65008 1638A 65010 65135 1639A 65137 65157 1640A 65159 65173 1641A 65187 65203 1642A 65208 65291 1643A 65293 65322 1644A 65362 65387 1645A 65389 65405 1646A 65407 65462 1647A 65464 65575 1648A 65577 65615 1649A 65626 65640 1650A 65642 65671 1651A 65673 65700 1652A 65702 65723 1653A 65725 65764 1654A 65781 65797 1655A 65806 65823 1656A 65825 65839 1657A 65841 65883 1658A 65896 65939 1659A 65947 66010 1660A 66012 66026 1661A 66038 66058 1662A 66062 66109 1663A 66120 66136 1664A 66131 66214 1665A 66216 66253 1666A 66255 66271 1667A 66273 66306 1668A 66315 66331 1669A 66335 66384 1670A 66409 66426 1671A 66410 66425 1672A 66430 66459 1673A 66470 66492 1674A 66494 66524 1675A 66499 66513 1676A 66501 66515 1677A 66537 66552 1678A 66566 66606 1679A 66619 66638 1680A 66640 66657 1681A 66656 66674 1682A 66677 66693 1683A 66695 66734 1684A 66740 66788 1685A 66790 66828 1686A 66830 66845 1687A 66847 66870 1688A 66872 66892 1689A 66923 66948 1690A 66960 66974 1691A 66973 67017 1692A 67037 67061 1693A 67072 67106 1694A 67108 67150 1695A 67159 67174 1696A 67176 67191 1697A 67189 67218 1698A 67226 67268 1699A 67247 67263 1700A 67298 67322 1701A 67325 67342 1702A 67348 67362 1703A 67399 67429 1704A 67446 67464 1705A 67466 67505 1706A 67507 67524 1707A 67526 67552 1708A 67600 67617 1709A 67618 67634 1710A 67636 67660 1711A 67677 67708 1712A 67710 67744 1713A 67759 67788 1714A 67837 67859 1715A 67861 67884 1716A 67886 67905 1717A 67929 67951 1718A 67956 67993 1719A 67995 68014 1720A 68018 68032 1721A 68034 68048 1722A 68050 68074 1723A 68081 68134 1724A 68144 68215 1725A 68232 68288 1726A 68290 68313 1727A 68315 68358 1728A 68360 68381 1729A 68397 68414 1730A 68416 68434 1731A 68436 68453 1732A 68455 68504 1733A 68536 68562 1734A 68564 68579 1735A 68591 68606 1736A 68655 68706 1737A 68708 68727 1738A 68729 68833 1739A 68909 68957 1740A 68959 68992 1741A 68994 69026 1742A 69038 69058 1743A 69054 69068 1744A 69060 69106 1745A 69108 69135 1746A 69137 69166 1747A 69168 69207 1748A 69209 69224 1749A 69236 69252 1750A 69253 69297 1751A 69299 69318 1752A 69320 69355 1753A 69376 69404 1754A 69406 69464 1755A 69466 69578 1756A 69586 69629 1757A 69631 69663 1758A 69677 69696 1759A 69708 69722 1760A 69724 69760 1761A 69762 69779 1762A 69784 69798 1763A 69800 69822 1764A 69833 69866 1765A 69869 69912 1766A 69921 69957 1767A 69974 69989 1768A 69996 70128 1769A 70131 70166 1770A 70203 70217 1771A 70297 70320 1772A 70322 70361 1773A 70363 70388 1774A 70393 70417 1775A 70419 70438 1776A 70447 70465 1777A 70493 70509 1778A 70517 70541 1779A 70561 70590 1780A 70598 70640 1781A 70669 70688 1782A 70690 70730 1783A 70767 70782 1784A 70784 70800 1785A 70802 70816 1786A 70832 70881 1787A 70885 70906 1788A 70910 70984 1789A 70986 71002 1790A 71004 71018 1791A 71020 71071 1792A 71073 71103 1793A 71105 71135 1794A 71178 71193 1795A 71209 71238 1796A 71240 71265 1797A 71267 71297 1798A 71316 71337 1799A 71407 71438 1800A 71449 71495 1801A 71497 71605 1802A 71607 71709 1803A 71711 71740 1804A 71742 71767 1805A 71769 71785 1806A 71787 71882 1807A 71884 71926 1808A 71920 71945 1809A 71970 71984 1810A 71993 72021 1811A 72039 72109 1812A 72111 72167 1813A 72204 72267 1814A 72295 72333 1815A 72336 72355 1816A 72377 72391 1817A 72393 72411 1818A 72413 72436 1819A 72470 72492 1820A 72494 72556 1821A 72558 72576 1822A 72577 72591 1823A 72598 72640 1824A 72642 72687 1825A 72687 72707 1826A 72735 72793 1827A 72797 72811 1828A 72816 72837 1829A 72843 72879 1830A 72881 72896 1831A 72928 72958 1832A 72974 73027 1833A 73046 73061 1834A 73066 73087 1835A 73099 73122 1836A 73126 73141 1837A 73160 73182 1838A 73193 73221 1839A 73241 73263 1840A 73277 73309 1841A 73311 73330 1842A 73334 73350 1843A 73367 73390 1844A 73403 73438 1845A 73444 73466 1846A 73477 73497 1847A 73503 73537 1848A 73539 73577 1849A 73596 73673 1850A 73675 73691 1851A 73708 73724 1852A 73726 73774 1853A 73776 73800 1854A 73802 73866 1855A 73871 73910 1856A 73935 73969 1857A 73971 73985 1858A 74013 74064 1859A 74076 74097 1860A 74114 74129 1861A 74136 74165 1862A 74167 74186 1863A 74188 74254 1864A 74271 74372 1865A 74374 74388 1866A 74401 74432 1867A 74449 74474 1868A 74476 74516 1869A 74518 74555 1870A 74550 74582 1871A 74614 74680 1872A 74704 74752 1873A 74774 74797 1874A 74802 74856 1875A 74867 74923 1876A 74903 74917 1877A 74937 74951 1878A 74953 74975 1879A 74958 74972 1880A 74969 75003 1881A 74974 74989 1882A 74991 75005 1883A 75023 75039 1884A 75024 75039 1885A 75051 75066 1886A 75080 75098 1887A 75095 75109 1888A 75135 75200 1889A 75189 75203 1890A 75223 75238 1891A 75245 75282 1892A 75293 75310 1893A 75312 75335 1894A 75337 75355 1895A 75364 75394 1896A 75411 75432 1897A 75434 75467 1898A 75481 75512 1899A 75514 75530 1900A 75532 75547 1901A 75572 75651 1902A 75667 75687 1903A 75689 75740 1904A 75739 75760 1905A 75762 75849 1906A 75859 75876 1907A 75885 75900 1908A 75907 75929 1909A 75931 75949 1910A 75951 75973 1911A 75975 76073 1912A 76075 76092 1913A 76094 76110 1914A 76118 76141 1915A 76143 76158 1916A 76160 76176 1917A 76179 76211 1918A 76224 76240 1919A 76247 76267 1920A 76269 76290 1921A 76292 76306 1922A 76308 76335 1923A 76343 76364 1924A 76366 76390 1925A 76392 76409 1926A 76428 76486 1927A 76488 76502 1928A 76519 76539 1929A 76541 76564 1930A 76575 76589 1931A 76606 76620 1932A 76640 76654 1933A 76645 76663 1934A 76653 76678 1935A 76727 76756 1936A 76782 76799 1937A 76805 76819 1938A 76831 76858 1939A 76907 76927 1940A 76942 76985 1941A 76987 77008 1942A 77010 77045 1943A 77056 77085 1944A 77101 77139 1945A 77158 77172 1946A 77174 77197 1947A 77199 77221 1948A 77223 77262 1949A 77267 77281 1950A 77283 77332 1951A 77349 77363 1952A 77383 77465 1953A 77478 77516 1954A 77518 77553 1955A 77555 77579 1956A 77594 77628 1957A 77631 77684 1958A 77686 77715 1959A 77733 77794 1960A 77796 77835 1961A 77854 77875 1962A 77883 77899 1963A 77920 77940 1964A 77942 77963 1965A 77978 77998 1966A 78009 78033 1967A 78035 78075 1968A 78092 78111 1969A 78113 78142 1970A 78144 78176 1971A 78189 78203 1972A 78215 78250 1973A 78267 78298 1974A 78313 78360 1975A 78386 78408 1976A 78410 78449 1977A 78467 78491 1978A 78494 78517 1979A 78519 78552 1980A 78554 78578 1981A 78589 78608 1982A 78620 78657 1983A 78659 78674 1984A 78676 78696 1985A 78719 78769 1986A 78771 78823 1987A 78834 78919 1988A 78921 78938 1989A 78953 78991 1990A 78992 79006 1991A 78992 79007 1992A 81650 81664 1993A 82345 82366 1994A 82358 82372 1995A 82390 82406 1996A 82531 82547 1997A 82535 82550 1998A 83245 83259 1999A 83709 83723 2000A 83901 83918 2001A 85858 85873

[0107] In some embodiments, the target sequence is selected from the group consisting of target regions 1A to 2001A as shown in Table 4 above.

TABLE-US-00005 TABLE 5 Exemplary target regions Target start SEQ end SEQ region ID NO: 1 ID NO: 1   1C 39 60   2C 60 78   3C 2314 2327   4C 2911 2951   5C 3211 3224   6C 4669 4682   7C 4670 4683   8C 5059 5073   9C 5789 5802  10C 6577 6591  11C 7773 7786  12C 8088 8101  13C 8773 8786  14C 11161 11175  15C 11431 11444  16C 12446 12459  17C 12703 12721  18C 12703 12717  19C 12704 12722  20C 12704 12718  21C 12705 12723  22C 12705 12719  23C 12706 12724  24C 2706 12720  25C 12707 12725  26C 12707 12721  27C 12708 12726  28C 12708 12722  29C 12709 12727  30C 12709 12723  31C 12710 12728  32C 12710 12724  33C 12711 12729  34C 12711 12725  35C 12711 12730  36C 12712 12726  37C 12713 12727  38C 12714 12728  39C 12715 12730  40C 12715 12729  41C 12717 12730  42C 12718 12732  43C 13178 13191  44C 15649 15662  45C 15822 15835  46C 15890 15903  47C 16495 16508  48C 19257 19270  49C 19891 19907  50C 22624 22642  51C 22707 22720  52C 25655 25776  53C 25793 25844  54C 25850 25869  55C 27809 27825  56C 28623 28636  57C 29713 29728  58C 29982 30004  59C 30008 30021  60C 30880 30897  61C 30882 30897  62C 30885 30899  63C 30887 30902  64C 30986 30999  65C 31588 31601  66C 31911 31925  67C 31913 31926  68C 32075 32088  69C 32266 32279  70C 33213 33232  71C 35865 35883  72C 35865 35879  73C 35866 35884  74C 35866 35880  75C 35867 35885  76C 35867 35881  77C 35868 35886  78C 35868 35882  79C 35869 35887  80C 35869 35883  81C 35870 35888  82C 35870 35884  83C 35871 35889  84C 35871 35885  85C 35871 35890  86C 35872 35886  87C 35873 35887  88C 35874 35888  89C 35875 35890  90C 35875 35889  91C 35877 35890  92C 35878 35891  93C 38221 38234  94C 38388 38402  95C 38596 38615  96C 38667 38686  97C 39710 39723  98C 41289 41303  99C 41290 41303 100C 41294 41310 101C 41548 41562 102C 41551 41567 103C 41572 41588 104C 41680 41693 105C 42012 42025 106C 42319 42332 107C 43518 43532 108C 43585 43601 109C 43586 43599 110C 43687 43707 111C 43709 43727 112C 43741 43757 113C 43770 43812 114C 44217 44230 115C 45386 45399 116C 45387 45400 117C 46795 46812 118C 49386 49402 119C 49431 49444 120C 49446 49459 121C 49518 49534 122C 49737 49751 123C 49777 49790 124C 50578 50592 125C 52491 52504 126C 57296 57311 127C 57374 57393 128C 57406 57426 129C 57488 57504 130C 57512 57533 131C 59439 59452 132C 59460 59474 133C 60638 60653 134C 60681 60700 135C 60881 60895 136C 61260 61280 137C 62960 62976 138C 64306 64320 139C 65023 65036 140C 65062 65099 141C 65498 65511 142C 65850 65863 143C 66276 66289 144C 67447 67460 145C 67508 67521 146C 67861 67874 147C 69112 69126 148C 69383 69404 149C 69436 69464 150C 69489 69506 151C 69541 69573 152C 69601 69617 153C 69833 69854 154C 70939 70955 155C 71029 71043 156C 71465 71488 157C 71531 71605 158C 71607 71629 159C 71631 71647 160C 71649 71671 161C 71673 71707 162C 71724 71740 163C 71751 71767 164C 71796 71809 165C 72008 72021 166C 72777 72790 167C 73605 73625 168C 74278 74291 169C 74295 74309 170C 74350 74370 171C 74492 74510 172C 74518 74549 173C 74617 74639 174C 75624 75644 175C 78777 78808 176C 78834 78850 177C 78858 78901 178C 78992 79005

[0108] In some embodiments, the target sequence is selected from the group consisting of target regions 10 to 178C as shown in Table 5 above.

Target Cell

[0109] The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. For the therapeutic use of the present invention it is advantageous if the target cell is infected with HBV. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a woodchuck cell or a primate cell such as a monkey cell (e.g. a cynomolgus monkey cell) or a human cell.

[0110] In preferred embodiments, the target cell expresses A1CF mRNA, such as the A1CF pre-mRNA or A1CF mature mRNA. The poly A tail of A1CF mRNA is typically disregarded for antisense oligonucleotide targeting.

[0111] Further, the target cell may be a hepatocyte. In one embodiment, the target cell is HBV infected primary human hepatocytes, either derived from HBV infected individuals or from a HBV infected mouse with a humanized liver (PhoenixBio, PXB-mouse).

[0112] In accordance with the present invention, the target cell may be infected with HBV. Further, the target cell may comprise HBV cccDNA. Thus, the target cell preferably comprises A1CF mRNA, such as the A1CF pre-mRNA or A1CF mature mRNA, and HBV cccDNA. In one embodiment, the target cell is a human cell. In one embodiment, the human cell is a hepatocyte.

Naturally Occurring Variant

[0113] The term “naturally occurring variant” refers to variants of A1CF gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.

[0114] In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian A1CF target nucleic acid, such as a target nucleic acid of SEQ ID NO: 1 and/or SEQ ID NO: 2. In some embodiments, the naturally occurring variants have at least 99% homology to the human A1CF target nucleic acid of SEQ ID NO: 1. In some embodiments, the naturally occurring variants are known polymorphisms.

Inhibition of Expression

[0115] The term “inhibition of expression” as used herein is to be understood as an overall term for an A1CF (APOBEC1 complementation factor) inhibitors ability to inhibit amount or the activity of A1CF in a target cell. Inhibition of expression or activity may be determined by measuring the level of A1CF pre-mRNA or A1CF mRNA, or by measuring the level of A1CF protein or activity in a cell. Inhibition of expression may be determined in vitro or in vivo. Inhibition is determined by reference to a control. It is generally understood that the control is an individual or target cell treated with a saline composition.

[0116] The term “inhibition” or “inhibit” may also be referred to as down-regulate, reduce, suppress, lessen, lower, decrease the expression or activity of A1CF.

[0117] The inhibition of expression of A1CF may occur e.g. by degradation of pre-mRNA or mRNA e.g. using RNase H recruiting oligonucleotides, such as gapmers, or nucleic acid molecules that function via the RNA interference pathway, such as siRNA or shRNA. Alternatively, the inhibitor of the present invention may bind to A1CF polypeptide and inhibit the activity of A1CF or prevent its binding to other molecules.

[0118] In some embodiments, the inhibition of expression of the A1CF target nucleic acid or the activity of A1CF protein results in a decreased amount of HBV cccDNA in the target cell. Preferably, the amount of HBV cccDNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV cccDNA is at least 20%, at least 30%, as compared to a control. In some embodiments, the amount of cccDNA in an HBV infected cell is reduced by at least 50%, such as 60%, such as 70%, when compared to a control.

[0119] In some embodiments, the inhibition of expression of the A1CF target nucleic acid or the activity of A1CF protein results in a decreased amount of HBV pgRNA in the target cell. Preferably, the amount of HBV pgRNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV pgRNA is at least 20%, at least 30%, as compared to a control. In some embodiments, the amount of pgRNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control.

Sugar Modifications

[0120] The oligonucleotide of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

[0121] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.

[0122] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011/017521) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

[0123] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2′-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2′, 3′, 4′ or 5′ positions.

High Affinity Modified Nucleosides

[0124] A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T.sub.m). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature in the range of +0.5 to +12° C., more preferably in the range of +1.5 to +10° C. and most preferably in the range of +3 to +8° C. per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2′ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

2′ Sugar Modified Nucleosides

[0125] A 2′ sugar modified nucleoside is a nucleoside which has a substituent other than H or —OH at the 2′ position (2′ substituted nucleoside) or comprises a 2′ linked biradical capable of forming a bridge between the 2′ carbon and a second carbon in the ribose ring, such as LNA (2′-4′ biradical bridged) nucleosides.

[0126] Indeed, much focus has been spent on developing 2′ sugar substituted nucleosides, and numerous 2′ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2′ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2′ substituted modified nucleosides are 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-Fluoro-RNA, and 2′-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2′ substituted modified nucleosides.

##STR00001##

[0127] In relation to the present invention 2′ substituted sugar modified nucleosides does not include 2′ bridged nucleosides like LNA.

Locked Nucleic Acid Nucleosides (LNA Nucleoside)

[0128] A “LNA nucleoside” is a 2′-sugar modified nucleoside which comprises a biradical linking the C2′ and C4′ of the ribose sugar ring of said nucleoside (also referred to as a “2′-4′ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.

[0129] Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352, WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698, WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0130] Particular examples of LNA nucleosides of the invention are presented in Scheme 1 (wherein B is as defined above).

##STR00002##

[0131] Particular LNA nucleosides are beta-D-oxy-LNA, 6′-methyl-beta-D-oxy LNA such as (S)-6′-methyl-beta-D-oxy-LNA (ScET) and ENA.

RNase H Activity and Recruitment

[0132] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91-95 of WO 01/23613 (hereby incorporated by reference). For use in determining RNase H activity, recombinant human RNase H1 is available from Creative Biomart® (Recombinant Human RNase H1 fused with His tag expressed in E. coli).

Gapmer

[0133] The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof, may be a gapmer, also termed gapmer oligonucleotide or gapmer designs. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5′-flank, a gap and a 3′-flank, F-G-F′ in the ‘5->3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5′ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3′ flanking region (F′) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F′ enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F′ are 2′ sugar modified nucleosides, such as high affinity 2′ sugar modifications, such as independently selected from LNA and 2′-MOE.

[0134] In a gapmer design, the 5′ and 3′ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5′ (F) or 3′ (F′) region respectively. The flanks may further be defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5′ end of the 5′ flank and at the 3′ end of the 3′ flank.

[0135] Regions F-G-F′ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F′.

[0136] The overall length of the gapmer design F-G-F′ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, such as from 15 to 20, such as 16 to 18 nucleosides.

[0137] By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae:

F.sub.1-8-G.sub.5-18-F′.sub.1-8, such as

F.sub.1-8-G.sub.7-18-F′.sub.2-8

with the proviso that the overall length of the gapmer regions F-G-F′ is at least 12, such as at least 14 nucleotides in length.

[0138] In an aspect of the invention, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-8 nucleosides, of which 1-4 are 2′ sugar modified and defines the 5′ and 3′ end of the F and F′ region, and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. In some embodiments, the G region consists of DNA nucleosides.

[0139] In some embodiments, region F and F′ independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.

[0140] In some embodiments, region F and F′ independently comprises both LNA and a 2′-substituted sugar modified nucleotide (mixed wing design). In some embodiments, the 2′-substituted sugar modified nucleotide is independently selected from the group consisting of 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.

[0141] In some embodiments, all the modified nucleosides of region F and F′ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In some embodiments, all the modified nucleosides of region F and F′ are beta-D-oxy LNA nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In such embodiments, the flanking region F or F′, or both F and F′ comprise at least three nucleosides, wherein the 5′ and 3′ most nucleosides of the F and/or F′ region are LNA nucleosides.

LNA Gapmer

[0142] An LNA gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of beta-D-oxy LNA nucleosides.

[0143] In some embodiments, the LNA gapmer is of formula: [LNA].sub.1-5-[region G].sub.6-18-[LNA].sub.1-5, wherein region G is as defined in the Gapmer region G definition.

MOE Gapmers

[0144] A MOE gapmers is a gapmer wherein regions F and F′ consist of MOE nucleosides. In some embodiments, the MOE gapmer is of design [MOE].sub.1-8-[Region G].sub.5-16-[MOE].sub.1-8, such as [MOE].sub.2-7-[Region G].sub.6-14-[MOE].sub.2-7, such as [MOE].sub.3-6-[Region G].sub.8-12-[MOE].sub.3-8, such as [MOE].sub.5-[Region G].sub.10-[MOE].sub.5 wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.

Region D′ or D″ in an Oligonucleotide

[0145] The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as a gapmer region F-G-F′, and further 5′ and/or 3′ nucleosides. The further 5′ and/or 3′ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5′ and/or 3′ nucleosides may be referred to as region D′ and D″ herein.

[0146] The addition of region D′ or D″ may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonucleoase protection or for ease of synthesis or manufacture.

[0147] Region D′ and D″ can be attached to the 5′ end of region F or the 3′ end of region F′, respectively to generate designs of the following formulas D′-F-G-F′, F-G-F′-D″ or D′-F-G-F′-D″. In this instance the F-G-F′ is the gapmer portion of the oligonucleotide and region D′ or D″ constitute a separate part of the oligonucleotide.

[0148] Region D′ or D″ may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F′ region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D′ or D″ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments, the additional 5′ and/or 3′ end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D′ or D″ are disclosed in WO2014/076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015/113922, where they are used to link multiple antisense constructs (e.g. gapmer regions) within a single oligonucleotide.

[0149] In one embodiment, the oligonucleotide of the invention comprises a region D′ and/or D″ in addition to the contiguous nucleotide sequence which constitutes the gapmer.

[0150] In some embodiments, the oligonucleotide of the present invention can be represented by the following formulae:

F-G-F′; in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8

D′-F-G-F′, in particular D′.sub.1-3-F.sub.1-8-G.sub.5-18-F′.sub.2-8

F-G-F′-D″, in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3

D′-F-G-F′-D″, in particular D′.sub.1-3-F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3

[0151] In some embodiments, the internucleoside linkage positioned between region D′ and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage positioned between region F′ and region D″ is a phosphodiester linkage.

Conjugate

[0152] The term “conjugate” as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalently linked to the antisense oligonucleotide, optionally via a linker group, such as region D′ or D″.

[0153] Oligonucleotide conjugates and their synthesis have been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.

[0154] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates (e.g. galactose or N-acetylgalactosamine (GalNAc)), cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins (e.g. antibodies), peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.

[0155] Exemplary conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPR, see for example WO 2014/076196, WO 2014/207232 and WO 2014/179620 (hereby incorporated by reference). Such conjugates serve to enhance uptake of the oligonucleotide to the liver.

Linkers

[0156] A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).

[0157] In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

[0158] Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 5 nucleosides, such as 1, 2, 3, 4 or 5 nucleosides, more preferably between 2 and 4 nucleosides and most preferably 2 or 3 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195 (hereby incorporated by reference).

[0159] Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments, the linker (region Y) is an amino alkyl, such as a C2-C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. some embodiments the linker (region Y) is a C6 amino alkyl group.

Treatment

[0160] The term “treatment” as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic. Prophylactic can be understood as preventing an HBV infection from turning into a chronic HBV infection or the prevention of severe liver diseases such as liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection.

Patient

[0161] For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Preferably, the subject is a mammal. More preferably the subject is human.

[0162] As described elsewhere herein, the patient to be treated may suffers from HBV infection, such as chronic HBV infection. In some embodiments, the patient suffering from HBV infection may suffer from hepatocellular carcinoma (HCC). In some embodiments, the patient suffering from HBV infection does not suffer from hepatocellular carcinoma.

DETAILED DESCRIPTION OF THE INVENTION

[0163] HBV cccDNA in infected hepatocytes is responsible for persistent chronic infection and reactivation, being the template for all viral subgenomic transcripts and pre-genomic RNA (pgRNA) to ensure both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. In the context of the present invention it was for the first time shown that A1CF is associated with cccDNA stability. This knowledge allows for the opportunity to destabilize cccDNA in HBV infected subjects which in turn opens the opportunity for a complete cure of chronically infected HBV patients.

[0164] One aspect of the present invention is an A1CF inhibitor for use in the treatment and/or prevention of Hepatitis B virus (HBV) infection, in particular a chronic HBV infection.

[0165] The A1CF inhibitor can for example be a small molecule that specifically binds to A1CF protein, wherein said inhibitor prevents or reduces binding of A1CF protein to cccDNA.

[0166] An embodiment of the invention is an A1CF inhibitor which is capable of reducing the amount of cccDNA and/or pgRNA in an infected cell, such as an HBV infected cell.

[0167] In a further embodiment, the A1CF inhibitor is capable of reducing HBsAg and/or HBeAg in vivo in an HBV infected individual.

A1CF Inhibitors for Use in Treatment of HBV

[0168] Without being bound by theory, it is believed that A1CF is involved in the stabilization of the cccDNA in the cell nucleus, either via direct or indirect binding to the cccDNA, and by preventing the binding/association of A1CF with cccDNA, the cccDNA is destabilized and becomes prone to degradation. One embodiment of the invention is therefore an A1CF inhibitor which interacts with the A1CF protein, and prevents or reduces its binding/association to cccDNA.

[0169] In some embodiments of the present invention, the inhibitor is an antibody, antibody fragment or a small molecule compound. In some embodiments, the inhibitor may be an antibody, antibody fragment or a small molecule that specifically binds to the A1CF protein, such as the A1CF protein encoded by SEQ ID NO: 1, 4, 5, 6, 7, 8, 9, 10 or 11.

Nucleic Acid Molecules of the Invention

[0170] Therapeutic nucleic acid molecules are potentially excellent A1CF inhibitors since they can target the A1CF transcript and promote its degradation either via the RNA interference pathway or via RNase H cleavage. Alternatively, oligonucleotides such as aptamers can also act as inhibitors of A1CF protein interactions.

[0171] One aspect of the present invention is an A1CF targeting nucleic acid molecule for use in treatment and/or prevention of Hepatitis B virus (HBV) infection. Such a nucleic acid molecule can be selected from the group consisting of a single stranded antisense oligonucleotide, an siRNA, and a shRNA.

[0172] The present section describes novel nucleic acid molecules suitable for use in treatment and/or prevention of Hepatitis B virus (HBV) infection.

[0173] The nucleic acid molecules of the present invention are capable of inhibiting expression of A1CF mRNA and/or protein in vitro and in vivo. The inhibition is achieved by hybridizing an oligonucleotide to a target nucleic acid encoding A1CF. The target nucleic acid may be a mammalian A1CF sequence. In some embodiments, the target nucleic acid may be a human A1CF pre-mRNA sequence such as the sequence of SEQ ID NO: 1 or a human mature A1CF mRNA sequence selected from SEQ ID NO: 4 to 11. In some embodiments, the target nucleic acid may be a cynomolgus monkey A1CF sequence such as the sequence of SEQ ID NO: 2.

[0174] In some embodiments, the nucleic acid molecule of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, at least 40%, or at least 50%, inhibition compared to the normal expression level of the target. In some embodiments, the nucleic acid molecule of the invention may be capable of inhibiting expression levels of A1CF mRNA by at least 50% or 60% in vitro by transfecting 25 nM nucleic acid molecule into PXB-PHH cells, this range of target reduction is advantageous in terms of selecting nucleic acid molecules with good correlation to the cccDNA reduction. Suitably, the examples provide assays which may be used to measure A1CF mRNA inhibition (e.g. example 1 and the “Materials and Methods” section). A1CF inhibition is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide, such as the guide strand of a siRNA or gapmer region of an antisense oligonucleotide, and the target nucleic acid. In some embodiments, the nucleic acid molecule of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired inhibition of A1CF expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide complementary to the target nucleic acid and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2′ sugar modified nucleosides, including LNA, present within the oligonucleotide sequence.

[0175] An aspect of the present invention relates to a nucleic acid molecule of 12 to 60 nucleotides in length, which comprises a contiguous nucleotide sequence of at least 12 nucleotides in length, such as at least 12 to 30 nucleotides in length, which is at least 95% complementary, such as fully complementary, to a mammalian A1CF target nucleic acid, in particular a human A1CF nucleic acid. These nucleic acid molecules are capable of inhibiting the expression of A1CF mRNA and/or protein.

[0176] An aspect of the invention relates to a nucleic acid molecule of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 12 nucleotides, such as 12 to 30 nucleotides in length which is at least 90% complementary, such as fully complementary, to a mammalian A1CF target sequence.

[0177] A further aspect of the present invention relates to a nucleic acid molecule according to the invention comprising a contiguous nucleotide sequence of 14 to 22 nucleotides in length with at least 90% complementary, such as fully complementary, to the target sequence of SEQ ID NO: 1.

[0178] In some embodiments, the nucleic acid molecule comprises a contiguous sequence of 12 to 30 nucleotides in length, which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.

[0179] It is advantageous if the oligonucleotide, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target sequence, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target sequence.

[0180] In some embodiments, the oligonucleotide sequence is 100% complementary to a region of the target sequence of SEQ ID NO: 1 and/or SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 and/or 11.

[0181] In some embodiments, the nucleic acid molecule or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and/or 2.

[0182] In some embodiments, the oligonucleotide or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 2 and/or SEQ ID NO: 4, 5, 6, 7, 8, 9 10 and/or 11.

[0183] In some embodiments, the oligonucleotide or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3.

[0184] In some embodiments, the contiguous sequence of the nucleic acid molecule of the present invention is least 90% complementary, such as fully complementary to a region of SEQ ID NO: 1, selected from the group consisting of target regions 1A to 2001A as shown in Table 4.

[0185] In some embodiments, the contiguous sequence of the nucleic acid molecule of the present invention is least 90% complementary, such as fully complementary to a region of SEQ ID NO: 1, selected from the group consisting of target regions 10 to 178C as shown in Table 5.

[0186] In some embodiments, the nucleic acid molecule of the invention comprises or consists of 12 to 60 nucleotides in length, such as from 13 to 50, such as from 14 to 35, such as 15 to 30, such as from 16 to 22 contiguous nucleotides in length. In a preferred embodiment, the nucleic acid molecule comprises or consists of 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

[0187] In some embodiments, the contiguous nucleotide sequence of the nucleic acid molecule which is complementary to the target nucleic acids comprises or consists of 12 to 30, such as from 13 to 25, such as from 15 to 23, such as from 16 to 22, contiguous nucleotides in length.

[0188] In some embodiments, the oligonucleotide is selected from the group consisting of an antisense oligonucleotide, an siRNA and a shRNA.

[0189] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA which is complementary to the target sequence comprises or consists of 18 to 28, such as from 19 to 26, such as from 20 to 24, such as from 21 to 23, contiguous nucleotides in length.

[0190] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide which is complementary to the target nucleic acids comprises or consists of 12 to 22, such as from 14 to 20, such as from 16 to 20, such as from 15 to 18, such as from 16 to 18, such as from 16, 17, 18, 19 or 20 contiguous nucleotides in length.

[0191] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences listed in Table 6 (Materials and Methods section).

[0192] It is understood that the contiguous oligonucleotide sequence (motif sequence) can be modified to, for example, increase nuclease resistance and/or binding affinity to the target nucleic acid.

[0193] The pattern in which the modified nucleosides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design.

[0194] The nucleic acid molecule of the invention may be designed with modified nucleosides and RNA nucleosides (in particular for siRNA and shRNA molecules) or DNA nucleosides (in particular for single stranded antisense oligonucleotides).

[0195] In advantageous embodiments, the nucleic acid molecule or contiguous nucleotide sequence comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides, such as comprise one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.

[0196] It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).

[0197] In some embodiments the contiguous nucleotide sequence comprises LNA nucleosides.

[0198] In some embodiments the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0199] In some embodiments the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides.

[0200] In some embodiments the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides and DNA nucleosides.

[0201] Advantageously, the 3′ most nucleoside of the antisense oligonucleotide, or contiguous nucleotide sequence thereof is a 2′sugar modified nucleoside.

[0202] In a further embodiment the nucleic acid molecule comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”.

[0203] Advantageously, the oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0204] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.

[0205] It is advantageous if at least 2 to 3 internucleoside linkages at the 5′ or 3′ end of the oligonucleotide are phosphorothioate internucleoside linkages.

[0206] For single stranded antisense oligonucleotides it is advantageous if at least 75%, such as all, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the single stranded antisense oligonucleotide are phosphorothioate linkages.

[0207] In an advantageous embodiment of the invention the antisense oligonucleotide of the invention is capable of recruiting RNase H, such as RNase H1. An advantageous structural design is a gapmer design as described in the “Definitions” section under for example “Gapmer”, “LNA Gapmer” and “MOE gapmer”. In the present invention it is advantageous if the antisense oligonucleotide of the invention is a gapmer with an F-G-F′ design.

[0208] In all instances the F-G-F′ design may further include region D′ and/or D″ as described in the “Definitions” section under “Region D′ or D” in an oligonucleotide”.

[0209] In a further aspect, of the invention the nucleic acid molecules, such as the antisense oligonucleotide, siRNA or shRNA, of the invention can be targeted directly to the liver by covalently attaching them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as divalent or trivalent GalNAc cluster.

Conjugates

[0210] Since HBV infection primarily affects the hepatocytes in the liver it is advantageous to conjugate the A1CF inhibitor to a conjugate moiety that will increase the delivery of the inhibitor to the liver compared to the unconjugated inhibitor. In one embodiment, liver targeting moieties are selected from moieties comprising cholesterol or other lipids or conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPR).

[0211] In some embodiments, the invention provides a conjugate comprising a nucleic acid molecule of the invention covalently attached to a conjugate moiety.

[0212] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moieties) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S. T. and Drickamer, K. JB. C. 1996, 271, 6686) or are readily determined using methods typical in the art.

[0213] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0214] To generate the ASGPR conjugate moiety the ASPGR targeting moieties (preferably GalNAc) can be attached to a conjugate scaffold. Generally, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties linked to a spacer which links each GalNAc moiety to a brancher molecule that can be conjugated to the antisense oligonucleotide.

[0215] In a further embodiment, the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. Advantageously, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) moieties.

[0216] GalNAc conjugate moieties can include, for example, those described in WO 2014/179620 and WO 2016/055601 and PCT/EP2017/059080 (hereby incorporated by reference), as well as small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor).

[0217] The ASGPR conjugate moiety, in particular a trivalent GalNAc conjugate moiety, may be attached to the 3′- or 5′-end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is linked to the 5′-end of the oligonucleotide.

[0218] In one embodiment, the conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc), such as those shown in FIG. 1. In one embodiment, the conjugate moiety is the tri-valent N-acetylgalactosamine (GalNAc) of FIG. 1A-1 or FIG. 1A-2, or a mixture of both. In one embodiment, the conjugate moiety is the tri-valent N-acetylgalactosamine (GalNAc) of FIG. 1B-1 or FIG. 1B-2, or a mixture of both. In one embodiment, the conjugate moiety is the tri-valent N-acetylgalactosamine (GalNAc) of FIG. 1C-1 or FIG. 1C-2, or a mixture of both. In one embodiment, the conjugate moiety is the tri-valent N-acetylgalactosamine (GalNAc) of FIG. 1D-1 or FIG. 1D-2, or a mixture of both.

Method of Manufacture

[0219] In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect, a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.

Pharmaceutical Salt

[0220] The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term “pharmaceutically acceptable salt” refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the compounds of the present invention.

[0221] In a further aspect, the invention provides a pharmaceutically acceptable salt of the nucleic acid molecules or a conjugate thereof, such as a pharmaceutically acceptable sodium salt, ammonium salt or potassium salt.

Pharmaceutical Composition

[0222] In a further aspect, the invention provides pharmaceutical compositions comprising any of the compounds of the invention, in particular the aforementioned nucleic acid molecules and/or nucleic acid molecule conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments, the nucleic acid molecule is used in the pharmaceutically acceptable diluent at a concentration of 50 to 300 μM solution.

[0223] Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091.

[0224] In some embodiments, the nucleic acid molecule or the nucleic acid molecule conjugates of the invention, or pharmaceutically acceptable salt thereof is in a solid form, such as a powder, such as a lyophilized powder.

[0225] Compounds, nucleic acid molecules or nucleic acid molecule conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0226] These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.

[0227] In some embodiments, the nucleic acid molecule or nucleic acid molecule conjugate of the invention is a prodrug. In particular with respect to nucleic acid molecule conjugates the conjugate moiety is cleaved off the nucleic acid molecule once the prodrug is delivered to the site of action, e.g. the target cell.

Administration

[0228] The compounds, nucleic acid molecules or nucleic acid molecule conjugates or pharmaceutical compositions of the present invention may be administered topically or enterally or parenterally (such as, intravenous, subcutaneous, or intra-muscular).

[0229] In a preferred embodiment, the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In one embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered intravenously. In another embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered subcutaneously.

[0230] In some embodiments, the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1-15 mg/kg, such as from 0.2-10 mg/kg, such as from 0.25-5 mg/kg. The administration can be once a week, every second week, every third week or even once a month.

[0231] The invention also provides for the use of the nucleic acid molecule or nucleic acid molecule conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration.

Combination Therapies

[0232] In some embodiments the inhibitor of the present invention such as the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above.

[0233] By way of example, the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as oligonucleotide-based antivirals—such as sequence specific oligonucleotide-based antivirals—acting either through antisense (including other LNA oligomers), siRNAs (such as ARC520), aptamers, morpholinos or any other antiviral, nucleotide sequence-dependent mode of action.

[0234] By way of further example, the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as immune stimulatory antiviral compounds, such as interferon (e.g. pegylated interferon alpha), TLR7 agonists (e.g. GS-9620), or therapeutic vaccines.

[0235] By way of further example, the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as small molecules, with antiviral activity. These other actives could be, for example, nucleoside/nucleotide inhibitors (e.g. entecavir or tenofovir disoproxil fumarate), encapsidation inhibitors, entry inhibitors (e.g. Myrcludex B).

[0236] In certain embodiments, the additional therapeutic agent may be an HBV agent, a Hepatitis C virus (HCV) agent, a chemotherapeutic agent, an antibiotic, an analgesic, a nonsteroidal anti-inflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent.

[0237] In particular, related embodiments, the additional HBV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).

[0238] In other particular related embodiments, the additional HCV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy.

Applications

[0239] The nucleic acid molecules of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.

[0240] In research, such nucleic acid molecules may be used to specifically modulate the synthesis of A1CF protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically, the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby preventing protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.

[0241] If employing the nucleic acid molecules of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0242] Also encompassed by the present invention is an in vivo or in vitro method for modulating A1CF expression in a target cell which is expressing A1CF, said method comprising administering a nucleic acid molecule, conjugate compound or pharmaceutical composition of the invention in an effective amount to said cell.

[0243] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments, the target cell is present in the liver. The target cell may be a hepatocyte.

[0244] One aspect of the present invention is related the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention for use as a medicament.

[0245] In an aspect of the invention, the A1CF inhibitor, such as a nucleic acid molecule, conjugate compound or pharmaceutical composition of the invention is capable of reducing the cccDNA level in HBV infected cells and thereby inhibiting HBV infection. In particular, the antisense oligonucleotide is capable of affecting one or more of the following parameters i) reducing cccDNA and/or ii) reducing pgRNA and/or iii) reducing HBV DNA and/or iv) reducing HBV viral antigens in an infected cell.

[0246] For example, a nucleic acid molecule that inhibits HBV infection may reduce i) the cccDNA levels in an infected cell by at least 40% such as 50%, 60% or 70% reduction compared to controls; or ii) the level of pgRNA by at least 40% such as 50%, 60% or 70% reduction compared to controls. The controls may be untreated cells or animals, or cells or animals treated with an appropriate control.

[0247] Inhibition of HBV infection may be measured in vitro using HBV infected primary human hepatocytes or in vivo using humanized hepatocytes PXB mouse model (available at PhoenixBio, see also Kakuni et al 2014 Int. J. Mol. Sci. 15:58-74). Inhibition of secretion of HBsAg and/or HBeAg may be measured by ELISA, e.g. by using the CLIA ELISA Kit (Autobio Diagnostic) according to the manufacturers' instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA may be measured by qPCR, e.g. as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits HBV infection are measuring secretion of HBV DNA by qPCR e.g. as described in WO 2015/173208 or using Northern Blot; in-situ hybridization, or immuno-fluorescence.

[0248] Due to the reduction of A1CF levels the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention can be used to inhibit development of or in the treatment of HBV infection. In particular, through the destabilization and reduction of the cccDNA, the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention more efficiently inhibits development of or treats a chronic HBV infection as compared to a compound that only reduces secretion of HBsAg.

[0249] Accordingly, one aspect of the present invention is related to use of an A1CF inhibitor, such as the nucleic acid molecule, conjugate compounds or pharmaceutical compositions of the invention to reduce cccDNA and/or pgRNA in an HBV infected individual.

[0250] A further aspect of the invention relates to the use of an A1CF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to inhibit development of or treat a chronic HBV infection.

[0251] A further aspect of the invention relates to the use of A1CF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to reduce the infectiousness of a HBV infected person. In a particular aspect of the invention, the A1CF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention inhibits development of a chronic HBV infection.

[0252] The subject to be treated with the A1CF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention (or which prophylactically receives nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention) is preferably a human, more preferably a human patient who is HBsAg positive and/or HBeAg positive, even more preferably a human patient that is HBsAg positive and HBeAg positive.

[0253] Accordingly, the present invention relates to a method of treating a HBV infection, wherein the method comprises administering an effective amount of A1CF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention. The present invention further relates to a method of preventing liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection. In one embodiment, the A1CF inhibitors of the present invention is not intended for the treatment of hepatocellular carcinoma, only its prevention.

[0254] The invention also provides for the use of a A1CF inhibitor, such as nucleic acid molecule, a conjugate compound or a pharmaceutical composition of the invention for the manufacture of a medicament, in particular a medicament for use in the treatment of HBV infection or chronic HBV infection or reduction of the infectiousness of a HBV infected person. In preferred embodiments, the medicament is manufactured in a dosage form for subcutaneous administration.

[0255] The invention also provides for the use of a nucleic acid molecule, a conjugate compound, the pharmaceutical composition of the invention for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration.

[0256] The A1CF inhibitor, such as the nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be used in a combination therapy. For example, the nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be combined with other anti-HBV agents such as interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir, or other emerging anti-HBV agents such as a HBV RNA replication inhibitor, a HBsAg secretion inhibitor, a HBV capsid inhibitor, an antisense oligomer (e.g. as described in WO2012/145697, WO 2014/179629 and WO2017/216390), a siRNA (e.g. described in WO 2005/014806, WO 2012/024170, WO 2012/2055362, WO 2013/003520, WO 2013/159109, WO 2017/027350 and WO2017/015175), a HBV therapeutic vaccine, a HBV prophylactic vaccine, a HBV antibody therapy (monoclonal or polyclonal), or TLR 2, 3, 7, 8 or 9 agonists for the treatment and/or prophylaxis of HBV.

Embodiments of the Invention

[0257] The following embodiments of the present invention may be used in combination with any other embodiments described herein. The definitions and explanations provided herein above, in particular in the sections “SUMMARY OF INVENTION”, “DEFINITIONS” and DETAILED DESCRIPTION OF THE INVENTION″ apply mutatis mutandis to the following. [0258] 1. An A1CF inhibitor for use in the in the treatment and/or prevention of Hepatitis B virus (HBV) infection. [0259] 2. The A1CF inhibitor for the use of embodiment 1, wherein the A1CF inhibitor is administered in an effective amount. [0260] 3. The A1CF inhibitor for the use of embodiment 1 or 2, wherein the HBV infection is a chronic infection. [0261] 4. The A1CF inhibitor for the use of embodiments 1 to 3, wherein the A1CF inhibitor is capable of reducing the amount of cccDNA and/or pgRNA in an infected cell. [0262] 5. The A1CF inhibitor for the use of any one of embodiments 1 to 4, wherein the A1CF inhibitor prevents or reduces the association of A1CF protein to cccDNA. [0263] 6. A1CF inhibitor for the use of embodiment 5, wherein said inhibitor is a small molecule that specifically binds to A1CF protein, wherein said inhibitor prevents or reduces association of A1CF protein to cccDNA. [0264] 7. A1CF inhibitor for the use of embodiment 6, wherein the A1CF protein is encoded by SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11. [0265] 8. The A1CF inhibitor for the use of any one of embodiments 1 to 7, wherein said inhibitor is a nucleic acid molecule of 12-60 nucleotides in length comprising or consisting of a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 90% complementary to a mammalian A1CF target nucleic acid. [0266] 9. The A1CF inhibitor for the use of embodiment 8, which is capable of reducing the level of the mammalian A1CF target nucleic acid. [0267] 10. The A1CF inhibitor for the use of embodiment 8 or 9, wherein the mammalian A1CF target nucleic acid is RNA. [0268] 11. The A1CF inhibitor for the use of embodiment 10, wherein the RNA is pre-mRNA. [0269] 12. The A1CF inhibitor for the use of any one of embodiments 8 to 11, wherein the nucleic acid molecule is selected from the group consisting of antisense oligonucleotide, siRNA and shRNA. [0270] 13. The A1CF inhibitor for the use of embodiment 12, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide or a double stranded siRNA. [0271] 14. The A1CF inhibitor for the use of any one of embodiments 8 to 13, wherein the mammalian A1CF target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 4, 5, 6, 7, 8, 9, 10 and 11. [0272] 15. The A1CF inhibitor for the use of any one of embodiments 8 to 13, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0273] 16. The A1CF inhibitor for the use of any one of embodiments 8 to 13, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0274] 17. The A1CF inhibitor for the use of any one of embodiments 1 to 16, wherein the amount of cccDNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control. [0275] 18. The A1CF inhibitor for the use of any one of embodiments 1 to 16, wherein the amount of pgRNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control. [0276] 19. The A1CF inhibitor for the use of any one of embodiments 8 to 18, wherein the amount of mammalian A1CF target nucleic acid is reduced by at least 50%, such as 60% when compared to a control. [0277] 20. A nucleic acid molecule of 12 to 60 nucleotides in length which comprises or consists of a contiguous nucleotide sequence of 12 to 30 nucleotides in length wherein the contiguous nucleotide sequence is at least 90% complementary, such as 95%, such as 98%, such as fully complementary, to a mammalian A1CF target nucleic acid. [0278] 21. The nucleic acid molecule of embodiment 20, wherein the nucleic acid molecule is chemically produced. [0279] 22. The nucleic acid molecule of embodiment 20 or 21, wherein the mammalian A1CF target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 4, 5, 6, 7, 8, 9, 10 and 11. [0280] 23. The nucleic acid molecule of embodiment 20 or 21, wherein the contiguous nucleotide sequence is at least 98% complementary, such as fully complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0281] 24. The nucleic acid molecule of embodiment 20 or 21, wherein the contiguous nucleotide sequence is fully complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0282] 25. The nucleic acid molecule of any one of embodiments 20 to 23, wherein the nucleic acid molecule is 12 to 30 nucleotides in length. [0283] 26. The nucleic acid molecule of any one of embodiments 20 to 25, wherein the nucleic acid molecule is a RNAi molecule, such as a double stranded siRNA or shRNA. [0284] 27. The nucleic acid molecule of any one of embodiments 20 to 25, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide. [0285] 28. The nucleic acid molecule of any one of embodiments 20 to 27, wherein the contiguous nucleotide sequence is fully complementary to a target nucleic acid sequence selected from Table 4 or Table 5. [0286] 29. The nucleic acid molecule of any one of embodiments 20 to 28, which is capable of hybridizing to a target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 with a ΔG° below −15 kcal. [0287] 30. The nucleic acid molecule of any one of embodiments 20 to 29, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, particularly 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides. [0288] 31. The nucleic acid molecule of any one of embodiments 20 to 29, wherein the contiguous nucleotide sequence comprises or consists of from 14 to 22 nucleotides. [0289] 32. The nucleic acid molecule of embodiment 31, wherein the contiguous nucleotide sequence comprises or consists of 16 to 20 nucleotides. [0290] 33. The nucleic acid molecule of any one of embodiments 20 to 32, wherein the nucleic acid molecule comprises or consists of 14 to 25 nucleotides in length. [0291] 34. The nucleic acid molecule of embodiment 33, wherein the nucleic acid molecule comprises or consists of at least one oligonucleotide strand of 16 to 22 nucleotides in length. [0292] 35. The nucleic acid molecule of any one of embodiment 20 to 34, wherein the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NO: 12, 13, 14, and 15. [0293] 36. The nucleic acid molecule of any one of embodiments 20 to 35, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the mammalian A1CF target nucleic acid it is complementary to. [0294] 37. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence has one mismatch compared to the mammalian A1CF target nucleic acid. [0295] 38. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence has two mismatches compared to the mammalian A1CF target nucleic acid. [0296] 39. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence is fully complementary to the mammalian A1CF target nucleic acid. [0297] 40. The nucleic acid molecule of any one of embodiments 20 to 39, comprising one or more modified nucleosides. [0298] 41. The nucleic acid molecule of embodiment 40, wherein the one or more modified nucleosides are high-affinity modified nucleosides. [0299] 42. The nucleic acid molecule of embodiment 40 or 41, wherein the one or more modified nucleosides are 2′ sugar modified nucleosides. [0300] 43. The nucleic acid molecule of embodiment 42, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, 2′-fluoro-ANA and LNA nucleosides. [0301] 44. The nucleic acid molecule of any one of embodiments 40 to 43, wherein the one or more modified nucleosides are LNA nucleosides. [0302] 45. The nucleic acid molecule of embodiment 44, wherein the modified LNA nucleosides are selected from the group consisting of oxy-LNA, amino-LNA, thio-LNA, cET, and ENA. [0303] 46. The nucleic acid molecule of embodiment 44 or 45, wherein the modified LNA nucleosides are oxy-LNA with the following 2′-4′ bridge —O—CH.sub.2—. [0304] 47. The nucleic acid molecule of embodiment 46, wherein the oxy-LNA is beta-D-oxy-LNA. [0305] 48. The nucleic acid molecule of embodiment 44 or 45, wherein the modified LNA nucleosides are cET with the following 2′-4′ bridge —O—CH(CH.sub.3)—. [0306] 49. The nucleic acid molecule of embodiment 48, wherein the cET is (S)cET, i.e. 6′(S)methyl-beta-D-oxy-LNA. [0307] 50. The nucleic acid molecule of embodiment 44 or 45, wherein the LNA is ENA, with the following 2′-4′ bridge —O—CH.sub.2—CH.sub.2—. [0308] 51. The nucleic acid molecule of any one of embodiments 20 to 50, wherein the nucleic acid molecule comprises at least one modified internucleoside linkage. [0309] 52. The nucleic acid molecule of embodiment 51, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. [0310] 53. The nucleic acid molecule of any one of embodiments 20 to 52, wherein the nucleic acid molecule is an antisense oligonucleotide capable of recruiting RNase H. [0311] 54. The nucleic acid molecule of embodiment 53, wherein the antisense oligonucleotide or the contiguous nucleotide sequence is a gapmer. [0312] 55. The nucleic acid molecule of embodiment 54, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. [0313] 56. The nucleic acid molecule of embodiment 55, wherein the 1-4 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. [0314] 57. The nucleic acid molecule of embodiment 55 or 56, wherein one or more of the 1-4 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0315] 58. The nucleic acid molecule of embodiment 57, wherein all the 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0316] 59. The nucleic acid molecule of any one of embodiments 56 to 58, wherein the LNA nucleosides are selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA. [0317] 60. The nucleic acid molecule of any one of embodiments 56 to 59, wherein region F and F′ consist of identical LNA nucleosides. [0318] 61. The nucleic acid molecule of any one of embodiments 56 to 60, wherein all the 2′ sugar modified nucleosides in region F and F′ are oxy-LNA nucleosides. [0319] 62. The nucleic acid molecule of any one of embodiments 55 to 61, wherein the nucleosides in region G are DNA nucleosides. [0320] 63. The nucleic acid molecule of embodiment 62, wherein region G consists of at least 75% DNA nucleosides. [0321] 64. The nucleic acid molecule of embodiment 63, where all the nucleosides in region G are DNA nucleosides. [0322] 65. A conjugate compound comprising a nucleic acid molecule according to any one of embodiments 20 to 64, and at least one conjugate moiety covalently attached to said nucleic acid molecule. [0323] 66. The conjugate compound of embodiment 65, wherein the nucleic acid molecule is a double stranded siRNA and the conjugate moiety is covalently attached to the sense strand of the siRNA. [0324] 67. The conjugate compound of embodiment 65 or 66, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof. [0325] 68. The conjugate compound of any one of embodiments 65 to 67, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor. [0326] 69. The conjugate compound of embodiment 68, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. [0327] 70. The conjugate compound of embodiment 69, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). [0328] 71. The conjugate compound of embodiment 69 or 70, wherein the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. [0329] 72. The conjugate compound of embodiment 71, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a brancher molecule that can be conjugated to the antisense compound. [0330] 73. The conjugate compound of embodiment 72, wherein the spacer is a PEG spacer. [0331] 74. The conjugate compound of any one of embodiments 68 to 73, wherein the conjugate moiety is a GalNAc moiety, such as a tri-valent N-acetylgalactosamine (GalNAc) moiety. [0332] 75. The conjugate compound of any one of embodiments 68 to 74, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in FIG. 1. [0333] 76. The conjugate compound of embodiment 75, wherein the conjugate moiety is the trivalent GalNAc moiety of FIG. 1B-1 or FIG. 1B-2, or a mixture of both. [0334] 77. The conjugate compound of embodiment 75, wherein the conjugate moiety is the trivalent GalNAc moiety of FIG. 1D-1 or FIG. 1D-2, or a mixture of both. [0335] 78. The conjugate compound of any one of embodiments 65 to 77, comprising a linker which is positioned between the nucleic acid molecule and the conjugate moiety. [0336] 79. The conjugate compound of embodiment 78, wherein the linker is a physiologically labile linker. [0337] 80. The conjugate compound of embodiment 79, wherein the physiologically labile linker is nuclease susceptible linker. [0338] 81. The conjugate compound of any one of embodiments 79 or 80, wherein the physiologically labile linker is composed of 2 to 5 consecutive phosphodiester linkages. [0339] 82. The conjugate compound of any one of embodiments 65-81, which display improved cellular distribution between liver vs. kidney or improved cellular uptake into the liver of the conjugate compound as compared to an unconjugated nucleic acid. [0340] 83. A pharmaceutical composition comprising a nucleic acid molecule of any one of embodiments 20 to 64, a conjugate compound of any one of embodiments 65 to 82 or acceptable salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. [0341] 84. A method for identifying a compound that prevents, ameliorates and/or inhibits a hepatitis B virus (HBV) infection, comprising: [0342] a. contacting a test compound with [0343] i. an A1CF polypeptide; or [0344] ii. a cell expressing A1CF; [0345] b. measuring the expression and/or activity of A1CF in the presence or absence of said test compound; and [0346] c. identifying a compound that reduces the expression and/or activity A1CF and reduces cccDNA. [0347] 85. An in vivo or in vitro method for modulating A1CF expression in a target cell which is expressing A1CF, said method comprising administering the nucleic acid molecule of any one of embodiments 20 to 64, a conjugate compound any one of embodiments 65 to 82 or the pharmaceutical composition of embodiment 83 in an effective amount to said cell. [0348] 86. The method of embodiments 85, wherein the A1CF expression is reduced by at least 50%, or at least 60% in the target cell compared to the level without any treatment or treated with a control. [0349] 87. The method of embodiments 85, wherein the target cell is infected with HBV and the cccDNA in an HBV infected cell is reduced by at least 50%, or at least 60% in the HBV infected target cell compared to the level without any treatment or treated with a control. [0350] 88. A method for treating or preventing a disease, such as HBV infection, comprising administering a therapeutically or prophylactically effective amount of the nucleic acid molecule any one of embodiments 20 to 64, a conjugate compound of any one of embodiments 65 to 82, or the pharmaceutical composition of embodiment 83 to a subject suffering from or susceptible to the disease. [0351] 89. The nucleic acid molecule of any one of embodiments 20 to 64, or the conjugate compound of any one of embodiments 65 to 82, or the pharmaceutical composition of embodiment 83, for use as a medicament for treatment or prevention of a disease, such as HBV infection, in a subject. [0352] 90. Use of the nucleic acid molecule of any one of embodiments 20 to 64, or the conjugate compound of any one of embodiments 65 to 82 for the preparation of a medicament for treatment or prevention of a disease, such as HBV infection, in a subject. [0353] 91. The method, the nucleic acid molecule, the conjugate compound, or the use of any one of embodiments 88 to 90, wherein the subject is a mammal. [0354] 92. The method, the nucleic acid molecule, the conjugate compound, or the use of embodiment 91, wherein the mammal is human.

[0355] The invention will now be illustrated by the following examples which have no limiting character.

EXAMPLES

Materials and Methods

[0356] siRNA Sequences and Compounds

TABLE-US-00006 TABLE 6 Human A1CF sequences targeted by the individual components of the siRNA pool SEQ ID Position on NO: A1CF target sequence SEQ ID NO: 1 Exon 12 GUGGACAACUGCCGAUUAU 49395-49413  8 13 CUGAAGGUGUUGUCGAUGU 49477-49495  8 14 CAACAGAGCCAUUAUCCGA 69636-69654 11 15 AGACGUAUGCAGCCGAAUA 75681-75699 14

[0357] The pool of siRNA (ON-TARGETplus SMART pool siRNA Cat. No. LU-013576-02-0005, Dharmacon) contains four individual siRNA molecules targeting the sequences listed in the above table.

TABLE-US-00007 TABLE 7 Control compounds SEQ Sequence ID Name Supplier Order number 5′ to 3′ sense strand NO Non-targeting Dharmacon #D-001810-01- UGGUUUACAUGUCGACUAA 16 negative control 05 siRNA#1 Hbx positive GA life Custom made GCACUUCGCUUCACCUCUG 17 control science

Oligonucleotide Synthesis

[0358] Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.

[0359] Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16 hours at 60° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.

Elongation of the oligonucleotide:

[0360] The coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5′-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.

[0361] For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.

Purification by RP-HPLC:

[0362] The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter® C18 10 μm 150×10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.

Abbreviations

[0363] DCI: 4,5-Dicyanoimidazole

[0364] DCM: Dichloromethane

[0365] DMF: Dimethylformamide

[0366] DMT: 4,4′-Dimethoxytrityl

[0367] THF: Tetrahydrofurane

[0368] Bz: Benzoyl

[0369] Ibu: Isobutyryl

[0370] RP-HPLC: Reverse phase high performance liquid chromatography

T.SUB.m .Assay:

[0371] Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2×T.sub.m-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Na-phosphate, pH 7.0). The solution is heated to 95° C. for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (T.sub.m) are measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20° C. to 95° C. and then down to 25° C., recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T.sub.m.

[0372] Clonal growth medium (dHCGM). dHCGM is a DMEM medium containing 100 U/ml Penicillin, 100 μg/ml Streptomycin, 20 mM Hepes, 44 mM NaHCO.sub.3, 15 μg/ml L-proline, 0.25 μg/ml insulin, 50 nM Dexamethazone, 5 ng/ml EGF, 0.1 mM Asc-2P, 2% DMSO and 10% FBS (Ishida et al., 2015). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO.sub.2. Culture medium was replaced 24 h post-plating and every 2 days until harvest.

HBV Infected PHH Cells

[0373] Fresh primary human hepatocytes (PHH) were provided by PhoenixBio, Higashi-Hiroshima City, Japan (PXB-cells also described in Ishida et al 2015 Am J Pathol. 185(5):1275-85) in 70,000 cells/well in 96-well plate format.

[0374] Upon arrival the PHH were infected with an MOI of 2GE using HepG2 2.2.15-derived HBV (batch Z12) by incubating the PHH cells with HBV in 4% (v/v) PEG in PHH medium for 16 hours. The cells were then washed three times with PBS and cultured a humidified atmosphere with 5% CO.sub.2 in fresh PHH medium consisting of DMEM (GIBCO, Cat #21885) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (GI BCO, Cat #10082), 2% (v/v) DMSO, 1% (v/v) Penicillin/Streptomycin (GIBCO, Cat #15140-148), 20 mM HEPES (GIBCO, Cat #15630-080), 44 mM NaHCO.sub.3(Wako, Cat #195-14515), 15 μg/ml L-proline (MP-Biomedicals, Cat #0219472825), 0.25 μg/ml Insulin (Sigma, Cat #11882), 50 nM Dexamethasone (Sigma, Cat #D8893), 5 ng/ml EGF (Sigma, Cat #E9644), and 0.1 mM L-Ascorbic acid 2-phosphate (Wako, Cat #013-12061). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO.sub.2. Culture medium was replaced 24 hours post-plating and three times a week until harvest.

siRNA Transfection

[0375] Four days post-infection the cells were transfected with the A1CF siRNA pool (see Table 6) in triplicates. No drug controls (NDC), negative control siRNA and HBx siRNA were included as controls (see Table 7).

[0376] Per well a transfection mixture was prepared with 2 μl of either negative control siRNA (stock concentration 1 μM), A1CF siRNA pool (stock concentration 1 μM), HBx control siRNA (stock concentration 0.12 μM) or H.sub.2O (NDC) with 18.2 μl OptiMEM® (Thermo Fisher Scientific Reduced Serum media) and 0.6 μl Lipofectamine® RNAiMAX Transfection Reagent (Thermofisher Scientific catalog No. 13778). The transfection mixture was mixed and incubated at room temperature 5 minutes prior to transfection. Prior to transfection, the medium was removed from the PHH cells and replaced by 100 μl/well William's E Medium+GlutaMAX™ (Gibco, #32551) supplemented with HepaRG supplement without P/S (Biopredic International, #ADD711C). 20 μl of transfection mix was added to each well yielding a final concentration of 16 nM for the negative control siRNA or A1CF siRNA pool, or 1.92 nM for the HBx control siRNA and the plates gently rocked before placing into the incubator. The medium was replaced with PHH medium after 6 hours. The siRNA treatment was repeated on day 6 post-infection as described above. On day 8 post-infection the supernatants were harvested and stored at −20° C. HBsAg and HBeAg can be determined from the supernatants if desired.

[0377] Measurement of HBV antigen expressionHBV antigen expression and secretion can be measured in the collected supernatants if desired. The HBV propagation parameters, HBsAg and HBeAg levels, are measured using CLIA ELISA Kits (Autobio Diagnostic #CL0310-2, #CL0312-2), according to the manufacturer's protocol. Briefly, 25 μL of supernatant per well is transferred to the respective antibody coated microtiter plate and 25 μL of enzyme conjugate reagent is added. The plate is incubated for 60 min on a shaker at room temperature before the wells are washed five times with washing buffer using an automatic washer. 25 μL of substrate A and B were added to each well. The plates are incubated on a shaker for 10 min at room temperature before luminescence is measured using an EnVision® luminescence reader (Perkin Elmer).

Cell Viability Measurements

[0378] The cell viability was measured on the supernatant free cells by the Cell Counting Kit −8 (CCK8 from Sigma Aldrich, #96992). For the measurement the CCK8 reagent was diluted 1:10 in normal culture medium and 100 μl/well added to the cells. After 1 h incubation in the incubator 80 μl of the supernatants were transferred to a clear flat bottom 96 well plate and read the absorbance at 450 nm. Absorbance values were normalized to the NDC which was set to 100% to calculate the relative cell viabilities.

[0379] Cell viability measurements are used to confirm that any reduction in the viral parameters is not the cause of cell death, the closer the value is to 100% the lower the toxicity.

qRT-PCR for cccDNA and HBV DNA Quantification

[0380] Following cell viability determination the cells were washed with PBS once and then lysed with 50 μl/well lysis solution from the TaqMan® Gene Expression Cells-to-CT™ Kit (Thermo Fisher Scientific, #AM1729) and stored at −80° C.

[0381] Prior to the cccDNA qPCR analysis, a fraction of the cell lysate was digested with T5 enzyme (15 U/4 μL cell lysate; New England Biolabs, #M0363L). Digestion was done at 37° C. for 30 min.

[0382] For the quantification of cccDNA for each reaction 2 μl T5-digested cell lysate, 0.5 μl 20×cccDNA_DANDRI Taqman primer/probe (Life Technologies, custom #AI1RW7N, FAM-dye listed in the Table below), 5 μl TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2.5 μl DEPC-treated water were used. Technical triplicates were run for each sample.

TABLE-US-00008 Primer name Sequence SEQ ID CCCDNA_DANDRI_F CCGTGTGCACTTCGCTTCA 18 CCCDNA_DANDRI_R GCACAGCTTGGAGGCTTGA 19 CCCDNA_DANDRI_M 5′-[6FAM]CATGGAGACCACCGTGAACGCCC[BHQ1]-3′ 20

[0383] For quantification of intra-cellular HBV DNA and the normalization control, human hemoglobin beta (HBB), for each reaction 2 μl undigested cell lysate, 0.5 μl 20×HBV Taqman primer/probe (Life Technologies, #Pa03453406_s1, FAM-dye), 0.5 μl 20×HBB Taqman® primer/probe (Life Technologies, #Hs00758889_s1, VIC-dye), 5 μl TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2 μl DEPC-treated water were used. Technical triplicates were run for each sample.

[0384] The qRT-PCR was run on the QuantStudio™ K12 Flex with standard settings for the fast heating block (95° C. for 20 seconds, then 40 cycles with 95° C. for 1 second and 60° C. for 20 seconds).

[0385] Any outliers were removed from the data set by excluding values with more than 0.9 difference to the median Ct of all 9 biological & technical replicates for each sample. Fold changes for cccDNA and total HBV DNA were determined from the Ct values via the 2.sup.−ddCT method, and normalized to the HBB as housekeeping gene. The expression levels are presented as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction).

Real-Time PCR for Measuring A1CF mRNA Expression

[0386] For quantification of A1CF RNA levels and the normalization control, GUS B, the TaqMan® RNA-to-Ct™ 1-Step Kit (Life Technologies, #4392656) was used. For each reaction 2 μl undigested cell lysate, 0.5 μl 20×A1CF Taqman primer/probe (Life Technologies, #Hs00205840_m1, FAM-dye), 0.5 μl 20×GUS B Taqman primer/probe (Life Technologies, #Hs00939627_m1, VIC-dye), 5 μl 2×TaqMan® RT-PCR Mix, 0.25 μl 40×TaqMan® RT Enzyme Mix and 1.75 μl DEPC-treated water were used. Technical triplicates were run for each sample and minus RT controls included to evaluate potential amplification due to DNA present.

[0387] The qRT-PCR was run on the QuantStudio™ K12 Flex with 48 C for 15 min, 95° C. for 10 min, then 40 cycles with 95° C. for 15 seconds and 60 C for 60 seconds.

[0388] The A1CF mRNA expression levels were analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GUS B and to non-transfected cells. Primers used for GUS B RNA and target mRNA quantification are listed in Table 8. The expression levels are presented as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction).

TABLE-US-00009 TABLE 8 GUS B and A1CF mRNA qPCR primers (Thermo Fisher Scientific) A1CF primers Hs00205840_m1 Housekeeping gene primers Hs00939627_m1

Example 1: Measurement of the Reduction of A1CF mRNA, HBV Intracellular DNA and cccDNA in HBV Infected PHH Cells Resulting from siRNA Treatment

[0389] In the following experiment, the effect of A1CF knock-down on the HBV parameters, HBV DNA and cccDNA, was tested.

[0390] HBV infected PHH cells were treated with the pool of siRNAs from Dharmacon (LU-013576-02-0005, see Table 6) as described in the Materials and Methods section “siRNA transfection”.

[0391] Following the 4 days-treatment, A1CF mRNA, cccDNA and intracellular HBV DNA were measured by qPCR as described in the Materials and Methods section “Real-time PCR for measuring A1CF mRNA Expression” and “qRT-PCR for cccDNA and HBV DNA quantification”. The results are shown in Table 9 as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction).

TABLE-US-00010 TABLE 9 Effect on HBV parameters following knockdown of A1CF with pool of siRNA. Values are given as average of biological and technical triplicates. HBV A1CF intracellular mRNA* DNA cccDNA Treatment Mean SD Mean SD Mean SD A1CF siRNA 39 6 40 15 24 3 HBx positive ND ND 56 30 94 60 control siRNA negative ND ND 94 37 109 63 control ND = not determined

[0392] From this it can be seen that the A1CF siRNA pool is capable of reducing A1CF mRNA, cccDNA as well as HBV DNA quite efficiently. The positive control reduced intracellular HBV DNA as expected but had no effect on cccDNA.