AAV DELIVERY SYSTEM FOR LUNG CANCER TREATMENT
20230257771 · 2023-08-17
Assignee
Inventors
- Eric B. Kmiec (Middletown, DE, US)
- Byung-Chun Yoo (Newark, DE)
- Natalia Rivera-Torres (Bear, DE, US)
- Pawel Bialk (Wilmington, DE, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2750/14132
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The disclosure provides a polynucleotide comprising: a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and a first promoter that is operably linked to the DNA sequence. The disclosure also provides vectors (e.g. AAV vectors), recombinant AAV (rAAV) and pharmaceutical compositions comprising the polynucleotides described herein. The disclosure further provides a method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a polynucleotide, vector, rAAV or pharmaceutical composition as described herein to the subject.
Claims
1. A recombinant adeno-associated virus (rAAV) comprising a polynucleotide, wherein the polynucleotide comprises: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence.
2. (canceled)
3. The rAAV of claim 1, wherein the NRF2 gene is a variant NRF2 gene.
4. The rAAV of claim 3, wherein the variant NRF2 gene encodes an NRF2 polypeptide comprising one or more amino acid substitutions selected from the group consisting of Q26E, Q26P, D29G, V32G, R34G, R34P, F71S, Q75H, E79G, T80P, E82W, and E185D relative to the amino acid sequence of SEQ ID NO: 8.
5. The rAAV of claim 4, wherein the NRF2 polypeptide comprises an R34G substitution relative to the amino acid sequence of SEQ ID NO: 8.
6. The rAAV of claim 3, wherein the gRNA is complementary to a target sequence in exon 2 of the variant NRF2 gene.
7. The rAAV of claim 1, further comprising: (a) a second DNA sequence encoding the gRNA; and (b) a second promoter that is operably linked to the second DNA sequence.
8. The rAAV of claim 7, further comprising: (a) a third DNA sequence encoding the gRNA; and (b) a third promoter that is operably linked to the third DNA sequence.
9. The rAAV of claim 3, wherein the DNA-binding domain of the gRNA comprises the nucleic acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, or SEQ ID NO: 126, or a biologically active fragment thereof.
10. The rAAV of claim 3, wherein one or more of the first, second and third DNA sequences encoding the gRNA comprises the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 84 or SEQ ID NO: 113, or a biologically active fragment thereof.
11-14. (canceled)
15. The rAAV of claim 8, wherein the first promoter, the second promoter, and the third promoter are selected from the group consisting of U6, H1 and 7SK.
16. The rAAV of claim 8, wherein the first promoter is U6, the second promoter is H1, and the third promoter is 7SK.
17. The rAAV of claim 1, further comprising one or more adeno-associated virus (AAV) inverted terminal repeat (ITR) sequences.
18. (canceled)
19. The rAAV of claim 1, further comprising one or more nucleic acid sequences that encode a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein or a fragment thereof.
20-21. (canceled)
22. The rAAV of claim 19, wherein the nucleic acid sequence that encodes the CRISPR-associated endonuclease or fragment thereof is operably linked to a promoter.
23. (canceled)
24. A polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence.
25. (canceled)
26. The polynucleotide of claim 24, wherein the NRF2 gene is a variant NRF2 gene.
27-46. (canceled)
47. An expression cassette comprising the polynucleotide of claim 24.
48. A vector comprising the polynucleotide of claim 24.
49-52. (canceled)
53. A method of reducing NRF2 expression or activity in a cancer cell in a subject, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 51 to the subject, wherein the gRNA hybridizes to the NRF2 gene and a CRISPR-associated endonuclease cleaves the NRF2 gene, and wherein NRF2 expression or activity is reduced in the cancer cell in the subject relative to a cancer cell in a subject that is not administered the polynucleotide, vector, rAAV or pharmaceutical composition.
54-58. (canceled)
59. A method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of claim 51 to the subject.
60. A method of reducing resistance to one or more chemotherapeutic agents in a cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of claim 51 to the subject.
61. The method of claim 59, wherein the cancer is selected from the group consisting of lung cancer, pancreatic cancer, melanoma, esophageal squamous cancer (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer.
62. The method of claim 61, wherein the cancer is lung cancer.
63. The method of claim 62, wherein the lung cancer is non-small-cell lung cancer (NSCLC).
64. The method of claim 63, wherein the NSCLC is squamous-cell lung carcinoma.
65. The method of claim 59, wherein expression or activity of wild-type NRF2 in a non-cancerous cell of the subject is unaffected by administration of the polynucleotide, vector, rAAV or pharmaceutical composition.
66. The method of claim 59, wherein the cancer is resistant to one or more chemotherapeutic agents.
67. The method of claim 59, further comprising administering one or more chemotherapeutic agents to the subject.
68. The method of claim 67, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, paclitaxel, docetaxel, cabazitaxel and a combination thereof.
69-72. (canceled)
73. The method of claim 59, wherein the pharmaceutical composition is administered intratumorally.
74. The method of claim 59, wherein the subject is human.
75. The rAAV of claim 22, wherein the promoter that is operably linked to the nucleic acid sequence that encodes the CRISPR-associated endonuclease or fragment thereof is selected from the group consisting of a tissue-specific promoter, an H1 promoter, a minimal cytomegalovirus (miniCMV) promoter, and an elongation factor 1α short (EFS) promoter.
76. A composition comprising: (a) a first recombinant adeno-associated virus (rAAV) comprising a polynucleotide encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a second rAAV comprising a polynucleotide encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein or a fragment thereof, wherein the gRNA and the CRISPR-associated endonuclease protein or fragment thereof are encoded by separate rAAVs.
77. The composition of claim 76, wherein the composition is a pharmaceutical composition.
78. The composition of claim 76, wherein the polynucleotide encoding the gRNA is operably linked to a promoter.
79. The composition of claim 76, wherein the polynucleotide encoding the CRISPR-associated endonuclease protein or fragment thereof is operably linked to a promoter.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
DETAILED DESCRIPTION
[0069] This disclosure is based at least in part on the discovery that successful knockout of the NRF2 gene using CRISPR/Cas9 in chemo-resistant A549 lung cancer cells decreased proliferation of the cancer cells and increased effectiveness of the anticancer drugs cisplatin, carboplatin and vinorelbine in both in vitro culture and a xenograft mouse model. The overall strategy was to design and utilize a CRISPR/Cas gene editing tool to disable the NRF2 gene in cancer cells rendering it incapable of producing a functional protein. The CRISPR/Cas9 complex aligns in homologous register with the target gene, which enables it to execute a double-stranded DNA break. This action is followed by an attempt by the cell to reclose scission, most often through a process known as nonhomologous end joining (NHEJ). The re-closure is often imperfect and unfaithful as a number of nucleotides are lost during the process resulting in a genetic frameshift and the subsequent production of nonfunctional transcripts, a gene knockout of NRF2.
[0070] In certain aspects, the disclosure relates to a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence.
[0071] In some embodiments, the guide RNA is complementary to a variant NRF2 gene that is found only in cancer cells and not in wild-type NRF2 genes in normal (i.e., non-cancerous) cells (e.g. exon 1, 2, 3, 4, or 5). In some embodiments, the guide RNA is complementary to a sequence in exon 2 of a variant NRF2 gene that is found only in cancer cells.
Definitions
[0072] Applicants specifically incorporate the entire contents of all cited references in this disclosure. Further, when an amount, concentration, or other value or parameter is given as either a range or a list of upper values and lower values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or value and any lower range limit or value, regardless of whether ranges are separately disclosed. Where a range of numerical values is recited herein, unless otherwise stated, the range is intended to include the endpoints thereof, and all integers and fractions within the range. It is not intended that the scope of the present disclosure be limited to the specific values recited when defining a range.
[0073] The indefinite articles “a” and “an”, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one”.
[0074] The phrase “and/or”, as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with openended language such as “comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0075] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of”, or, when used in the claims, “consisting of”, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, “either”, “one of”, “only one of”, “exactly one of”. “Consisting essentially of”, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0076] The term “about” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0077] The term “biologically active fragment” as used herein refers to a portion of a polynucleotide or polypeptide that retains at least one activity of the full length polynucleotide or polypeptide. For example, in some embodiments, a biologically active fragment of a promoter is a portion of the promoter that retains promoter activity. In some embodiments, a biologically active fragment of a DNA binding domain is a portion of the DNA binding domain that retains DNA binding activity. In some embodiments, a biologically active fragment of a DNA sequence encoding a guide RNA is a portion of the DNA sequence that encodes a functional guide RNA.
[0078] A “Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain” or “Cas binding domain” refers to a nucleic acid element or domain within a nucleic acid sequence or polynucleotide sequence that, in an effective amount, will bind or have an affinity for one or a plurality of CRISPR-associated endonuclease (or functional fragments thereof). In some embodiments, in the presence of the one or a plurality of proteins (or functional fragments thereof) and a target sequence, the one or plurality of proteins and the nucleic acid element forms a biologically active CRISPR complex and/or can be enzymatically active on a target sequence. In some embodiments, the CRISPR-associated endonuclease is a class 1 or class 2 CRISPR-associated endonuclease, and in some embodiments, a Cas9 or Cas12a endonuclease. In a particular embodiment, the CRISPR-associated endonuclease is Cas9. The Cas9 endonuclease can have a nucleotide sequence identical to the wild type Streptococcus pyogenes sequence. In some embodiments, the CRISPR-associated endonuclease protein-binding domain is a Cas9 protein binding domain. In some embodiments, the DNA sequence encoding the Cas9 protein binding domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 113, or a DNA sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 113, or a biologically active fragment thereof.
[0079] In some embodiments, the CRISPR-associated endonuclease can be a sequence from other species, for example other Streptococcus species, such as thermophilus; Pseudomona aeruginosa, Escherichia coli, or other sequenced bacteria genomes and archaea, or other prokaryotic microorganisms. Such species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cycliphilusdenitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp., and Verminephrobacter eiseniae (or functional fragments or variants of any of the aforementioned sequences that have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the aforementioned Cas9 endonucleases). In some embodiments, the CRISPR-associated endonuclease can be a Cas12a nuclease. The Cas12a nuclease can have a nucleotide sequence identical to a wild type Prevotella or Francisella sequence (or functional fragments or variants of any of the aforementioned sequences that have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the aforementioned Cas12 endonucleases).
[0080] In some embodiments, the terms “(CRISPR)-associated endonuclease protein-binding domain” or “Cas binding domain” refer to a nucleic acid element or domain (e.g. and RNA element or domain) within a nucleic acid sequence that, in an effective amount, will bind to or have an affinity for one or a plurality of CRISPR-associated endonucleases (or functional fragments or variants thereof that are at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to a CRISPR-associated endonucleas). In some embodiments, the Cas binding domain consists of at least or no more than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides and comprises at least one sequence that is capable of forming a hairpin or duplex that partially associates or binds to a biologically active CRISPR-associated endonuclease at a concentration and within a microenvironment suitable for CRISPR system formation.
[0081] The “Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)—CRISPR associated (Cas) (CRISPR-Cas) system guide RNA” or “CRISPR-Cas system guide RNA” may comprise a transcription terminator domain. The term “transcription terminator domain” refers to a nucleic acid element or domain within a nucleic acid sequence (or polynucleotide sequence) that, in an effective amount, prevents bacterial transcription when the CRISPR complex is in a bacterial species and/or creates a secondary structure that stabilizes the association of the nucleic acid sequence to one or a plurality of Cas proteins (or functional fragments thereof) such that, in the presence of the one or a plurality of proteins (or functional fragments thereof), the one or plurality of Cas proteins and the nucleic acid element forms a biologically active CRISPR complex and/or can be enzymatically active on a target sequence in the presence of such a target sequence and a DNA-binding domain. In some embodiments, the transcription terminator domain consists of at least or no more than about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides and comprises at least one sequence that is capable of forming a hairpin or duplex that partially drives association of the nucleic acid sequence (sgRNA, crRNA with tracrRNA, or other nucleic acid sequence) to a biologically active CRISPR complex at a concentration and microenvironment suitable for CRISPR complex formation.
[0082] The term “DNA-binding domain” refers to a nucleic acid element or domain within a nucleic acid sequence (e.g. a guide RNA) that is complementary to a target sequence (e.g. an NRF2 gene). In some embodiments, the DNA-binding domain will bind or have an affinity for an NRF2 gene such that, in the presence of a biologically active CRISPR complex, one or plurality of Cas proteins can be enzymatically active on the target sequence. In some embodiments, the DNA binding domain comprises at least one sequence that is capable of forming Watson Crick basepairs with a target sequence as part of a biologically active CRISPR system at a concentration and microenvironment suitable for CRISPR system formation.
[0083] “CRISPR system” refers collectively to transcripts or synthetically produced transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a nucleic acid sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is a DNA polynucleotide and is referred to a DNA target sequence. In some embodiments, a target sequence comprises at least three nucleic acid sequences that are recognized by a Cas-protein when the Cas protein is associated with a CRISPR complex or system which comprises at least one sgRNA or one tracrRNA/crRNA duplex at a concentration and within an microenvironment suitable for association of such a system. In some embodiments, the target DNA comprises at least one or more proto-spacer adjacent motifs which sequences are known in the art and are dependent upon the Cas protein system being used in conjunction with the sgRNA or crRNA/tracrRNAs employed by this work. In some embodiments, the target DNA comprises NNG, where G is an guanine and N is any naturally occurring nucleic acid. In some embodiments the target DNA comprises any one or combination of NNG, NNA, GAA, NNAGAAW and NGGNG, where G is an guanine, A is adenine, and N is any naturally occurring nucleic acid
[0084] In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell.
[0085] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional (bind the Cas protein or functional fragment thereof). In some embodiments, the tracr sequence has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that the presence and/or expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. With at least some of the modification contemplated by this disclosure, in some embodiments, the guide sequence or RNA or DNA sequences that form a CRISPR complex are at least partially synthetic. The CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. In some embodiments, the disclosure relates to a composition comprising a chemically synthesized guide sequence. In some embodiments, the chemically synthesized guide sequence is used in conjunction with a vector comprising a coding sequence that encodes a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein. In some embodiments, the chemically synthesized guide sequence is used in conjunction with one or more vectors, wherein each vector comprises a coding sequence that encodes a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more additional (second, third, fourth, etc.) guide sequences, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, one or more additional guide sequence, tracr mate sequence, and tracr sequence are each a component of different nucleic acid sequences. For instance, in the case of a tracr and tracr mate sequences and in some embodiments, the disclosure relates to a composition comprising at least a first and second nucleic acid sequence, wherein the first nucleic acid sequence comprises a tracr sequence and the second nucleic acid sequence comprises a tracr mate sequence, wherein the first nucleic acid sequence is at least partially complementary to the second nucleic acid sequence such that the first and second nucleic acid for a duplex and wherein the first nucleic acid and the second nucleic acid either individually or collectively comprise a DNA-targeting domain, a Cas protein binding domain, and a transcription terminator domain. In some embodiments, the CRISPR enzyme, one or more additional guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter. In some embodiments, the disclosure relates to compositions comprising any one or combination of the disclosed domains on one guide sequence or two separate tracrRNA/crRNA sequences with or without any of the disclosed modifications. Any methods disclosed herein also relate to the use of tracrRNA/crRNA sequence interchangeably with the use of a guide sequence, such that a composition may comprise a single synthetic guide sequence and/or a synthetic tracrRNA/crRNA with any one or combination of modified domains disclosed herein.
[0086] In some embodiments, a guide RNA can be a short, synthetic, chimeric tracrRNA/crRNA (a “single-guide RNA” or “sgRNA”). A guide RNA may also comprise two short, synthetic tracrRNA/crRNAs (a “dual-guide RNA” or ‘dgRNA”).
[0087] The terms “cancer” or “tumor” are well known in the art and refer to the presence, e.g., in a subject, of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, decreased cell death/apoptosis, and certain characteristic morphological features.
[0088] As used herein, “cancer” refers to all types of cancer or neoplasm or malignant tumors found in humans, including, but not limited to: leukemias, lymphomas, melanomas, carcinomas and sarcomas. As used herein, the terms or language “cancer,” “neoplasm,” and “tumor,” are used interchangeably and in either the singular or plural form, refer to cells that have undergone a malignant transformation that makes them pathological to the host organism. Primary cancer cells (that is, cells obtained from near the site of malignant transformation) can be readily distinguished from non-cancerous cells by well-established techniques, particularly histological examination. The definition of a cancer cell, as used herein, includes not only a primary cancer cell, but also cancer stem cells, as well as cancer progenitor cells or any cell derived from a cancer cell ancestor. This includes metastasized cancer cells, and in vitro cultures and cell lines derived from cancer cells. In certain embodiments, the cancer is a blood tumor (i.e., a non-solid tumor). In some embodiments, the cancer is lymphoid neoplasm diffuse large B-cell lymphoma, cholangiocarcinoma, uterine carcinosarcoma, kidney chromophobe, uveal melanoma, mesothelioma, adrenocortical carcinoma, thymoma, acute myeloid leukemia, testicular germ cell tumor, rectum adenocarcinoma, pancreatic adenocarcinoma, phenochromocytoma and paraganglioma, esophageal carcinoma, sarcoma, kidney renal papillary cell carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, kidney renal clear cell carcinoma, liver hepatocellular carcinoma, glioblastoma multiforme, bladder urothelial carcinoma, colon adenocarcinoma, stomach adenocarcinoma, ovarian serous cystadenocarcinoma, skin cutaneous melanoma, prostate adenocarcinoma, thyroid carcinoma, lung squamous cell carcinoma, head and neck squamous cell carcinoma, brain lower grade glioma, uterine corpus endometrial carcinoma, lung adenocarcinoma, or breast invasive carcinoma (see, e.g., Kerins et al., Sci. Rep. 8:12846 (2018)).
[0089] In certain embodiments, the cancer is a solid tumor. A “solid tumor” is a tumor that is detectable on the basis of tumor mass; e.g., by procedures such as CAT scan, MR imaging, X-ray, ultrasound or palpation, and/or which is detectable because of the expression of one or more cancer-specific antigens in a sample obtainable from a patient. The tumor does not need to have measurable dimensions.
[0090] Specific criteria for the staging of cancer are dependent on the specific cancer type based on tumor size, histological characteristics, tumor markers, and other criteria known by those of skill in the art. Generally, cancer stages can be described as follows: [0091] Stage 0 - Carcinoma in situ [0092] Stage I, Stage II, and Stage III - Higher numbers indicate more extensive disease: Larger tumor size and/or spread of the cancer beyond the organ in which it first developed to nearby lymph nodes and/or tissues or organs adjacent to the location of the primary tumor [0093] Stage IV - The cancer has spread to distant tissues or organs
[0094] As used herein, a “variant”, “mutant”, or “mutated” polynucleotide contains at least one polynucleotide sequence alteration as compared to the polynucleotide sequence of the corresponding wild-type or parent polynucleotide. Mutations may be natural, deliberate, or accidental. Mutations include substitutions, deletions, and insertions.
[0095] As used herein, the terms “treat,” “treating” or “treatment” refer to an action to obtain a beneficial or desired clinical result including, but not limited to, alleviation or amelioration of one or more signs or symptoms of a disease or condition (e.g., regression, partial or complete), diminishing the extent of disease, stability (i.e., not worsening, achieving stable disease) of the state of disease, amelioration or palliation of the disease state, diminishing rate of or time to progression, and remission (whether partial or total). “Treatment” of a cancer can also mean prolonging survival as compared to expected survival in the absence of treatment. Treatment need not be curative. In certain embodiments, treatment includes one or more of a decrease in pain or an increase in the quality of life (QOL) as judged by a qualified individual, e.g., a treating physician, e.g., using accepted assessment tools of pain and QOL. In certain embodiments, a decrease in pain or an increase in the QOL as judged by a qualified individual, e.g., a treating physician, e.g., using accepted assessment tools of pain and QOL is not considered to be a “treatment” of the cancer.
[0096] “Chemotherapeutic agent” refers to a drug used for the treatment of cancer. Chemotherapeutic agents include, but are not limited to, small molecules, hormones and hormone analogs, and biologics (e.g., antibodies, peptide drugs, nucleic acid drugs). In certain embodiments, chemotherapy does not include hormones and hormone analogs.
[0097] A “cancer that is resistant to one or more chemotherapeutic agents” is a cancer that does not respond, or ceases to respond to treatment with a chemotherapeutic regimen, i.e., does not achieve at least stable disease (i.e., stable disease, partial response, or complete response) in the target lesion either during or after completion of the chemotherapeutic regimen. Resistance to one or more chemotherapeutic agents results in, e.g., tumor growth, increased tumor burden, and/ or tumor metastasis.
[0098] A “therapeutically effective amount” is that amount sufficient, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as for treatment of a disease (e.g. cancer), condition, or disorder, and/or pharmacokinetic or pharmacodynamic effect of the treatment in a subject. A therapeutically effective amount can be administered in one or more administrations. The therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject.
[0099] As used herein, a “vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. In general, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Recombinant expression vectors can comprise a nucleic acid suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements (e.g. promoters), which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
[0100] The term “AAV vector” as used herein refers to a DNA vector that comprises at least one inverted terminal repeat (e.g., one, two or three inverted terminal repeats) and one or more heterologous nucleotide sequences (e.g. encoding an sgRNA as described herein). The AAV vector may comprises two ITRs (e.g., AAV ITRs), which may be at the 5′ and 3′ ends of the heterologous nucleotide sequence(s), but need not be contiguous thereto. The ITRs can be the same or different from each other. The AAV vector may contain a single ITR at its 3′ or 5′ end.
[0101] The term “inverted terminal repeat” or “ITR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like). The ITR can be an AAV ITR or a non-AAV ITR. For example, a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition. Further, the ITR can be partially or completely synthetic, such as the “double-D sequence” as described in U.S. Pat. No. 5,478,745 to Samulski et al.
[0102] The term “recombinant adeno-associated virus” or “rAAV” as used herein refers to a viral particle composed of at least one AAV capsid polypeptide (including both variant capsid polypeptides and non-variant parent capsid polypeptides) and an encapsidated polynucleotide AAV vector.
[0103] The term “promoter” as used herein refers to a DNA regulatory element that drives expression of a polynucleotide. Promoters include those that direct constitutive expression of a polynucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific promoter). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. lung, liver, pancreas), or particular cell types (e.g. lymphocytes). Promoters may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific.
[0104] The term “expression cassette” as used herein refers to a polynucleotide comprising an adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence at each end. In some embodiments, the expression cassette further comprises one or more nucleic acid sequences encoding a gRNA. The one or more nucleic acids sequences encoding a gRNA may be operably linked to a promoter. In some embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 125, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 125, or a biologically active fragment thereof. SEQ ID NO: 125 comprises three repeats of a nucleic acid sequence (SEQ ID NO: 124) encoding the gRNA of SEQ ID NO: 128. Each repeat is operably linked to the H1, U6 or 7SK promoter.
[0105] The terms “polynucleotide” and “nucleic acid sequence” are used interchangeably herein.
NRF2
[0106] Nuclear Factor Erythroid 2- Related Factor (NRF2) is considered the master regulator of 100-200 target genes involved in cellular responses to oxidative/electrophilic stress. Targets include glutathione (GSH) mediators, antioxidants and genes controlling efflux pumps. Hayden, et al., Urol. Oncol. Semin. Orig. Investig. 32, 806-814 (2014). NRF2 is also known to regulate expression of genes involved in protein degradation and detoxification and is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1), a substrate adapter for the Cul3-dependent E3 ubiquitin ligase complex. Under normal conditions, Keap1 constantly targets NRF2 for ubiquitin-dependent degradation maintaining low expression of NRF2 on downstream target genes. However, chemotherapy has been shown to activate transcriptional activity of the NRF2 target genes often triggering a cytoprotective response; enhanced expression of NRF2 occurs in response to environmental stress or detrimental growth conditions. Other mechanisms that lead to NRF2 upregulation include mutations in KEAP1 or epigenetic changes of the promoter region. The upregulation of NRF2 expression leads to an enhanced resistance of cancer cells to chemotherapeutic drugs, which by their very action induce an unfavorable environment for cell proliferation. Indeed, Hayden et al. (ibid) have clearly demonstrated that increased NRF2 expression leads to the resistance of cancer cells to chemotherapeutic drugs including cisplatin. Singh et al. (2010, Antioxidants & Redox Signaling 13) also showed that constitutive expression of NRF2 leads to radioresistance, and inhibition of NRF2 causes increased endogenous reactive oxygen species (ROS) levels as well as decreased survival. Recently, Torrente et al. (Oncogene (2017). doi:10.1038/onc.2017.221) identified crosstalk between NRF2 and the homeodomain interacting protein kinase two, HIPK2, demonstrating that HIPK2 exhibits a cytoprotective effect through NRF2.
[0107] By using CRISPR/Cas9, it is possible to target and knock out the mutated NRF2 protein causing chemoresistance, while not disrupting the function of wildtype NRF2 protein. Thus, some embodiments are directed to reducing or, in some embodiments, eliminating expression of variant NRF2s found only in cancer cells and not in non-cancerous cells. These variants are commonly found within the Neh2 Domain of NRF2, which is known as the KEAP1 binding domain. In some embodiments, the NRF2 mutations can be those found in Table 1 below.
TABLE-US-00001 SEQ ID NO: Sequence, with substitution identified in brackets Base position in SEQ ID NO: 7 Notes/Amino Acid substitution (relative to position in SEQ ID NO:8) 41 TTTGATTGACATACTTTGGAGGC(C>G) 205-227 Q26E 42 CTTACTCCAAGATCTATATCTT(T>G)G 249-227 Reverse complement; Q26P 43 ATACTTTGGAGGCAAGATATAGA(A>G) 215-237 D29G 44 AGGCAAGATATAGATCTTGGAGT(T>G) 224-246 V32G 45 GATATAGATCTTGGAGTAAGTC(C>G)G 230-252 R34G 46 TGACTGAAGTCAAATACTTCTC(C>G)G 273-251 Reverse complement; R34P 47 TTCATCTAGTTGTAACTGAGCGA(A>G) 385-363 Reverse complement; F71S 48 ATTCACCTGTCTCTTCATCTAGT(T>G) 398-376 Reverse complement; Q75H 49 CTCAGTTACAACTAGATGAAGA(A>G)G 366-388 E79G 50 TGAATTGGGAGAAATTCACCTGT(T>G) 411-389 Reverse complement; T80P 51 CAACTAGATGAAGAGACAGGTGA(A>G) 374-396 E82W 52 ATAATAGCTCCTCCCAAACTTGC(C>G) 728-706 Reverse complement; E185D 57 TTTTTCGCTCAGTTACAACTAGA(A>G) 360-381 D77G 58 CAACTAGATGAAGAGACAGGTGA(A>G) 374-396 E82G PAM sequence underlined.
[0108] In some embodiments, a variant NRF2 polypeptide encoded by the variant NRF2 gene in a cancer cell can comprise one or more amino acid substitutions of: (a) Q26E, D29G, V32G, R34G, F71S, Q75H, D77G, E79G, T80P, E82W, or E185D relative to SEQ ID NO:8; (b) Q26E, D29G, V32G, R34P, F71S, Q75H, D77G, E79G, T80P, E82W, or E185D relative to SEQ ID NO:8; (c) Q26P, D29G, V32G, R34G, F71S, Q75H, D77G, E79G, T80P, E82W, or E185D relative to SEQ ID NO:8; (d) Q26P, D29G, V32G, R34P, F71S, Q75H, D77G, E79G, T80P, E82W, or E185D relative to SEQ ID NO:8; (e) Q26E, D29G, V32G, R34G, F71S, Q75H, D77G, E79G, T80P, E82G, or E185D relative to SEQ ID NO:8; (f) Q26E, D29G, V32G, R34P, F71S, Q75H, D77G, E79G, T80P, E82G, or E185D relative to SEQ ID NO:8; (g) Q26P, D29G, V32G, R34G, F71S, Q75H, D77G, E79G, T80P, E82G, or E185D relative to SEQ ID NO:8; or (h) Q26P, D29G, V32G, R34P, F71S, Q75H, D77G, E79G, T80P, E82G, or E185D relative to SEQ ID NO:8.
[0109] In some embodiments, a variant NRF2 gene can comprise: (a) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:41 substituting positions 205-227 of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:45 substituting positions 230-252 of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:51 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (b) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:41 substituting positions 205-227 of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:46 substituting positions 273-251 of the reverse complement of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:51 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (c) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:42 substituting positions 249-227 of the reverse complement of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:45 substituting positions 230-252 of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:51 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (d) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:42 substituting positions 249-227 of the reverse complement of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:46 substituting positions 273-251 of the reverse complement of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:51 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (e) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:41 substituting positions 205-227 of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:45 substituting positions 230-252 of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:58 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (f) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:41 substituting positions 205-227 of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:46 substituting positions 273-251 of the reverse complement of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:58 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; (g) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:42 substituting positions 249-227 of the reverse complement of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:45 substituting positions 230-252 of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:58 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7; or (h) one or more polynucleotide sequences selected from the group consisting of SEQ ID NO:42 substituting positions 249-227 of the reverse complement of SEQ ID NO:7, SEQ ID NO:43 substituting positions 215-237 of SEQ ID NO:7, SEQ ID NO:44 substituting positions 224-246 of SEQ ID NO:7, SEQ ID NO:46 substituting positions 273-251 of the reverse complement of SEQ ID NO:7, SEQ ID NO:47 substituting positions 385-363 of the reverse complement of SEQ ID NO:7, SEQ ID NO:48 substituting positions 398-376 of the reverse complement of SEQ ID NO:7, SEQ ID NO:49 substituting positions 366-388 of SEQ ID NO:7, SEQ ID NO:50 substituting positions 411-389 of the reverse complement of SEQ ID NO:7, SEQ ID NO:58 substituting positions 374-396 of SEQ ID NO:7, SEQ ID NO:52 substituting positions 728-706 of the reverse complement of SEQ ID NO:7, or SEQ ID NO:57 substituting positions 360-381 of SEQ ID NO:7.
CRISPR/Endonucleases
[0110] CRISPR/endonuclease (e.g., CRISPR/Cas9) systems are known in the art and are described, for example, in U.S. Pat. No. 9,925,248, which is incorporated by reference herein in its entirety. CRISPR-directed gene editing can identify and execute DNA cleavage at specific sites within the chromosome at a surprisingly high efficiency and precision. The natural activity of CRISPR/Cas9 is to disable a viral genome infecting a bacterial cell. Subsequent genetic reengineering of CRISPR/Cas function in human cells presents the possibility of disabling human genes at a significant frequency.
[0111] In bacteria, the CRISPR/Cas loci encode RNA-guided adaptive immune systems against mobile genetic elements (viruses, transposable elements and conjugative plasmids). Three types (I-III) of CRISPR systems have been identified. CRISPR clusters contain spacers, the sequences complementary to antecedent mobile elements. CRISPR clusters are transcribed and processed into mature CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA (crRNA) containing a DNA binding region (spacer) which is complementary to the target gene. The CRISPR-associated endonuclease, Cas9, belongs to the type II CRISPR/Cas system and has strong endonuclease activity to cut target DNA. Cas9 is guided by a mature crRNA that contains about 20 base pairs (bp) of unique target sequence (called a spacer) and a trans-activated small RNA (tracrRNA) that serves as a guide for ribonuclease III-aided processing of pre-crRNA. The crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called protospacer) on the target DNA. Cas9 recognizes a trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cut site (the 3rd nucleotide from PAM).
[0112] The compositions described herein can include a nucleic acid encoding a CRISPR-associated endonuclease. The CRISPR-associated endonuclease can be, e.g., a class 1 CRISPR-associated endonuclease or a class 2 CRISPR-associated endonuclease. Class 1 CRISPR-associated endonucleases include type I, type III, and type IV CRISPR-Cas systems, which have effector molecules that comprise multiple subunits. For class 1 CRISPR-associated endonucleases, effector molecules can include, in some embodiments, Cas7 and Cas5, along with, in some embodiments, SS (Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3″ and Cas10d; Cas SS (Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS (Cas11) and Cas8-like (Csf1); or SS (Cas11) and Cas10. Class 1 CRISPR-associated endonucleases also be associated with, in some embodiments, target cleavage molecules, which can be Cas3 (type I) or Cas10 (type III) and spacer acquisition molecules such as, e.g., Cas1, Cas2, and/or Cas4. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich & Chertow, J. Clin. Microbiol. 57:1307-18 (2019).
[0113] Class 2 CRISPR-associated endonucleases include type I, type V, and type VI CRISPR-Cas systems, which have a single effector molecule. For class 2 CRISPR-associated endonucleases, effector molecules can include, in some embodiments, Cas9, Cas12a (cpf1), Cas12b1 (c2c1), Cas12b2, Cas12c (c2c3), Cas12d (CasY), Cas12e (CasX), Cas12f1 (Cas14a), Cas12f2 (Cas14b), Cas12f3 (Cas14c), Cas12g, Cas12h, Cas12i, Cas12k (c2c5), Cas13a (c2c2), Cas13b1 (c2c6), Cas13b2 (c2c6), Cas13c (c2c7), Cas13d, c2c4, c2c8, c2c9, and/or c2c10. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich & Chertow, J. Clin. Microbiol. 57:1307-18 (2019); Makarova et al., Nat. Rev. Microbiol. 18:67-83 (2020).
[0114] In some embodiments, the CRISPR-associated endonuclease can be a Cas9 nuclease. The Cas9 nuclease can be encoded by a nucleotide sequence identical to the wild type Streptococcus pyogenes nucleotide sequence. In some embodiments, the nucleic acid sequence that encodes the Cas9 nuclease comprises or consists of the nucleic acid sequence of SEQ ID NO: 115, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 115. In some embodiments, the Cas9 nuclease comprises or consists of the amino acid sequence of SEQ ID NO: 114, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 114.
[0115] In some embodiments, the CRISPR-associated endonuclease can be a sequence from other species, for example other Streptococcus species, such as thermophilus; Pseudomona aeruginosa, Escherichia coli, or other sequenced bacteria genomes and archaea, or other prokaryotic microorganisms. Such species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cycliphilusdenitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp., and Verminephrobacter eiseniae.
[0116] Alternatively, the wild type Streptococcus pyogenes Cas9 sequence can be modified. The nucleic acid sequence can be codon optimized for efficient expression in mammalian cells, e.g., human cells. A Cas9 nuclease sequence codon optimized for expression in human cells sequence can be for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers KM099231.1 GI:669193757; KM099232.1 GI:669193761; or KM099233.1 GI:669193765. Alternatively, the Cas9 nuclease sequence can be, for example, the sequence contained within a commercially available vector such as pX458, pX330 or pX260 from Addgene (Cambridge, Mass.). In some embodiments, the Cas9 endonuclease can have an amino acid sequence that is a variant or a fragment of any of the Cas9 endonuclease sequences of Genbank accession numbers KM099231.1 GI:669193757; KM099232.1 GI:669193761; or KM099233.1 GI:669193765 or Cas9 amino acid sequence of pX458, pX330 or pX260 (Addgene, Cambridge, Mass.). The Cas9 nucleotide sequence can be modified to encode biologically active variants of Cas9, and these variants can have or can include, for example, an amino acid sequence that differs from a wild type Cas9 by virtue of containing one or more mutations (e.g., an addition, deletion, or substitution mutation or a combination of such mutations). One or more of the substitution mutations can be a substitution (e.g., a conservative amino acid substitution). For example, a biologically active variant of a Cas9 polypeptide can have an amino acid sequence with at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a wild type Cas9 polypeptide.
[0117] In some embodiments, the CRISPR-associated endonuclease can be a Cas12a nuclease. The Cas12a nuclease can have a nucleotide sequence identical to a wild type Prevotella or Francisella sequence. Alternatively, a wild type Prevotella or Francisella Cas12a sequence can be modified. The nucleic acid sequence can be codon optimized for efficient expression in mammalian cells, e.g., human cells. A Cas12a nuclease sequence codon optimized for expression in human cells sequence can be for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers MF193599.1 GI: 1214941796, KY985374.1 GI: 1242863785, KY985375.1 GI: 1242863787, or KY985376.1 GI: 1242863789. Alternatively, the Cas12a nuclease sequence can be, for example, the sequence contained within a commercially available vector such as pAs-Cpf1 or pLb-Cpf1 from Addgene (Cambridge, Mass.). In some embodiments, the Cas12a endonuclease can have an amino acid sequence that is a variant or a fragment of any of the Cas12a endonuclease sequences of Genbank accession numbers MF193599.1 GI: 1214941796, KY985374.1 GI: 1242863785, KY985375.1 GI: 1242863787, or KY985376.1 GI: 1242863789 or Cas12a amino acid sequence of pAs-Cpf1 or pLb-Cpf1 (Addgene, Cambridge, Mass.). The Cas12a nucleotide sequence can be modified to encode biologically active variants of Cas12a, and these variants can have or can include, for example, an amino acid sequence that differs from a wild type Cas12a by virtue of containing one or more mutations (e.g., an addition, deletion, or substitution mutation or a combination of such mutations). One or more of the substitution mutations can be a substitution (e.g., a conservative amino acid substitution). For example, a biologically active variant of a Cas12a polypeptide can have an amino acid sequence with at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a wild type Cas12a polypeptide.
[0118] The compositions described herein may also include sequence encoding a guide RNA (gRNA) comprising a DNA-binding domain that is complementary to a target domain from an NRF2 gene (e.g., a target domain from exon 1, 2, 3, 4, or 5 of an NRF2 gene), and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain. In some embodiments, the gRNA comprises a DNA-binding domain that is complementary to a target domain from a variant NRF2 gene that is found only in cancer cells and not in wild-type NRF2 genes in normal (i.e., non-cancerous) cells (e.g., a target domain from exon 1, 2, 3, 4, or 5 of a variant NRF2 gene). The guide RNA sequence can be a sense or antisense sequence. The guide RNA sequence may include a proto-spacer adjacent motif (PAM). The sequence of the PAM can vary depending upon the specificity requirements of the CRISPR endonuclease used. In the CRISPR-Cas system derived from S.pyogenes, the target DNA typically immediately precedes a 5′-NGG proto-spacer adjacent motif (PAM). Thus, for the S.pyogenes Cas9, the PAM sequence can be AGG, TGG, CGG or GGG. Other Cas9 orthologs may have different PAM specificities. The specific sequence of the guide RNA may vary, but, regardless of the sequence, useful guide RNA sequences will be those that minimize off-target effects while achieving high efficiency. In some embodiments, the guide RNA sequence achieves complete ablation of the NRF2 gene. In some embodiments, the guide RNA sequence achieves complete ablation of a variant NRF2 gene without affecting expression or activity of a wild-type NRF2 gene.
[0119] In some embodiments, the DNA-binding domain varies in length from about 20 to about 55 nucleotides, for example, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides. In some embodiments, the Cas protein-binding domain is from about 30 to about 55 nucleotides in length, for example, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides.
Polynucleotides Encoding the Guide RNA and CRISPR Endonuclease
[0120] In some embodiments, the compositions comprise one or more nucleic acid (i.e. DNA) sequences encoding the guide RNA and the CRISPR endonuclease. When the compositions are administered as a nucleic acid or are contained within an expression vector, the CRISPR endonuclease can be encoded by the same nucleic acid or vector as the guide RNA sequence. In some embodiments, the CRISPR endonuclease can be encoded in a physically separate nucleic acid from the guide RNA sequence or in a separate vector. In some embodiments, the nucleic acid sequence encoding the guide RNA comprises a nucleic acid sequence encoding a DNA binding domain, a nucleic acid sequence encoding a Cas protein binding domain, and a transcription terminator domain. In some embodiments, the nucleic acid sequence encoding the guide RNA comprises a nucleic acid sequence encoding a DNA binding domain, and a nucleic acid sequence encoding a Cas protein binding domain. In some embodiments the nucleic acid sequence encoding the DNA binding domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 84, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 84, or a biologically active fragment thereof. In a particular embodiment, the nucleic acid sequence encoding the DNA binding domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 61, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 61, or a biologically active fragment thereof. In a further particular embodiment, the nucleic acid sequence encoding the DNA binding domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 61.
[0121] In some embodiments, the nucleic acid sequence encoding the Cas (e.g. Cas9) protein binding domain comprises of consists of the nucleic acid sequence of SEQ ID NO: 113 or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 113, or a biologically active fragment thereof. In some embodiments, the DNA sequence encoding the guide RNA comprises the nucleic acid sequence of SEQ ID NO: 61 (encoding the DNA binding domain), and the nucleic acid sequence of SEQ ID NO: 113 (encoding a Cas9 binding domain). For example, in some embodiments, the DNA sequence encoding the gRNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 124, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 124, or a biologically active fragment thereof. SEQ ID NO: 124 consists of the nucleic acid sequence of SEQ ID NO: 61 (encoding the DNA binding domain), and the nucleic acid sequence of SEQ ID NO: 113 (encoding a Cas9 binding domain).
[0122] The nucleic acid encoding the guide RNA and/or the CRISPR endonuclease may be an isolated nucleic acid. An “isolated” nucleic acid can be, for example, a naturally-occurring DNA molecule or a fragment thereof, provided that at least one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally-occurring genome is removed or absent. Isolated nucleic acid molecules can be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid containing a nucleotide sequence described herein, including nucleotide sequences encoding a polypeptide described herein. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described in, for example, PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. Various PCR strategies also are available by which site-specific nucleotide sequence modifications can be introduced into a template nucleic acid.
[0123] Isolated nucleic acids also can be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3′ to 5′ direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., >50-100 nucleotides) can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector. Isolated nucleic acids also can be obtained by mutagenesis of, e.g., a naturally occurring portion of a Cas9-encoding DNA (in accordance with, for example, the formula above).
[0124] Recombinant constructs are also provided herein and can be used to transform cells in order to express the CRISPR endonuclease and/or a guide RNA complementary to an NRF2 gene (in some embodiments, a variant NRF2 gene found only in cancer cells). A recombinant nucleic acid construct may comprise a nucleic acid encoding a CRISPR endonuclease and/or a guide RNA complementary to an NRF2 gene (in some embodiments, a variant NRF2 gene found only in cancer cells), operably linked to a promoter suitable for expressing the CRISPR endonuclease and/or a guide RNA complementary to the NRF2 gene (in some embodiments, the variant NRF2 gene) in the cell. In some embodiments the nucleic acid encoding a CRISPR endonuclease is operably linked to the same promoter as the nucleic acid encoding the guide RNA. In other embodiments, the nucleic acid encoding a CRISPR endonuclease and the nucleic acid encoding the guide RNA are operably linked to different promoters. In some embodiments, the nucleic acid encoding a CRISPR endonuclease and/or the nucleic acid encoding a guide RNA are operably linked to a lung specific promoter. Suitable lung specific promoters include, but are not limited to, Clara cell 10-kDa protein (CC.sub.10) (aka Scgb1a1) promoter (Stripp et al., J. Biol. Chem. 267:14703-12 (1992)), SFTPC promoter (Wert et al., Dev. Biol. 156:426-43 (1993)), FOXJ1 promoter (Ostrowski et al., Mol. Ther. 8:637-45 (2003)), aquaporin (Aqp5) promoter (Funaki et al., Am. J. Physiol. 275:C1151-57 (1998)), Keratin 5 (Krt5) promoter (Rock et al., Dis. Model Mech. 3:545-56 (2010)), Keratin 14 (Krt14) promoter (Rock et al., Dis. Model Mech. 3:545-56 (2010)), cytokeratin 18 (K18) promoter (Chow et al., Proc. Natl. Acad. Sci. USA 94:14695-14700 (1997)), surfactant protein B (SP-B) promoter (Strayer et al., Am. J. Physiol. Lung Cell Mol. Physiol. 282:L394-404 (2002)), TTF1 gene under the control of human telomerase reverse transcriptase promoter and human surfactant protein A1 promoter (Fukazawa et al., Cancer Res. 64:363-69 (2004)), surfactant protein C (SP-C) promoter (Zhuo et al., Transgenic Res. 15:543-55 (2006)), insulinoma-associated antigen-1 (INSM1) promoter (Li et al., Biochem. Biophys. Res. Commun. 236:776-81 (1997)), and surfactant protein A (SP-A) promoter (Bruno et al., J. Biol. Chem. 270:6531-36 (1995)).
[0125] In some embodiments, one or more CRISPR endonucleases and one or more guide RNAs may be provided in combination in the form of ribonucleoprotein particles (RNPs). An RNP complex can be introduced into a subject by means of, e.g., injection, electroporation, nanoparticles, vesicles, and/or with the assistance of cell-penetrating peptides.
[0126] DNA vectors containing nucleic acids such as those described herein also are also provided. A “DNA vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a DNA vector is capable of replication when associated with the proper control elements. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. The term “DNA vector” includes cloning and expression vectors, as well as viral vectors and integrating vectors. An “expression vector” is a vector that includes a regulatory region. A wide variety of host/expression vector combinations may be used to express the nucleic acid sequences described herein. Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, and retroviruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen/Life Technologies (Carlsbad, Calif.).
[0127] The DNA vectors provided herein also can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers. A marker gene can confer a selectable phenotype on a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). As noted above, an expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or Flag™ tag (Kodak, New Haven, Conn.) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.
[0128] The DNA vector can also include a regulatory region. The term “regulatory region” refers to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5′ and 3′ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.
[0129] As used herein, the term “operably linked” refers to positioning of a regulatory region (e.g. a promoter) and a sequence to be transcribed in a nucleic acid so as to influence transcription or translation of such a sequence. For example, to bring a coding sequence under the control of a promoter, the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter. A promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site or about 2,000 nucleotides upstream of the transcription start site. A promoter typically comprises at least a core (basal) promoter. A promoter also may include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). The choice of promoters to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. It is a routine matter for one of skill in the art to modulate the expression of a coding sequence by appropriately selecting and positioning promoters and other regulatory regions relative to the coding sequence.
[0130] Vectors include, for example, viral vectors (such as adenoviruses (“Ad”), adeno-associated viruses (AAV), and vesicular stomatitis virus (VSV) and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a host cell. Direct injection of adenoviral vectors into lung tumors has been a routine procedure in clinical trials evaluating gene therapy of lung cancer. Dong et al., J. Int. Med. Res. 36, 1273-1287 (2008); Li et al., Cancer Gene Ther. 20, 251-259 (2013); Zhou, et al., Cancer Gene Ther. 23, 1-6 (2016). Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Other vectors include those described by Chen et al; Bio Techniques, 34: 167-171 (2003). A large variety of such vectors are known in the art and are generally available.
[0131] Suitable nucleic acid delivery systems include recombinant viral vector, typically sequence from at least one of an adenovirus, adenovirus-associated virus (AAV), helper-dependent adenovirus, retrovirus, or hemagglutinating virus of Japan-liposome (HVJ) complex. In such cases, the viral vector comprises a strong eukaryotic promoter operably linked to the polynucleotide e.g., a cytomegalovirus (CMV) promoter. The recombinant viral vector can include one or more of the polynucleotides therein, in some embodiments about one polynucleotide. In embodiments in which the polynucleotide is to be administered with a non-viral vector, use of between from about 0.1 nanograms to about 4000 micrograms will often be useful e.g., about 0.1 ng to about 3900 .Math.g, about 0.1 ng to about 3800 .Math.g, about 0.1 ng to about 3700 .Math.g, about 0.1 ng to about 3600 .Math.g, about 0.1 ng to about 3500 .Math.g, about 0.1 ng to about 3400 .Math.g, about 0.1 ng to about 3300 .Math.g, about 0.1 ng to about 3200 .Math.g, about 0.1 ng to about 3100 .Math.g, about 0.1 ng to about 3000 .Math.g, about 0.1 ng to about 2900 .Math.g, about 0.1 ng to about 2800 .Math.g, about 0.1 ng to about 2700 .Math.g, about 0.1 ng to about 2600 .Math.g, about 0.1 ng to about 2500 .Math.g, about 0.1 ng to about 2400 .Math.g, about 0.1 ng to about 2300 .Math.g, about 0.1 ng to about 2200 .Math.g, about 0.1 ng to about 2100 .Math.g, about 0.1 ng to about 2000 .Math.g, about 0.1 ng to about 1900 .Math.g, about 0.1 ng to about 1800 .Math.g, about 0.1 ng to about 1700 .Math.g, about 0.1 ng to about 1600 .Math.g, about 0.1 ng to about 1500 .Math.g, about 0.1 ng to about 1400 .Math.g, about 0.1 ng to about 1300 .Math.g, about 0.1 ng to about 1200 .Math.g, about 0.1 ng to about 1100 .Math.g, about 0.1 ng to about 1000 .Math.g, about 0.1 ng to about 900 .Math.g, about 0.1 ng to about 800 .Math.g, about 0.1 ng to about 700 .Math.g, about 0.1 ng to about 600 .Math.g, about 0.1 ng to about 500 .Math.g, about 0.1 ng to about 400 .Math.g, about 0.1 ng to about 300 .Math.g, about 0.1 ng to about 200 .Math.g, about 0.1 ng to about 100 .Math.g, about 0.1 ng to about 90 .Math.g, about 0.1 ng to about 80 .Math.g, about 0.1 ng to about 70 .Math.g, about 0.1 ng to about 60 .Math.g, about 0.1 ng to about 50 .Math.g, about 0.1 ng to about 40 .Math.g, about 0.1 ng to about 30 .Math.g, about 0.1 ng to about 20 .Math.g, about 0.1 ng to about 10 .Math.g, about 0.1 ng to about 1 .Math.g, about 0.1 ng to about 900 ng, about 0.1 ng to about 800 ng, about 0.1 ng to about 700 ng, about 0.1 ng to about 600 ng, about 0.1 ng to about 500 ng, about 0.1 ng to about 400 ng, about 0.1 ng to about 300 ng, about 0.1 ng to about 200 ng, about 0.1 ng to about 100 ng, about 0.1 ng to about 90 ng, about 0.1 ng to about 80 ng, about 0.1 ng to about 70 ng, about 0.1 ng to about 60 ng, about 0.1 ng to about 50 ng, about 0.1 ng to about 40 ng, about 0.1 ng to about 30 ng, about 0.1 ng to about 20 ng, about 0.1 ng to about 10 ng, about 0.1 ng to about 1 ng, about 1 ng to about 4000 .Math.g, about 1 ng to about 3900 .Math.g, about 1 ng to about 3800 .Math.g, about 1 ng to about 3700 .Math.g, about 1 ng to about 3600 .Math.g, about 1 ng to about 3500 .Math.g, about 1 ng to about 3400 .Math.g, about 1 ng to about 3300 .Math.g, about 1 ng to about 3200 .Math.g, about 1 ng to about 3100 .Math.g, about 1 ng to about 3000 .Math.g, about 1 ng to about 2900 .Math.g, about 1 ng to about 2800 .Math.g, about 1 ng to about 2700 .Math.g, about 1 ng to about 2600 .Math.g, about 1 ng to about 2500 .Math.g, about 1 ng to about 2400 .Math.g, about 1 ng to about 2300 .Math.g, about 1 ng to about 2200 .Math.g, about 1 ng to about 2100 .Math.g, about 1 ng to about 2000 .Math.g, about 1 ng to about 1900 .Math.g, about 1 ng to about 1800 .Math.g, about 1 ng to about 1700 .Math.g, about 1 ng to about 1600 .Math.g, about 1 ng to about 1500 .Math.g, about 1 ng to about 1400 .Math.g, about 1 ng to about 1300 .Math.g, about 1 ng to about 1200 .Math.g, about 1 ng to about 1100 .Math.g, about 1 ng to about 1000 .Math.g, about 1 ng to about 900 .Math.g, about 1 ng to about 800 .Math.g, about 1 ng to about 700 .Math.g, about 1 ng to about 600 .Math.g, about 1 ng to about 500 .Math.g, about 1 ng to about 400 .Math.g, about 1 ng to about 300 .Math.g, about 1 ng to about 200 .Math.g, about 1 ng to about 100 .Math.g, about 1 ng to about 90 .Math.g, about 1 ng to about 80 .Math.g, about 1 ng to about 70 .Math.g, about 1 ng to about 60 .Math.g, about 1 ng to about 50 .Math.g, about 1 ng to about 40 .Math.g, about 1 ng to about 30 .Math.g, about 1 ng to about 20 .Math.g, about 1 ng to about 10 .Math.g, about 1 ng to about 1 .Math.g, about 1 ng to about 900 ng, about 1 ng to about 800 ng, about 1 ng to about 700 ng, about 1 ng to about 600 ng, about 1 ng to about 500 ng, about 1 ng to about 400 ng, about 1 ng to about 300 ng, about 1 ng to about 200 ng, about 1 ng to about 100 ng, about 1 ng to about 90 ng, about 1 ng to about 80 ng, about 1 ng to about 70 ng, about 1 ng to about 60 ng, about 1 ng to about 50 ng, about 1 ng to about 40 ng, about 1 ng to about 30 ng, about 1 ng to about 20 ng, about 1 ng to about 10 ng, about 10 ng to about 4000 .Math.g, about 20 ng to about 4000 .Math.g, about 30 ng to about 4000 .Math.g, about 40 ng to about 4000 .Math.g, about 50 ng to about 4000 .Math.g, about 60 ng to about 4000 .Math.g, about 70 ng to about 4000 .Math.g, about 80 ng to about 4000 .Math.g, about 90 ng to about 4000 .Math.g, about 100 ng to about 4000 .Math.g, about 200 ng to about 4000 .Math.g, about 300 ng to about 4000 .Math.g, about 400 ng to about 4000 .Math.g, about 500 ng to about 4000 .Math.g, about 600 ng to about 4000 .Math.g, about 700 ng to about 4000 .Math.g, about 800 ng to about 4000 .Math.g, about 900 ng to about 4000 .Math.g, about 1 .Math.g to about 4000 .Math.g, 10 .Math.g to about 4000 .Math.g, 20 .Math.g to about 4000 .Math.g, 30 .Math.g to about 4000 .Math.g, 40 .Math.g to about 4000 .Math.g, 50 .Math.g to about 4000 .Math.g, 60 .Math.g to about 4000 .Math.g, 70 .Math.g to about 4000 .Math.g, 80 .Math.g to about 4000 .Math.g, 90 .Math.g to about 4000 .Math.g, 100 .Math.g to about 4000 .Math.g, 200 .Math.g to about 4000 .Math.g, 300 .Math.g to about 4000 .Math.g, 400 .Math.g to about 4000 .Math.g, 500 .Math.g to about 4000 .Math.g, 600 .Math.g to about 4000 .Math.g, 700 .Math.g to about 4000 .Math.g, 800 .Math.g to about 4000 .Math.g, 900 .Math.g to about 4000 .Math.g, 1000 .Math.g to about 4000 .Math.g, 1100 .Math.g to about 4000 .Math.g, 1200 .Math.g to about 4000 .Math.g, 1300 .Math.g to about 4000 .Math.g, 1400 .Math.g to about 4000 .Math.g, 1500 .Math.g to about 4000 .Math.g, 1600 .Math.g to about 4000 .Math.g, 1700 .Math.g to about 4000 .Math.g, 1800 .Math.g to about 4000 .Math.g, 1900 .Math.g to about 4000 .Math.g, 2000 .Math.g to about 4000 .Math.g, 2100 .Math.g to about 4000 .Math.g, 2200 .Math.g to about 4000 .Math.g, 2300 .Math.g to about 4000 .Math.g, 2400 .Math.g to about 4000 .Math.g, 2500 .Math.g to about 4000 .Math.g, 2600 .Math.g to about 4000 .Math.g, 2700 .Math.g to about 4000 .Math.g, 2800 .Math.g to about 4000 .Math.g, 2900 .Math.g to about 4000 .Math.g, 3000 .Math.g to about 4000 .Math.g, 3100 .Math.g to about 4000 .Math.g, 3200 .Math.g to about 4000 .Math.g, 3300 .Math.g to about 4000 .Math.g, 3400 .Math.g to about 4000 .Math.g, 3500 .Math.g to about 4000 .Math.g, 3600 .Math.g to about 4000 .Math.g, 3700 .Math.g to about 4000 .Math.g, 3800 .Math.g to about 4000 .Math.g, or 3900 .Math.g to about 4000 .Math.g.
[0132] Additional vectors include viral vectors, fusion proteins and chemical conjugates. Retroviral vectors include Moloney murine leukemia viruses and HIV-based viruses. One HIV-based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus. DNA viral vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector [Geller, A. I. et al., J. Neurochem, 64: 487 (1995); Lim, F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A. I. et al., Proc Natl. Acad. Sci.: U.S.A.:90 7603 (1993); Geller, A. I., et al., Proc Natl. Acad. Sci USA: 87:1149 (1990)], Adenovirus Vectors [LeGal LaSalle et al., Science, 259:988 (1993); Davidson, et al., Nat. Genet. 3: 219 (1993); Yang, et al., J. Virol. 69: 2004 (1995)] and Adeno-associated Virus Vectors [Kaplitt, M. G., et al., Nat. Genet. 8:148 (1994)].
[0133] If desired, the polynucleotides described here may also be used with a microdelivery vehicle such as cationic liposomes, adenoviral vectors, and exosomes. For a review of the procedures for liposome preparation, targeting and delivery of contents, see Mannino and Gould-Fogerite, BioTechniques, 6:682 (1988). See also, Feigner and Holm, Bethesda Res. Lab. Focus, 11(2):21 (1989) and Maurer, R. A., Bethesda Res. Lab. Focus, 11(2):25 (1989). In some embodiments, exosomes may be used for delivery of a nucleic acid encoding a CRISPR endonuclease and/or guide RNA to a target cell, e.g. a cancer cell. Exosomes are nanosized vesicles secreted by a variety of cells and are comprised of cellular membranes. Exosomes can attach to target cells by a range of surface adhesion proteins and vector ligands (tetraspanins, integrins, CD11b and CD18 receptors), and deliver their payload to target cells. Several studies indicate that exosomes have a specific cell tropism, according to their characteristics and origin, which can be used to target them to disease tissues and/or organs. See Batrakova et al., 2015, J Control Release 219: 396-405. For example, cancer-derived exosomes function as natural carriers that can efficiently deliver CRISPR/Cas9 plasmids to cancer cells. See Kim et al., 2017, J Control Release 266: 8-16.
[0134] Replication-defective recombinant adenoviral vectors, can be produced in accordance with known techniques. See, Quantin, et al., Proc. Natl. Acad. Sci. USA, 89:2581-2584 (1992); Stratford-Perricadet, et al., J. Clin. Invest., 90:626-630 (1992); and Rosenfeld, et al., Cell, 68:143-155 (1992).
[0135] Another delivery method is to use single stranded DNA producing vectors which can produce the expressed products intracellularly. See for example, Chen et al., Bio Techniques, 34: 167-171 (2003), which is incorporated herein, by reference, in its entirety.
[0136] In certain aspects, the disclosure relates to a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence. In some embodiments, the NRF2 gene is a wildtype NRF2 gene, e.g. an NRF2 gene that naturally occurs in normal cells (e.g. non-cancerous cells). In some embodiments, the NRF2 gene is a variant NRF2 gene. In some embodiments, the variant NRF2 gene is a variant that is found in normal cells (e.g. non-cancerous cells). In some embodiments, the variant NRF2 gene is a variant that is found in cancer cells. In a particular embodiment the variant NRF2 gene is a variant found in lung cancer cells, e.g. non-small cell lung cancer (NSCLC) cells or lung squamous cell carcinoma. In some embodiments, the variant NRF2 gene encodes an NRF2 polypeptide comprising one or more amino acid substitutions selected from the group consisting of Q26E, Q26P, D29G, V32G, R34G, R34P, F71S, Q75H, E79G, T80P, E82W, and E185D relative to the amino acid sequence of SEQ ID NO: 8. In a particular embodiment, the NRF2 polypeptide comprises an R34G substitution relative to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the gRNA is complementary to a target sequence in exon 2 of the variant NRF2 gene. In some embodiments, the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, or SEQ ID NO: 126, or a biologically active fragment thereof. In some embodiments, the DNA sequence encoding the DNA binding domain of the gRNA comprises the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 84, or a biologically active fragment thereof. In some embodiments, the DNA sequence encoding the (CRISPR)-associated endonuclease protein-binding domain of the gRNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 113, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 113, or a biologically active fragment thereof.
[0137] In some embodiments, the DNA binding domain of the gRNA comprises or consists of the RNA sequence of SEQ ID NO: 126, or an RNA sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 126, or a biologically active fragment thereof. In some embodiments, the (CRISPR)-associated endonuclease protein-binding domain of the gRNA comprises or consists of the RNA sequence of SEQ ID NO: 127, or an RNA sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 127, or a biologically active fragment thereof. In some embodiments, the gRNA comprises or consists of the RNA sequence of SEQ ID NO: 128, or an RNA sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 128, or a biologically active fragment thereof. The DNA binding domain of SEQ ID NO: 126 and SEQ ID NO: 128 is encoded by the nucleic acid sequence of SEQ ID NO: 61.
[0138] The polynucleotide encoding the gRNA may comprise two or more repeats (e.g. tandem repeats) of a DNA sequence encoding the gRNA with each DNA sequence being operably linked to a promoter. The polynucleotide may contain 2, 3, 4, 5 or more repeats (e.g. tandem repeats) of the DNA sequence encoding the gRNA, with each DNA sequence being operably linked to a promoter. In some embodiments, each promoter operably linked to the DNA sequence encoding the gRNA is the same promoter. In some embodiments, the promoters operably linked to the DNA sequence encoding the gRNA may be different promoters.
[0139] For example, the polynucleotide comprising the first DNA sequence encoding the gRNA operably linked to a first promoter may further comprise (a) a second DNA sequence encoding the gRNA; and (b) a second promoter that is operably linked to the second DNA sequence. In some embodiments, the polynucleotide further comprises: (a) a third DNA sequence encoding the gRNA; and (b) a third promoter that is operably linked to the third DNA sequence.
[0140] In some embodiments, multiple sgRNAs may be expressed through the use of tRNA processing machinery. In this system, tRNA genes are fused to polynucleotide sequence encoding sgRNAs, such that multiple active sgRNAs can be produced from a single precursor transcript containing the tRNAs through tRNA processing. tRNA-based multiplex sgRNA expression systems are known in the art and are described, for example, in Shiraki et al., 2018, Sci. Rep. 8: 13366.
[0141] The length of the polynucleotides described herein may be at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9 or 10 kb. In some embodiments, the length of the polynucleotides described herein may be less than 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9 or 10 kb. Any of these values may be used to define a range for the length of the polynucleotide. For example, in some embodiments, the polnucleotide is 2-3 kb, 2-4 kb or 2-5 kb in length. In a particular embodiment, the polynucleotide is at least 2 kb in length. The polnuecleotide may be single-stranded or double-stranded.
[0142] In some embodiments, the promoter operably linked to the DNA sequence encoding the gRNA is a pol III promoter. In some embodiments, a vector may comprise one or more RNA polymerase III (pol III) promoters (e.g. 1, 2, 3, 4, 5, or more pol III promoters), one or more RNA polymerase II (pol II) promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more tissue-specific promoters (e.g. 1, 2, 3, 4, 5, or more tissue-specific promoters), or combinations thereof. A number of Pol III promoters are known in the art, including the U6 small nuclear (sn) RNA promoter, 7SK promoter, and the H1 promoter. See, e.g., Ro et al., BioTechniques, 38(4):625-627 (2005). In some embodiments, the U6 promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 118, or a biologically active fragment thereof. In some embodiments, the 7SK promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 123, or a biologically active fragment thereof. In some embodiments, the H1 promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 122, or a biologically active fragment thereof.
[0143] In some embodiments, the promoter operably linked to the DNA sequence encoding the gRNA is a pol II promoter. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the minimal CMV promoter (without the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, the elongation factor 1α (EF1α) promoter, the elongation factor 1α short (EFS) promoter, the CAG promoter (see, e.g., Alexopoulou et al., BMC Cell Biology 9: 2, 2008; Miyazaki et al., Gene 79 (2): 269-77 (1989); Niwa et al., Gene 108 (2): 193-9 (1991); the CAGGS promoter, the PGK promoter, the UbiC promoter.
[0144] In some embodiments, the promoter operably linked to the DNA sequence encoding the gRNA is a tissue-specific promoter. Examples of tissue-specific promoters include, but are not limited to, B29, Desmin, Endoglin, FLT-1, GFPA and SYN1.
[0145] The CMV and PGK promoters can be amplified from pSicoR and pSicoR PGK respectively (Ventura et al., Proc Natl Acad Sci USA 101: 10380-10385 (2004)), the UbiC promoter can be amplified from pDSL_hpUGIH (ATCC), the CAGGS promoter can be amplified from pCAGGS (BCCM), and the EF1A promoter can be amplified from the pEF6 vector (Invitrogen). The Pol II core promoter is described in Butler and Kadonaga, Genes & Dev. 16: 2583-2592 (2002). In some embodiments, the CMV promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 119.
[0146] In particular embodiments of the polynucleotides described herein, the first promoter, the second promoter, and the third promoter are selected from the group consisting of U6, H1 and 7SK. In some embodiments, the first promoter is U6, the second promoter is H1, and the third promoter is 7SK. In some embodiments, the U6 promoter comprises the nucleic acid sequence of SEQ ID NO: 118.
[0147] The polynucleotides described herein may further comprise one or more adeno-associated virus (AAV) inverted terminal repeat (ITR) sequences. The AAV ITR may be an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, or an AAV9 ITR. In a particular embodiment, the AAV ITR is an AAV2 ITR.
[0148] In certain aspects, the disclosure also relates to a vector (e.g a DNA vector) comprising the polynucleotide encoding one or more sgRNAs as described herein. In some embodiments, the vector is an adeno-associated virus (AAV) vector.
Self-Complementary AAV Vectors
[0149] In some embodiments, the AAV vector is a self-complementary adeno-associated virus (scAAV) vector. Self-complementary AAV vectors are described, for example, in Zhang et al., 2020, Science Advances 6: 1-11; and U.S. Pat. No. 10,369,193, each of which is incorporated by reference herein in its entirety. Typically, rAAV DNA is packaged into a viral capsid as a single-stranded DNA (ssDNA) molecule. Following infection of the cell by the virus, the single DNA strand is converted into a double-stranded DNA (dsDNA) form. Only the dsDNA is useful to proteins of the cell that transcribe the contained gene or genes into RNA. Thus, the conventional replication scheme of AAV requires de novo synthesis of a complementary DNA strand. This step of converting the ssDNA AAV genome into dsDNA prior to expression can be circumvented by the use of self-complementary (sc) AAV vectors.
[0150] Self-complementary vectors are produced by base pairing complementary strands from two infecting viruses, which does not require DNA synthesis (see, e.g., Nakai et al., J. Virol. (2000) 74:9451-9463). This interstrand base pairing, or strand annealing (SA), is possible because AAV packages either the plus or minus DNA strand with equal efficiency (Berns, K. I., Microbiol. Rev. (1990) 54:316-329).
[0151] Thus the need for dsDNA conversion, either by SA or DNA synthesis, can be entirely circumvented by packaging both strands as a single molecule. This can be achieved by taking advantage of the tendency of AAV to produce dimeric inverted repeat genomes during the AAV replication cycle. If these dimers are small enough, they can be packaged in the same manner as conventional AAV genomes, and the two halves of the ssDNA molecule can fold and base pair to form a dsDNA molecule of half the length. dsDNA conversion is independent of host-cell DNA synthesis and vector concentration (McCarty et al., Gene Ther. (2001) 8:1248-1254).
[0152] scAAV vectors are able to be packaged into the normal AAV capsid. Each of the known AAV serotypes is capable of packaging scAAV genomes with similar efficiency (see, e.g., Sipo et al., Gene Ther. (2007) 14:1319-1329). Thus, in certain embodiments, the scAAV vector are packaged in AAVs comprising capsid proteins from serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 serotypes. However, an scAAV vector may be packaged in an AAV comprising capsid proteins from any of the known serotypes or modified capsid proteins known in the art. These scAAV vectors may also be pseudotyped vectors which contain the genome of one AAV serotype packaged in the capsid of a second AAV serotype.
[0153] scAAV vectors can be produced either by generating vector plasmids that are approximately half of the conventional genome size combined with selective purification of the infectious double stranded form, or through the use of approximately half-genome sized vector plasmids with a mutation in one of the terminal resolution sequences of the AAV virus that provides for synthesis of double-stranded virus. Both strategies generate + and - strand viral genomes that are covalently linked at one terminal repeat.
[0154] In particular, the generation of normal monomeric AAV genomes relies on the efficient resolution of the two ITRs in turn, with each round of DNA synthesis. This reaction is mediated by the ssDNA endonuclease activity of the two larger isoforms of AAV Rep. Nicking the ITR at the terminal resolution site is followed by DNA elongation from the nick by host DNA polymerase. Dimeric genomes are formed when Rep fails to nick the terminal resolution site before it is reached by the replication complex initiated at the other end.
[0155] The yield of dimeric genomes in a scAAV prep can be increased dramatically by inhibiting resolution at one terminal repeat. This is readily accomplished by deleting the terminal resolution site sequence from one ITR, such that the Rep protein cannot generate the essential ssDNA nick (see, e.g., McCarty et al., Gene Ther. (2003) 10:2112-2118 and Wang et al., Gene Ther. (2003) 10:2105-2111). The replication complex initiated at the other ITR then copies through the hairpin and back toward the initiating end. Replication proceeds to the end of the template molecule, leaving a dsDNA inverted repeat with a wild-type ITR at each end and the mutated ITR in the middle. This dimeric inverted repeat can then undergo normal rounds of replication from the two wild-type ITR ends. Each displaced daughter strand comprises a ssDNA inverted repeat with a complete ITR at each end and a mutated ITR in the middle. Packaging into the AAV capsid starts at the 3′ end of the displaced strand. Production of scAAV from constructs with one mutated ITR typically yields more than 90% dimeric genomes.
[0156] Production and purification of scAAV vector from mutated ITR constructs is the same as conventional ssAAV, as described further below. However, if dot blot or Southern blot is used, the vector DNA is preferably applied to hybridization membranes under alkaline conditions to prevent reannealing of the complementary strands. Additionally, it is possible for a spurious Rep-nicking site to be produced close enough to the mutated ITR to allow terminal resolution and generation of monomer genomes. This can typically be avoided by turning the transgene cassette around with respect to the mutant and wild-type terminal repeats.
[0157] See, e.g., McCarty, D. M., Molec. Ther. (2008) 16:1648-1656; McCarty et al., Gene Ther. (2001) 8:1248-1254; McCarty et al., Gene Ther. (2003) 10:2112-2118; Wang et al., Gene Ther. (2003) 10:2105-2111); Wu et al., Human Gene Ther. (2007) 18:171-182; U.S. Pat. Publication Nos. 2007/0243168 and 2007/0253936, incorporated herein by reference in their entireties, for methods of producing scAAV constructs.
Recombinant Adeno-Associated Virus (rAAV)
[0158] In certain aspects, the disclosure also relates to arecombinant adeno-associated virus (rAAV) comprising a vector comprising a polynucletodie encoding one or more gRNAs as described herein. The rAAV may further comprise one or more nucleic acid sequences that encode a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein, or a fragment thereof. In some embodiments, the CRISPR-associated endonuclease is a class 2 CRISPR-associated endonuclease. In some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. In a particular embodiment, the nucleic acid that encodes the CRISPR-associated endonuclease or fragment thereof is operably linked to a promoter selected from the group consisting of a tissue-specific promoter, an H1 promoter, a minimal cytomegalovirus (miniCMV) promoter and an elongation factor 1α short (EFS) promoter. In some embodiments, the miniCMV promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 116. In some embodiments, the EFS promoter comprises of consists of the nucleic acid sequence of SEQ ID NO: 117.
[0159] In some embodiments, the same H1 promoter is used to drive expression of the CRISPR-associated endonuclease and one or more sgRNAs. See Gao et al., 2018, Molecular Therapy: Nucleic Acids 14: 32-40, which is incorporated by reference herein in its entirety. For example, in some embodiments, a single H1 promoter is operably linked to both a nucleic acid that encodes a CRISPR-associated endonuclease and a nucleic acid that encodes one or more sgRNAs.
[0160] In some embodiments, the nucleic acid sequence that encodes the CRISPR-associated endonuclease or fragment thereof is operably linked to at least one nucleus localization signal (NLS). For example, in some embodiments, the nucleic acid sequence that encodes the CRISPR-associated endonuclease or fragment thereof is operably linked to 1, 2, 3, 4 or 5 nucleus localization signals. In some embodiments, the NLS is an SV40 NLS. In some embodiments, the SV40 NLS comprises or consists of the nucleic acid sequence of SEQ ID NO: 121.
[0161] In some embodiments, the nucleic acid that encodes the CRISPR-associated endonuclease or fragment thereof and the one or more DNA sequences encoding the gRNA are on the same vector. In some embodiments, the nucleic acid that encodes the CRISPR-associated endonuclease or fragment thereof and the one or more DNA sequences encoding the gRNA are on separate vectors.
[0162] In some embodiments, the entire nucleic acid sequence encoding CRISPR-associated endonuclease (e.g. Cas 9) is on one vector. However, a major limitation to their application in gene therapy is the size of some CRISPR-associated endonucleases such as Cas9 (>4 kb), impeding its efficient delivery via recombinant adeno-associated virus (rAAV). Accordingly, the nucleic acid sequence encoding the CRISPR-associated endonuclease may be divided into two fragments and placed on separate vectors. In some embodiments, the two fragments of the CRISPR-associated endonuclease (e.g. Cas 9) are ligated together by using a split-intein system. An intein is an intervening protein domain that undergoes a unique posttranslational autoprocessing event, termed protein splicing. In this spontaneous process, the intein excises itself from the host protein and, in the process, ligates together the flanking N- and C-terminal residues (exteins) to form a native peptide bond. Each half of the CRISPR-associated endonuclease (e.g. Cas 9) is fused to a split-intein moiety, and upon co-expression intein-mediated transsplicing occurs and the full CRISPR-associated endonuclease is reconstituted. Split-intein systems for expressing CRISPR-associated endonucleases are known in the art and are described, for example, in Truong et al., 2015, Nucleic Acids Research 43(13): 6450-6458, and Schmelas et al., 2018, Biotechnology Journal 13: 1700432, each of which is incorporated by reference herein in its entirety. Alternatively, the CRISPR-associated endonuclease (e.g. Cas9) can be split into two fragments and rendered chemically inducible by rapamycin sensitive dimerization domains for controlled reassembly. See Zetche et al., 2015, Nat Biotechnol. Feb; 33(2): 139-142, which is incorporated by reference herein in its entirety.
[0163] Recombinant AAV of any serotype can be used in the compositions and methods described herein, wherein the recombinant AAV may be either a self-complementary AAV or a non-self complementary AAV. The serotype of the rAAV used in certain embodiments is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9 (see, e.g., Gao et al. (2002) PNAS, 99:11854 11859; and Viral Vectors for Gene Therapy: Methods and Protocols, ed. Machida, Humana Press, 2003). In a particular embodiment, the rAAV is AAV5 or a variant thereof. In a further particular embodiment, the rAAV is AAV6 or a variant thereof.
[0164] In some embodiments, a particular serotype of rAAV is selected based on its ability to transduce a target cell, e.g., a cancer cell. For example, some serotypes of AAV exhibit greater transduction rates than other serotypes for particular types of cancers. In some embodiments, a particular serotype of AAV exhibits greater transduction rates for lung cancer relative to other AAV serotypes. In a particular embodiment, the AAV is AAV6 and exhibits greater transduction rates for lung cancer (e.g., H1703 squamous non-small cell lung cancer) relative to other AAV serotypes (e.g., AAV5).
[0165] Other serotype besides those listed herein may be used. For example, pseudotyped AAV vectors may also be utilized in the compositions and methods described herein. Pseudotyped AAV vectors are those which contain the genome of one AAV serotype in the capsid of a second AAV serotype; for example, an AAV vector that contains the AAV2 capsid and the AAV1 genome or an AAV vector that contains the AAV5 capsid and the AAV 2 genome (Auricchio et al., (2001) Hum. Mol. Genet., 10(26):3075-81). In a particular embodiment, the rAAV comprise the capsid protein of AAV5 and the ITR sequence of AAV2. In a further particular embodiment, the rAAV comprises the capsid protein of AAV6 and the ITR sequence of AAV2.
[0166] The AAV ITRs may be selected from among any AAV, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9. In a particular embodiment, the ITR is an AAV2 ITR. In some embodiments, the AAV2 ITR comprises of consists of the nucleic acid sequence of SEQ ID NO: 120. In some embodiments, the rAAV comprises an ITR and a capsid protein from different serotypes, e.g. the capsid protein of AAV5 and the ITR sequence of AAV2, as discussed above. In some embodiments, the rAAV comprises an ITR and a capsid protein from the same serotype. These ITRs may be isolated using techniques available to those of skill in the art from an AAV sequence. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank.RTM., PubMed.RTM., or the like.
Preparation of Recombinant AAV (rAAV)
[0167] A recombinant AAV may be prepared by providing to a cell in vitro, (a) a template comprising (i) a heterologous nucleic acid (e.g. encoding an sgRNA as described herein), and (ii) packaging signal sequences sufficient for the encapsidation of the AAV template into virus particles (e.g., one or more (e.g., two) terminal repeats, such as AAV inverted terminal repeats), and (b) AAV sequences sufficient for replication and encapsidation of the template into viral particles (e.g., the AAV rep and AAV cap sequences encoding an AAV capsid). The template and AAV replication and capsid sequences may be provided under conditions such that recombinant virus particles comprising the template packaged within the capsid are produced in the cell. The method can further comprise the step of collecting the virus particles from the cell. Virus particles may be collected from the medium and/or by lysing the cells.
[0168] In some embodiments, the rAAV may be prepared by providing a cell in vitro with a nucleic acid encoding an AAV capsid, an AAV rep coding sequence, an AAV vector comprising a heterologous nucleic acid (e.g. encoding an sgRNA as described herein), and helper functions for generating a productive AAV infection; and allowing assembly of the AAV particles comprising the AAV capsid and encapsidating the AAV vector.
[0169] The cell is typically a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed, such as mammalian cells. Also suitable are trans-complementing packaging cell lines that provide functions deleted from a replication-defective helper virus, e.g., 293 cells or other E1a trans-complementing cells.
[0170] The AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep/cap genes on a single plasmid. The AAV replication and packaging sequences need not be provided together, although it may be convenient to do so. The AAV rep and/or cap sequences may be provided by any viral or non-viral vector. For example, the rep/cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the E1a or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the AAV cap and rep genes. One advantage of this method is that EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an EBV based nuclear episome.
[0171] As a further alternative, the rep/cap sequences may be stably carried (episomal or integrated) within a cell. Typically, the AAV rep/cap sequences will not be flanked by the AAV packaging sequences (e.g., AAV ITRs), to prevent rescue and/or packaging of these sequences. To obtain maximal virus titers, helper virus functions (e.g., adenovirus or herpesvirus) essential for a productive AAV infection are generally provided to the cell. Helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences are provided by a helper adenovirus or herpesvirus vector. Alternatively, the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g., as a non-infectious adenovirus miniplasmid that carries all of the helper genes required for efficient AAV production as described by Ferrari et al., (1997) Nature Med. 3:1295, and U.S. Pat. Nos. 6,040,183 and 6,093,570.
[0172] Further, the helper virus functions may be provided by a packaging cell with the helper genes integrated in the chromosome or maintained as a stable extrachromosomal element. In representative embodiments, the helper virus sequences cannot be packaged into AAV virions, e.g., are not flanked by AAV ITRs.
[0173] Those skilled in the art will appreciate that it may be advantageous to provide the AAV replication and capsid sequences and the helper virus sequences (e.g., adenovirus sequences) on a single helper construct. This helper construct may be a non-viral or viral construct, but is optionally a hybrid adenovirus or hybrid herpesvirus comprising the AAV rep/cap genes. In some embodiments, the AAV rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. In a further embodiment, the AAV rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. In a further exemplary embodiment, the AAV rep/cap sequences and adenovirus helper sequences are provided by a single adenovirus helper. The heterologous nucleic acid (e.g. encoding an sgRNA as described herein) is provided on a separate replicating viral vector. For example, the heterologous nucleic acid encoding the sgRNA may be provided by a rAAV particle or a second recombinant adenovirus particle.
[0174] According to the foregoing methods, the hybrid adenovirus vector typically comprises the adenovirus 5′ and 3′ cis sequences sufficient for adenovirus replication and packaging (i.e., the adenovirus terminal repeats and PAC sequence). The AAV rep/cap sequences and, if present, the rAAV template are embedded in the adenovirus backbone and are flanked by the 5′ and 3′ cis sequences, so that these sequences may be packaged into adenovirus capsids. As described above, in representative embodiments, the adenovirus helper sequences and the AAV rep/cap sequences are not flanked by the AAV packaging sequences (e.g., the AAV ITRs), so that these sequences are not packaged into the AAV virions.
[0175] Herpesvirus may also be used as a helper virus in AAV packaging methods. Hybrid herpesviruses encoding the AAV rep protein(s) may advantageously facilitate for more scalable AAV vector production schemes. A hybrid herpes simplex virus type I (HSV-1) vector expressing the AAV-2 rep and cap genes has been described (Conway et al., (1999) Gene Therapy 6:986 and WO 00/17377, the disclosures of which are incorporated herein in their entireties). Other methods of producing AAV use stably transformed packaging cells (see, e.g., U.S. Pat. No. 5,658,785).
[0176] AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, AAV and helper virus may be readily differentiated based on size. AAV may also be separated away from helper virus based on affinity for a heparin substrate (Zolotukhin et al., (1999) Gene Therapy 6:973). In representative embodiments, deleted replication-defective helper viruses are used so that any contaminating helper virus is not replication competent. As a further alternative, an adenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of AAV virus. Adenovirus mutants defective for late gene expression are known in the art (e.g., ts100K and ts149 adenovirus mutants).
Pharmaceutical Compositions
[0177] Any of the pharmaceutical compositions disclosed herein can be formulated for use in the preparation of a medicament, and particular uses are indicated below in the context of treatment, e.g., the treatment of a subject having cancer. When employed as pharmaceuticals, any of the nucleic acids and vectors can be administered in the form of pharmaceutical compositions. Administration may be pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), topical (including ophthalmic and to mucous membranes including intranasal, vaginal and rectal delivery), ocular, oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular administration. Parenteral administration can be in the form of a single bolus dose, or may be, for example, by a continuous perfusion pump. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, powders, and the like. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
[0178] In some embodiments, pharmaceutical compositions can contain, as the active ingredient, nucleic acids and vectors described herein in combination with one or more pharmaceutically acceptable carriers. The term “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal or a human, as appropriate. The term “pharmaceutically acceptable carrier,” as used herein, includes any and all solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants and the like, that may be used as media for a pharmaceutically acceptable substance. In making the pharmaceutical compositions disclosed herein, the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, tablet, sachet, paper, or other container. When the excipient serves as a diluent, it can be a solid, semisolid, or liquid material (e.g., normal saline), which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), lotions, creams, ointments, gels, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. As is known in the art, the type of diluent can vary depending upon the intended route of administration. The resulting compositions can include additional agents, such as preservatives. In some embodiments, the carrier can be, or can include, a lipid-based or polymer-based colloid. In some embodiments, the carrier material can be a colloid formulated as a liposome, a hydrogel, a microparticle, a nanoparticle, or a block copolymer micelle. As noted, the carrier material can form a capsule, and that material may be a polymer-based colloid.
[0179] The nucleic acid sequences disclosed herein can be delivered to an appropriate cell of a subject, e.g. a cancer cell. This can be achieved by, for example, the use of a polymeric, biodegradable microparticle or microcapsule delivery vehicle, sized to optimize phagocytosis by phagocytic cells such as macrophages. Delivery of “naked DNA” (i.e., without a delivery vehicle) to an intramuscular, intradermal, or subcutaneous site, is another means to achieve in vivo expression. In the relevant polynucleotides (e.g., expression vectors) the nucleic acid sequence encoding the isolated nucleic acid sequence comprising a sequence encoding a CRISPR-associated endonuclease and a guide RNA can be operatively linked to a promoter or enhancer-promoter combination. Promoters and enhancers are described above.
[0180] In some embodiments, the pharmaceutical compositions can be formulated as a nanoparticle, for example, nanoparticles comprised of a core of high molecular weight linear polyethylenimine (LPEI) complexed with DNA and surrounded by a shell of polyethyleneglycol-modified (PEGylated) low molecular weight LPEI.
[0181] The nucleic acids and vectors may also be applied to a surface of a device (e.g., a catheter) or contained within a pump, patch, or other drug delivery device. The nucleic acids and vectors disclosed herein can be administered alone, or in a mixture, in the presence of a pharmaceutically acceptable excipient or carrier (e.g., physiological saline). The excipient or carrier is selected on the basis of the mode and route of administration. Suitable pharmaceutical carriers, as well as pharmaceutical necessities for use in pharmaceutical formulations, are described in Remington’s Pharmaceutical Sciences (E. W. Martin), a well-known reference text in this field, and in the USP/NF (United States Pharmacopeia and the National Formulary).
[0182] In some embodiments, the compositions can be formulated as a nanoparticle encapsulating a nucleic acid encoding a CRISPR-associated endonuclease and a guide RNA sequence complementary to an NRF2 gene (or, in some embodiments, a variant NRF2 gene), or vector comprising a nucleic acid encoding a CRISPR-associated endonuclease and a guide RNA sequence complementary to an NRF2 gene (or, in some embodiments, a variant NRF2 gene).
[0183] In another aspect, the present disclosure provides a method for delivery of a polynucleotide encoding one or more gRNA to a subject that involves transfecting or infecting a selected host cell (e.g. a cancer cell) of the subject with a recombinant AAV comprising the polynucleotide. This method involves transfecting or infecting a selected host cell with a recombinant AAV containing a polynucleotide encoding one or more sgRNA under the control of sequences that direct expression thereof. The recombinant AAV may be delivered in a pharmaceutical composition comprising a pharmaceutically acceptable carrier. The rAAV may be administered to a human or non-human mammalian subject.
[0184] The rAAV are administered in sufficient amounts to transfect the target cells (e.g. cancer cells) and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., the lung), oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired. In a particular embodiment, the route of administration is intratumoral.
[0185] Dosages of the rAAV vector will depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and may thus vary among patients. For example, a therapeutically effective human dosage of the rAAV vector is generally in the range of from about 0.1 mL to about 100 mL of solution containing concentrations of from about 1×10.sup.9 to 1×10.sup.16 genomes virus vector. The dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The levels of expression of the transgene can be monitored to determine the frequency of dosage.
Methods of Reducing NRF2 Expression or Activity in a Cell
[0186] In certain aspects, the disclosure relates to a method of reducing NRF2 expression or activity in a cancer cell comprising introducing into the cancer cell a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence, or a vector or rAAV comprising the polynucleotide as described herein, wherein the gRNA hybridizes to the NRF2 gene and a CRISPR-associated endonuclease cleaves the NRF2 gene, and wherein NRF2 expression or activity is reduced in the cancer cell relative to a cancer cell in which the polynucleotide, vector or rAAV is not introduced.
[0187] In certain aspects, the disclosure relates to a method of reducing NRF2 expression or activity in a cancer cell in a subject, the method comprising administering to the subject an effective amount of a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence, or a vector, rAAV or pharmaceutical composition comprising the polynucleotide as described herein, wherein the gRNA hybridizes to the NRF2 gene and a CRISPR-associated endonuclease cleaves the NRF2 gene, and wherein NRF2 expression or activity is reduced in the cancer cell in the subject relative to a cancer cell in a subject that is not administered the polynucleotide, vector, rAAV or pharmaceutical composition.
[0188] Reducing NRF2 expression in the cell may comprise reducing expression of NRF2 mRNA in the cell, reducing expression of the NRF2 protein in the cell, or both. Because the ploidy level of a cancer cell may change from the normal diploid, the cancer cell may comprise 1, 2, 3, 4, 5 or more NRF2 alleles. Accordingly, in some embodiments, expression of at least 1, 2, 3, 4 or 5 alleles of the NRF2 gene is reduced. In some embodiments, expression of all alleles of the NRF2 gene is reduced. In some embodiments, introducing the polynucleotide encoding the gRNA and the nucleic acid sequence encoding a CRISPR-associated endonuclease into the cell reduces NRF2 expression and/or activity in the cell, but does not completely eliminate it. In other embodiments, NRF2 expression and/or activity in the cell are completely eliminated.
[0189] The gRNA may be complementary to a target sequence in an exon of the NRF2 gene. In a particular embodiment, the gRNA is complementary to a target sequence in exon 1, 2, 3, 4, or 5 of the NRF2 gene. In some embodiments, the gRNA is encoded by a single DNA sequence. In other embodiments, the gRNA is encoded by two or more DNA sequences. For example, in some embodiments, the gRNA is encode by a first DNA sequence encoding a trans-activated small RNA (tracrRNA) and a second DNA sequence encoding a CRISPR RNA (crRNA). The tracrRNA and crRNA may hybridize within the cell to form the guide RNA. Accordingly, in some embodiments, the gRNA comprises a trans-activated small RNA (tracrRNA) and a CRISPR RNA (crRNA).
[0190] In some embodiments, the guide RNA is complementary to a variant NRF2 gene that is found only in cancer cells and not in wild-type NRF2 genes in normal (i.e., non-cancerous) cells (e.g. exon 1, 2, 3, 4, or 5). In some embodiments, the variant NRF2 gene comprises an R34G substitution in exon 2. In some embodiments, the guide RNA is complementary to a sequence in exon 2 of a variant NRF2 gene that is found only in cancer cells (e.g. lung cancer cells). In some embodiments, introducing the polynucleotide encoding the gRNA and the nucleic acid sequence encoding a CRISPR-associated endonuclease into the cell reduces variant NRF2 expression and/or activity in the cell, but does not completely eliminate it. In other embodiments, variant NRF2 expression and/or activity in the cell are completely eliminated.
[0191] In some embodiments, CRISPR-associated endonucleases suitable for use in reducing expression of the variant NRF2 gene include, but are not limited to, a class 1 CRISPR-associated endonucleases such as, e.g., Cas7 and Cas5, along with, in some embodiments, SS (Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3″ and Cas10d; Cas SS (Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS (Cas11) and Cas8-like (Csf1); or SS (Cas11) and Cas10. Class 2 CRISPR-associated endonucleases include type I, type V, and type VI CRISPR-Cas systems, which have a single effector molecule. In some embodiments, CRISPR-associated endonucleases suitable for use in reducing expression of the variant NRF2 gene include, but are not limited to, class 2 CRISPR-associated endonucleases such as, e.g., Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas13a, Cas13b, Cas13c, c2c4, c2c5, c2c8, c2c9, and/or c2c10. In some embodiments, CRISPR-associated endonucleases suitable for use in reducing expression of the variant NRF2 gene include, but are not limited to, CasX, CasY, and/or MAD6 (see, e.g., Liu et al., Nature 566:218-23 (2019)).
[0192] Any cell containing an NRF2 gene (e.g. a variant NRF2 gene) may be suitable for use in the methods of reducing NRF2 expression or activity described herein. In some embodiments, the cell is a eukaryotic cell, e.g. a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the NRF2 gene is a human NRF2 gene.
[0193] In certain aspects, the disclosure also relates to a cell comprising a mutated NRF2 gene produced by the methods of reducing NRF2 expression or activity described herein. In some embodiments, the mutated NRF2 gene comprises an insertion or a deletion relative to the endogenous NRF2 gene. In some embodiments, the insertion or deletion occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotide(s) of a protospacer adjacent motif sequence (PAM) in the NRF2 gene.
Methods for Treatment of Cancer
[0194] In certain aspects, the disclosure relates to a method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence, or a vector, rAAV or pharmaceutical composition comprising the polynucleotide as described herein, to the subject.
[0195] In some embodiments, the guide RNA is complementary to a variant NRF2 gene that is found only in cancer cells and not in wild-type NRF2 genes in normal (i.e., non-cancerous) cells (e.g. exon 1, 2, 3, 4, or 5). In some embodiments, the guide RNA is complementary to a sequence in exon 2 of a variant NRF2 gene that is found only in cancer cells.
[0196] In certain embodiments, the cancer is a solid tumor. In certain embodiments, the cancer is lung cancer. In certain embodiments, the lung cancer is non-small-cell lung cancer (NSCLC). In certain embodiments, the NSCLC is squamous-cell lung carcinoma. In certain embodiments, the cancer is treated only with the pharmaceutical composition comprising a polynucleotide comprising: (a) a first DNA sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a DNA-binding domain and a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease protein-binding domain, and the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a first promoter that is operably linked to the DNA sequence. In some embodiments, the guide RNA is complementary to a variant NRF2 gene that is found only in cancer cells (e.g. lung cancer cells) and not to a wild-type NRF2 genes in normal (i.e., non-cancerous) cells (e.g. exon 1, 2, 3, 4, or 5 of the NRF gene). In some embodiments, the guide RNA is complementary to a sequence in exon 2 of a variant NRF2 gene that is found only in cancer cells. In some embodiments, expression or activity of wild-type NRF2 in a non-cancerous cell of the subject is unaffected by administration of the polynucleotide, vector, rAAV or pharmaceutical composition.
[0197] In certain embodiments, the cancer is treated with the pharmaceutical compositions as described herein and an additional agent, e.g. one or more chemotherapeutic agents. In certain embodiments, treatment with the chemotherapeutic agent is initiated at the same time as treatment with the pharmaceutical composition. In certain embodiments, the treatment with the chemotherapeutic agent is initiated after the treatment with the pharmaceutical composition is initiated. In certain embodiments, treatment with the chemotherapeutic agent is initiated at before the treatment with the pharmaceutical composition. In some embodiments, the cancer is resistant to one or more chemotherapeutic agents. The one or more chemotherapeutic agents include, but are not limited to, cisplatin, vinorelbine, carboplatin, paclitaxel, docetaxel, cabazitaxel and combinations thereof.
[0198] In certain embodiments, the pharmaceutical compositions of the present disclosure may be utilized for the treatment of cancer wherein the subject has failed at least one prior chemotherapeutic regimen. For example, in some embodiments, the cancer is resistant to one or more chemotherapeutic agents, e. g. cisplatin, vinorelbine, carboplatin, paclitaxel, docetaxel, or cabazitaxel. Accordingly, the present disclosure provides methods of treating cancer in a subject, wherein the subject has failed at least one prior chemotherapeutic regimen for the cancer, comprising administering the pharmaceutical compositions as described herein to the subject in an amount sufficient to treat the cancer, thereby treating the cancer. The pharmaceutical compositions described herein may also be utilized for inhibiting tumor cell growth in a subject wherein the subject has failed at least one prior chemotherapeutic regimen. Accordingly, the present disclosure further provides methods of inhibiting tumor cell growth in a subject, e.g. wherein the subject has failed at least one prior chemotherapeutic regimen, comprising administering the pharmaceutical compositions described herein to the subject, such that tumor cell growth is inhibited. In certain embodiments, the subject is a mammal, e.g. a human.
[0199] For example, the pharmaceutical compositions described herein may be administered to a subject in an amount sufficient to reduce proliferation of cancer cells relative to cancer cells that are not treated with the pharmaceutical composition. The pharmaceutical composition may reduce cancer cell proliferation by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to cancer cells that are not treated with the pharmaceutical composition.
[0200] In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth relative to a tumor that is not treated with the pharmaceutical composition. The pharmaceutical composition may reduce tumor growth by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to cancer cells that are not treated with the pharmaceutical composition. In a particular embodiment, administration of the pharmaceutical composition to the subject completely inhibits tumor growth.
[0201] In one embodiment, administration of a pharmaceutical composition as described herein, achieves at least stable disease, reduces tumor size, inhibits tumor growth and/or prolongs the survival time of a tumor-bearing subject as compared to an appropriate control. Accordingly, this disclosure also relates to a method of treating tumors in a human or other animal, including a subject, who has failed at least one prior chemotherapeutic regimen, by administering to such human or animal an effective amount of a pharmaceutical composition described herein. One skilled in the art would be able, by routine experimentation with the guidance provided herein, to determine what an effective amount of the pharmaceutical composition would be for the purpose of treating malignancies including in a subject who has failed at least one prior chemotherapeutic regimen. For example, a therapeutically active amount of the pharmaceutical composition may vary according to factors such as the disease stage (e.g., stage I versus stage IV), age, sex, medical complications, and weight of the subject, and the ability of the pharmaceutical composition to elicit a desired response in the subject. The dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, the dose may be administered by continuous infusion, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0202] In certain embodiments, the methods further include a treatment regimen which includes any one of or a combination of surgery, radiation, chemotherapy, e.g., hormone therapy, antibody therapy, therapy with growth factors, cytokines, and anti-angiogenic therapy.
[0203] Cancers for treatment using the methods of the disclosed herein include, for example, all types of cancer or neoplasm or malignant tumors found in mammals, including, but not limited to: leukemias, lymphomas, melanomas, carcinomas and sarcomas. In one embodiment, cancers for treatment using the methods of disclosed herein include melanomas, carcinomas and sarcomas. In some embodiments, the compositions are used for treatment, of various types of solid tumors, for example breast cancer, bladder cancer, colon and rectal cancer, endometrial cancer, kidney (renal cell) cancer, lung cancer, melanoma, pancreatic cancer, prostate cancer, thyroid cancer, skin cancer, bone cancer, brain cancer, cervical cancer, liver cancer, stomach cancer, mouth and oral cancers, neuroblastoma, testicular cancer, uterine cancer, thyroid cancer, head and neck, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and medulloblastoma, and vulvar cancer. In certain embodiments, solid tumors include breast cancer, including triple negative breast cancer. In certain embodiments, skin cancer includes melanoma, squamous cell carcinoma, cutaneous T-cell lymphoma (CTCL). In certain embodiments, the cancer includes leukemia. In certain embodiments, the cancer is selected from the group consisting of lung cancer, melanoma, esophageal squamous cancer (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer.
[0204] In a particular embodiment, the cancer is lung cancer, e.g. non-small-cell lung cancer (NSCLC). In some embodiments, the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. Beyond the current well-established combinatorial drug strategies used to treat NSCLC, several different combinatorial approaches are also being investigated for the treatment of cancers. For example, the use of an oncolytic virus that infects tumor cells has been found to enhance the activity of chemotherapy. Infection with myxoma virus combined with cisplatin or gemcitabine efficiently destroyed ovarian cancer cells at much lower dosages than needed without viral addition. Nounamo et al., Mol. Ther. oncolytics 6, 90-99 (2017). The use of oncolytic virus therapy and cytotoxic chemotherapy for improved effectiveness of cancer treatment is an active area of development. Wennier, et al., Curr. Pharm. Biotechnol. 13, 1817-33 (2012); Pandha, et al., Oncolytic Virotherapy 5, 1 (2016). Infection with a replication competent virus before treatment with cisplatin markedly enhances the therapeutic benefit of chemotherapy.
[0205] With the usage of targeted therapy (targeting EGFR mutation, ALK rearrangement, etc.) and immunotherapy (checkpoint inhibitors, anti-PD1, anti-CTLA4, etc.), the clinical management of NSCLC has greatly improved. Patients can have a longer and better quality of life. However, these therapies cannot solve all the problems. For example, agents that target specific molecules typically have a response rate of ~70%. However, after a median period of 8-16 months, due to the inevitable resistance, relapse happens in almost all patients. Anichini, et al., Cancer Immunol. Immunother. 67, 1011-1022 (2018). In regards to immunotherapy, though pembrolizumab (Keytruda) can be used as first treatment in certain lung cancer patients, only a fraction of them will respond. Bianco, et al., Curr. Opin. Pharmacol. 40, 46-50 (2018).
[0206] On the other hand, chemotherapy is still indispensable in the lung cancer treatment paradigm. In patients with locoregional NSCLC, chemotherapy is the only systemic therapy proven to improve curability when combined with surgery or radiation. Wang, et al., Investig. Opthalmology Vis. Sci. 58, 3896 (2017). In patients with metastasis, chemotherapy is still the mainstay of care for those who have developed resistance to targeted therapy agents. Meanwhile, it also has the potential to stimulate the immune system to boost the effectiveness of immunotherapy.
Combination Therapies
[0207] In certain embodiments, the pharmaceutical compositions described herein can be used in combination therapy with at least one additional anticancer agent, e.g., a chemotherapeutic agent.
[0208] Small molecule chemotherapeutic agents generally belong to various classes including, for example: 1. Topoisomerase II inhibitors (cytotoxic antibiotics), such as the anthracyclines/anthracenediones, e.g., doxorubicin, epirubicin, idarubicin and nemorubicin, the anthraquinones, e.g., mitoxantrone and losoxantrone, and the podophillotoxines, e.g., etoposide and teniposide; 2. Agents that affect microtubule formation (mitotic inhibitors), such as plant alkaloids (e.g., a compound belonging to a family of alkaline, nitrogen-containing molecules derived from plants that are biologically active and cytotoxic), e.g., taxanes, e.g., paclitaxel and docetaxel, and the vinka alkaloids, e.g., vinblastine, vincristine, and vinorelbine, and derivatives of podophyllotoxin; 3. Alkylating agents, such as nitrogen mustards, ethyleneimine compounds, alkyl sulphonates and other compounds with an alkylating action such as nitrosoureas, dacarbazine, cyclophosphamide, ifosfamide and melphalan; 4. Antimetabolites (nucleoside inhibitors), for example, folates, e.g., folic acid, fiuropyrimidines, purine or pyrimidine analogues such as 5-fluorouracil, capecitabine, gemcitabine, methotrexate, and edatrexate; 5. Topoisomerase I inhibitors, such as topotecan, irinotecan, and 9-nitrocamptothecin, camptothecin derivatives, and retinoic acid; and 6. Platinum compounds/complexes, such as cisplatin, oxaliplatin, and carboplatin. Exemplary chemotherapeutic agents for use in the methods of disclosed herein include, but are not limited to, amifostine (ethyol), cisplatin, dacarbazine (DTIC), dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carrnustine (BCNU), lomustine (CCNU), doxorubicin (adriamycin), doxorubicin lipo (doxil), gemcitabine (gemzar), daunorubicin, daunorubicin lipo (daunoxome), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil (5-FU), vinblastine, vincristine, bleomycin, paclitaxel (taxol), docetaxel (taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, CPT-I 1, 10-hydroxy-7-ethyl-camptothecin (SN38), capecitabine, ftorafur, 5′deoxyflurouridine, UFT, eniluracil, deoxycytidine, 5-azacytosine, 5-azadeoxycytosine, allopurinol, 2-chloro adenosine, trimetrexate, aminopterin, methylene-10-deazaaminopterin (MDAM), oxaplatin, picoplatin, tetraplatin, satraplatin, platinum-DACH, ormaplatin, CI-973 (and analogs thereof), JM-216 (and analogs thereof), epirubicin, 9-aminocamptothecin, 10,11-methylenedioxycamptothecin, karenitecin, 9-nitrocamptothecin, TAS 103, vindesine, L-phenylalanine mustard, ifosphamidemefosphamide, perfosfamide, trophosphamide carmustine, semustine, epothilones A-E, tomudex, 6-mercaptopurine, 6-thioguanine, amsacrine, etoposide phosphate, acyclovir, valacyclovir, ganciclovir, amantadine, rimantadine, lamivudine, zidovudine, bevacizumab, trastuzumab, rituximab, Pentostatin, floxuridine, fludarabine, hydroxyurea, ifosfamide, idarubicin, mesna, irinotecan, mitoxantrone, topotecan, leuprolide, megestrol, melphalan, plicamycin, mitotane, pegaspargase, pipobroman, tamoxifen, teniposide, testolactone, thiotepa, uracil mustard, vinorelbine, chlorambucil, mTor, epidermal growth factor receptor (EGFR), and fibroblast growth factors (FGF) and combinations thereof which are readily apparent to one of skill in the art based on the appropriate standard of care for a particular tumor or cancer. In a particular embodiment, the chemotherapeutic agent is selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof (e.g., cisplatin and vinorelbine; cisplatin and carboplatin; vinorelbine and carboplatin; cisplatin, vinorelbine, and carboplatin).
[0209] In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth relative to a tumor that is treated with the at least one chemotherapeutic agent but is not treated with the pharmaceutical composition. The pharmaceutical composition may reduce tumor growth by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to cancer cells that are treated with the at least one chemotherapeutic agent but are not treated with the pharmaceutical composition.
TABLE-US-00002 Description of Sequences. PAM sequences are underlined SEQ ID NO: Description Sequence 1 Guide RNA1 (gRNA1) recognition element 3′-AGCTACTCTGGCCCTTATAGTCC-5′ 2 Guide RNA1 (gRNA1) 5′-UCGAUGUGACCGGGAAUAUCAGG-3′ 3 Guide RNA2 (gRNA2) recognition element (from Sanjana et al., Nat. Methods 11(8):783-84 (2014)) 3′-ACTAAATCTGCCATACGTTGTCC-5′ 4 Guide RNA2 (gRNA2) 5′-UGAUUUAGACGGUAUGCAACAGG-3′ 5 PCR primer, forward GTAGTGGTGCCTTAGAGCTTACTCATCC 6 PCR primer, reverse CTAGCATGGGCAGTACTCATGACTAAG 7 human NRF2 DNA sequence NCBI Reference Sequence NM_006164.5 8 human NRF2 amino acid sequence NCBI Reference Sequence NP_006155.2 9 Exon 4 gRNA1 10 Exon 4 gRNA2 11 Exon 3 gRNA3 12 Exon 3 gRNA4 13 Exon 2 gRNA 14 Exon 5 gRNA 15 Exon 2 gRNA 16 Exon 5 gRNA 17-40 Table 5, guide RNAs 41-52 Table 1, guide RNAs 53-56 Table 5, guide RNAs 57-58 Table 1, guide RNAs 59-63 Table 6, guide RNAs 64 Exon 2 gRNA 65 R34G ssDNA template 66 Exon 4 gRNA1 67 Exon 4 gRNA2 68-77
EXAMPLES
Example 1. Creation of NRF2 Knockout Clonal A549 Cell Lines Using a CRISPR-Directed Gene Editing Approach
Methods
Cell Culture Conditions
[0210] Human lung carcinoma A549 cells were purchased from ATCC (Manassas, VA, USA). A549 is a well-established non-small cell lung adenocarcinoma cell line, which harbors a mutation in the Kelch domain of KEAP1 causing overexpression of NRF2. It has been used often as a standard for the discovery of novel therapeutic agents directed against cancer. Cells were thawed according to manufacturer’s protocol and grown in F-12K medium (ATCC, Manassas, VA, USA) supplemented with 10% FBS (ATCC, Manassas, VA, USA) and 1% Penicillin-Streptomycin Solution (ATCC, Manassas, VA, USA). Cells were cultured and maintained at a concentration between 2×10.sup.3 and 1×10.sup.4 viable cells/cm.sup.2 and incubated at 37° C. and 5% CO.sub.2. Cell number was determined using a hemacytometer.
Guide RNA Design and Construction
[0211] The NRF2 gene coding sequence was entered into the Zhang lab’s online generator (crispr.mit.edu/), and the gRNA with the highest score was chosen for gRNA1 (5′ -UCGAUGUGACCGGGAAUAUCAGG) (SEQ ID NO:2) and a previously validated gRNA targeting NRF2 (Sanjana et al., 2014, Nature Methods 11(8); 783-784) was also chosen for gRNA2 (5′ - UGAUUUAGACGGUAUGCAACAGG) (SEQ ID NO:4). The CRISPR-directed gene editing system was designed to disable the NES domain of NRF2, which reduces the capacity of the protein to reenter the nucleus and activate the transcription factor. The CRISPR plasmid was cloned using standard cloning methods with single-step digestion-ligation. The CRISPR guide sequences with appropriate 5′ overhangs were cloned into the pX458 backbone vector digested with BbsI (plasmid 48138; Addgene), a human codon optimized pSpCas9 and chimeric guide RNA expression plasmid with a 2AeGFP, purchased through Addgene (addgene.org). The guide RNA sequences were under transcriptional control of the constitutive U6 promoter. See
Transfection and Clonal Isolation
[0212] A549 cells were transfected at a concentration of 5×10.sup.5 cells/100.Math.l in 4 mm gap cuvette (BioExpress, Kaysville, UT, USA). NRF2 targeting pX458 constructs were separately electroporated (250 V, LV, 13 ms pulse length, 2 pulses, 1 s interval) into A549 cells using a Bio-Rad Gene Pulser XCell Electroporation System (Bio-Rad Laboratories, Hercules, CA, USA). Cells were then recovered in 6-well plates with complete growth media at 37° C. for 72 hours prior to sorting. A549s were sorted into a 96-well plate with a FACS AriaII flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA), with an individual eGFP+ cell sorted to each well. Clones were expanded and transferred to larger plates as the individual clones reached confluence, with DNA isolation occurring when cells reached confluence in a six-well plate (1×10.sup.6 cells/mL).
Sequencing and Sequence Analyses
[0213] CRISPR/Cas9 targeted A549 clones were PCR amplified (forward 5′ -gtagtggtgccttagagcttactcatcc (SEQ ID NO: 5), reverse 5′ - ctagcatgggcagtactcatgactaag (SEQ ID NO: 6)) using Amplitaq Gold Fast PCR Master Mix (Applied Biosystems, Foster City, CA). Briefly, template DNA, primers, water and master mix were combined and cycled: 95° C. for 10 minutes, (96° C. for 3 s, 60° C. for 3 s, 68° C. for 5 s) x35 cycles, and 72° C. for 10 s. The 402 bp products were purified (Qiagen, Hilden, Germany) and Sanger sequenced using the forward PCR primer. Clonal allelic analyses of individual A549 cell clones were analyzed by the software program, Tracking of Indels by DEcomposition (TIDE), to determine the individual subsequences within the multi-peaked breakdown product after CRISPR/Cas9 activity. Brinkman, et al., Nucleic Acids Res. 42, e168-- (2014). The TIDE analyses provide a visual of the sequence decomposition, the indel patterns of the clone, as well as relative ratios of each clonal indel pattern, serving as an intermediate step in determining each allelic profile. By utilizing the indel patterns and their relative ratios provided by TIDE, the control trace sequence and a clonal trace sequence were manually aligned, allowing for the visualization of the indel patterns of each allele of a clone.
Western Blot Analysis
[0214] Total cellular protein was collected from A549 cell lines using a standard RIPA lysis buffer containing a protease inhibitor cocktail. Protein concentrations were determined using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). The samples were heated at 95° C. for 10 minutes and then were subjected to SDS-PAGE on a 10% polyacrylamide gel for 90 minutes at 100V. The gel was transferred to a nitrocellulose membrane for 1 hour at 100 V. The blot was placed in 3% BSA and blocked overnight on a shaker at 4° C. Primary antibody incubation was performed overnight on a shaker at 4° C. for NRF2 (phospho S40) (1:10,000, Abcam ab76026) and 1 hour at room temperature for beta actin (1:8,000, Abcam ab8226), and secondary antibody (Jackson Immunoresearch, West Grove, PA, USA) incubations were all done 1 hour at room temperatures, at a 1:10,000 dilution. The protein bands were visualized via chemiluminescence using a Super signal west dura extended duration ECL (Pierce) and detected on the LiCor Odyssey FC. All bands were quantified for densitometry on the Image Studio software system.
Cell Proliferation by FACS Analysis
[0215] A549 cell lines were trypsinized and harvested at 50-70% confluency. Cells were fixed with ice cold 70% ethanol dropwise while vortexing and incubated at 4° C. for a minimum of 72 hours. Fixed cells were pelleted and washed twice with PBS followed by a 30-minute incubation on ice. As indicated in the manufacturer’s protocol (BD Biosciences), 20 .Math.l per 10.sup.6 cells of Alexa Fluor 647 Mouse anti-Ki67 (561126, BD Biosciences) was added to the cells and incubated for 30 minutes. Controls included Alexa Fluor 647 Mouse IgG1 k isotype control (557714, BD Biosciences), at the same dilution. After incubation, cells were washed twice and resuspended in stain buffer (5% BSA in 1x PBS). Cells were analyzed with a FACS AriaII flow cytometer and processed using FlowJo software.
Results
[0216] The strategy was to use CRISPR-directed gene editing to functionally disable NRF2 alleles in A549 lung carcinoma cells. It is critical to establish the fact that a gene editing technology can knockout a target gene. Below are provided the strategy details which were utilized to generate the genetic tools used to disable NRF2 in A549 cells.
[0217]
[0218] Next, the same experiment was carried out except in this case, individual cells were isolated by FACS sorting to obtain single cell clonal expansions. When the single cell isolates had expanded to sufficient quantity, half of each clonal population was cryo-preserved and allelic sequence analysis was performed on the other half using the same strategy and method described above.
[0219] A fundamental cellular phenotype that could be affected by the lack of an NES is the rate at which cells proliferate in culture. Murakami et al., Free Radic. Biol. Med. 88, 168-178 (2015); Mitsuishi et al., Cancer Cell 22, 66-79 (2012). Wildtype A549 cells typically have a doubling time of 24 hours, however, it was noted that clones 1-40, but more clearly, 2-11, grew slower in the clonal expansion process (data not shown). This observation prompted us to further investigate the proliferation profile of clones 1-40 and 2-11 by staining the cells with antibodies against Ki67, followed by FACS analysis. Ki67 is a nuclear antigen expressed in actively proliferating cells. Therefore, one might predict a decrease in Ki67 expression based on the growth characteristics seen in cell culture. Ethanol-fixed cells were stained with Alexa Fluor 647 Anti-Ki67, analyzed by FACS and plotted as a histogram (Left panel,
[0220] The decrease in proliferation in 2-11 cells was striking while the reduction in proliferation in 1-40 cells was modest at best. Thus, we decided to continue our studies on the effect of NRF2 knockout using 2-11 cells only because CRISPR-directed gene editing succeeded in disrupting function more completely in those cells. Based on growth characteristics in cell culture and the FACS analysis, the MTS assay was utilized to assess the proliferation of 2-11 cells compared to wildtype cells (Right Panel,
Example 2. Chemosensitivity is Increased in NRF2 Knockout A549 Cell Lines
Methods
MTS Cell Proliferation Assay
[0221] Cell viability was evaluated using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI). A549 cell lines were plated at 2×10.sup.3 cells per well and allowed to culture for 24 hours. The cell media was then aspirated, the cells washed with PBS, then exposed to the MTS reagent for 3 hours. After 3 hours of MTS bio-reduction by proliferating cells, the formazan product’s absorbance was measured using a 450 nm filter on an Infinite 2000 PRO microplate reader (Tecan, Mannadorf, Switzerland). Cell viability after drug exposure was evaluated using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay. A549 cell lines were plated at 2×10.sup.3 cells per well and allowed to culture for 24 hours. The cells were then treated with cisplatin, carboplatin, or a combination of cisplatin and vinorelbine for three days. The cell media was then aspirated, the cells washed with PBS, then exposed to the MTS reagent for 3 hours. After 3 hours of MTS bio-reduction by proliferating cells, the formazan product’s absorbance was measured using a 450 nm filter on an Infinite 2000 PRO microplate reader.
Results
[0222] To examine the chemosensitivity of the genetically engineered NRF2-deficient A549 cell lines, the MTS assay, depicted in
Example 3. Genetically Reengineered A549 Cells Showed Slower Growth Rate and Increased Chemosensitivity in a Xenograft Mouse Model of Lung Cancer
Methods
Animal Experiments and Statistical Analysis
[0223] The animal trials presented herein were carried out at Washington Biotech Inc., Simpsonville Maryland, under animal use and care protocol (SOP 505, SOP 520, SOP 522, SOP 1610, SOP1650) approved by the animal care and use committee of Washington Biotechnology Inc. (AAALAC accredited Animal Welfare Assurance number A4192-01). The human xenograft model was established using methodology reported previously. Kellar et al., Biomed Res. Int. 2015, 1-17 (2015). Female athymic nude mice (Envigo, 5-6 weeks old) were used in this study. Approximately 5 × 10.sup.6 cells (wild type A549 or homozygous knockout (clonal expansion 2-11)) suspended in PBS with 20% Matrigel were injected subcutaneously into right flank of each mouse. Tumor volume was measured three times a week with a digital caliper once palpable, and calculated using the formula, tumor size = ab.sup.2/2, where ‘a’ is the larger and ‘b’ is the smaller of the two dimensions. When tumors grew up to a mean volume of around 100 mm.sup.3, A549 tumor bearing mice or A549-2-11 tumor bearing mice were randomly divided into 7 groups (N=5 for each group) respectively and subject to dose/regimen-finding study. They were treated with tail vein injection of (1) Cisplatin (2 mg/kg), (2) Carboplatin (25 mg/kg), (3) Cisplatin (5 mg/kg) and Vinorelbine (5 mg/kg) or (4) saline on day 0, 3, 6 and 9 (day 0 is designated as the day of dose started) (Sanjana et al., 2014, Nature Methods 11(8); 783-784). Tumor volume and body weight was closely monitored over time. After 16 days, the animals were sacrificed, with tumor removed, weighed and processed for molecular analysis. Mice were euthanized. The data were expressed as mean ± SD. Student’s t-test and one-way or two-way ANOVA was used to assess the significance of difference. A P value < 0.05 was considered significant.
Immunofluorescence Staining
[0224] A549 xenografts were resected on day 16, snap frozen in liquid nitrogen and stored in -80° C. until usage. All immunofluorescence staining was performed as previously described. Wang et al., Investig. Opthalmology Vis. Sci. 58, 3896 (2017). Briefly, tumors were embedded in Optimum Cutting Temperature (Tissue Tek, Torrance, CA, USA) and 16-.Math.m-thick sections were obtained with a Leica CM3050 cryostat (Leica Microsystems, Buffalo Grove, IL, USA), and mounted on slides. Slides were fixed and incubated with blocking buffer for 1 hour at room temperature. Sections were then incubated with primary antibody (refer to Table 3 for more details), then washed in PBS and incubated with Alexa Fluor 488 labeled secondary antibody (1:200 dilution; Invitrogen, Grand Island, NY, USA) for 1 hour at RT. Sections were washed in PBS, then mounted with SlowFade Gold antifade mountant with DAPI (Invitrogen, Carlsbad, CA, USA). Images were obtained with a Zeiss Observer.Z1 microscope (Carl Zeiss, Inc., Gottingen, Germany). The TUNEL assay was conducted with In Situ Cell Death Detection Kit, Fluorescein (Roche, Base, Switzerland), following the manufacturer’s instructions.
TABLE-US-00003 Primary antibody Fixation Blocking buffer Dilution buffer Incubation condition and dilution rate Ki67 (9129, Cell Signaling) 4% PFA for 30 min at room temperature 5% goat serum, 0.3% Triton X-100 in PBS 2% BSA, 0.3% Triton X-100 in PBS Overnight at 4° C., 1:100
Immunocytochemistry and Image Quantification
[0225] A549 cell lines were seeded in 8-well chamber slides (LabTek II) and allowed to grow for 24 hours. After exposure to 2 .Math.M of cisplatin for 48 hours, cells were washed with PBS, fixed and permeabilized with 4% paraformaldehyde +0.1% Triton X-100 for 45 minutes, while shaking at room temperature. Cells were washed three times with PBS and blocked with a blocking buffer solution (5% normal goat serum + 0.3% Triton X-100 made in 1X PBS) for 2 hours at room temperature. Following blocking, cells were incubated with primary antibody (NRF2 1:500, Abcam ab62352) made in an antibody dilution buffer (1% BSA + 0.3% Triton X-100 made in 1X PBS), overnight in a humidified chamber at 4° C. Cells were washed three times with PBS and incubated with a conjugated secondary antibody (goat anti-rabbit Alexafluor 594, Thermo Fisher A-11037) made in an antibody dilution buffer at a concentration of 1:200. Controls included secondary only antibody stains, at the same dilutions. Cells were incubated for one hour at room temperature, in the dark. Cells were washed three times with PBS and the chamber was separated from the glass slide. Immediately following this step, 5.Math.1 of Slow Fade Gold antifade reagent with DAPI (S36938, Invitrogen) was added to each section of the slide and a coverslip was added and sealed. Slides were imaged on the Zeiss Axio fluorescent observer. Z1 microscope and images were processed on the AxioVision software. Random fields were imaged and the total number of cells/field was counted. Each field was quantified for no staining (none), nuclear staining, or cytoplasmic staining. Two individuals independently counted and quantified the images and values were averaged. The percent of NRF2 positive stained cells over the total cells analyzed in each category was plotted in the graph. Errors bars represent ±SEM and * denotes a significant p value that is <0.05 (Student’s T-test).
Results
[0226] Since CRISPR/Cas9-mediated NRF2 knockdown increased chemosensitivity in A549 cells in vitro, we examine enhanced chemosensitivity driven by gene editing in a xenograft mouse model. The homozygous knockout A549 cells (clone 2-11) and wild type A549 cells (control group) were implanted into the back of a nude mouse and the cells (5×10.sup.6 per cell line) were allowed to proliferate into a tumor with a diameter of approximately 100 mm.sup.3. The workflow is depicted in
[0227]
[0228]
Analyses of A549 Tumor Proliferation
[0229] Representative tumor samples were harvested from four groups (wild type A549 with saline, wild type A549 with cisplatin 2 mg/kg, knockout 2-11 with saline, knockout 2-11 with cisplatin 2 mg/kg) (N=3 for each group). As shown in
[0230] Since A549 2-11 knockout xenograft tumors exhibited smaller tumor volume compared to their wild type counterparts, we wanted to examine the proliferative activity within the tumors using Ki67, a well-known marker for proliferation, which presents during all active phases of cell cycle (G1, S, G2 and mitosis). Scholzen et al., J. Cell. Physiol. 182, 311-322 (2000). As shown in
[0231] Taken together, the accumulated data build a strong case for clone 2-11 as a functional knockout since these cells enable a higher sensitivity to chemotherapy as compared to the wild-type counterpart. We sought to provide some explanation for this phenotype observed in both cell culture and in the mouse. The effect of the disruption of the NES region located in the Neh5 domain of NRF2 was further characterized using immunocytochemistry. Wild type A549 and clone 2-11 cells were pre-treated with 2 .Math.M Cisplatin to stimulate NRF2 expression. Random fields of each cell sample were identified, imaged and total cell counts determined. Cells were quantified based on the following observed outcomes: no staining of NRF2, nuclear staining only or cytoplasmic staining only.
[0232] Cell line 2-11 exhibited a heightened sensitivity to increasing dosages of cisplatin and to a lesser extent in response to increasing concentrations of carboplatin. When cisplatin is combined with vinorelbine, a heightened sensitivity is also observed. Cell killing was determined by the standard MTS assay. Chemosensitivity of the homozygous knockout cell line 2-11 was then evaluated in a xenograft mouse model wherein the cells were implanted in the back of a nude mouse and allowed to proliferate for 16 days. Subsequent tail vein injection of cisplatin, carboplatin or cisplatin and vinorelbine at various days after the tumor had grown to approximately 100 mm.sup.3, led to a reduction in tumor proliferation over the course of the next 16 days. Interestingly, cell line 2-11 alone exhibited a slower growth phenotype in a xenograft mouse model even without the addition of chemotherapeutic drugs. This result indicates that the disruption of the NRF2 gene itself reduces proliferative activity to a small degree, although the addition of cisplatin, carboplatin or cisplatin/vinorelbine leads to a significant reduction in tumor cell proliferation.
[0233] Tumors isolated from mice implanted with wild type A549 cells or the clonal knockout cells treated with either cisplatin or saline were sectioned and stained for Ki67, a commonly used marker for cell proliferation. Ki67 is strictly associated with cell proliferation and is present during all active phases of the cell cycle, but absent in resting cells. Our results suggest that there is no difference in Ki67 levels in treated or untreated wild type A549 cells grown in the xenograft model, again reflecting the well-known resistance of A549 cells to cisplatin. In contrast, Ki67 levels in NRF2 knockout cells treated with cisplatin were found to be substantially lower when compared to the wild type counterparts. These results provide a plausible explanation for the reduced size of the tumor found in mice implanted with NRF2 knockout cells, a reduction in tumor cell proliferation as a function of CRISPR-directed gene editing. These results reflect those of Velma et al. (Biomark Insights 11, BMI.S39445, 2016) who reported that cisplatin-treated cells are arrested at the G0/G1 border as a function of increasing concentrations. Cisplatin reduces proliferation or retardation of cell cycle progression with an impact at the interface between G0 and G1. These data certainly indicate that disruption of NRF2 in A549 cells leads to a reduced proliferative phenotype, which may preclude the appearance of apoptosis in tumors analyzed at 16 days. It is possible that apoptosis may be evident shortly after the introduction of any of the four treatments of cisplatin taking place in the early part of the experiment.
[0234] When stimulated with stressors, functional NRF2 translocates to the nucleus where it binds to the ARE (antioxidant response element) sequence and activates transcription of the various downstream cytoprotective genes. The translocation of NRF2 to the nucleus (appears as purple) can be seen in the images of wildtype A549 cells (
[0235] Our results provide support for the notion that the combination of gene editing activity and chemotherapy act synergistically to reduce tumor cell growth. In our case, the treatment of A549 cells with CRISPR/Cas9 to disable NRF2 at the level of the gene also led to effective killing at lower dosages of multiple chemotherapeutic agents.
Example 4. Chemosensitivity in Vitro and in Xenograft Mouse Models of Melanoma, ESC, HNSCC, and Breast Cancer (Prophetic)
[0236] Following the methods in the examples above, the effects of CRISPR/Cas9-mediated NRF2 knockdown will be evaluated for additional cancers, both in vitro and in xenograft mouse models. For example, following the methods in Example 1 above, the gRNA1 sequence (5′ -UCGAUGUGACCGGGAAUAUCAGG) (SEQ ID NO:2) or the gRNA2 sequence (5′ -UGAUUUAGACGGUAUGCAACAGG) (SEQ ID NO:4) will be used to generate NRF2 knockdown cell lines of the human malignant melanoma A375 cell line (Wang, et al., 2018, Oxidative Medicine and Cellular Longevity Volume 2018, Article ID 9742154), the esophageal squamous cancer (ESC) cell lines KYSE-30, -50, -70, -110, -140, -150, -170, -180, -220, and -270 (Shibata et al., 2015, Neoplasia 13:864), the head and neck squamous cell carcinoma (HNSCC) HSC-4 cell line (Kitamura & Motohashi, 2018, Cancer Science 109:900), and the breast cancer (adenocarcinoma) cell line MCF7 (Kang et al., 2014, Scientific Reports 4:7201). Chemosensitivity of the genetically engineered NRF2-deficient cancer cell lines will be compared to that of the corresponding wild type cancer cell line in vitro following the methods provided in Example 2 above. For each cell line, chemosensitivity to the following chemotherapeutic agents will be evaluated as shown in Table 4 below.
TABLE-US-00004 Chemotherapeutic Agents for Evaluation of Chemosensitivity Cancer Cell lines Chemotherapeutic Agent human malignant melanoma (A375) cisplatin esophageal squamous cancer (ESC) (KYSE-30, -50, -70, -110, -140, -150, -170, -180, -220, and -270) 5-fluorouracil head and neck squamous cell carcinoma (HNSCC) (HSC-4) cetuximab, cisplatin, fluorouracil, carboplatin breast cancer (MCF7) doxorubicin
[0237] Wild type and NRF2-deficient cancer cell lines as shown in Table 4 above will be implanted into nude mice and evaluated for chemosensitivity as described in Example 3 above.
Example 5
RF2 gRNA Designs
Ppx458 Plasmid Vector
[0238] TABLE-US-00005 Exon 4 gRNA1 - 5′ TCGATGTGACCGGGAATATCAGG 3′ (SEQ ID NO:9)
TABLE-US-00006 Exon 4 gRNA2 - 5′ TGATTTAGACGGTATGCAACAGG 3′ (SEQ ID NO:10)
[0239] The NRF2 gene-coding sequence was entered into the Zhang lab’s online generator (http://crispr.mit.edu/) and the gRNA with the highest score was chosen for gRNA1 (5′ TCGATGTGACCGGGAATATCAGG 3′ (SEQ ID NO:9)) and a previously validated gRNA targeting NRF2 was also chosen for gRNA2 (5′ TGATTTAGACGGTATGCAACAGG 3′ (SEQ ID NO:10)) (1). The CRISPR plasmid was cloned using standard cloning methods with single-step digestion-ligation. The CRISPR guide sequences with appropriate 5′ overhangs were cloned into the px458 backbone vector digested with BbsI (plasmid 48138, Addgene). These two plasmids were transfected separately to knockout NRF2 in the A549 cell line, creating cell line 1-40 and 2-11, with small indels at the cleavage site (2).
[0240] Both plasmid constructs, gRNA1 and gRNA2, were transfected (Lipofection) in the A549 cell line targeting NRF2 in order to cleave and remove a 103 base pair fragment. The transfected cells were single-cell sorted and expanded. Clonal populations were initially screened using PCR and gel electrophoresis to visually analyze a shift in amplicon size. Once screened, DNA was sent out for sequenced across exon 4 of NRF2.
TABLE-US-00007 Exon 3 gRNA3 - 5′ AAGTACAAAGCATCTGATTTGGG 3′ (SEQ ID NO:11)
TABLE-US-00008 Exon 3 gRNA4 - 5′ AGCATCTGATTTGGGAATGTGGG 3′ (SEQ ID NO:12)
[0241] The previously described experiments were designed to cleave within exon 4. In order to ensure complete knockout of NRF2, gRNA3 (5′ AAGTACAAAGCATCTGATTTGGG 3′ (SEQ ID NO:11)) and gRNA4 (5′ AGCATCTGATTTGGGAATGTGGG 3′ (SEQ ID NO:12)) (NRF2 sequence entered into Benchling and gRNA were strategically chosen) were designed to be cloned into the px458 backbone vector to cleave within exon 3. The newly designed gRNAs would be used in conjunction with the previously designed gRNA1 and gRNA2 to cleave from exon 3 to exon 4. gRNA4 was designed to be used with gRNA1 which would remove 782 based. gRNA3 was designed to be used with gRNA2 which would remove 877 bases. Both of these combinations would result in loss of the majority of exon 3 and exon 4, leaving only the beginning of exon 3 and end of exon 4. (Sanjana et al., Nat. Methods 11:783 (2014); Bialk et al., Mol. Ther. - Oncolytics 11:75-89 (2018))
Cas9 RNP
[0242] TABLE-US-00009 Exon 2 gRNA - 5′ TGGATTTGATTGACATACTTTGG 3′ (Neh2 for NRF2 KO) (SEQ IDNO:13)
TABLE-US-00010 Exon 5 gRNA - 5′ GCTTCTTACTTTTGGGAACAAGG 3′ (Neh3 for NRF2 KO) (SEQ IDNO:14)
[0243] The following gRNAs were designed to be complexed with tracrRNA and Cas9 protein to form a ribonucleoprotein (RNP) complex. The gRNAs were designed using the NRF2 sequence in Benchling.
[0244] Exon 2 gRNA (5′ TGGATTTGATTGACATACTTTGG 3′ (SEQ ID NO:13)) was designed to cleave at the beginning of Neh2 in exon 2 in order to knockout NRF2. The RNP was transfected in A549 cells and collected at various times points to assess indel formation (TIDE analysis), shown in
[0245] Exon 5 gRNA (5′ GCTTCTTACTTTTGGGAACAAGG 3′ (SEQ ID NO:14)) was designed to be to cleave at the end of Neh3 in exon 5 and to be used in conjunction with Exon 2 gRNA. By using both gRNAs, the entire NRF2 gene would be removed (3429 bp). Cells would be transfected with both RNP complexes and single-cell sorted by FACS. Clonal populations would be analyzed for NRF2 KO.
Cas12a RNP
[0246] TABLE-US-00011 Exon 2 gRNA - 5′ TTTGATTGACATACTTTGGAGGCAA 3′ (Neh 2 for NRF2 KO) (SEQID NO:15)
TABLE-US-00012 Exon 5 gRNA - 5′ TTTTCCTTGTTCCCAAAAGTAAGAA 3′ (Neh 3 for NRF2 KO) (SEQID NO:16)
[0247] The following gRNAs were designed to be complexed with tracrRNA and Cas12a protein to form a ribonucleoprotein (RNP) complex. The gRNAs were designed using the NRF2 sequence in Benchling.
[0248] Exon 2 gRNA (5′ TTTGATTGACATACTTTGGAGGCAA 3′ (SEQ ID NO:15)) was designed to cleave at the beginning of Neh2 in exon 2 in order to knockout NRF2. The RNP was transfected in A549 cells and collected at various times points to assess indel formation, shown in
[0249] Exon 5 gRNA (5′ TTTTCCTTGTTCCCAAAAGTAAGAA 3′ (SEQ ID NO:16)) was designed to cleave at the end of Neh3 in exon 5 and to be used in conjunction with Exon 2 gRNA. By using both gRNAs, the entire NRF2 gene would be removed (3432 bp). Cells would be transfected with both RNP complexes and single-cell sorted by FACS. Clonal populations would be analyzed for NRF2 KO.
Example 6
[0250] One gRNA that may be used to target the R34G mutation using CRISPR/Cas9 comprises a DNA binding domain encoded by the nucleic acid sequence 5′ GATATAGATCTTGGAGTAAGTGG 3′ (SEQ ID NO: 84) (underlined - PAM site, bold - R34G mutation). This R34G mutation changes the first base of codon 34 in NRF2 from cytosine to guanine (i.e. from CGA to GGA), resulting in the R34G mutation. As proof of concept, an in vitro cleavage reaction was carried out to assess the level of discrimination using the R34G gRNA in a ribonucleoprotein complex (RNP). Wildtype and mutated (R34G) NRF2 sequences were incubated with the R34G RNP complex and cleavage products were analyzed by gel electrophoresis (
[0251] To test the specificity and differential recognition of CRISPR/Cas9 in normal versus mutated cells, we will use the BEAS-2B cell line, which is derived from normal human bronchial epithelium, to create an endogenous R34G mutation. This will be done by transfecting two CRISPR/Cas9 constructs (plasmid vector or RNP) designed to cleave within the Neh2 domain. The fragment being cleaved will be replaced using single stranded oligonucleotides, with the same sequence except for the single base change that creates the R34G mutation. The transfected cells will be sorted by fluorescence activated single cell sorting (FACS) for clonal expansion and clonal sequence analysis. The mutation should induce oncogenesis in the engineered cell line.
[0252] Once established, we will test the specificity and efficiency of R34G-targeting CRISPR/Cas9 on the new mutated cell line. We will assess gene editing activity by analyzing the cleavage site for indel formation after transfecting the new clonal cell line with the R34G-targeting CRISPR. As a control to show differential recognition of the R34G-targeting CRISPR, we will transfect the wildtype cell line with the R34G CRISPR and assess indel formation. Following these experiments, we will use various techniques to analyze the functionality of NRF2 post gene editing as well as the effect CRISPR cleavage on cellular pathways. We will determine the baseline of chemoresistance in the mutated cell line before gene editing using the MTS assay to measure cell viability. We will carry out the same experiment after transfection of the R34G CRISPR to assess the response to chemotherapeutic drugs. We will do a western blot analysis to determine the degree of NRF2 knockout after gene editing.
[0253] A similar approach will be taken in a xenograft model to show the differential recognition of the R34G CRISPR in mutated cells versus normal (i.e., non-cancerous) cells. We will use the established, mutated cell line to inject a mouse xenograft. Once the tumor is established, the R34G CRISPR will be systemically delivered. The tumors will be resected and used for thorough genetic analysis of the NRF2 gene across the cleavage site. Normal (i.e., non-cancerous) tissue will be randomly sampled to assess the presence/absence of off-target gene editing.
[0254] Guide RNAs that may be evaluated in these experiments include guide RNAs containing the DNA binding domain of SEQ ID NO: 126 (encoded by SEQ ID NO: 61). Additional DNA binding domains of gRNAs that may be evaluated in these experiments are provided in Table 5 below.
TABLE-US-00013 DNA binding domains of cancer-derived gRNAs from variant NRF2s (substitution in bold). The guide RNA recognition element encodes the DNA binding domain of the corresponding guide RNA SEQ ID NO:17 Guide RNA3 (gRNA3) recognition element 3′-AAACTAACTGTATGAAACCTCCC-5′ SEQ ID NO:18 Guide RNA3 (gRNA3) 5′-UUUGAUUGACAUACUUUGGAGGG-3′ SEQ ID NO:19 Guide RNA4 (gRNA4) recognition element 3′-GAATGAGGTTCTAGATATAGACC-5′ SEQ ID NO:20 Guide RNA4 (gRNA4) 5′-CUUACUCCAAGAUCUAUAUCUGG-3′ SEQ ID NO:21 Guide RNA5 (gRNA5) recognition element 3′-TATGAAACCTCCGTTCTATATCC-5′ SEQ ID NO:22 Guide RNA5 (gRNA5) 5′-AUACUUUGGAGGCAAGAUAUAGG-3′ SEQ ID NO:23 Guide RNA6 (gRNA6) recognition element 3′-TCCGTTCTATATCTAGAACCTCC-5′ SEQ ID NO:24 Guide RNA6 (gRNA6) 5′-AGGCAAGAUAUAGAUCUUGGAGG-3′ SEQ ID NO:25 Guide RNA7 (gRNA7) recognition element 3′-CTATATCTAGAACCTCATTCACC-5′ SEQ ID NO:26 Guide RNA7 (gRNA7) 5′-GAUAUAGAUCUUGGAGUAAGUGG-3′ SEQ ID NO:27 Guide RNA8 (gRNA8) recognition sequence 3′-ACTGACTTCAGTTTATGAAGACC-5′ SEQ ID NO:28 Guide RNA8 (gRNA8) 5′-UGACUGAAGUCAAAUACUUCUGG-3′ SEQ ID NO:29 Guide RNA9 (gRNA9) recognition sequence 3′-AAGTAGATCAACATTGACTCGCC-5′ SEQ ID NO:30 Guide RNA9 (gRNA9) 5′-UUCAUCUAGUUGUAACUGAGCGG-3′ SEQ ID NO:31 Guide RNA10 (gRNA10) recognition sequence 3′-TAAGTGGACAGAGAAGTAGATCC-5′ SEQ ID NO:32 Guide RNA10 (gRNA10) 5′-AUUCACCUGUCUCUUCAUCUAGG-3′ SEQ ID NO:33 Guide RNA11 (gRNA11) recognition sequence 3′-GAGTCAATGTTGATCTACTTCCC-5′ SEQ ID NO:34 Guide RNA11 (gRNA11) 5′-CUCAGUUACAACUAGAUGAAGGG-3′ SEQ ID NO:35 Guide RNA12 (gRNA12) recognition sequence 3′-ACTTAACCCTCTTTAAGTGGACC-5′ SEQ ID NO:36 Guide RNA12 (gRNA12) 5′-UGAAUUGGGAGAAAUUCACCUGG-3′ SEQ ID NO:37 Guide RNA 13 (gRNA 13) recognition sequence 3′-GTTGATCTACTTCTCTGTCCACC-5′ SEQ ID NO:38 Guide RNA 13 (gRNA 13) 5′-CAACUAGAUGAAGAGACAGGUGG-3′ SEQ ID NO:39 Guide RNA14 (gRNA14) recognition sequence 3′-TATTATCGAGGAGGGTTTGAACC-5′ SEQ ID NO:40 Guide RNA14 (gRNA14) 5′-AUAAUAGCUCCUCCCAAACUUGG-3′ SEQ ID NO:53 Guide RNA15 (gRNA15) recognition sequence 3′- AAAAAGCGAGTAATGTTGATCC-5′ SEQ IDNO:54 Guide RNA15 (gRNA15) 5′- UUUUUCGCUCAGUUACAACUAGG-3′ SEQ ID NO:55 Guide RNA16 (gRNA16) recognition sequence 3′- GTTGATCTACTTCTCTGTCCACC-5′ SEQ ID NO:56 Guide RNA16 (gRNA16) 5′- CAACUAGAUGAAGAGACAGGUGG-3′ PAM sequence underlined.
Example 7
[0255] H1703 (NCI-H1703) is a lung squamous cell carcinoma cell line with a missense mutation at codon 285 (GAG.fwdarw.AAG) of its p53 gene. You et al., Cancer Res. 60:1009-13 (2000). NCI—H1703 has been shown to primarily express FGFRlc and to induce Erk½ phosphorylation upon stimulation with FGF2. Marek et al., Mol. Pharmacol. 75:196-207 (2009).
Cas9 RNP
[0256] TABLE-US-00014 Exon 2 gRNA 3 - 5′ TGGAGGCAAGATATAGATCTTGG 3′ (Neh 2 for NRF2 KO) (SEQID NO:64)
TABLE-US-00015 R34G ssDNA template - 5′TTAAAAAACATGAGCTCTCTCCTTCC TTTTTTTGTCTTAAACATAGGACATGGATTTGATTGACATACTTTGGAGG CAAGATATAGATCTTGGAGTAAGTGGAGAAGTATTTGACTTCAGTCAGCG ACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAAAAGGAAAGAC AAGAACAACTCCAAAAGGAGCAAG 3′ (underlined,intended R 34G mutation) (SEQ ID NO:65)
[0257] The Exon 2 gRNA 3 was designed to cleave at the D29 codon in exon 2 of the NRF2 gene in order to recreate the R34G mutation. The gRNA was complexed with Cas9 protein to form a RNP and was used with the R34G template DNA to facilitate DNA repair and introduce an intended R34G mutation in the NRF2 gene. The experiment yielded several clonal-derived cell lines which are being characterized further.
[0258] The following gRNAs were designed to be used in the px458 plasmid vector as well as with Cas9 RNP for further experiments in the H1703 cell line. Individual and both RNP complexes is used to create NRF2 KO clonal-derived cell lines for characterization of the NRF2 KO in the H1703 cell line. The clonal-derived cell lines is used for MTS proliferation assay to determine chemosensitivity
Cas9 RNP
[0259] TABLE-US-00016 Exon 4 gRNA1 - 5′ TCGATGTGACCGGGAATATCAGG 3′ (NRF2 KO) (SEQ ID NO:66)
TABLE-US-00017 Exon 4 gRNA2 - 5′ TGATTTAGACGGTATGCAACAGG 3′ (NRF2 KO) (SEQ ID NO:67)
Example 8 (Prophetic) Chemosensitivity is Increased in NRF2 Knockout H1703 Cell Lines
Methods
MTS Cell Proliferation Assay
[0260] Cell viability will be evaluated using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI). H1703 cell lines will be plated at 2×10.sup.3 cells per well and will be allowed to culture for 24 hours. The cell media will then be aspirated, the cells will be washed with PBS, then will be exposed to the MTS reagent for 3 hours. After 3 hours of MTS bio-reduction by proliferating cells, the formazan product’s absorbance will be measured using a 450 nm filter on an Infinite 2000 PRO microplate reader (Tecan, Mannadorf, Switzerland). Cell viability after drug exposure will be evaluated using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay. H1703 cell lines will be plated at 2×10.sup.3 cells per well and allowed to culture for 24 hours. The cells will then be treated with cisplatin, carboplatin, or a combination of cisplatin and vinorelbine for three days. The cell media will then be aspirated, the cells will be washed with PBS, then will be exposed to the MTS reagent for 3 hours. After 3 hours of MTS bio-reduction by proliferating cells, the formazan product’s absorbance will be measured using a 450 nm filter on an Infinite 2000 PRO microplate reader.
Results
[0261] To examine the chemosensitivity of the genetically engineered NRF2-deficient H1703 cell lines, the MTS assay will be utilized. Wild type and NRF-2 deficient H1703 cells will be exposed to increasing dosages of cisplatin. After 72 hours, cisplatin will be removed, and the MTS reagent will be added for three hours after which time the population will be measured for the absorbance of formazan. The data will show that wild type H1703 cells are resistant to high dosages of Cisplatin. In the genetically engineered knockout cell lines, we will observe an increase in chemosensitivity in a dose-dependent fashion. The NRF2 knockout cells will display a heightened sensitivity. Thus, it is possible that we will observe a gene dosage effect of sorts in that the heterozygous cell line exhibits more resistance to cisplatin than homozygous knockout cells because it contains at least one viable gene copy.
Example 9
[0262] DNA sequences encoding single guide RNAs were ordered from Synthego (Menlo Park, CA). ALT-R SpCas9 from IDT was used.
TABLE-US-00018 Oligos encoding DNA binding domains of single guide RNAs sgRNA length Sequence (5′ .fwdarw. 3′) SEQ ID NO: 23 nt CAAGATATAGATCTTGGAGTAAG 59 22 nt AAGATATAGATCTTGGAGTAAG 60 20 nt GATATAGATCTTGGAGTAAG 61 18 nt TATAGATCTTGGAGTAAG 62 17 nt ATAGATCTTGGAGTAAG 63
[0263] H1703 parental cells were cultured 48 hours prior to transfections and about 60-80% confluent on the day of transfection. 10.sup.6 cells per 100 ul was used per transfection and each condition was run in duplicate.
[0264] Each CRISPR/Cas9 RNP was complexed at a 5:1 ratio of sgRNA to Cas9. 250 pmol of sgRNA was complexed at room temperature with 50 pmol of Cas9, in duplicate. The RNP complex was then transfected into H1703 parental cells using nucleofection (Lonza) with the SF Nucleofection Kit. Transfected cells were plated and allowed to recover for 72 hours. After the 72 hours, each sample of cells was collected by trypsinization and pelleted for further analysis. Cell pellets were used for genomic DNA isolation, PCR and Sanger sequencing. Sanger sequences were used for indel analysis by TIDE (overall scheme shown in
[0265] It has been reported that gRNA length can affect target specificity (Fu et al., Nat. Biotechnol. 32:279-84 (2014)). The efficiency of indel formation of the various length R34G sgRNAs to the wildtype “on-target” site was evaluated. sgRNAs for each length were synthetized and complexed with purified Cas9. Replicate experiments were carried out with H1703 lung squamous cells that were transfected with each RNP, recovered for 72 hours, then analyzed for indel formation. No R34G site is present in the wildtype NRF2 gene in the H1703 cell line, therefore only minimal or background gene editing activity is expected.
[0266] The indel efficiencies of various length sgRNAs from the replicate experiments are displayed in
Example 10 A549 Neh2 Knock-Out
[0267] The lung adenocarcinoma-derived cell line, A549, was used transfected with CRISPR/Cas9 designed to target exon 2 of NRF2 to create individual clones with random indel patterns. A total of three clones, 1-17, 2-16, and 2-23, were isolated and expanded. All three clones were collected for genomic DNA isolation and sanger sequencing to confirm the indels present. The DECODR program was used to deconvolute the sanger sequencing of each clone. The A549 cell line is polyploid and therefore, these clones contain 3 alleles of the NRF2 gene. Clone 1-17 contains -2, -2, -13 base pair deletions. Clone 2-16 contains a -1 base pair deletion across all alleles. Clone 2-23 contains two wildtype alleles and a -2 base pair deletion. See
[0268] Several A549 NRF2 knockout clones were created and used for dose curves with Cisplatin and Carboplatin (0-10 uM concentration). A single guide RNA was used to target exon 2 of the NRF2 gene to create the NRF2 knockout clones. The A549 clones selected were clones 1-17, 2-16, 2-23. These three were created by targeting NRF2 with a single guide RNA in exon 2, which encodes the Neh2 Domain. Clone 1-17 contains a -2 (62%), -2 318%) and -13 (6%) bp deletion. Clone 2-16 contains a -1 (100%) bp deletion. Clone 2-23 contains two wildtype alleles (79%) and a -2 (21%) bp deletion. These genomic profiles were analyzed by TIDE and DECODR. An MTS assay was used to determine cellular proliferation and chemosensitivity profiles of each NRF2 KO clone. The cells were treated with various concentrations of cisplatin (1, 2, 3, 5, 10 uM) to assess chemosensitivity after different degrees of NRF2 KO. Both
Example 11. CRISPR-Directed Tumor Cell Selectivity at the DNA Level
[0269] When NRF2 is expressed in normal cells, it acts as a tumor suppressor promoting cell survival against oxidative stress. However, when overexpressed in tumor cells, it acts as an oncogene favoring tumor cell survival and protecting against oxidative stress and chemopreventive compounds, thus conferring chemoresistance (Menegon et al., Trends Mol. Med. doi:10.1016/j.molmed.2016.05.002 (2016)). Overexpression of NRF2 can occur as a result of mutations in the KEAP1 and/or NRF2 and are most commonly found in lung cancer. Loss-of-function mutations in KEAP1, found in all of the domains of the protein, interfere with binding of NRF2. Gain-of-function mutations in NRF2 are primarily found in the DLG and ETGE motifs, shown in
[0270] Recently, a study by Kerins and Ooi in Scientific Reports, catalogued somatic NRF2 mutations in various cancer cases reported in The Cancer Genome Atlas (Kerins et al., Sci. Rep. 8:12846 (2018)). The study identified the percentage of NRF2 and KEAP1 mutations found across 33 different tumor types as well as the common mutations responsible for constitutive NRF2 activation. They reported 214 cases of NRF2 mutations, predominantly seen in Lung Squamous Cell Carcinoma (LUSC). Several of these NRF2 mutations have been reported and characterized previously and are shown in
[0271] Mutations in the DLG motif have been shown to disrupt intramolecular interactions inhibiting KEAP1 binding (Fukutomi et al., Mol. Cell. Biol. 34:832-46 (2014)). More recently, Kerins and Ooi investigated the nature of the R34G mutation in NRF2 and found the mutation itself increased protein stability. Therefore, due to the nature of the R34G mutation, it should only be present in cancerous cells allowing for the differentiation of tumor genomic DNA from normal genomic DNA. This approach also improves the delivery method and specificity of delivery. The DNA binding domain of the guide RNA (gRNA) that would be used to target the R34G mutation with CRISPR/Cas9 is encoded by the sequence: 5′ GATATAGATCTTGGAGTAAGTGG 3′ (bold - PAM site, underlined - R34G mutation (SEQ ID NO: 84)). Several experiments have been conducted to assess the level of discrimination and specificity of the R34G mutation-specific CRISPR/Cas9 complex.
[0272] As proof of concept, an in vitro cleavage reaction was conducted to assess the level of discrimination using the R34G guide RNA in a ribonucleoprotein complex (RNP). The in vitro cleavage reaction encompasses complexing target specific-guide RNA with Cas9 protein to form a ribonucleoprotein (RNP). The RNP is incubated with DNA of interest (100 ng) and the reaction and cleavage products are visualized by gel electrophoresis. For this experiment, wildtype and R34G-mutated NRF2 PCR products (901 bp) from an NRF2 expression plasmid (
[0273] After the initial proof of concept, in vivo experiments were conducted to further assess specificity and efficacy. Initial in vivo studies were conducted in the A549 cell line, derived from a human lung adenocarcinoma. The A549 cell line was genetically engineered to contain the R34G mutation in the NRF2 gene. The work conducted in the A549 cell lines is also being conducted in the H1703 cell line, which is derived from a human lung squamous cell carcinoma. The parental A549 cell line, R34G-mutated A549 cell line (A549 R34G-6) and H1703 parental cell line were sequenced across exon 2. Both A549 and H1703 parental cell lines contain no mutations within exon 2 of the NRF2 gene, whereas, the A549 R34G-6 cell line contains a heterozygous R34G mutation (
[0274] Once the sequences were verified, genomic DNA from each cell line was used to amplify exon 2 of NRF2. The PCR products (530 bp) from each cell line were then used in in vitro cleavage reactions under various parameters to test specificity and fidelity of the R34G-targeting RNP. For these cleavage reactions, expected cleavage products would appear at 385 and 145 bp as indicated by the red lines along the ladder, with uncut product appearing at 530 bp.
[0275] Another in vitro cleavage reaction was conducted to assess the cleavage efficiency of the wildtype NRF2 sequence to ensure the R34G-targeting RNP was, in fact, not cleaving the wildtype NRF2 sequence because of the lack of the R34G mutation. A guide RNA with a cut site 29 bp upstream (labeled Neh2 RNP) from the R34G RNP cut site was selected and used as a positive cleavage control. The results of the in vitro cleavage reaction using both RNPs is displayed in the gel image in
[0276] The last in vitro cleavage reaction before moving to in vivo studies was conducted using genomic DNA and NRF2 exon 2 PCR products from the H1703 and A549 parental cell lines, which contain wildtype NRF2, and the A549 R34G-6 cell line, which contains R34G-mutated NRF2 (
[0277] The in vitro cleavage reactions were further assessed through cell based-experiments using the same cell lines: A549 and H1703 parental cell lines and the A549 R34G-6 cell line. The cell lines were cultured under the standard conditions and transfected by electroporation (Lonza, Nucleofection) using previously established parameters.
[0278]
[0279]
[0280]
Example 12. [Prophetic] Evaluation of gRNAs in H1703 Lung Squamous Cell Carcinoma Cell Line Containing the R34G Mutation
[0281] Further studies include engineering the H1703 cell line to contain the R34G mutation to be used as a model system for Lung Squamous Cell Carcinoma in downstream experiments. This will be done by transfecting a CRISPR/Cas9 ribonucleoprotein (RNP) designed to cleave within exon 2 of the NRF2 gene, which contains the Neh2 Domain. A single stranded oligonucleotide (ssODN) containing the R34G mutation will serve as a template strand to bridge the double-strand break. The RNP and ssODN will be transfected via electroporation (Nucleofection, Lonza) and transfected cells will be sorted by fluorescence activated single cell sorting (FACS) for clonal expansion and sequence analysis. Once a R34G mutated-H1703 cell line is established, we will test the specificity and efficiency of the R34G-targeting CRISPR/Cas9 guide RNAs containing DNA binding domains encoded by the sequences: 5′ GATATAGATCTTGGAGTAAGTGG 3′ (SEQ ID NO: 84) and SEQ ID NO: 61 (e.g., the gRNA encoded by SEQ ID NO: 124) on the new mutated cell line using several cell-based experiments and a xenograft mouse model. We will assess gene editing activity of the R34G-targeting RNP by analyzing the cleavage site for indel formation (TIDE analysis, Desktop Genetics website, tide.deskgen.com/) after transfection of the R34G mutated-H1703 cell line with the R34G-targeting RNP. Cells will be harvested after transfection, sequenced and analyzed. We will also assess the specificity of the R34G-targeting RNP in the parental cell line to determine the degree of recognition of the wildtype NRF2 sequence. Experiments will be repeated to ensure reproducibility. To mimic experiments in the xenograft mouse model, cellular proliferation and cell viability experiments will be conducted to assess the effect of NRF2 knockout following R34G-targeting with CRISPR/Cas9. To do so, cell proliferation and cell viability will be measured by Ki67 staining and MTS assay. Experiments will be repeated with cisplatin treatment as a condition to further assess sensitivity of these cells following R34G-targeting.
Example 13: Optimal Multiplicity of Infection (MOI) Testing of Self-Complementary (sc) AAV5 in H1703 Squamous Lung Carcinoma Cells
[0282] On Day 1, 1 × 10.sup.5 H1703 squamous lung carcinoma cells were plated in 1 mL of Complete Media in 12-well plates and incubated overnight at 37° C.
[0283] On Day 2, self-complementary (sc) AAV5 that express GFP were resuspended to desired multiplicity of infection (MOI) in 500 ul of 2% FBS medium. The amounts of virus tested were 1 × 10.sup.3, 1 × 10.sup.4, 5 ×10.sup.4, 1 × 10.sup.5 and 5 × 10.sup.5 infectious particles per cell. The medium was aspirated, and the viral suspensions were added to the H1703 cells and incubated at 37° C. The plate was swirled every 30 min for 2 hrs. Then 500 ul of 18% FBS media was added and the plates were incubated at 37° C. for 48 hrs or 72 hrs.
[0284] On Days 4 and 5, fresh media was added and the cells were harvested for eGFP analysis by FACS. Transduction efficiency was calculated by dividing the number of GFP expressing cells by the total number of cells. The experiment was run twice for the 5 × 10.sup.5 concentration of infectious particles per cell.
[0285] As shown in
Example 14: AAV Serotype Assessment of AAV5, AAV6, AAV6.2 and AAV9 Using a scAAV-GFP Construct
[0286] AAV 5, 6, 6.2 and 9 that express eGFP were purchased from the Horae Gene Therapy Center at University of Massachusetts Medical School. NCIH1703 [H1703] cells were purchased from ATCC (ATCC® CRL¬5889™) and cultured in RPMI 1640 (ATCC formulation) medium supplemented with 10% FBS. H1703 cells were removed from culture flasks and seeded into 12-well cell culture plates at a density of 5 × 10.sup.4. After an overnight culture, the medium was removed and replaced. The cells were infected with AAV/EGFP viruses at a multiplicity of infection (MOI) of 1 × 10.sup.5 infectious particles per cell or 5 × 10.sup.5 infectious particles per cell in antibiotics free medium. Cells were incubated for 48-72 hrs. At the corresponding time point cells were collected and analyzed for transduction efficiency by measuring eGFP expression by flow cytometry utilizing the cell analyzer BD LSRFortessa™. As shown in
Example 15: AAV Tropism Assessment for AAV5 and AAV6 in H1703, H520, A549, MRC5 and HepG2 Cells
[0287] To further select the optimal serotype to transduce lung squamous cell carcinoma, the tropism of AAV5 and AAV6 was tested against cell lines from different tissue lineages (H1703 and H520 human lung squamous carcinoma; A549 human lung adenocarcinoma; MRC5 human normal lung cells; HepG2 human Hepatocellular Carcinoma). All cell lines were purchased from ATCC and cultured following their guidelines. AAV 5 and 6 that express eGFP were purchased from the Horae Gene Therapy Center at University of Massachusetts Medical School. Cells were removed from culture flasks and seeded into 12-well cell culture plates at a density of 5 × 10.sup.4. After an overnight culture, the medium was removed and replaced. The cells were infected with AAV/EGFP viruses at a multiplicity of infection (MOI) of 1 × 10.sup.5 infectious particles per cell in antibiotics free medium. Cells were incubated for 48-72 hrs. At the corresponding time point cells were collected and analyzed for transduction efficiency by measuring eGFP expression by flowcytometry utilizing the cell analyzer BD LSRFortessa™. As shown in
Example 16: [Prophetic] Selective Disruption of Lung Tumor Cell NRF2 to Enhance Chemosensitivity of Human Squamous NSCLC (H1703) Cells in a Xenograft Mouse Model
[0288] We will disable the NRF2 mutant gene using CRISPR/Cas9 in H1703 squamous cell lung carcinoma (SQCLC) with the subsequent analysis of increased effectiveness of anticancer drugs in a xenograft mouse model. The development of pre-clinical mouse models for SQCLC has been limited due to the lack of validated driver mutations, unclear cell or origin and difficulty replicating the complex genomic landscape of the disease. Therefore, we have decided to utilize cancer mouse models starting with a xenograft approach. Xenograft models are primarily used to examine tumor response to therapy in vivo prior to translation into clinical trials. Xenograft models are also ideal for examining multitherapy approaches in vivo. Much chemotherapy is approved based on a combination therapy regimen with other preexisting interventions, therefore, pre-clinical xenograft models are used to evaluate efficacy of these drug combinations prior to clinical trials. Female athymic nude mice (Envigo, 5-6 weeks old) will be used in this study. Approximately 5 × 10.sup.6 cells (wild-type H1703 or H1703 NRF2 R34G) suspended in PBS with 20% Matrigel will be injected subcutaneously into the right flank of each mouse. Tumor volume will be measured three times a week with a digital caliper once palpable and will be calculated using the following formula: tumor size = ab.sup.2/2, where a is the larger and b is the smaller of the two dimensions. When tumors grow up to a mean volume of around 100 mm.sup.3, H1703 tumor-bearing mice or H1703NRF2 R34G tumor-bearing mice will be randomly divided into 7 groups (n = 5 for each group), respectively. To deliver the R34G targeting CRISPR/Cas9 system we will employ an adeno-associated virus 6 (AAV6) delivery approach that we have optimized in our lab.
[0289] The viral AAV particles will be delivered into the tumor by direct injection at Day 0; a standard for analyzing the therapeutic benefit of novel biologics. On days 3, 6, and 9 the mice will be treated with tail vein injection of (1) cisplatin (2 mg/kg), (2) carboplatin (25 mg/kg), (3) cisplatin (5 mg/kg) and paclitaxel (5 mg/kg), or (4) saline. Tumor volume and body weight will be closely monitored over time. After 16 days, the animals will be sacrificed, with tumor removed, weighed, and processed for molecular analysis. The data collected will be expressed as mean ± SD. Student’s t-test and one-way or two-way ANOVA will be used to assess the significance of difference. A p-value < 0.05 will be considered significant. The expression of NRF2 will be tested at the mRNA and protein level using Realtime PCR and Immunohistochemistry (IHC) staining, respectively, to confirm the efficiency of NRF2 knockout. This experiment lays the groundwork for an evaluation of synergistic activity between CRISPR-directed gene editing and chemotherapy. These experiments are foundational to developing the concept that CRISPR-directed gene editing can act synergistically in combination with chemotherapeutic agents as an effective therapy for lung cancer.
Example 17: AAV Tropism Assessment for AAV5 and AAV6 in a Human Xenograft Mouse Model of H1703 Non-Small Cell Lung Cancer (NSCLC)
[0290] Purpose: To determine the in vivo transduction rate of two AAV serotypes, AAV5 and AAV6, expressing firefly luciferase using the H1703 NSCLC human xenograft model in female NCG mice, and assess with bioimaging.
TABLE-US-00019 Treatment Groups Gr. N Agent Active dose Route Schedule 1 8 AAV5-fLUC 1 × 10.sup.11 viral genomes (vg)/animal intra-tumoral once per day 2 8 AAV6-fLUC 1 × 10.sup.11 viral genomes (vg)/animal intra-tumoral once per day
Procedures
[0291] CR female NCG mice were injected with 5×10.sup.6 H1703 tumor cells in 50% Matrigel subcutaneously in flank. The cell injection volume was 0.1 mL/mouse, and the age of the mice at the start date was 8 to 12 weeks. A pair match was performed when tumors reached an average size of 60 - 100 mm.sup.3 and treatment was begun. An average tumor size of ~80 mm.sup.3 was targeted. Day 1 was defined as the day of dosing of the AAVs . Body weight of the mice was measured daily and tumor size was measured by calipers biweekly until the end of the experiment. Any individual animal with a single observation of > than 30% body weight loss or three consecutive measurements of >25% body weight loss was euthanized. The endpoint of the experiment was a mean tumor weight in the Control Group of 2000 mm.sup.3. When the endpoint was reached, all the animals were euthanized.
[0292] AAV5-fLUC and AAV6-fLUC containing the firefly luciferase gene under transcriptional control of the chicken actin promoter (CAG) were administered in PBS intratumorally in a volume of 0.05 mL/mouse on Day 1.
[0293] Whole body in vivo bioluminescent imaging was performed for a total of 7 imaging timepoints as described below: [0294] All Groups: All Animals - Day 2 (1 day post AAV injection) [0295] All Groups: All Animals - Day 3 (2 days post AAV injection) [0296] All Groups: Animals 2,3,5,6,7 - Day 4 (3 days post AAV injection) [0297] All Groups: Animals 2,3,5,6,7 - Day 6 (4 days post AAV injection) [0298] All Groups: Animals 2,3,5,6,7 - Day 8 (7 days post AAV injection) [0299] All Groups: Animals 2,3,5,6,7 - Day 9 (8 days post AAV injection) [0300] All Groups: Animals 2,3,5,6,7 - Day 10 (9 days post AAV injection) [0301] All Groups: Animals 2,3,5,6,7 - Day 13 (12 days post AAV injection) [0302] All Groups: Animals 2,3,5,6,7 - Day 15 (14 days post AAV injection) [0303] All Groups: Animals 2,3,5,6,7 - Day 17 (16 days post AAV injection) [0304] All Groups: Animals 2,3,5,6,7 - Day 20 (19 days post AAV injection)
[0305] The luciferase substrate (D-Luciferin) was administered at 150 mg/kg i.p. at 10 mL/kg (split into 2 injections) based upon recent body weights. Dorsolateral images were taken 10 minutes post substrate injection. Imaging was performed under anesthesia.
[0306] For ex vivo bioluminescent imaging, prior to sampling, luciferase substrate (D-Luciferin) was administered at 150 mg/kg i.p. at 10 mL/kg (split into 2 injections) based upon recent body weights. Ex vivo bioluminescent imaging of sampled tissues was performed for a total of 2 imaging timepoints as described below: [0307] All Groups: Animals 1,4,8 - Day 4 (3 days post AAV injection) [0308] All Groups: Animals 2,5,7 - Day 21 (20 days post AAV injection)
[0309] In order to capture all organs per animal, two images per animal were assumed for a total of 24 images (n=3 animals from each of 2 groups at 2 timepoints, two images per animal).
Results
[0310] As shown in
[0311] As shown in
[0312] As shown in