SARS-COV-2 IMMUNOGENIC COMPOSITIONS, VACCINES, AND METHODS
20230256084 · 2023-08-17
Inventors
- Pierre Charneau (Paris, FR)
- Min-Wen KU (Paris, FR)
- Pierre AUTHIE (Paris, FR)
- Nicolas Escriou (Paris, FR)
- Maryline BOURGINE (Paris, FR)
- Laleh MAJLESSI (Paris, FR)
Cpc classification
A61K39/215
HUMAN NECESSITIES
C12N2770/20034
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
A method of inducing a protective immune response against Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2), comprising administering to the upper respiratory tract of a subject an effective amount of an agent that induces a protective immune response against SARS-CoV-2. A dosage form for administration to the upper respiratory tract of a pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
Claims
1. A method of inducing and/or activating a protective immune response against Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) in a subject, comprising administering to the upper respiratory tract of the subject an effective amount of an agent that induces a protective immune response against SARS-CoV-2.
2. The method of claim 1, wherein the agent that induces a protective immune response against SARS-CoV-2 is a pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
3. The method of claim 1 or 2, wherein the agent is administered by aerosol inhalation.
4. The method of claim 2, wherein the agent is administered by nasal instillation.
5. The method of claim 2, wherein the agent is administered by nasal insufflation.
6. The method of any one of claims 1 to 5, wherein the treatment course consists of a single administration to the upper respiratory tract or wherein the treatment course comprises more than one administration, in particular two administrations, to the upper respiratory tract.
7. The method of any one of claims 1 to 5, wherein the treatment course comprises at least one priming administration outside of the respiratory tract, such as intramuscular, intradermal or subcutaneous routes, followed by at least one boosting administration to the upper respiratory tract.
8. The method of any one of claims 1 to 7, wherein the protective immune response comprises production of SARS-CoV-2 neutralizing antibodies in the subject.
9. The method of claim 8, wherein the neutralizing antibodies comprise IgG antibodies.
10. The method of any one of claims 1 to 9, wherein the protective immune response comprises production of SARS-CoV-2 S-specific T cells in the subject.
11. The method of claim 10, wherein the SARS-CoV-2 S-specific T cells comprise CD4.sup.+ T cells, CD8.sup.+ T cells, or both CD4.sup.+ and CD8.sup.+ T cells.
12. The method of claim 10 or 11, wherein the SARS-CoV-2 S-specific T cells comprise lung CD8.sup.+ T cells.
13. The method of any one of claims 10 to 12, wherein the SARS-CoV-2 S-specific T cells comprise IFN-γ-producing T-cells.
14. The method of any one of claims 10 to 13, wherein the CD8.sup.+ T cells comprise T cells with an effector memory (T.sub.em) and/or resident memory (T.sub.rm) phenotype.
15. The method of any one of claims 10 to 14, wherein the SARS-CoV-2 S-specific T cells are recruited to the olfactory bulb.
16. The method of any one of claims 1 to 15 wherein the protective immune response provides a reduced likelihood of developing SARS-CoV-2 infection-related inflammation in the subject.
17. The method of any one of claims 2 to 16, wherein the SARS-CoV-2 S protein has an amino acid sequence identical to SEQ ID NO: 1 and the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical to SEQ ID NO: 1.
18. The method of any one of claims 2 to 17, wherein the SARS-CoV-2 S protein is expressed from a coding sequence having a nucleotide sequence identical to SEQ ID NO: 2 and the SARS-CoV-2 S protein derivative is expressed from a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID NO: 2.
19. The method of any one of claims 2 to 18, wherein the SARS-CoV-2 S protein derivative or fragment thereof comprises a peptide selected from peptide 61-75 (NVTWFHAIHVSGTNG (SEQ ID NO: 15)), peptide 536-550 (NKCVNFNFNGLTGTG (SEQ ID NO: 16)) and peptide 576-590 (VRDPQTLEILDITPC (SEQ ID NO: 17)).
20. The method of any one of claims 2 to 18, wherein the SARS-CoV-2 S derivative or fragment thereof comprises an amino acid modification relative to SEQ ID NO: 1, the modification selected from: (i) 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P, (ii) 681.sup.PRRARS686 (SEQ ID NO: 22).fwdarw.681.sup.PGSAGS686 (SEQ ID NO: 23), and (iii) 986.sup.K.fwdarw.P, 987V.sup..fwdarw.P, and 675.sup.QTQTNSPRRAR685 (SEQ ID NO: 24) deletion.
21. The method of any one of claims 2 to 20, wherein the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120.
22. The method of any one of claims 2 to 21, wherein the administered lentiviral vector particle is integrative.
23. The method of any one of claims 2 to 21, wherein the administered lentiviral vector particle is nonintegrative.
24. The method of claim 23, wherein the administered nonintegrative lentiviral particle comprises a D64V mutation in an integrase coding sequence.
25. The method of any one of claims 2 to 24, wherein the administered lentiviral vector particle is pseudotyped with Vesicular Stomatitis Virus envelop Glycoprotein (VSV-G).
26. The method of any one of claims 2 to 25, wherein lentiviral vector particle is administered as a vaccine formulation comprising the lentiviral vector particle and a pharmaceutically acceptable carrier.
27. A dosage form for administration to the upper respiratory tract of a subject of a pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
28. The dosage form of claim 27, wherein the dosage form is for administration by aerosol inhalation.
29. The dosage form of claim 27, wherein the dosage form is for administration by nasal instillation.
30. The dosage form of claim 27, wherein the dosage form is for administration by nasal insufflation.
31. The dosage form of any one of claims 27 to 30, wherein the SARS-CoV-2 S protein has an amino acid sequence identical to SEQ ID NO: 1 and the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical to SEQ ID NO: 1.
32. The dosage form of any one of claims 27 to 30, wherein the SARS-CoV-2 S protein is expressed from a coding sequence having a nucleotide sequence identical to SEQ ID NO: 2 and the SARS-CoV-2 S protein derivative is expressed from a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID NO: 2.
33. The dosage form of any one of claims 27 to 32, wherein the SARS-CoV-2 S protein derivative or fragment thereof comprises a peptide selected from peptide 61-75 (NVTWFHAIHVSGTNG (SEQ ID NO: 15)), peptide 536-550 (NKCVNFNFNGLTGTG (SEQ ID NO: 16)) and peptide 576-590 (VRDPQTLEILDITPC (SEQ ID NO: 17)).
34. The dosage form of any one of claims 27 to 33, wherein the SARS-CoV-2 S derivative or fragment thereof comprises an amino acid modification relative to SEQ ID NO: 1, the modification selected from: (i) 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P, (ii) 681.sup.PRRARS686 (SEQ ID NO: 22).fwdarw.681.sup.PGSAGS686 (SEQ ID NO: 23), and (iii) 986.sup.K.fwdarw.P, 987.sup.V.fwdarw.P, and 675.sup.QTQTNSPRRAR685 (SEQ ID NO: 24) deletion.
35. The dosage form of any one of claims 27 to 34, wherein the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120
36. The dosage form of any one of claims 27 to 35, wherein the administered lentiviral vector particle is integrative.
37. The dosage form of any one of claims 27 to 35, wherein the administered lentiviral vector particle is nonintegrative.
38. The dosage form of claim 37, wherein the nonintegrative lentiviral particle comprises a D64V mutation in an integrase coding sequence.
39. The dosage form of any one of claims 27 to 38, wherein the lentiviral vector particle is pseudotyped with Vesicular Stomatitis Virus envelop Glycoprotein (VSV-G).
40. A kit comprising the dosage form of the pseudotyped lentiviral vector particle encoding a SARS-CoV-2 S protein or a derivative or fragment thereof according to any one of claims 27 to 39 and an applicator for administration to the upper respiratory tract.
41. The kit of claim 40, wherein the applicator for administration to the upper respiratory tract is an applicator for aerosol inhalation.
42. The kit of claim 40, wherein the applicator for administration to the upper respiratory tract is an applicator for nasal instillation.
43. The kit of claim 470, wherein the applicator for administration to the upper respiratory tract is an applicator for nasal insufflation.
44. A vector selected from: pFlap-ieCMV-S2PdeltaF-WPREm (CNCM I-5537), pFlap-ieCMV-S2P3F-WPREm (CNCM I-5538), pFlap-ieCMV-S2P-WPREm (CNCM I-5539), pFlap-ieCMV-SFL-WPREm (CNCM I-5540), pFlap-ieCMV-S-B1.1.7-WPREm (CNCM I-5708), pFlap-ieCMV-S-B351-WPREm (CNCM I-5709), pFlap-ieCMV-S-B351-2P-WPREm (CNCM I-5710), pFlap-ieCMV-SFL-D614G-WPREm (CNCM I-5711), and pFlap-ieCMV-S-P1-WPREm (CNCM I-5712).
45. A host cell comprising a vector of claim 38.
46. A pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
47. A pseudotyped lentiviral vector particle according to claim 46 wherein the encoded SARS-CoV-2 spike protein derivative or fragment thereof is as defined in any one of claim 31, 32, 33, 34 or 35.
48. A pseudotyped lentiviral vector particle according to claim 46 or 47 wherein the SARS-CoV-2 spike protein is selected from the SARS-CoV-2 spike protein that has the amino acid sequence of SEQ ID No. 1; the SARS-CoV-2 S protein derivative that has an amino acid sequence at least 95% identical or at least 99% identical to SEQ ID NO:1; the SARS-CoV-2 spike protein derivative that has the amino acid sequence of SEQ ID NO: 8, SEQ ID No. 11, SEQ ID No. 108, SEQ ID No. 111, SEQ ID No. 114, SEQ ID No. 117, or SEQ ID No. 120; the SARS-CoV-2 S protein derivative that has an amino acid sequence at least 95% identical or at least 99% identical to SEQ ID NO: 8, SEQ ID No. 11, SEQ ID No. 108, SEQ ID No. 111, SEQ ID No. 114, SEQ ID No. 117, or SEQ ID No. 120; and the SARS-CoV-2 spike protein fragment that has the amino acid sequence of SEQ ID No. 14 or the SARS-CoV-2 S protein derivative that has an amino acid sequence at least 95% identical or at least 99% identical to SEQ ID NO: 14.
49. A pseudotyped lentiviral vector particle according to any one of claims 46 to 48 wherein the pseudotyped lentiviral vector particle is as defined in any one of claim 36, 37, 38, or 39.
50. A pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof, wherein the pseudotyped lentiviral vector particle is made by a method comprising co-transfection of a host cell with a vector selected from: pFlap-ieCMV-S2PdeltaF-WPREm (CNCM I-5537), pFlap-ieCMV-S2P3F-WPREm (CNCM I-5538), pFlap-ieCMV-S2P-WPREm (CNCM I-5539), pFlap-ieCMV-SFL-WPREm (CNCM I-5540), pFlap-ieCMV-S-B1.1.7-WPREm (CNCM I-5708), pFlap-ieCMV-S-B351-WPREm (CNCM I-5709), pFlap-ieCMV-S-B351-2P-WPREm (CNCM I-5710), pFlap-ieCMV-SFL-D614G-WPREm (CNCM I-5711), and pFlap-ieCMV-S-P1-WPREm (CNCM I-5712).
51. A pseudotyped lentiviral vector particle according to any one of claims 46 to 49, wherein the genome of the vector particle comprises a polynucleotide selected from: a polynucleotide encoding S2PΔF (S2PdeltaF) of SEQ ID No. 13 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.13, in particular a coding sequence having a mutation, in particular a deletion, in the RBD, a polynucleotide encoding S2P3F of SEQ ID No. 10 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 having a mutation in the RBD, in particular wherein the coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 comprises mutations 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P. a polynucleotide encoding S2P of SEQ ID No. 7 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.7 having a mutation in the RBD, a polynucleotide encoding SFL of SEQ ID No. 2 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 2 having a mutation in the RBD, a polynucleotide encoding S-B1.1.7 of SEQ ID No. 107 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 107 having a mutation in the RBD, a polynucleotide encoding S-B351 of SEQ ID No. 110 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 110 having a mutation in the RBD, a polynucleotide encoding S-B1.1.7 S-B351-2P of SEQ ID No. 113 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 113 having a mutation in the RBD, a polynucleotide encoding SFL-D614G of SEQ ID No. 116 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 116 having a mutation in the RBD, and a polynucleotide encoding S-P1 of SEQ ID No. 119 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 119 having a mutation in the RBD.
52. An immunogenic composition that comprises a dosage form according to any one of claims 27 to 39 or a pseudotyped lentiviral particle according to any one of claims 46 to 51.
53. An immunogenic composition according to claim 52 for use in inducing and/or activating a protective immune response against Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) in a subject, wherein said use comprises a prime administration outside of the upper respiratory tract, in particular systemic, especially intramuscular administration and a boost or target administration to the upper respiratory tract.
54. The immunogenic composition according to claim 52 for use according to claim 53 wherein the administered doses or LV particles are identical in the prime and boost/target administration steps, or wherein the administered doses or LV particles are different in the prime and boost/target administration steps, in particular may be higher for the administration to the upper respiratory tract.
55. The immunogenic composition according to claim 52 for use according to claim 53 or 54 wherein the lentiviral vector particles are LV::SFL, in particular NILV::SFL and the administration regimen consists in a systemic, especially i.m. prime and a boost to the upper respiratory tract, in particular by i.n. boost.
56. The immunogenic composition according to claim 52 for use according to claim 53 or 54 wherein the lentiviral vector particles are LV::S.sub.prefusion, in particular NILV::S.sub.prefusion, such as LV::S2PΔF (LV::S2deltaF) or NILV::S2PΔF (NILV::S2deltaF), or LV::S2P3F or NILV::S2P3F and the administration regimen consists in a systemic, especially i.m. prime and a boost to the upper respiratory tract, in particular by i.n. boost.
57. The immunogenic composition according to claim 52 for use to induce a protective immune response against SARS-CoV-2 in the upper respiratory tract of a subject and/or in the brain against SARS-CoV-2.
58. The immunogenic composition according to claim 52 for use to induce a cross protective immune response of lungs and brain against ancestral including SARS-CoV-2 selected from the group of SARS-CoV-2 Wuhan strain, SARS-CoV-2 D614G strain and SARS-CoV-2 B1.117 strain and against emerging SARS-CoV-2 variants such as SARS-CoV-2 P.1 variant, by eliciting B and T cell-responses.
59. The immunogenic composition according to claim 52 for use according to claims 53 to 58 wherein the dosage form or the pseudotyped lentiviral particle comprises pseudotyped lentiviral particles according to any one of claims 46 to 51 wherein the pseudotyped lentiviral particles are non-integrative.
60. The immunogenic composition according to claim 52 for use according to claim 53 or 58 to elicit a protective immune response against SARS-CoV-2 wherein the response elicits SARS-CoV-2 S-specific T cells, in particular SARS-CoV-2 S-specific T cells that comprise lung CD8+ T cells and/or IFN-γ-producing T-cells.
61. The immunogenic composition according to claim 52 for use according to any one of claims 53 to 60 to elicit a protective immune response against SARS-CoV-2 wherein the response elicits CD8+ T cells that comprise T cells with an effector memory (T.sub.em) and/or resident memory (T.sub.rm) phenotype.
62. The immunogenic composition according to claim 52 for use according to any one of claims 53 to 61, the SARS-CoV-2 S-specific T cells are recruited to the olfactory bulb.
63. The immunogenic composition according to claim 52 for use according to claims 53 to 62 wherein the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120.
64. The immunogenic composition according to claim 52 for use according to any one of claims 53 to 63 to prevent or to alleviate SARS-CoV-2 infection-related inflammation in the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS—The figures are filed as color figures
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060] The sequences disclosed herein that are related to the transgene constructs are specified by their SEQ ID No. as follows:
TABLE-US-00001 SEQ ID No. origin Sequence disclosed in 1 Genbank: YP_009724390.1 Text 2 Genbank: YP_009724390.1 Text 3 pFlap-CMV-S-2019-nCoV-WPREm FIG. 20 4 SARS-COV-2 S (nt) FIG. 20 5 SARS-COV-2 S (aa) FIG. 20 6 pFlap-ieCMV-S2P-WPREm FIG. 21 7 S2P (nt) FIG. 21 8 S2P (aa) FIG. 21 9 pFlap-ieCMV-S2P3F-WPREm FIG. 22 10 S2P3F (nt) FIG. 22 11 S2P3F (aa) FIG. 22 12 pFlap-ieCMV-S2P-AF-WPREm FIG. 23 13 S2PAF (nt) FIG. 23 14 S2PAF(aa) FIG. 23 15 SARS-COV-2 S-peptide 61-75 NVTWFHAIHVSGTNG 16 SARS-COV-2 S-peptide 536-550 NKCVNFNFNGLTGTG 17 SARS-COV-2 S-peptide 576-590 VRDPQTLEILDITPC 18 SARS-COV-2 S-peptide 441-455 LDSKVGGNYNYLYRL 19 SARS-COV-2 S-peptide 671-685 CASYQTQTNSPRRAR 20 SARS-COV-2 S-peptide 991-1005 VQIDRLITGRLQSLQ 21 SARS-COV-2 S-peptide 256-275 SGWTAGAAAYYVGYLQPRTF 22 SARS-COV-2 S-peptide 681-686 PRRARS 23 SARS-COV-2 S-mutated peptide PGSAGS 681-686 24 SARS-COV-2 S-peptide 675-685 QTQTNSPRRAR 25 pFLAP K18-hACE2 WPRE FIG. 24A 26 K18 promoter FIG. 24A 27 Modified splicing donor site AAGTGGTAG 28 Acceptor site CTTTTTCCTTCCAGGT 29 hACE2 coding sequence(nt) FIG. 24C 30 hACE2 protein FIG. 24D 31 WPRE wild type (nt) FIG. 24E 98 WPRE mutated (nt) FIG. 24G 33 Polypeptide of the Kan/neoR gene FIG. 24F
DETAILED DESCRIPTION
[0061] The inventions described herein are based in part on the potent vaccination strategy demonstrated in the examples. The examples demonstrate the utility of the vaccine strategy, which is based in certain embodiments on lentiviral vectors (LVs), able to induce neutralizing antibodies specific to the Spike glycoprotein (S) of SARS-CoV-2, the etiologic agent of CoronaVirus Disease 2019 (COVID-19). Among several LV encoding distinct variants of S, one encoding the full-length, membrane anchored S (LV::S.sub.FL) and one encoding the mutated prefusion (an optionally stabilized) form such as in LV::S.sub.ΔF2P (also designated LV::S2PΔF or LV::S2PDF or LV::S2PdeltaF) triggered high antibody titers in mice and hamsters, with substantial capacity to inhibit in vitro and in vivo viral invasion of host cells, expressing human Angiotensin-Converting Enzyme 2 (hACE2), the receptor for SARS-CoV-2 entry. S-specific T cells were also abundantly induced in LV::S.sub.FL- or LV::S.sub.ΔF2P-vaccinated individuals. In mice, in which the expression of hACE2 was induced by transduction of the respiratory tract cells by an adenoviral type 5 (Ad5) vector or by transgenesis with hACE2 vectorized by LV vector (B6.K18-hACE2.sup.IP-THV mice), as well as in hamsters, substantial or full protective effect against pulmonary SARS-CoV-2 replication was afforded when LV::S.sub.FL or LV::S.sub.ΔF2P was used in systemic prime immunization, followed by intranasal mucosal boost/target. The conferred protection avoided pulmonary inflammation and prevented tissue damage. Besides, in B6.K18-hACE2.sup.IP-THV mice with substantial brain permissibility to SARS-CoV-2 replication, protection was shown to extend to the brain and to CNS. The results presented demonstrate marked prophylactic effects of an LV-based vaccination strategy against SARS-CoV-2 in pre-clinical animal models and designate in particular the intranasal LV::S.sub.FL-based immunization as a vigorous and promising vaccine approach against COVID-19. The i.n. boost after a systemic prime with LV-based vaccine is required to reach full protection of CNS in the developed transgenic model, which is a stringent model of SARS-CoV-2 infection with particularly high permissibility of brain to SARS-CoV-2 replication.
A. SEVERE ACUTE RESPIRATORY SYNDROME BETA-CORONAVIRUS 2 SPIKE PROTEIN
[0062] Various aspects of this disclosure incorporate a SARS-CoV-2 S protein. In a preferred embodiment the SARS-CoV-2 S Protein comprises the following amino acid sequence (Genbank: YP_009724390.1; SEQ ID NO: 1):
TABLE-US-00002 1 MFVFLVLLPL VSSQCVNLTT RTQLPPAYTN SFTRGVYYPD KVFRSSVLHS TQDLFLPFFS 61 NVTWFHAIHV SGTNGTKRFD NPVLPFNDGV YFASTEKSNI IRGWIFGTTL DSKTQSLLIV 121 NNATNVVIKV CEFQFCNDPF LGVYYHKNNK SWMESEFRVY SSANNCTFEY VSQPFLMDLE 181 GKQGNFKNLR EFVFKNIDGY FKIYSKHTPI NLVRDLPQGF SALEPLVDLP IGINITRFQT 241 LLALHRSYLT PGDSSSGWTA GAAAYYVGYL QPRTFLLKYN ENGTITDAVD CALDPLSETK 301 CTLKSFTVEK GIYQTSNERV QPTESIVRFP NITNLCPFGE VFNATRFASV YAWNRKRISN 361 CVADYSVLYN SASFSTFKCY GVSPTKLNDL CFTNVYADSF VIRGDEVRQI APGQTGKIAD 421 YNYKLPDDFT GCVIAWNSNN LDSKVGGNYN YLYRLFRKSN LKPFERDIST EIYQAGSTPC 481 NGVEGENCYF PLQSYGFQPT NGVGYQPYRV VVLSFELLHA PATVCGPKKS TNLVKNKCVN 541 FNFNGLTGTG VLTESNKKEL PFQQFGRDIA DTTDAVRDPQ TLEILDITPC SFGGVSVITP 601 GTNTSNQVAV LYQDVNCTEV PVAIHADQLT PTWRVYSTGS NVFQTRAGCL IGAEHVNNSY 661 ECDIPIGAGI CASYQTQTNS PRRARSVASQ SIIAYTMSLG AENSVAYSNN SIAIPTNFTI 721 SVTTEILPVS MTKTSVDCTM YICGDSTECS NLLLQYGSFC TQLNRALTGI AVEQDKNTQE 781 VFAQVKQIYK TPPIKDFGGF NFSQILPDPS KPSKRSFIED LLFNKVTLAD AGFIKQYGDC 841 LGDIAARDLI CAQKFNGLTV LPPLLTDEMI AQYTSALLAG TITSGWTFGA GAALQIPFAM 901 QMAYRENGIG VTQNVLYENQ KLIANQFNSA IGKIQDSLSS TASALGKLQD VVNQNAQALN 961 TLVKQLSSNF GAISSVLNDI LSRLDKVEAE VQIDRLITGR LQSLQTYVTQ QLIRAAEIRA 1021 SANLAATKMS ECVLGQSKRV DFCGKGYHLM SFPQSAPHGV VFLHVTYVPA QEKNFTTAPA 1081 ICHDGKAHFP REGVFVSNGT HWFVTQRNFY EPQIITTDNT FVSGNCDVVI GIVNNTVYDP 1141 LQPELDSFKE ELDKYFKNHT SPDVDLGDIS GINASVVNIQ KEIDRLNEVA KNLNESLIDL 1201 QELGKYEQYI KWPWYIWLGF IAGLIAIVMV TIMLCCMTSC CSCLKGCCSC GSCCKFDEDD 1261 SEPVLKGVKL HYT
[0063] In another preferred embodiment the SARS-CoV-2 S protein consists of the amino acid sequence (Genbank: YP_009724390.1; SEQ ID NO: 1).
[0064] It is pointed out that, unless it would appear technically not applicable to the person skilled in the art, the definitions provided herein for the SARS-CoV-2 S protein or the polynucleotide encoding the SARS-CoV-2 S protein similarly apply to the derivatives or to the fragments of the SARS-CoV-2 S protein defined with respect to the sequences of SEQ ID No. 1 or respectively SEQ ID No.2.
[0065] In some embodiments the SARS-CoV-2 S protein comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. Such SARS-CoV-2 S protein may qualify as a SARS-CoV-2 S protein derivative and/or as a SARS-CoV-2 S protein fragment if the obtained sequence is shorter than SEQ ID NO: 1. It may also be a sequence of a SARS-CoV-2 S protein expressed by a different strain of the virus than the originally identified isolate Wuhan-Hu-1 (accession number MN908947).
[0066] In some embodiments the SARS-CoV-2 S protein consists of an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. Such SARS-CoV-2 S protein may qualify as a SARS-CoV-2 S protein derivative and/or as a SARS-CoV-2 S protein fragment if the obtained sequence is shorter than SEQ ID NO: 1. It may also be a sequence of a SARS-CoV-2 S protein expressed by a different strain of the virus than the originally identified isolate Wuhan-Hu-1 (accession number MN908947). In some embodiments, the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical or at least 99% identical to SEQ ID NO:1. In one embodiment the SARS-CoV-2 spike protein derivative or fragment has the amino acid sequence of SEQ ID No. 8, SEQ ID No. 11, SEQ ID No. 108, SEQ ID No. 111, SEQ ID No. 114, SEQ ID No. 117, or SEQ ID No. 120, or the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical or at least 99% identical to S SEQ ID No. 8, SEQ ID No. 11, SEQ ID No. 108, SEQ ID No. 111, SEQ ID No. 114, SEQ ID No. 117, or SEQ ID No. 120 or the SARS-CoV-2 spike protein fragment has the amino acid sequence of SEQ ID No. 14 or the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical or at least 99% identical to SEQ ID NO: 14.
[0067] In some embodiments the SARS-CoV-2 S protein comprises an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NO: 1. In some embodiments the SARS-CoV-2 S protein comprises of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1. Such SARS-CoV-2 S protein may qualify as a SARS-CoV-2 S protein derivative and/or as a SARS-CoV-2 S protein fragment if the obtained sequence is shorter than SEQ ID NO: 1. It may also be a sequence of a SARS-CoV-2 S protein expressed by a different variant of the virus than the originally identified isolate Wuhan-Hu-1 (accession number MN908947).
[0068] In some embodiments the SARS-CoV-2 S protein consists of an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NO: 1. In some embodiments the SARS-CoV-2 S protein consist of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1 in particular no more than 10 amino acid changes at a single location in the protein. In some embodiments the SARS-CoV-2 S protein harbors mutation(s) such as those of the nucleotide sequence encoding S2PΔF or S2P3F In some embodiments a SARS-CoV-2 Spike protein comprises mutation(s) in the Receptor Binding Domain of the protein. In some embodiments the SARS-CoV-2 Spike protein harbors a substitution at residue 614 such as D614G or comprises such substitution. In some embodiments the SARS-CoV-2 Spike protein harbors mutation(s) identified in so-called variant SARS-CoV-2 VUI 2020 12/01 S protein i.e., mutations by substitution or deletion of amino acid residues of the Spike protein such as deletion 69-70, deletion 144, N501Y, substitutions A570D, D614G, P681H, T716I, S982A and D1118H. In some embodiments the SARS-CoV-2 Spike protein harbors mutation(s) that are present in SEQ ID No. 108, SEQ ID No. 111, SEQ ID No. 114, SEQ ID No. 117, or SEQ ID No. 120.
[0069] In a preferred embodiment the SARS-CoV-2 S protein is encoded by a nucleotide sequence that comprises nucleotides 21563 to 25384 of Genbank: NC_045512.2 (SEQ ID NO: 2):
TABLE-US-00003 21541 atgtttgt ttttcttgtt ttattgccac tagtctctag 21601 tcagtgtgtt aatcttacaa ccagaactca attaccccct gcatacacta attctttcac 21661 acgtggtgtt tattaccctg acaaagtttt cagatcctca gttttacatt caactcagga 21721 cttgttctta cctttctttt ccaatgttac ttggttccat gctatacatg tctctgggac 21781 caatggtact aagaggtttg ataaccctgt cctaccattt aatgatggtg tttattttgc 21841 ttccactgag aagtctaaca taataagagg ctggattttt ggtactactt tagattcgaa 21901 gacccagtcc ctacttattg ttaataacgc tactaatgtt gttattaaag tctgtgaatt 21961 tcaattttgt aatgatccat ttttgggtgt ttattaccac aaaaacaaca aaagttggat 22021 ggaaagtgag ttcagagttt attctagtgc gaataattgc acttttgaat atgtctctca 22081 gccttttctt atggaccttg aaggaaaaca gggtaatttc aaaaatctta gggaatttgt 22141 gtttaagaat attgatggtt attttaaaat atattctaag cacacgccta ttaatttagt 22201 gcgtgatctc cctcagggtt tttcggcttt agaaccattg gtagatttgc caataggtat 22261 taacatcact aggtttcaaa ctttacttgc tttacataga agttatttga ctcctggtga 22321 ttcttcttca ggttggacag ctggtgctgc agcttattat gtgggttatc ttcaacctag 22381 gacttttcta ttaaaatata atgaaaatgg aaccattaca gatgctgtag actgtgcact 22441 tgaccctctc tcagaaacaa agtgtacgtt gaaatccttc actgtagaaa aaggaatcta 22501 tcaaacttct aactttagag tccaaccaac agaatctatt gttagatttc ctaatattac 22561 aaacttgtgc ccttttggtg aagtttttaa cgccaccaga tttgcatctg tttatgcttg 22621 gaacaggaag agaatcagca actgtgttgc tgattattct gtcctatata attccgcatc 22681 attttccact tttaagtgtt atggagtgtc tcctactaaa ttaaatgatc tctgctttac 22741 taatgtctat gcagattcat ttgtaattag aggtgatgaa gtcagacaaa tcgctccagg 22801 gcaaactgga aagattgctg attataatta taaattacca gatgatttta caggctgcgt 22861 tatagcttgg aattctaaca atcttgattc taaggttggt ggtaattata attacctgta 22921 tagattgttt aggaagtcta atctcaaacc ttttgagaga gatatttcaa ctgaaatcta 22981 tcaggccggt agcacacctt gtaatggtgt tgaaggtttt aattgttact ttcctttaca 23041 atcatatggt ttccaaccca ctaatggtgt tcgttaccaa ccatacagag tagtagtact 23101 ttcttttgaa cttctacatg caccagcaac tgtttgtgga cctaaaaagt ctactaattt 23161 ggttaaaaac aaatgtgtca atttcaactt caatggttta acaggcacag gtgttcttac 23221 tgagtctaac aaaaagtttc tgcctttcca acaatttggc agagacattg ctgacactac 23281 tgatgctgtc cgtgatccac agacacttga gattcttgac attacaccat gttcttttgg 23341 tggtgtcagt gttataacac caggaacaaa tacttctaac caggttgctg ttctttatca 23401 ggatgttaac tgcacagaag tccctgttgc tattcatgca gatcaactta ctcctacttg 23461 gcgtgtttat tctacaggtt ctaatgtttt tcaaacacgt gcaggctgtt taataggggc 23521 tgaacatgtc aacaactcat atgagtgtga catacccatt ggtgcaggta tatgcgctag 23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat 23641 tgcctacact atgtcacttg gtgcagaaaa ttcagttgct tactctaata actctattgc 23701 catacccaca aattttacta ttagtgttac cacagaaatt ctaccagtgt ctatgaccaa 23761 gacatcagta gattgtacaa tgtacatttg tggtgattca actgaatgca gcaatctttt 23821 gttgcaatat ggcagttttt gtacacaatt aaaccgtgct ttaactggaa tagctgttga 23881 acaagacaaa aacacccaag aagtttttgc acaagtcaaa caaatttaca aaacaccacc 23941 aattaaagat tttggtggtt ttaatttttc acaaatatta ccagatccat caaaaccaag 24001 caagaggtca tttattgaag atctactttt caacaaagtg acacttgcag atgctggctt 24061 catcaaacaa tatggtgatt gccttggtga tattgctgct agagacctca tttgtgcaca 24121 aaagtttaac ggccttactg ttttgccacc tttgctcaca gatgaaatga ttgctcaata 24181 cacttctgca ctgttagcgg gtacaatcac ttctggttgg acctttggtg caggtgctgc 24241 attacaaata ccatttgcta tgcaaatggc ttataggttt aatggtattg gagttacaca 24301 gaatgttctc tatgagaacc aaaaattgat tcccaaccaa tttaatagtg ctattggcaa 24361 aattcaagac tcactttctt ccacagcaag tgcacttgga aaacttcaag atgtggtcaa 24421 ccaaaatgca caagctttaa acacgcttgt taaacaactt agctccaatt ttggtgcaat 24481 ttcaagtgtt ttaaatgata tcctttcacg tcttgacaaa gttgaggctg aagtgcaaat 24541 tgataggttg atcacaggca gacttcaaag tttgcagaca tatgtgactc aacaattaat 24601 tagagctgca gaaatcagag cttctgctaa tcttgctgct actaaaatgt cagagtgtgt 24661 acttggacaa tcaaaaagag ttgatttttg tggaaagggc tatcatctta tgtccttccc 24721 tcagtcagca cctcatggtg tagtcttctt gcatgtgact tatgtccctg cacaagaaaa 24781 gaacttcaca actgctcctg ccatttgtca tgatggaaaa gcacactttc ctcgtgaagg 24841 tgtctttgtt tcaaatggca cacactggtt tgtaacacaa aggaattttt atgaaccaca 24901 aatcattact acagacaaca catttgtgtc tggtaactgt gatgttgtaa taggaattgt 24961 caacaacaca gtttatgatC ctttgcaacc tgaattagac tcattcaagg aggagttaga 25021 taaatatttt aagaatcata catcaccaga tcttgattta ggtgacatct ctggcattaa 25081 tgcttcagtt gtaaacattc aaaaagaaat tgaccgcctc aatgaggttg ccaagaattt 25141 aaatgaatct ctcatcgatc tCcaagaact tggaaagtat gagcagtata taaaatggcc 25201 atggtacatt tggctaggtt ttatagctgg cttgattgcc atagtaatgg tgacaattat 25261 gctttgctgt atgaccagtt gctgtagttg tctcaagggc tgttgttctt gtggatcctg 25321 ctgcaaattt gatgaagacg actctgagcc agtgctcaaa ggagtcaaat tacattacac 25381 ataa
[0070] In a preferred embodiment the SARS-CoV-2 S protein is encoded by a nucleotide sequence that consists of nucleotides 21563 to 25384 of Genbank: NC_045512.2 (SEQ ID NO: 2).
[0071] In some embodiments the SARS-CoV-2 S protein is encoded by a nucleotide sequence that is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. Such SARS-CoV-2 S protein may qualify as a SARS-CoV-2 S protein derivative and/or as a SARS-CoV-2 S protein fragment if the nucleotide sequence having such defined percentage of identity is shorter than SEQ ID NO: 2. It may also be a sequence encoding a SARS-CoV-2 S protein which originates from a different strain of the virus than the originally identified isolate Wuhan-Hu-1 (accession number MN908947). In some embodiments the nucleotide sequence encoding the SARS-CoV-2 Spike protein harbors mutation(s) encompassing at least one non-synonymous mutation. In some embodiments the SARS-CoV-2 S protein is encoded by a nucleotide sequence that harbors mutation(s) such as those of the nucleotide sequence encoding S2PΔF or S2P3F. In some embodiments the nucleotide sequence encoding the SARS-CoV-2 Spike protein harbors a mutation at location 23403 in the sequence of SEQ ID No.2 wherein codon GGT is mutated, in particular substituted for codon GAT (corresponding to mutation at location 614, in particular to D614G substitution in the encoded protein). In some embodiments the nucleotide sequence is the sequence encoding the Spike protein of the so-called variant SARS-CoV-2 VUI 2020 12/01 wherein the Spike protein harbors multiple mutations by substitution or deletion of nucleotides wherein the mutations lead to the following changes in the amino acid residues of the encoded Spike protein: deletion 69-70, deletion 144, substitutions N501Y, A570D, D614G, P681H, T716I, S982A and D1118H.
[0072] In some embodiments the SARS-CoV-2 S protein is encoded by a nucleotide sequence that is codon-optimized, such as a codon optimized variant of SEQ ID NO: 2.
[0073] In some embodiments, the SARS-CoV-2 S protein comprises K986P and V987P amino acid substitutions.
[0074] In some embodiments, the SARS-CoV-2 S protein comprises a modification in which amino acids 681-686 are changed PRRARS (SEQ ID NO: 22) to PGSAGS (SEQ ID NO: 23).
[0075] In some embodiments, the SARS-CoV-2 S protein comprises a modification in which amino acids 675-685 (QTQTNSPRRAR (SEQ ID NO: 24)) are deleted.
B. LENTIVIRAL VECTORS AND PSEUDOTYPED LENTIVIRAL VECTOR PARTICLES ENCODING A SEVERE ACUTE RESPIRATORY SYNDROME BETA-CORONAVIRUS 2 (SARS-COV-2) SPIKE (S) PROTEIN
[0076] Within the context of this invention, a “lentiviral vector” means a non-replicating vector for the transduction of a host cell with a transgene comprising cis-acting lentiviral RNA or DNA sequences, and requiring lentiviral proteins (e.g., Gag, Pol, and/or Env) that are provided in trans. The lentiviral vector lacks expression of functional Gag, Pol, and Env proteins. The lentiviral vector may be present in the form of an RNA or DNA molecule, depending on the stage of production or development of said retroviral vectors.
[0077] The lentiviral vector can be in the form of a recombinant DNA molecule, such as a plasmid. The lentiviral vector can be in the form of a lentiviral vector particle, such as an RNA molecule(s) within a complex of lentiviral other proteins. Typically, lentiviral particle vectors, which correspond to modified or recombinant lentivirus particles, comprise a genome which is composed of two copies of single-stranded RNA. These RNA sequences can be obtained by transcription from a double-stranded DNA sequence inserted into a host cell genome (proviral vector DNA) or can be obtained from the transient expression of plasmid DNA (plasmid vector DNA) in a transformed host cell.
[0078] The lentiviral vector particles may have the capacity for integration. As such, they contain a functional integrase protein. Alternatively, the lentiviral vector particles may have impaired or no capacity for integration. Non-integrating vector particles have one or more mutations that eliminate most or all of the integrating capacity of the lentiviral vector particles. For, example, a non-integrating vector particle can contain mutation(s) in the integrase encoded by the lentiviral pol gene that cause a reduction in integrating capacity. In contrast, an integrating vector particle comprises a functional integrase protein that does not contain any mutations that eliminate most or all of the integrating capacity of the lentiviral vector particles.
[0079] In some embodiments the lentiviral vector particles are integrative (ILV).
[0080] In some embodiments the lentiviral vector particles are non-integrative (NILV).
[0081] Lentiviral vectors derive from lentiviruses, in particular human immunodeficiency virus (HIV-1 or HIV-2), simian immunodeficiency virus (SIV), equine infectious encephalitis virus (EIAV), caprine arthritis encephalitis virus (CAEV), bovine immunodeficiency virus (BIV) and feline immunodeficiency virus (FIV), which are modified to remove genetic determinants involved in pathogenicity and introduce new determinants useful for obtaining therapeutic effects. Preferably lentiviral vectors derive from HIV-1.
[0082] Such vectors are based on the separation of the cis- and trans-acting sequences. In order to generate replication-defective vectors, the trans-acting sequences (e.g., gag, pol, tat, rev, and env genes) can be deleted and replaced by an expression cassette encoding a transgene.
[0083] Efficient integration and replication in non-dividing cells generally requires the presence of two cis-acting sequences at the center of the lentiviral genome, the central polypurine tract (cPPT) and the central termination sequence (CTS). These lead to the formation of a triple-stranded DNA structure called the central DNA “flap”, which acts as a signal for uncoating of the pre-integration complex at the nuclear pore and efficient importation of the expression cassette into the nucleus of non-dividing cells, such as dendritic cells.
[0084] In one embodiment, the invention encompasses a lentiviral vector comprising a central polypurine tract and central termination sequence referred to as cPPT/CTS sequence as described, in particular, in the European patent application EP 2 169 073.
[0085] Further sequences are usually present in cis, such as the long terminal repeats (LTRs) that are involved in integration of the vector proviral DNA sequence into a host cell genome. Vectors may be obtained by mutating the LTR sequences, for instance, in domain U3 of said LTR (AU3) (Miyoshi H et al, 1998, J Virol. 72(10):8150-7; Zufferey et al., 1998, J Virol 72(12):9873-80).
[0086] In some embodiments the vector does not contain an enhancer. In some embodiments the lentiviral vector comprises LTR sequences, preferably with a mutated U3 region (ΔU3) removing promoter and enhancer sequences in the 3′ LTR.
[0087] The packaging sequence ψ (psi) can also be incorporated to help the encapsidation of the polynucleotide sequence into the vector particles (Kessler et al., 2007, Leukemia, 21(9):1859-74; Paschen et al., 2004, Cancer Immunol Immunother 12(6): 196-203).
[0088] In some embodiments, the invention encompasses a lentiviral vector comprising a lentiviral packaging sequence ψ (psi).
[0089] Further additional functional sequences, such as a transport RNA-binding site or primer binding site (PBS) or a Woodchuck PostTranscriptional Regulatory Element (WPRE) wild type or mutated (WPREm) a mutation being introduced to the start codon of protein X in WPRE to avoid expression of X protein peptide, can also be included in the lentiviral vector polynucleotide sequence, which in some embodiments allows for a more stable expression of the transgene in vivo.
[0090] In some embodiments, the lentiviral vector comprises a PBS. In one embodiment, the invention encompasses a lentiviral vector comprising a WPRE and/or an IRES.
[0091] In some embodiments, the lentiviral vector comprises at least one cPPT/CTS sequence, one ψ sequence, one (preferably 2) LTR sequence, and an expression cassette including a transgene under the transcriptional control of a cytomegalovirus (CMV) immediate-early promoter, a β2m promoter or a class I MHC promoter.
[0092] Methods of producing lentiviral vector particles and lentiviral vector particles are also provided. A lentiviral vector particle (or lentiviral particle vector) comprises a lentiviral vector in association with viral proteins. The vector may be an integrating vector (IL) (in particular for the preparation of transgenic mice as illustrated below) or may be a non-integrating vector (NIL) in particular for administration to human subject.
[0093] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof according to any of the embodiments disclosed herein.
[0094] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120.
[0095] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 1.
[0096] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 5.
[0097] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 8.
[0098] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 11.
[0099] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 14.
[0100] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 108.
[0101] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 111.
[0102] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 114.
[0103] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 117.
[0104] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises or consists of the amino acid sequence of SEQ ID NO: 120.
[0105] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that consists of the amino acid sequence Genbank: YP_009724390.1 (SEQ ID NO: 1).
[0106] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. The specific embodiments of such protein S derivative or fragment are also encompassed within these embodiments of the lentiviral vector particles.
[0107] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NOS: 5, 8, 11, 14, 108, 111, 114, 117, or 120. The specific embodiments of such protein S derivative or fragment are also encompassed within these embodiments of the lentiviral vector particles.
[0108] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that consists of an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. The specific embodiments of such protein S derivative or fragment disclosed herein are also encompassed within these embodiments of the lentiviral vector particles.
[0109] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that consists of an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NOS: 5, 8, 11, 14, 108, 111, 114, 117, or 120. The specific embodiments of such protein S derivative or fragment are also encompassed within these embodiments of the lentiviral vector particles.
[0110] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NO: 1. In some embodiments the SARS-CoV-2 S protein comprises of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1.
[0111] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that comprises an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NOS: 5, 8, 11, 14, 108, 111, 114, 117, or 120. In some embodiments the SARS-CoV-2 S protein comprises of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1.
[0112] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that consists of an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NO: 1. In some embodiments the SARS-CoV-2 S protein consists of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1.
[0113] In some embodiments, the lentiviral vector particles encode a SARS-CoV-2 S protein or a derivative or fragment thereof that consists of an amino acid sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid changes relative to SEQ ID NOS: 5, 8, 11, 14, 108, 111, 114, 117, or 120. In some embodiments the SARS-CoV-2 S protein consists of an amino acid sequence that has no more than 1, no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9 or no more than 10 amino acid changes relative to SEQ ID NO: 1.
[0114] In some embodiments the lentiviral vector particles encode a SARS-CoV-2 Spike protein that harbors mutation(s) such as those contained in S2PΔF (S2PdeltaF) or S2P3F protein derivatives.
[0115] In some embodiments the lentiviral vector particles encode a SARS-CoV-2 Spike protein that harbors a substitution at residue 614 such as D614G or that comprises such substitution. In some embodiments the lentiviral vector particles encode a SARS-CoV-2 Spike protein that harbors mutation(s) identified in so-called variant SARS-CoV-2 VUI 2020 12/01 S protein i.e., mutations by substitution or deletion of amino acid residues of the Spike protein such as deletion 69-70, deletion 144, N501Y, substitutions A570D, D614G, P681H, T716I, S982A and D1118H.
[0116] In some embodiments the lentiviral vector particles encode a SARS-CoV-2 S protein that is encoded by a nucleotide sequence that comprises SEQ ID NO: 2.
[0117] In some embodiments the lentiviral vector particles encode a SARS-CoV-2 S protein that is encoded by a nucleotide sequence that consists of nucleotides 21563 to 25384 of Genbank: NC_045512.2 (SEQ ID NO: 2).
[0118] In some embodiments the lentiviral vector particles comprise a nucleotide sequence that is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.
[0119] In some embodiments the lentiviral vector particles encode a SARS-CoV-2 S protein that is encoded by the nucleotide sequence that harbors mutation(s) with respect to the sequence of SEQ ID NO: 2, wherein the mutation(s) encompass at least one non-synonymous mutation. In some embodiments the lentiviral vector particles encode a SARS-CoV-2 S protein whose nucleotide sequence harbors a mutation at location 23403 in the sequence of SEQ ID No.2 wherein codon GGT is mutated, in particular substituted for codon GAT (corresponding to mutation at location 614, in particular to D614G substitution in the encoded S protein of SEQ ID No.1). In some embodiments the lentiviral vector particles encode the Spike protein of the so-called variant SARS-CoV-2 VUI 2020 12/01 wherein the Spike protein harbors multiple mutations by substitution or deletion of nucleotides with respect to the sequence of SEQ ID No.2 and wherein the nucleotide mutations lead to the following changes in the amino acid residues of the encoded Spike protein: deletion 69-70, deletion 144, substitutions N501Y, A570D, D614G, P681H, T716I, S982A and D1118H.
[0120] In some embodiments the lentiviral vector particles comprise a nucleotide sequence that is codon-optimized, such as a codon optimized variant of SEQ ID NO: 2 or a codon optimized variant of the nucleotide sequence encoding the S2PΔF (S2PdeltaF) or the S2P3F derivatives.
[0121] In some embodiments the lentiviral vector particles comprise a nucleotide sequence that encodes a SARS-CoV-2 S protein that comprises K986P and V987P amino acid substitutions.
[0122] In some embodiments the lentiviral vector particles comprise a nucleotide sequence that encodes a SARS-CoV-2 S protein that comprises a modification in which amino acids 681-686 PRRARS (SEQ ID No.22) are changed to PGSAGS (SEQ ID No.23) such as in LV::S2P3F.
[0123] In some embodiments the lentiviral vector particles comprise a nucleotide sequence that encodes a SARS-CoV-2 S protein that comprises a modification in which amino acids 675-685 (QTQTNSPRRAR) (SEQ ID No.24) are deleted such as in LV::S2PΔF (LV::S2PdeltaF).
[0124] In some embodiments, the pseudotyped lentiviral vector particles comprise a polynucleotide selected from: [0125] a polynucleotide encoding S2PΔF (S2PdeltaF) of SEQ ID No. 13 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.13, in particular a coding sequence having a mutation, in particular a deletion, in the RBD, [0126] a polynucleotide encoding S2P3F of SEQ ID No. 10 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 having a mutation in the RBD, in particular wherein the coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 comprises mutations 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P. [0127] a polynucleotide encoding S2P of SEQ ID No. 7 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.7 having a mutation in the RBD, [0128] a polynucleotide encoding SFL of SEQ ID No. 2 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 2 having a mutation in the RBD, [0129] a polynucleotide encoding S-B1.1.7 of SEQ ID No. 107 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 107 having a mutation in the RBD, [0130] a polynucleotide encoding S-B351 of SEQ ID No. 110 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 110 having a mutation in the RBD, [0131] a polynucleotide encoding S-B1.1.7 S-B351-2P of SEQ ID No. 113 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 113 having a mutation in the RBD, [0132] a polynucleotide encoding SFL-D614G of SEQ ID No. 116 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 116 having a mutation in the RBD, and [0133] a polynucleotide encoding S-P1 of SEQ ID No. 119 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 119 having a mutation in the RBD.
[0134] In some embodiments, the lentiviral vector particle comprises HIV-1 Gag and Pol proteins. In some embodiments, the lentiviral vector particle comprises subtype D, especially HIV-1.sub.NDK, Gag and Pol proteins.
[0135] According to some embodiments, the lentivector particles are obtained in a host cell transformed with a DNA plasmid.
[0136] Such a DNA plasmid can comprise: [0137] bacterial origin of replication (ex: pUC ori); [0138] antibiotic resistance gene (ex: KanR) for selection; and more particularly: [0139] a lentiviral vector comprising at least one nucleic acid encoding a SARS-CoV-2 S protein or a derivative or fragment thereof, transcriptionally linked to a CMV promoter.
[0140] Such a method allows producing a recombinant vector particle according to the invention, comprising the following steps of:
[0141] i) transfecting a suitable host cell with a lentiviral vector;
[0142] ii) transfecting said host cell with a packaging plasmid vector, containing viral DNA sequences encoding at least structural and polymerase (+ integrase) activities of a retrovirus (preferably lentivirus); Such packaging plasmids are described in the art (Dull et al., 1998, J Virol, 72(11):8463-71; Zufferey et al., 1998, J Virol 72(12):9873-80).
[0143] iii) culturing said transfected host cell in order to obtain expression and packaging of said lentiviral vector into lentiviral vector particles; and
[0144] iv) harvesting the lentiviral vector particles resulting from the expression and packaging of step iii) in said cultured host cells.
[0145] For different reasons, in particular for administration to a human subject, it may be helpful to pseudotype the obtained retroviral particles, i.e. to add or replace specific particle envelope proteins. In some embodiments pseudotyping extends the spectrum of cell types that may be transduced while avoiding being the target of pre-existing immunity in human populations.
[0146] In order to pseudotype the retroviral particles of the invention, the host cell can be further transfected with one or several envelope DNA plasmid(s) encoding viral envelope protein(s), preferably a VSV-G envelope protein.
[0147] An appropriate host cell is preferably a human cultured cell line as, for example, a HEK cell line, such as a HEK293T line.
[0148] Alternatively, the method for producing the vector particle is carried out in a host cell, which genome has been stably transformed with one or more of the following components: a lentiviral vector DNA sequence, the packaging genes, and the envelope gene. Such a DNA sequence may be regarded as being similar to a proviral vector according to the invention, comprising an additional promoter to allow the transcription of the vector sequence and improve the particle production rate.
[0149] In a preferred embodiment, the host cell is further modified to be able to produce viral particle in a culture medium in a continuous manner, without the entire cells swelling or dying. One may refer to Strang et al., 2005, J Virol 79(3):1165-71; Relander et al., 2005, Mol Ther 11(3):452-9; Stewart et al., 2009, Gene Ther, 16(6):805-14; and Stuart et al., 2011, Hum gene Ther, with respect to such techniques for producing viral particles.
[0150] An object of the present invention consists of a host cell transformed with a lentiviral particle vector.
[0151] The lentiviral particle vectors can comprise the following elements, as previously defined: [0152] cPPT/CTS polynucleotide sequence; and [0153] a nucleic acid encoding a CAR under control of a 132m or MHCI promoter, and optionally one of the additional elements described above.
[0154] Preferably, the lentivector particles are in a dose of 10.sup.6, 2×10.sup.6, 5×10.sup.6, 10.sup.7, 2×10.sup.7, 5×10.sup.7, 10.sup.8, 2×10.sup.8, 5×10.sup.8, or 10.sup.9 TU.
[0155] This disclosure provides pseudotyped lentiviral vector particles bearing a SARS-CoV-2 S protein according to this disclosure. The lentivector can be integrative or non-integrative. The lentiviral vectors are pseudotyped lentiviral vectors (i.e. “lentiviral vector particles”) bearing a SARS-CoV-2 S protein.
[0156] The disclosure also provides an immunogenic composition comprising a lentiviral vector particle bearing a SARS-CoV-2 S protein according to this disclosure. All embodiments disclosed herein in relation to the lentiviral particles apply to the definition of the immunogenic composition.
[0157] In some embodiments, the immunogenic composition is for use in a method of prevention of infection of a human subject by SARS-CoV-2. In some embodiments, the immunogenic composition is for use in a method of protection against SARS-CoV-2 replication in a human subject at risk of being exposed to SARS-CoV-2 or infected by SARS-CoV-2. In some embodiments, the immunogenic composition is for use in a method of preventing development of symptoms or development of a disease associated with infection by SARS-CoV-2, such as COVID-19 in a human subject at risk of being exposed to SARS-CoV-2 or infected by SARS-CoV-2. In some embodiments, the immunogenic composition is for use in a method of preventing the onset of neurological outcome associated with infection by SARS-CoV-2 in a human subject at risk of being exposed to SARS-CoV-2 or infected by SARS-CoV-2. In some embodiments, the immunogenic composition is for use in a method of protecting the Central Nervous System (CNS) of a human subject at risk of being exposed to SARS-CoV-2 or infected by SARS-CoV-2. In some embodiments, in any of these applications for use in a method disclosed, the immunogenic composition may be administered to the subject as a prophylactic agent in an effective amount for elicitation of an immune response against SARS-CoV-2.
[0158] In some embodiment the immunogenic composition is for use in a method of protection of a human subject against SARS-CoV-2 infection or against development of the symptoms or the disease (COVID-19) associated with SARS-CoV-2 infection, wherein the subject is at risk of developing lung and/or CNS pathology. In particular the human subject is in need of immune protection of CNS from SARS-CoV-2 replication because he/she is affected with comorbid conditions, in particular comorbid conditions affecting the CNS.
[0159] The disclosure also provides a vaccine composition comprising a lentiviral vector particle bearing a SARS-CoV-2 S protein according to this disclosure and a carrier. In some embodiments the vaccine reduces the likelihood that a vaccinated subject, especially a human subject, will develop COVID-19. In some embodiments the reduction is by at least 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments the vaccine reduces COVID-19 disease severity in a subject by at least 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In some embodiments the reduction is by at least 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
[0160] In some embodiments the vaccine provides protection against the infection by SARS-Cov-2, especially sterilizing protection. In some embodiments, the vaccine is for use in a method as disclosed herein in respect of the immunogenic composition.
[0161] The herein disclosed immunogenic composition and vaccine may be administered according to the administration route and administration regimen disclosed herein, in particular in accordance with the specific embodiments disclosed in C. below in particular in accordance with the illustrated embodiments.
C. METHODS OF INDUCING AND/OR ACTIVATING A PROTECTIVE IMMUNE RESPONSE AGAINST SEVERE ACUTE RESPIRATORY SYNDROME BETA-CORONAVIRUS 2 (SARS-COV-2)
[0162] Also provided are methods of inducing or activating a protective immune response against Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2), comprising administering to the upper respiratory tract of a subject an effective amount of an agent that induces a protective immune response against SARS-CoV-2. In certain embodiments the agent that induces a protective immune response against SARS-CoV-2 is a pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof. The disclosure of the methods herein is similarly applicable to the immunogenic composition for use in a method as disclosed in the present disclosure or to the vaccine for use in a method as disclosed in the present disclosure.
[0163] In some embodiments the agent is administered by nasal inhalation.
[0164] As used herein, “administered to the upper respiratory tract” includes any type of administration that results in delivery to the mucosa lining of the upper respiratory tract and includes in particular nasal administration. Administration to the upper respiratory tract includes without limitation aerosol inhalation, nasal instillation, nasal insufflation, and all combinations thereof. In some embodiments the administration is by aerosol inhalation. In some embodiments the administration is by nasal instillation. In some embodiments the administration is by nasal insufflation.
[0165] In some embodiments the treatment course consists of a single administration to the upper respiratory tract. In some embodiments the treatment course comprises a plurality of administrations to the upper respiratory tract. In some embodiments the treatment course comprises at least one administration to the upper respiratory tract and at least one administration outside of the respiratory tract. In some embodiments the treatment course comprises at least one priming administration via route outside of the respiratory tract followed by at least one boosting administration to the upper respiratory tract. The administration outside of the respiratory tract may be intramuscular, intradermal or subcutaneous. In some embodiments the treatment course comprises at least a prime/boost or a prime/target administration. In some embodiments the administration regimen comprises or consists of a prime administration outside of the upper respiratory tract, such as systemic (in particular intramuscular) administration and a boost or a target administration to the upper respiratory tract. The administered doses of the agent may be identical or may be different in the prime and boost/target administration steps, in particular may be higher for the administration to the upper respiratory tract. Details for the administration to the upper respiratory tract are provided below.
[0166] In a particular embodiment the lentiviral vector particles are LV::SFL, in particular NILV::SFL and the administration regimen consists in a systemic, especially i.m. prime and a boost to the upper respiratory tract, in particular by i.n. boost.
[0167] In a particular embodiment the lentiviral vector particles are LV::S.sub.prefusion, in particular NILV::S.sub.prefusion, such as LV::S2PΔF or NILV::S2PΔF, or LV::S2P3F or NI LV::S2P3F and the administration regimen consists in a systemic, especially i.m. prime and a boost to the upper respiratory tract, in particular by i.n. boost.
[0168] In some embodiments, the lentiviral vector particles comprise a polynucleotide selected from: [0169] a polynucleotide encoding S2PΔF (S2PdeltaF) of SEQ ID No. 13 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.13, in particular a coding sequence having a mutation, in particular a deletion, in the RBD, [0170] a polynucleotide encoding S2P3F of SEQ ID No. 10 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 having a mutation in the RBD, in particular wherein the coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.10 comprises mutations 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P. [0171] a polynucleotide encoding S2P of SEQ ID No. 7 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No.7 having a mutation in the RBD, [0172] a polynucleotide encoding SFL of SEQ ID No. 2 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 2 having a mutation in the RBD, [0173] a polynucleotide encoding S-B1.1.7 of SEQ ID No. 107 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 107 having a mutation in the RBD, [0174] a polynucleotide encoding S-B351 of SEQ ID No. 110 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 110 having a mutation in the RBD, [0175] a polynucleotide encoding S-B1.1.7 S-B351-2P of SEQ ID No. 113 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 113 having a mutation in the RBD, [0176] a polynucleotide encoding SFL-D614G of SEQ ID No. 116 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 116 having a mutation in the RBD, and [0177] a polynucleotide encoding S-P1 of SEQ ID No. 119 or a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID No. 119 having a mutation in the RBD.
[0178] In some embodiments the protective immune response comprises production of SARS-CoV-2 neutralizing antibodies in the subject. In some embodiments the neutralizing antibodies comprise IgG antibodies. In some embodiments the protective immune response comprises production of SARS-CoV-2 S-specific T cells in the subject. In some embodiments the SARS-CoV-2 S-specific T cells comprise CD4.sup.+ T cells. In some embodiments the SARS-CoV-2 S-specific T cells comprise CD8.sup.+ T cells. In some embodiments the SARS-CoV-2 S-specific T cells comprise CD4.sup.+ T cells and CD8.sup.+ T cells. In some embodiments the SARS-CoV-2 S-specific T cells comprise lung CD8.sup.+ T cells. In some embodiments the SARS-CoV-2 S-specific T cells comprise IFN-γ-producing T-cells. In some embodiments the SARS-CoV-2 S-specific T cells comprise T cells with an effector memory (Tem) and/or resident memory (Trm) phenotype. In some embodiments the SARS-CoV-2 S-specific T cells are recruited to the olfactory bulb. In some embodiments the protective immune response reduces the development of at least one symptom of a SARS-CoV-2 infection. In some embodiments the protective immune response reduces the time period during which an infected subject suffers from at least one symptom of a SARS-CoV-2 infection. In some embodiments the protective immune response reduces the likelihood of developing SARS-CoV-2 infection-related inflammation in the subject.
[0179] In various embodiments, the pseudotyped lentiviral vector particle may encode any Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof that is disclosed herein in the above embodiments relating to the description of the lentiviral vector particles.
[0180] In some embodiments the SARS-CoV-2 S protein derivative has an amino acid sequence at least 95% identical to SEQ ID NO: 1. In some embodiments the SARS-CoV-2 S protein derivative is expressed from a coding sequence having a nucleotide sequence at least 80% identical to SEQ ID NO: 2. In some embodiments the SARS-CoV-2 S protein fragment comprises a peptide selected from peptide 61-75 (NVTWFHAIHVSGTNG (SEQ ID NO: 15)), peptide 536-550 (NKCVNFNFNGLTGTG (SEQ ID NO: 16)) and peptide 576-590 (VRDPQTLEILDITPC (SEQ ID NO: 17)). In some embodiments the SARS-CoV-2 S derivative or fragment thereof comprises an amino acid modification relative to SEQ ID NO: 1, the modification selected from: (i) 986.sup.K.fwdarw.P and 987.sup.V.fwdarw.P, (ii) 681.sup.PRRARS686 (SEQ ID NO: 22).fwdarw.681.sup.PGSAGS686 (SEQ ID NO: 23), and (iii) 986.sup.K.fwdarw.P, 987.sup.V.fwdarw.P, and 675.sup.QTQTNSPRRAR685 (SEQ ID NO: 24) deletion. In some embodiments the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120.
[0181] In some embodiments the administered lentiviral vector particle is integrative. In some embodiments the administered lentiviral vector particle is nonintegrative. In some embodiments the administered nonintegrative lentiviral particle comprises a D64V mutation in an integrase coding sequence. In some embodiments the administered lentiviral vector particle is pseudotyped with Vesicular Stomatitis Virus envelop Glycoprotein (VSV-G). In some embodiments the lentiviral vector particle is administered as a vaccine formulation comprising the lentiviral vector particle and a pharmaceutically acceptable carrier.
[0182] In some embodiments, the lentivector contains a promoter that drives high expression of the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof, and drives expression in sufficient quantity for elimination by the induced immune response. In some embodiments, the promoter lacks an enhancer element to avoid insertional effects.
[0183] In some embodiments, at least 95%, 99%, 99.9%, or 99.99% of the lentiviral DNA integrated in cells of a mouse or hamster animal model at day 4 after administration is eliminated by day 21 after administration.
[0184] In some embodiments, the lentivector particles are in a dose of 10.sup.6, 2×10.sup.6, 5×10.sup.6, 10.sup.7, 2×10.sup.7, 5×10.sup.7, 10.sup.8, 2×10.sup.8, 5×10.sup.8, or 10.sup.9 TU.
[0185] The immune response induced by the lentiviral vector can be a B cell response, a CD4.sup.+ T cell response, and/or a CD8.sup.+ T cell response.
[0186] The present invention thus provides vectors that are useful as a medicament or vaccine, particularly for administration to the upper respiratory tract.
[0187] The disclosed lentiviral vectors have the ability to induce, improve, or in general be associated with the occurrence of a B cell response, a CD4.sup.+ T cell response, and/or a CD8.sup.+ T cell response, including a memory CTL response.
[0188] In some embodiments the lentiviral vector is used in combination with adjuvants, other immunogenic compositions, and/or any other therapeutic treatment.
[0189] According to some embodiments the immunogenic compositions as defined or illustrated herein are for use to induce a protective immune response against SARS-CoV-2 in the upper respiratory tract and/or in the brain against SARS-CoV-2 of a subject.
[0190] According to some embodiments the immunogenic compositions are for use to induce a cross protective immune response of lungs and brain against ancestral including SARS-CoV-2 selected from the group of SARS-CoV-2 Wuhan strain, SARS-CoV-2 D614G strain and SARS-CoV-2 B1.117 strain and against emerging SARS-CoV-2 variants such as SARS-CoV-2 P.1 variant, by eliciting B and T cell-responses.
[0191] According to some embodiments the immunogenic compositions are for use as defined herein and are characterized in that the dosage form or the pseudotyped lentiviral particle comprises pseudotyped lentiviral particles as defined herein wherein the pseudotyped lentiviral particles are non-integrative.
[0192] In some embodiments, these immunogenic compositions are for use to elicit a protective immune response against SARS-CoV-2 wherein the response elicits SARS-CoV-2 S-specific T cells, in particular SARS-CoV-2 S-specific T cells that comprise lung CD8.sup.+ T cells and/or IFN-γ-producing T-cells.
[0193] According to some embodiments the immunogenic compositions are for use to elicit a protective immune response against SARS-CoV-2 wherein the response elicits CD8.sup.+ T cells that comprise T cells with an effector memory (Tem) and/or resident memory (Trm) phenotype.
[0194] According to some embodiments the immunogenic compositions are for use as defined herein, the SARS-CoV-2 S-specific T cells are recruited to the olfactory bulb.
[0195] According to some embodiments the immunogenic compositions for use according to the invention are characterized in that the Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof comprises or consists of an amino acid sequence selected from SEQ ID NOS: 1, 5, 8, 11, 14, 108, 111, 114, 117, and 120.
[0196] According to some embodiments the immunogenic compositions are for use to prevent or to alleviate SARS-CoV-2 infection-related inflammation in the subject.
D. DOSAGE FORMS FOR ADMINISTRATION TO THE UPPER RESPIRATORY TRACT
[0197] The immunogenic compositions of the disclosure may be provided in a dosage form suitable for administration to the upper respiratory tract of a subject. Appropriate formulations are known in the art. In some embodiments the dosage form is adapted for aerosol inhalation. In some embodiments the dosage form is adapted for nasal instillation. In some embodiments the nasal dosage form is adapted for nasal insufflation. In some embodiments the dosage form is aliquoted in a single dose. In some embodiments the dosage form is packaged in a single dose.
E. KITS
[0198] Also provided are kits suitable for use in practicing a method disclosed herein. In some embodiments the kit comprises a dosage form for administration to the upper respiratory tract of a subject of the pseudotyped lentiviral vector particle encoding a SARS-CoV-2 S protein or a derivative or fragment thereof according to this disclosure, and an applicator. In some embodiments the applicator is an applicator for aerosol inhalation. In some embodiments the applicator is an applicator for nasal instillation. In some embodiments the applicator is an applicator for nasal insufflation. Suitable examples of each are known in the art and may be used.
F. LENTIVIRAL VECTORS
[0199] Also provided are novel and nonobvious lentiviral vectors and plasmids for creating the same. The LV and the plasmids encode a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
[0200] Having thus described different embodiments of the present invention, it should be noted by those skilled in the art that the disclosures herein are exemplary only and that various other alternatives, adaptations, and modifications may be made within the scope of the present invention. Accordingly, the present invention is not limited to the specific embodiments as illustrated herein.
G. EXAMPLES
Example 1: Intranasal Vaccination with LV Against SARS-Cov-2 in Preclinical Animal Models of Golden Hamster and Mice Treated to Express Human ACE2
Example 1.1: Materials and Methods
[0201] 1. 1.1 Construction of Transfer pFLAP Plasmids Coding SFL, S1-S2, or S1 Derived from SCoV-2.
[0202] codon-optimized full-length S (1-1273) sequence was amplified from pMK-RQ_S-2019-nCoV and inserted between BamHI and XhoI sites of pFlap-ieCMV-WPREm. Sequences encoding for S1-S2 (1-1211) or S1 (1-681) were amplified by PCR from the pFlap-ieCMV-SFL-WPREm plasmid and sub-cloned into pFlap-ieCMV-WPREm between the BamHI and XhoI restriction sites. Each of the PCR products were inserted between the native human ieCMV promoter and a mutated WPRE (Woodchuck Posttranscriptional Regulatory Element) sequence, where a mutation was introduced to the start codon of protein X in WPRE to avoid expression of X protein peptide. Plasmids were amplified in Escherichia coli DH5a in Lysogeny Broth (LB) supplemented with 50 μg/ml of kanamycin, purified using the NucleoBond Xtra Maxi EF Kit (Macherey Nagel) and resuspended in Tris-EDTA Endotoxin-Free (TE-EF) buffer overnight. The plasmid was quantified with a NanoDrop 2000c spectrophotometer (Thermo Scientific), adjusted to 1 μg/μl in TE-EF buffer, aliquoted and stored at −20° C. The plasmid DNA was verified by (i) diagnostic check with restriction digestion, and (ii) sequencing the region proximal to the transgene insertion sites.
[0203] 1. 1.2 Production and Titration of LV Vectors
[0204] Non-replicative integrative LV vectors were produced in Human Embryonic Kidney (HEK)-293T cells, as previously detailed (Zennou et al., 2000). 6×10.sup.6 cells/Petri dish were cultured in DMEM and were co-transfected in a tripartite fashion with 1 ml of a mixture of: (i) 2.5 μg/ml of the pSD-GP-NDK packaging plasmid, coding for codon-optimized gag-pol-tat-rre-rev, (ii) 10 μg/ml of VSV-G Indiana envelop plasmid, and (iii) 10 μg/ml of transfer pFLAP plasmid in Hepes 1× containing 125 mM of Ca(ClO.sub.3).sub.2 Supernatants were harvested at 48h post transfection, clarified by 6-minute centrifugation at 2500 rpm at 4° C., then treated for 30 min with benzonase 10 U/ml final concentration at 37° C. in Hepes-buffered solution, containing MgCl.sub.2 (2 mM) final to eliminate residual DNA. LV vectors were aliquoted and conserved at −80° C. To determine the titers of LV preparations, HEK-293T were distributed at 4×10.sup.5 cell/well in flat-bottom 6-well-plates in complete DMEM in the presence of 8 μM aphidicolin (Sigma) which blocks the cell proliferation. The cells were then transduced with serial dilutions of LV preparations. The titer, proportional to the efficacy of nuclear gene transfer, is determined as Transduction Unit (TU)/ml by qPCR on total lysates at day 3 post transduction, by use of forward 5′-TGG AGG AGG AGA TAT GAG GG-3′ (SEQ ID NO: 100) and reverse 5′-CTG CTG CAC TAT ACC AGA CA-3′ (SEQ ID NO: 101) primers, specific to pFLAP plasmid and forward 5′-TCT CCT CTG ACT TCA ACA GC-3′ (SEQ ID NO: 102) and reverse 5′-CCC TGC ACT TTT TAA GAG CC-3′ (SEQ ID NO: 103) primers specific to the host housekeeping gene gadph, as described elsewhere (Iglesias et al., 2006).
[0205] 1. 1.3 Mouse Studies
[0206] Female C57BL/6J mice (Janvier, Le Genest Saint Isle, France) were used between the age of 6 and 10 weeks. Male Mesocricetus auratus golden hamsters (Janvier, Le Genest Saint Isle, France) were purchased mature, i.e. 80-90 gr weight. At the beginning of the immunization regimen they weigh between 100 and 120 gr. Experimentation on animals was performed in accordance with the European and French guidelines (Directive 86/609/CEE and Decree 87-848 of 19 Oct. 1987) subsequent to approval by the Institut Pasteur Safety, Animal Care and Use Committee, protocol agreement delivered by local ethical committee (CETEA #DAP20007) and Ministry of High Education and Research APAFIS #24627-2020031117362508 v1. Mice were vaccinated with the indicated TU of LV via intraperitoneal (i.p.) injection. Sera were collected at various time points post immunization to monitor binding and neutralization activities.
[0207] 1. 1.4 SARS-CoV-2 Inoculation
[0208] Ad5::hACE2-pretreated mice or hamsters were anesthetized by peritoneal injection of mixture Ketamine and Xylazine, transferred into a PSM-III where they were inoculated with 1×10.sup.5 TCID.sub.50 of a SARS-CoV-2 clinical isolate amplified in VeroE6 cells, provided by the Centre National de Reference des Virus Respiratoires, France. The viral inoculum was contained in 20 μl for mice and in 50 μl for hamsters. Animals were then housed in an isolator in BSL3 animal facilities of Institut Pasteur. The organs and fluids recovered from the infected mice, with live SARS-CoV-2 were manipulated following the approved standard operating procedures of the BioSafety Level BSL3 facilities.
[0209] 1. 1.5 Recombinant S.sub.CoV-2 Protein Variants
[0210] Codon-optimized nucleotide fragments encoding a stabilized foldon-trimerized version of the SARS-CoV-2 S ectodomain (a.a. 1 to 1208), the S1 monomer (a.a. 16 to 681) and the RBD subdomain (amino acid 331 to 519) both preceded by a murine IgK leader peptide, followed by an 8×His Tag (SEQ ID NO: 104) were synthetized and cloned into pcDNA™3.1/Zeom expression vector (Thermo Fisher Scientific). Proteins were produced by transient co-transfection of exponentially growing Freestyle™ 293-F suspension cells (Thermo Fisher Scientific, Waltham, Mass.) using polyethylenimine (PEI)-precipitation method as previously described (Lorin and Mouquet, 2015). Recombinant S.sub.CoV-2 proteins were purified by affinity chromatography using the Ni Sepharose® Excel Resin according to manufacturer's instructions (Thermo Fisher Scientific). Protein purity was evaluated by in-gel protein silver-staining using Pierce Silver Stain kit (Thermo Fisher Scientific) following SDS-PAGE in reducing and non-reducing conditions using NuPAGE™ 3-8% Tris-Acetate gels (Life Technologies). Purified proteins were dialyzed overnight against PBS using Slide-A-Lyzer® dialysis cassettes (10 kDa MW cut-off, Thermo Fisher Scientific). Protein concentration was determined using the NanoDrop™ One instrument (Thermo Fisher Scientific).
[0211] 1. 1.6 ELISA
[0212] Ninety-six-well Nunc Polysorp plates (Nunc, Thermo Scientific) were coated overnight at 4° C. with 100 ng/well of purified tri-S proteins in carbonate buffer pH 9.6. After washings with PBS containing 0.1% Tween 20 (PBST), plate wells were blocked with PBS containing 1% Tween20 and 10% FBS for 2 h at room temperature. After PBST washings, 1:100-diluted sera in PBST containing 10% FBS and 4 consecutive 1:10 dilutions were added and incubated during 2h at 37° C. After PBST washings, plates were incubated with 1,000-fold diluted peroxydase-conjugated goat anti-mouse IgG/IgM (Jackson ImmunoResearch Europe Ltd, Cambridgeshire, United Kingdom) for 1 h. Plates were revealed by adding 100 μl of TMB chromogenic substrate (TMB, Eurobio Scientific) after PBST washings. Optical densities were measured at 450 nm/620 nm on a PR3100 reader following a 30 min incubation.
[0213] 1. 1.7 nAb Detection
[0214] Serial dilutions of plasma were assessed for nAbs via an inhibition assay which uses Human Embryonic Kidney (HEK) 293-T cells transduced to express stably human ACE2, and safe, non-replicative S.sub.CoV-2 pseudo-typed LV particles which harbor the reporter luciferase firefly gene, allowing quantitation of the host cell invasion by mimicking fusion step of native SARS-CoV-2 virus (Sterlin et al.). First, 1.5×10.sup.2 TU of S.sub.CoV-2 pseudo-typed LV were pre-incubated, during 30 min at room temperature, in U-bottom plates, with serial dilutions of each serum in a final volume of 50 μl in DMEM, completed with 10% heat-inactivated FCS and 100 U/ml penicillin and 100 μg/ml streptomycin. The samples were then transferred into clear-flat-bottom 96-well-black-plates, and each well received 2×10.sup.4 hACE2.sup.+ HEK293-T cells contained in 50 μl. After 2 days incubation at 37° C. 5% CO.sub.2, the transduction efficiency of hACE2.sup.+ HEK293-T cells by pseudo-typed LV particles was determined by measuring the luciferase activity, using the Luciferase Assay System Kit with Reporter Lysis Buffer (Promega). To do so, the supernatants were completely removed from the culture wells, 40 μl of Reporter Lysis Buffer 1× and 50 μl of Luciferase Assay Reagent (Luciferase FireFly) were sequentially added to each culture well. The bioluminescent signal was quantified using an LB 960 plate reader (Berthold).
[0215] 1. 1.8 SFS T-Cell Epitope Mapping
[0216] In order to map the immuno-dominant epitopes, peptides spanning the whole spike protein were pooled in ten pools, each containing 15 amino-acid residues overlapping by ten amino acids. Synthetic peptides were purchased from Mimotopes (Australia). IFN-g ELISpot assay was performed as previously described (Dion et al, 2013). These different sets of pooled peptides were used in a matrix assay to map by ICS the epitope responses induced by each construct. Peptides were dissolved in DMSO at a concentration of 2 mg/ml and diluted before use at 1 μg/ml and 2-5 μg/mL with culture medium before their use in ELISpot and ICS assays, respectively. Responses in ELISpot were considered positive if the median number of spot-forming cells in triplicate wells was at least twice that observed in control wells and at least 50 spot-forming cells per million splenocytes were detected after subtraction of the background.
[0217] 1. 1.9 Generation of Ad5 Gene Transfer Vectors and Intranasal Pretreatment of Mice
[0218] The Ad5 gene transfer vectors were produced by use of ViraPower Adenoviral Promoterless Gateway Expression Kit (Thermo Fisher Scientific, France). The pCMV-BamH1-Xho1-WPRE sequence was PCR amplified from the pTRIPΔU3CMV plasmid, by use of: (i) forward primer, encoding the attB1 in the 5′ end, and (ii) reverse primer, encoding both the attB2 and SV40 polyA signal sequence in the 5′ end. The attb-PCR product was cloned into the gateway pDORN207 donor vector, via BP Clonase reaction, to form the pDORN207-CMV-BamH1-Xho1-WPRE-SV40 polyA. The hACE2 was amplified from a plasmid derivative of hACE2-expressing pcDNA3.11 (generous gift from Nicolas Escriou) while egfp was amplified from pTRIP-ieCMV-eGFP-WPRE2. The amplified PCR products were cloned into the pDORN207-CMV-BamH1-Xho1-WPRE-SV40 polyA plasmid via the BamH1 and Xho1 restriction sites. To obtain the final Ad5 plasmid, the pDORN207 vector, harboring hACE2 or gfp genes, was further inserted into pAd/PL-DEST™ vector via LR Clonase reaction.
[0219] The Ad5 virions were generated by transfecting the E3-transcomplementing HEK-293A cell line with pAd CMV-GFP-WPRE-SV40 polyA or pAd CMV-hACE2-WPRE-SV40 polyA plasmid followed by subsequent vector amplification, according to the manufacturer's protocol (ViraPower Adenoviral Promoterless Gateway Expression Kit, Thermo Fisher Scientific). The Ad5 particles were purified using Adeno-X rapid Maxi purification kit and concentrated with the Amicon Ultra-4 10k centrifugal filter unit. Vectors were resuspended and stocked à −80° C. in PIPES buffer pH 7.5, supplemented with 2.5% glucose. Ad5 were titrated using qRT-PCR protocol, as described by Gallaher et al.sup.3, adapted to HEK-293T cells.
[0220] Four days before the challenge, mice were instilled i.n. with 2.4×10.sup.9 IGU of Ad5::hACE2, Ad5::GFP or control empty vector resuspended in 15 μl of PBS, under general anesthesia, obtained by i.p. injection of a mixture of Ketamine (Imalgene, 100 mg/kg) and Xylazine (Rompun, 10 mg/kg).
[0221] 1. 1.10 Western Blot
[0222] Expression of hACE2 in the lungs of Ad5::hACE2-transduced mice was assessed by Western Blotting. One ×10.sup.6 cells from lung homogenate were resolved on 4-12% NuPAGE Bis-Tris protein gels (Thermo Fisher Scientific, France), then transferred onto a nitrocellulose membrane (Biorad, France). The nitrocellulose membrane was blocked in 5% non-fat milk in 0.5% Tween PBS (PBS-T) for 2 hours at room temperature and probed overnight with goat anti-hACE2 primary Ab at 1 μg/mL (AF933, R&D systems). Following three washing intervals of 10 minutes with PBS-T, the membrane was incubated for 1 hour at room temperature with HRP-conjugated anti-goat secondary Ab and HRP-conjugated anti-β-actin (ab197277, Abcam). The membrane was washed with PBS-T thrice before visualization with enhanced chemiluminescence via the super signal west femto maximum sensitivity substrate (ThermoFisher, France) on ChemiDoc XRS+ (Biorad, France). PageRuler Plus prestained protein ladder was used as size reference.
[0223] 1. 1.11 Determination of SARS-CoV-2 Viral Loads in the Lungs
[0224] Half of each lung lobes were removed aseptically and were frozen at −80° C. Organs were thawed and homogenized twice for 20 s at 4.0 m/s, using lysing matrix D (MP Biomedical) in 500 μl of ice-cold PBS. The homogenization was performed in an MP Biomedical Fastprep 24 Tissue Homogenizer. Particulate viral RNA was extracted from 70 μl of lung homogenate using QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's procedure. Viral load was determined following reverse transcription and real-time TaqMan® PCR essentially as described by Corman et al. (Corman et al., 2020) using SuperScript™ II Platinum One-Step Quantitative RT-PCR System (Invitrogen) and primers and probe (Eurofins) targeting SARS-CoV-2 envelope (E) gene as listed in (Table 1). In vitro transcribed RNA derived from plasmid pCI/SARS-CoV E was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega), then purified by phenol/chloroform extractions and two successive precipitations with ethanol. RNA concentration was determined by optical density measurement, then RNA was diluted to 10 genome equivalents/μL in RNAse-free water containing 100 μg/mL tRNA carrier, and stored in single-use aliquots at −80° C. Serial dilutions of this in vitro transcribed RNA were prepared in RNAse-free water containing 10 μg/ml tRNA carrier and used to establish a standard curve in each assay. Thermal cycling conditions were: (i) reverse transcription at 55° C. for 10 min, (ii) enzyme inactivation at 95° C. for 3 min, and (iii) 45 cycles of denaturation/amplification at 95° C. for 15 s, 58° C. for 30 s. Products were analyzed on an ABI 7500 Fast real-time PCR system (Applied Biosystems).
[0225] 1. 1.12 Cytometric Analysis of Lung Innate Immune Cells
[0226] Lungs from individual mice were treated with collagenase-DNAse-I for 30-minute incubation at 370 C and homogenized by use of GentleMacs. Cells were and filtered through 100 μm-pore filters and centrifuged at 1200 rpm during 8 minutes. Cells were then treated with Red Blood Cell Lysing Buffer (Sigma), washed twice in PBS. Cells were then stained as following. (i) To detect DC, monocytes, alveolar and interstitial macrophages: Near IR Live/Dead (Invitrogen), FcγII/III receptor blocking anti-CD16/CD32 (BD Biosciences), BV605-anti-CD45 (BD Biosciences), PE-anti-CD11b (eBioscience), PE-Cy7-antiCD11c (eBioscience), BV450-anti-CD64 (BD Biosciences), FITC-anti-CD24 (BD Biosciences), BV711-anti-CD103 (BioLegend), AF700-anti-MHC-II (BioLegend), PerCP-Cy5.5-anti-Ly6C (eBioscience) and APC anti-Ly-6G (Miltenyi) mAbs, (ii) to detect neutrophils or eosinophils: Near IR DL (Invitrogen), FcγII/III receptor blocking anti-CD16/CD32 (BD Biosciences), PerCP-Vio700-anti-CD45 (Miltenyi), APC-anti-CD11 b (BD Biosciences), PE-Cy7-anti-CD11c (eBioscience), FITC-anti-CD24 (BD Biosciences), AF700-anti-MHC-II (BioLegend), PE-anti-Ly6G (BioLegend), BV421-anti-Siglec-F (BD Biosciences), (iii) to detect mast cells, basophils, NK: Near IR DL (Invitrogen), BV605-anti-CD45 (BD Biosciences), PE-anti-CD11b (eBioscience), eF450-anti-CD11c (eBioscience), PE-Cy7-anti-CD117 (BD Biosciences), APC-anti-FcER1 (BioLegend), AF700-anti-NKp46 (BD Biosciences), FITC-anti-CCR3 (BioLegend), without FcγII/III receptor blocking anti-CD16/CD32. Cells were incubated with appropriate mixtures for 25 minutes at 4° C. Cells were then washed twice in PBS containing 3% FCS and then fixed PFA 4% and overnight incubation at 4° C. The cells were acquired in an Attune NxT cytometer system (Invitrogen) and data were analyzed by FlowJo software (Treestar, OR, USA).
[0227] 1.1.13 qRT-PCR Detection of Inflammatory Cytokines and Chemokines in the Lungs
[0228] Lung samples were added to lysing matrix D (MP Biomedical) containing 1 mL of TRIzol reagent and homogenized during 30 seconds at 6.0 m/s, twice using MP Biomedical Fastprep 24 Tissue Homogenizer. Total RNA was extracted using TRIzol reagent (ThermoFisher Scientific, France), according to the manufacturer's procedure. cDNA was synthesized from 4 μg of RNA in the presence of 2.5 μM of oligo(dT) 18 primers (SEQ ID NO: 105), 0.5 mM of deoxyribonucleotides, 2.0 U of RNase Inhibitor and SuperScript IV Reverse Transcriptase (ThermoFisher Scientific, France) in 20 μl reaction. The real-time PCR was performed on QuantStudio™ 7 Flex Real-Time PCR System (ThermoFisher Scientific, France). Reactions were performed in triplicates in a final reaction volume of 10 μl containing 5 μl of iQ™ SYBR® Green Supermix (Biorad, France), 4 μl of cDNA diluted 1:15 in DEPC-water and 0.5 μl of each forward and reverse primers at a final concentration of 0.5 μM (Table 2). The following thermal profile was used: a single cycle of polymerase activation for 3 min at 95° C., followed by 40 amplification cycles of 15 sec at 95° C. and 30 sec 60° C. (annealing-extension step). The average CT values were calculated from the technical replicates for relative quantification of target cytokines/chemokines. The differences in the CT cytokines/chemokines amplicons and the CT of the reference β-globin, termed ACT, were calculated to normalized for differences in the quantity of nucleic acid. The ACT of experimental condition were compared relatively to the PBS-treated mice using the comparative ΔΔCT method. The fold change in gene expression was further calculated using 2-ΔΔCT.
Example 1.2: Induction of Antibody Responses by LV Coding SARS-CoV-2 Spike Protein Variants
[0229] To develop a vaccine candidate able to induce nAbs specific to S.sub.CoV-2, we generated LV encoding, under the transcriptional control of the cytomegalovirus (CMV) immediate-early promoter, for codon-optimized sequences of: (i) full-length, membrane anchored form of S (LV::S.sub.FL), (ii) S1-S2 ecto-domain, without the transmembrane and C-terminal short internal tail (LV::S1-S2), or (iii) S1 alone (LV::S1), which all harbor the RBD (
[0230] Sera were then evaluated for their capacity to neutralize SARS-CoV-2, using a reliable neutralization assay based on nAb-mediated inhibition of hACE2.sup.+ cell invasion by non-replicative LV particle surrogates, pseudo-typed with S.sub.CoV-2 (Sterlin et al.). Such S.sub.CoV-2 pseudo-typed LV particles, harbor the reporter luciferase gene, which allows quantitation of the hACE2.sup.+ host cell invasion, inversely proportional to the neutralization efficiency of nAbs possibly contained in the biological fluids. Analysis of 50% Effective Concentrations (EC50) of the sera from the LV::S.sub.FL-, LV::S1-S2- or LV::S1-immunized mice clearly established that LV::S.sub.FL was the most potent vector at inducing S.sub.CoV-2-specific nAbs (
[0231] In order to potentially increase the immunogenicity of LV::S vectors at inducing neutralizing Abs, we generated LV vectors coding for stabilized pre-fusion S.sub.CoV-2, engineered as follows:
[0232] (i) S.sub.CoV-2 with prospective increased stability, harboring two 986K.fwdarw.P and 987V.fwdarw.P consecutive a.a. substitution. It is indeed established that the a.a substitution toward the rigid proline residue increases the protein stability by decreasing the conformational entropy.
[0233] (ii) S.sub.CoV-2 with the 681 PRRARS686 (SEQ ID NO: 22).fwdarw.681PGSAGS686 (SEQ ID NO: 23) a.a. substitution at the furin cleavage site, thereby unrecognizable by this proteolytic enzyme.
[0234] (iii) S.sub.CoV-2 harboring the 986K.fwdarw.P and 987V.fwdarw.P consecutive a.a. substitutions, and deleted for the 675 .sup.QTQTNSPRRAR 685 (SEQ ID NO: 24), encompassing the furin cleavage site.
[0235]
[0236] The nucleotide sequence of pFlap-ieCMV-SFL-WPREm is shown in
[0237]
[0238] The nucleotide sequence of pFlap-ieCMV-S2P-WPREm is shown in
[0239]
[0240] The nucleotide sequence of pFlap-ieCMV-S2P3F-WPREm is shown in
[0241]
[0242] The nucleotide sequence of pFlap-ieCMV-S2PdeltaF-WPREm is shown in
[0243] The COLLECTION NATIONALE DE CULTURES DE MICROORGANISMS (CNCM) has the status of International Depositary Authority under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The CNCM is located at Institut Pasteur, 25-28 rue du Docteur Roux, 75724 Paris Cedex 15 FRANCE.
[0244] The following materials were deposited on Jul. 15, 2020: pFlap-ieCMV-S2PdeltaF-WPREm (CNCM I-5537), pFlap-ieCMV-S2P3F-WPREm (CNCM I-5538), pFlap-ieCMV-S2P-WPREm (CNCM I-5539), and pFlap-ieCMV-SFL-WPREm (CNCM I-5540). Deposit receipts are filed herewith.
[0245] The following materials were deposited on Jul. 6, 2021 at the CNCM: pFlap-ieCMV-S-B1.1.7-WPREm (CNCM I-5708), pFlap-ieCMV-S-B351-WPREm (CNCM I-5709), pFlap-ieCMV-S-B351-2P-WPREm (CNCM I-5710), pFlap-ieCMV-SFL-D614G-WPREm (CNCM I-5711), pFlap-ieCMV-S-P1-WPREm (CNCM I-5712). Deposit receipts are filed herewith.
[0246] LV::S.sub.FL-immunized C57BL/6 mice (n=3) also displayed strong anti-S.sub.CoV-2 T-cell responses, as detected at week 2 post immunization by IFNγ ELISPOT-based epitope mapping, applied to splenocytes stimulated with distinct pools of 15-mer peptides spanning the full-length S.sub.CoV-2 (
Example 1.3: Set Up of a Murine Model Expressing Human ACE2 in the Respiratory Tracts, Using an Ad5 Gene Delivery Vector
[0247] As S.sub.CoV-2 does not interact efficaciously with murine ACE2, wild-type laboratory mice are not permissive to replication of SARS-CoV-2 clinical isolates. Due to unavailability of hACE2 transgenic mice in Europe during the progression of the present study, to evaluate the LV::S.sub.FL vaccine efficacy, we sought to elaborate a murine model in which the hACE2 expression is induced in the respiratory tracts and pulmonary mucosa. To do so, we generated an Ad5 gene delivery vector able to vehicle in non-integrating episomes, the gene coding for hACE2 under the transcriptional control of CMV promoter (Ad5::hACE2). We first checked in vitro the potential of the Ad5::hACE2 vector to transduce HEK293T cells by RT-PCR (
[0248] To evaluate the permissibility of such hACE2-transduced mice to SARS-CoV-2 infection, 4 days after i.n. pretreatment with either Ad5::hACE2 or an empty control Ad5 vector, C57BL/6 mice were inoculated i.n. with 1×10.sup.5 TCID.sub.50 of a SARS-CoV-2 clinical isolate, which was isolated in February 2020 from a COVID-19 patient by the National Reference Centre for Respiratory Viruses (Institut Pasteur, France). The lung viral loads, determined at 2 days post inoculation (dpi), were as high as (4.4±1.8)×109 copies of SARS-CoV-2 RNA/mouse in Ad5::hACE2-pretreated mice, compared to only (6.2±0.5)×10.sup.5 copies/mouse in empty Ad5-pretreated, or (4.0±2.9)×105 copies/mouse in un-pretreated mice (
[0249] Ad5::hACE-2 i.n. instillation induced CD45.sup.+ cell recruitment to the lungs, however, this effect was reduced with decreasing vector doses, as determined at day 4 post instillation. The dose of 4×10.sup.8 IGU/mouse did not cause CD45.sup.+ cell recruitment, as compared to the PBS-treated controls (
Example 1.4: Evaluation of the Protective Potential of LV::SFL Against SARS-CoV-2 in Mice
[0250] To investigate the prophylactic potential of LV::S.sub.FL against SARS-CoV-2, C57BL/6 mice (n=4/group) were injected i.p. with a single dose of 1×10.sup.7 TU/mouse of LV::S.sub.FL or a negative control LV (sham). At week 6 post immunization, the mice were pretreated with Ad5::hACE2, and 4 days later, they were inoculated i.n. with 1×10.sup.5 TCID.sub.50 of SARS-CoV-2 (
[0251] To further improve the prophylactic effect, we evaluated the prime-boost or prime-target approaches. C57BL/6 mice (n=4-5/group) were primed i.p. with 1×10.sup.7 TU of LV::S.sub.FL or a control LV at week 0, and then boosted at week 3 with: (i) 1×10.sup.7 TU of the same LV via the i.p. route (“LV::S.sub.FL i.p.-i.p.”, prime-boost), or (ii) with 3×10.sup.7 TU via the i.n. route (“LV::S.sub.FL i.p.-i.n.”, prime-target) to attract the mediators of systemic immunity to the lung mucosa (
[0252] All mice were then pretreated with Ad5::hACE2 and challenged i.n. with 0.3×10.sup.5 TCID.sub.50 of SARS-CoV-2 at week 4 post prime. At 3 dpi, the lung viral loads were significantly lower in LV::S.sub.FL i.p.-i.p. immunized mice, i.e., mean±SD (2.3±3.2)×10.sup.8, than in sham-vaccinated mice (13.7±7.5)×10.sup.8 copies of SARS-CoV-2 RNA, (
[0253] Based on the compelling evidences of innate immune hyperactivity in the acute lung injury in COVID-19 (Vabret et al., 2020), we investigated the possible variations of the lung innate immune cell subsets (
Example 1.5: Evaluation of the Protective Potential of LV::S.SUB.FL .Against SARS-CoV-2 in Golden Hamsters
[0254] Outbred Mesocricetus auratus, so-called golden hamsters, provide a suitable pre-clinical model to study the COVID-19 pathology, as the ACE2 ortholog of this species interacts efficaciously with S.sub.CoV-2, whereby host cell invasion and viral replication (Sia et al., 2020). We thus investigated the prophylactic effect of LV::S.sub.FL vaccination on SARS-CoV-2 infection in this pertinent model. Although integrative LV vectors are largely safe and passed successfully a phase 1 clinical trial (2011-006260-52 EN), in addition to the integrative LV::S.sub.FL, we also evaluated an integrase deficient, non-integrative version of LV::S.sub.FL with the prospect of application un future clinical trials.
[0255] To assess the prophylactic effect of vaccination following prime-boost/target regimen, M. auratus hamsters (n=6/group) were: (i) primed i.p. with the low dose of 1×10.sup.6 TU of integrative LV::S.sub.FL and boosted i.n. at week 4 with 3×10.sup.7 TU of integrative LV::S.sub.FL, (“int LV::S.sub.FL i.p.-i.n. Low”), (ii) primed i.p. with the high dose of 1×10.sup.7 TU of integrative LV::S.sub.FL and boosted i.n. at week 4 with 3×10.sup.7 TU of integrative LV::S.sub.FL (“int LV::S.sub.FL i.p.-i.n. High”), or (iii) primed intramuscularly (i.m.) with 1×10.sup.8 TU of non-integrative LV::S.sub.FL and boosted i.n. at week 4 with 3×10.sup.7 TU of non-integrative LV::S.sub.FL (“non int LV::S.sub.FL i.m.-i.n.”) (
[0256] In an additional experiment (
[0257] Sterilizing protection in hamster model by a single i.n. NILV::S.sub.ΔF2P administration We generated LV encoding a prefusion form of S.sub.CoV-2 under transcriptional control of the cytomegalovirus promoter. This prefusion S.sub.CoV-2 variant (S.sub.ΔF2P) has a deletion of 675.sup.QTQTNSPRRAR685 (SEQ ID NO: 24) sequence, encompassing the polybasic RRAR (SEQ ID NO: 99) furin cleavage site, at the boundary of S1/S2 subunits, and harbors K.sup.986P and V.sup.987P consecutive proline substitutions in S2, within the hinge loop between heptad repeat 1 and the central helix (
[0258] We also assessed the prophylactic effect of vaccination with only a single i.n. administration of NILV::S.sub.ΔF2P in the hamster model.
[0259] Hamsters (n=6/group) were: (i) primed i.m. at wk 0 with 1×10.sup.8 TU of NILV::S.sub.ΔF2P and boosted i.n. at wk 5 with the same amount of the vector, as a positive protection control, (ii) immunized i.n. with a single injection of 1×10.sup.8 TU of NILV::S.sub.ΔF2P at wk 0, or (iii) at wk 5 (
[0260] At wk 7, all animals were challenged i.n. with 0.3×10.sup.5 TCID.sub.50 of a SARS-CoV-2. At 4 days post inoculation (dpi), only 2-3% weight loss was detected in the NILV::S.sub.ΔF2P-vaccinated groups, compared to 12% in sham-vaccinated hamsters (
[0261] At 4 dpi, as evaluated by qRT-PCR in total lung homogenates, substantially decreased inflammation was detected in NILV::S.sub.ΔF2P-vaccinated hamsters compared to their sham-vaccinated counterparts, regardless of the immunization regimen, i.e., i.m.-i.n. prime-boost or single i.n. injection given at wk 0 or 5 (
[0262] These data collectively indicated that a single i.n. administration of NILV::S.sub.ΔF2P was as protective as a systemic prime and i.n. boost regimen, conferred sterilizing pulmonary immunity against SARS-CoV-2 and readily prevented lung inflammation and pathogenic tissue injury in the susceptible hamster model.
[0263] Altogether, based on a complete set of virological, immunological and expected histopathological data (the latter in progress), the LV::S.sub.FL vector elicits S.sub.CoV-2-specific nAbs and T-cell responses, correlative with substantial level of protection against SARS-CoV-2 infection in two pertinent animal models, and notably upon mucosal i.n. administration.
Example 1.6: Discussion
[0264] Prophylactic strategies are necessary to control SARS-CoV-2 infection which, 6 months into the pandemic, still continue to spread exponentially without sign of slowing down. It is now demonstrated that primary infection with SARS-CoV-2 in rhesus macaques leads to protective immunity against re-exposure (Chandrashekar et al., 2020). Numerous vaccine candidates, based on naked DNA (Yu et al., 2020) or mRNA, recombinant protein, replicating or non-replicating viral vectors, including adenoviral Ad5 vector (Zhu et al., 2020), or alum-adjuvanted inactivated virus (Gao et al., 2020) are under active development for COVID-19 prevention. Our immunologic rationale for selecting LV vector to deliver gene encoding S.sub.CoV-2 antigen is based on the insights obtained on the efficacy of heterologous gene expression in situ, as well as the longevity and composite nature of humoral and cell-mediated immunity elicited by this immunization platform. Unique to LV is the ability to transduce proliferating and resting cells (Esslinger et al., 2002; He et al., 2005), thereby LV serves as a powerful vaccination strategy (Beignon et al., 2009; Buffa et al., 2006; Coutant et al., 2012; Gallinaro et al., 2018; Iglesias et al., 2006) to provokes strong and long-lasting adaptive responses. Notably, in net contrast to many other viral vectors, LV vectors do not suffer from pre-existing immunity in populations, which is linked to their pseudo-typing with the glycoprotein envelop from Vesicular Stomatitis Virus, in which humans are barely exposed. We recently demonstrated that a single injection of a LV expressing Zika envelop provides a rapid and durable protection against Zika infection (Ku et al., 2020). Our recent comprehensive systematic comparison of LV to the gold standard Ad5 immunization vector also documented the superior ability of LV to induce multifunctional and central memory T cells in the mouse model, and stronger immunogenicity in outbred rats (Ku et al., 2021 (PMID: 33357418), underlining the largely adapted properties of LV for vaccinal applications.
[0265] We evaluated the efficacy of LV each encoding one of the variants of S, i.e., full-length, membrane anchored (LV::S.sub.FL), S1-S2 ecto-domain, devoid of the transmembrane and C-terminal short internal tail (LV::S1-S2), or S1 alone (LV::S1). Even though a single administration of each of these LV was able to induce high anti-S.sub.CoV-2 Ab titers, only LV::S.sub.FL was able to induce highly functional nAbs. Such single-injection of LV-based vaccine induced a neutralizing activity, which on average was comparable to those found in a cohort of SARS-CoV-2 patients manifesting mild symptoms. This finding predicted a protective potential of the humoral responses induced by the LV::S.sub.FL vector. In parallel, S-specific CD4+ and CD8.sup.+ T-cell responses were also observed in the spleen of mice as early as 2 weeks after a single LV::S.sub.FL injection, as detectable against numerous MHC-I- or -II-restricted immunogenic regions that we identified in C57BL/6 (H-2.sup.b) mice.
[0266] Linked to the absence of permissibility of laboratory mice to SARS-CoV-2 replication and the current unavailability of hACE2 transgenic mice in Europe, we set up an in vivo-infection murine model in which the hACE2 expression is induced in the respiratory tracts by an i.n. Ad5::hACE2 pretreatment prior to SARS-CoV-2 inoculation. This approach renders mice largely permissive to SARS-CoV-2 replication in the lungs and allows assessment of vaccine or drug efficacy against this virus. This method has also been successfully used to establish the expression of human DPP4 for the study of mouse infection with MERS-CoV (Zhao et al., 2014). Even though the Ad5::hACE2 model may not fully mimic the physiological ACE2 expression profile and thus may not reflect all the aspects of the pathophysiology of SARS-CoV-2 infection, it provides a pertinent model to evaluate in vivo the effects of anti-viral drugs, vaccine candidates, various mutations or genetic backgrounds on the SARS-CoV-2 replication. By using a low dose of Ad5::hACE2/mouse, no particular CD45.sup.+ cell recruitments were detectable at day 4 post instillation, indicative of an absence of Ad5-related inflammation before the inoculation of SARS-CoV-2.
[0267] In the transduced mouse model which allows high rate of SARS-CoV-2 replication, vaccination by a single i.p. administration of 1×10.sup.7 TU of LV::S.sub.FL, 6 weeks before the virus inoculation, was sufficient to inhibit the viral replication by ˜1 log.sub.10. Further boosting via the systemic route did not afford improved protection rate when compared to a single administration. However, priming by systemic route and boosting via mucosal route efficiently inhibited viral replication and avoided lung inflammation. Such protection was correlated with high titers of anti-S.sub.CoV-2 IgG and a strong neutralization activity in sera. S-specific T-cell responses were also detected in the spleen of LV::S.sub.FL-immunized mice, as assessed by ELISPOT followed by stimulation of splenocytes with pools of overlapping 15-mer peptides. Much longer termed experiments in appropriate KO mice or adoptive immune cell transfer approaches are necessary to identify the immunological pathways that contribute to disease severity or protection against SARS-CoV-2. Both nAbs and cell-mediated immunity, together very efficaciously induced with the LV-based vaccine candidate, synergize to inhibit infection and viral replication.
[0268] Substantial degrees of protection against SARS-CoV-2 infection, accompanied by drastic reduction in mucosal inflammation and lung tissue damage, were observed in Mesocricetus auratus Golden hamsters immunized following prime-boost/target regimen with either integrative or non-integrative LV::S.sub.FL. Confirmation of the protection results in this highly sensitive species further favors the LV::S.sub.FL vaccine candidate, especially under its non-integrative variant, for future introduction into clinical trials.
[0269] Ab-Dependent Enhancement (ADE) of coronavirus entry to the host cells has been evoked as a mechanism which could be an obstacle in vaccination against coronaviruses. With DNA (Yu et al., 2020) or inactivated SARS-CoV-2 virus (Gao et al., 2020) vaccination in macaques, no immunopathological exacerbation has been observed but could not be excluded. Long term observation even after decrement in Ab titer could be necessary to exclude such hypothesis. In the case of MERS-CoV, it has been reported that one particular RBD-specific neutralizing monoclonal Ab (Mersmab1), by mimicking the viral receptor human DPP4 and inducing conformational rearrangements of S.sub.MERS, can mediate in vitro ADE of MERS-CoV into the host cells (Wan et al., 2020). We believe that it is difficult to compare the polyclonal Ab response with its paratope repertoire complexity with the singular properties of a monoclonal Ab which cannot be representative of the polyclonal response induced by a vaccine. In addition, very contradictory results from the same team reported that a single-dose treatment with a humanized version of Mersmab1 afforded complete protection of a human transgenic mouse model from lethal MERS challenge (Qiu et al., 2016). Therefore, even with an Ab which could facilitate the cell host invasion in vitro in some conditions, not only there is no exacerbation of the infection in vivo, but also there is a notable protection. Indeed, to affirm that Abs could cause ADE in vivo, it is necessary, by large scale B-cell fusions, until they have made to estimate the probability of generation of such Ab.
[0270] Prophylactic vaccination is the most cost-effective and efficient strategy against infectious diseases and notably against emerging coronaviruses in particular. Our results provide strong evidences that the LV vector coding for SFS protein of SARS-CoV-2 used via the mucosal route of vaccination represent a promising vaccine candidate against COVID-19.
TABLE-US-00004 TABLE 1 Sequences of primers and probes for SARS-COV-2 viral load determination. Primer/Probe Name and SEQ ID No. DNA Sequences ″E-Sarbeco″ Fw-ID No. 34 5′-ACAGGTACGTTAATAGTTAATAGCGT-3′ ″E-Sarbeco″ Rv-ID No. 35 5′-ATATTGCAGCAGTACGCACACA-3′ ″E-Sarbeco″ Probe-ID 5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ-1-3′ No. 36
TABLE-US-00005 TABLE 2 Sequences of primers used to quantitate mouse cytokines and chemokines by qRT-PCR Gene and SEQ ID No. Sequences β-globin-ID No. 37 F: 5′-ATGGGAAGCCGAACATACTG-3′ -ID No. 38 R: 5′-CAGTCTCAGTGGGGGTGAAT-3′ GAPDH-ID No. 39 F: 5′-TTCACCACCATGGAGAAGGC-3′ -ID No. 40 R: 5′-GGCATGGACTGTGGTCATGA-3′ IFNα-ID No. 41 F: 5′-GGATGTGACCTTCCTCAGACTC-3′ -ID No. 42 R: 5′-ACCTTCTCCTGCGGGAATCCAA-3′ IFNγ-ID No. 43 F: 5′-TCAAGTGGCATAGATGTGGAAGAA-3′ -ID No. 44 R: 5′-TGGCTCTGCAGGATTTTCATG-3′ TNFα-ID No. 45 F: 5′-CATCTTCTCAAAATTCGAGTGACAA-3′ -ID No. 46 R: 5′-TGGGAGTAGACAAGGTACAACCC-3′ TGFβ-ID No. 47 F: 5′-TGACGTCACTGGAGTTGTACGG-3′ -ID No.48 R: 5′-GGTTCATGTCATGGATGGTGC-3′ IL1ß-ID No. 49 F: 5′-TGGACCTTCCAGGATGAGGACA-3′ -ID No.50 R: 5′-GTTCATCTCGGAGCCTGTAGTG-3′ IL2-ID No. 51 F: 5′-CCTGAGCAGGATGGAGAATTACA-3′ -ID No. 52 R: 5′-TCCAGAACATGCCGCAGAG-3′ IL4-ID No. 53 F: 5′-CGAGGTCACAGGAGAAGGGA-3′ -ID No. 54 R: 5′-AAGCCCTACAGACGAGCTCACT-3′ IL5-ID No. 55 F: 5′-GATGAGGCTTCCTGTCCCTACT-3′ -ID No. 56 R: 5′-TGACAGGTTTTGGAATAGCATTTCC-3′ IL6-ID No. 57 F: 5′-CTGCAAGTGCATCATCGTTGTTC-3′ -ID No. 58 R: 5′-TACCACTTCACAAGTCGGAGGC-3′ IL10-ID No. 59 F: 5′-GGTTGCCAAGCCTTATCGGA-3′ -ID No.. 60 R: 5′-ACCTGCTCCACTGCCTTGCT-3′ IL12p40-ID No. 61 F: 5′-GGAAGCACGGCAGCAGAATA-3′ -ID No. 62 R: 5′-AACTTGAGGGAGAAGTAGGAATGG-3′ IL17A-ID No. 63 F: 5′-GAAGCTCAGTGCCGCCA-3′ -ID No. 64 R: 5′-TTCATGTGGTGGTCCAGCTTT-3′ IL18-ID No. 65 F: 5′-GACAGCCTGTGTTCGAGGATATG-3′ -ID No. 66 R: 5′-TGTTCTTACAGGAGAGGGTAGAC-3′ IL33-ID No. 67 F: 5′-CTACTGCATGAGACTCCGTTCTG-3′ -ID No. 68 R: 5′-AGAATCCCGTGGATAGGCAGAG-3′ CCL2-ID No. 69 F: 5′-AGGTCCCTGTCATGCTTCTG-3′ -ID No. 70 R: 5′-TCTGGACCCATTCCTTCTTG-3′ CCL3-ID No. 71 F: 5′-CCTCTGTCACCTGCTCAACA-3′ -ID No. 72 R: 5′-GATGAATTGGCGTGGAATCT-3′ CCL5-ID No. 73 F: 5′-GTGCCCACGTCAAGGAGTAT-3′ -ID No. 74 R: 5′-GGGAAGCGTATACAGGGTCA-3′ CXCL5-ID No. 75 F: 5′-GCATTTCTGTTGCTGTTCACGCTG-3′ -ID No. 76 R: 5′-CCTCCTTCTGGTTTTTCAGTTTAGC-3′ CXCL9-ID No. 77 F: 5′-AAAATTTCATCACGCCCTTG-3′ -ID No. 78 R: 5′-TCTCCAGCTTGGTGAGGTCT-3′ CXCL10-ID No. 79 F: 5′-GGATGGCTGTCCTAGCTCTG-3′ -ID No. 80 R: 5′-ATAACCCCTTGG GAAGATGG-3′
Example 2: Generation of a Transgenic Mice Harboring the Human ACE2 Gene
[0271] To date several Transgenic (Tg) mice of different strains expressing the hACE2 gene under distinct transcription and expression control sequences have been provided, some of them originating from developments performed to fulfil needs that arose when on emergence of SARS-CoV epidemic in 2003. These earlier developed Tg mice and further models have been assessed for the study and understanding of the pathogenesis of SARS-CoV and have shown to be permissible to viral replication and sometimes to some degree of disease symptom or clinical illness but the observed various clinical profiles in Tg mice inoculated with SARS-CoV-2 have not yet provided proved suitable to reproduce all aspects of the outcome of the infection, in particular have not adequately shown virus spread as observed in human patients, in particular spread beyond the airways and the pulmonary tract, such as spread to the brain. Also the available Tg mice have not shown all the consistent disease symptoms that would reproduce the symptoms observed in human patients.
[0272] A B6.K18-ACE2.sup.2PrImn/JAX mouse strain has been previously deposited at JAX Laboratories (Jackson Laboratories, Bar Harbor, Me.). However, the new B6.K18-hACE2.sup.IP-THV transgenic mice that the inventors generated according to the present invention display distinctive characteristics identified following SARS-CoV-2 intranasal (i.n.) inoculation. In fact, in addition to the large permissibility of their lungs to SARS-CoV-2 replication and viral dissemination to peripheral organs, B6.K18-hACE2.sup.IP-THV mice surprisingly allow substantial viral replication in the brain, which is ≈4 log.sub.10 higher than the replication range observed in the previously available B6.K18-ACE2.sup.2PrImn/JAX strain (McCray et al., 2007). This new mouse model, not only has broad applications in the study of COVID-19 vaccine or COVID-19 therapeutics efficacy, but also provides an experimental model to elucidate COVID-19 immune/neuro-physiopathology. Neurotropism of SARS-CoV-2 has been demonstrated and some COVID-19 human patients present symptoms like headache, confusion, anosmia, dysgeusia, nausea, and vomiting (Bourgonje et al., 2020). Olfactory transmucosal SARS-CoV-2 invasion is also very recently described as a port of central nervous system entry in human individuals with COVID-19 (https://doi.org/10.1038/s41593-020-00758-5). Since coronaviruses can infect the central nervous system (Bergmann et al., 2006), the B6.K18-hACE2.sup.IP-THV small rodent experimental model represents an invaluable pre-clinical or co-clinical animal model of major interest for: (i) investigation of immune protection of the brain and (ii) exploration of COVID-19-derived neuropathology.
[0273] 1. Construction of the Human Keratin 18 Promoter
[0274] The human K18 promoter (GenBank: AF179904.1 nucleotides 90 to 2579) was amplified by nested PCR from A549 cell lysate, as described previously (Chow et al., 1997; Koehler et al., 2000). The “i6x7” intron (GenBank: AF179904.1 nucleotides 2988 to 3740) was synthesized by Genscript. The “K18i6x7PA” promoter, previously used to generate B6.K18-ACE2.sup.2PrImn/JAX strain, includes the K18 promoter, the “i6x7” intron at 5′ and an enhancer/polyA sequence (PA) at 3′ of the hACE2 gene. The.sup.K18 IP-ThV promoter used here contains, instead of PA, the stronger wild-type Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) at 3′ of the hACE2 gene. In contrast to K18i6x7PA construct which harbors the 3′ regulatory region containing a polyA sequence, the K18.sup.IP-ThV construct takes benefice of the polyA sequence already present within the 3′ Long Terminal Repeats (LTR) of the pFLAP LV plasmid, used for transgenesis. The i6x7 intronic part was modified to introduce a consensus 5′ splicing donor and a 3′ donor site sequence. The AAGGGG (SEQ ID No.97) donor site was further modified for the AAGTGG (SEQ ID No.95) consensus site. Based on a consensus sequence logo (Dogan et al., 2007), the poly-pyrimidine tract preceding splicing acceptor site (TACAATCCCTC (SEQ ID No.82) in original sequence GenBank AF179904.1 and TTTTTTTTTTT (SEQ ID No.83) in K18.sup.JAX) was replaced by CTTTTTCCTTCC (SEQ ID No.96) to limit incompatibility with the reverse transcription step during transduction. Moreover, original splicing acceptor site CAGAT was modified to correspond to the consensus sequence CAGGT (SEQ ID No.84). As a construction facility, a ClaI restriction site was introduced between the promoter and the intron. The construct was inserted into a pFLAP plasmid between the MluI and BamHI sites. The hACE2 cDNA was introduced between the BamHI and XhoI sites by restriction/ligation. Integrative LV::K18-hACE2.sup.IP-THV was produced as described elsewhere (Sayes et al., 2018) and concentrated by two cycles of ultracentrifugation at 22,000 rpm for 1 h at 4° C.
[0275] 2. Transgenesis
[0276] High tittered (8.32×10.sup.9 TU/ml) integrative LV::K18-hACE2.sup.IP-THV was micro-injected into the pellucid area of fertilized eggs which were transplanted into pseudo-pregnant B6CBAF1 females (Charles Rivers). The NO mice were investigated for integration and copy number of hACE2 gene per genome by using hACE2-forward: 5′-TCC TAA CCA GCC CCC TGT T-3′ (SEQ ID No.85) and hACE2-reverse: 5′-TGA CAA TGC CAA CCA CTA TCA CT-3′ (SEQ ID No.86) primers in PCR applied on genomic DNA prepared from the tail biopsies. Toward stabilization of the progeny, transgene positive males were then crossed to WT C57BL/6 females (Charles Rivers). Transgene transfer by microinjection of integrative LV::K18-hACE2.sup.IP-THV into the nucleus of fertilized eggs was particularly efficient. At the NO generation, 11% of the mice obtained, i.e., 15 out of 139, had at least one copy of the transgene per genome. Eight NO males carrying the transgene were crossed with female C57BL/6 WT mice (Janvier, Le Genest Saint Isle, France). At the N1 generation, ≈62% of the mice obtained, i.e., 91 out of 147, had at least one copy of the transgene per genome. 10 N1 males carrying the transgene were further crossed with female C57BL/6 WT mice.
[0277] During the immunization period female or male transgenic mice were housed in individually-ventilated cages under specific pathogen-free conditions. Mice were transferred into individually filtered cages in isolator for SARS-CoV-2 inoculation at the Institut Pasteur animal facilities. Prior to i.n. injections, mice were anesthetized by i.p. injection of Ketamine (Imalgene, 80 mg/kg) and Xylazine (Rompun, 5 mg/kg).
[0278] 3. Genotyping and Quantitation of hACE2 Gene Copy Number/Genome in Transgenic Mice
[0279] Genomic DNA (gDNA) from transgenic mice was prepared from the tail biopsies by phenol-chloroform extraction. A 60 ng of gDNA were used as a template of qPCR with SyBr Green using specific primers listed in Table 3. Using the same template and in the similar reaction plate, mouse PKD1 (Polycystic Kidney Disease 1) and GAPDH were also quantified. All samples were run in quadruplicate in 10 μl reaction as follows: 10 in at 95° C., 40 cycles of 15 s at 95° C. and 30 sec at 60° C. To calculate the transgene copy number, the 2.sup.−ΔΔCt method was applied using the PKD1 as a calibrator and GAPDH as a endogenous control. The 2.sup.−ΔΔCt provides the fold change in copy number of the hACE2 gene relative to PKD1 gene.
TABLE-US-00006 TABLE 3 Sequences of primers used to genotype B6.K18-hACE2.sup.IP-THV transgenic mice. Primers and SEQ ID No. hACE2 Fw-SEQ ID No. 85 TCCTAACCAGCCCCCTGTT hACE2 Rv-SEQ ID No. 86 TGACAATGCCAACCA CTATCACT PKD1 Fw-SEQ ID No. 87 GGCTGCTGAGCGTCTGGTA PKD1 Rv-SEQ ID No. 88 CCAGGTCCTGCGTGTCTGA GAPDH-ACE2 Fw-SEQ ID No. 89 GCCCAGAACATCATCCCTGC GAPDH-ACE2 Rv-SEQ ID No. 90 CCGTTCAGCTCTGGGATGACC
[0280] 4. K18-hACE2.sup.IP-THV permissibility to SARS-CoV-2 replication
[0281] The permissibility of N1 mice to SARS-CoV-2 replication was evaluated in the sampled individuals from the progeny. N1 females with varying number of transgene copies per genome were sampled (
[0282] The organs recovered from the animals infected with live SARS-CoV-2 were manipulated following the approved standard operating procedures of these facilities.
[0283] At 3 days post-inoculation (dpi) the Mean±SD of lung viral loads were as high as (3.3±1.6)×10.sup.10 copies of SARS-CoV-2 RNA/mouse in the permissive mice (
[0284] 5. Comparison of B6.K18-ACE2.sup.2PrImn/JAX and K18-hACE2.sup.IP-THV Strains in Terms of Permissibility to SARS-CoV-2 Replication
[0285] We further comparatively evaluated SARS-CoV-2 replication in lungs and brain and dissemination to various organs in B6.K18-hACE2.sup.IP-THV and B6.K18-ACE2.sup.2PrImn/JAX mice (
[0286] Correlative with the brain viral loads, much higher inflammation was detected by qRT-PCR in the brain of B6.K18-hACE2.sup.IP-THV mice compared to B6.K18-ACE2.sup.2PrImn/JAX mice, at 3 dpi, showing an immunological/inflammatory symptom in the central nervous system of the former, but not in the latter (
[0287] Therefore, large permissibility to SARS-CoV-2 replication at both lung and CNS, marked brain inflammation and rapid lethal disease are major distinctive features of this new B6.K18-hACE2.sup.IP-THV transgenic model.
[0288] Ethical Approval of Animal Studies
[0289] In all Examples, experimentation on mice and hamsters was realized in accordance with the European and French guidelines (Directive 86/609/CEE and Decree 87-848 of 19 Oct. 1987) subsequent to approval by the Institut Pasteur Safety, Animal Care and Use Committee, protocol agreement delivered by local ethical committee (CETEA #DAP20007, CETEA #DAP200058) and Ministry of High Education and Research APAFIS #24627-2020031117362508 v1.
Example 3: Full CNS and Lung Prophylaxis Against SARS-CoV-2 by Intranasal Lentivector Vaccination
[0290] Here, we generated a new hACE2 transgenic mouse strain with unprecedent permissibility of the brain to SARS-CoV-2 replication. By use of this unique preclinical animal model, we demonstrated the importance of i.n. booster immunization with this LV-based vaccine candidate to reach full protection of not only lungs but also CNS against SARS-CoV-2. Our results indicate that i.n. vaccination step with non-cytopathic and non-inflammatory LV, appears to be a performant and safe strategy to elicit sterilizing immunity in the main anatomical sites affected by COVID-19.
[0291] Methods
[0292] Construction and production of LV::S.sub.ΔF2P
[0293] A codon-optimized S.sub.ΔF2P sequence (1-1262) (SEQ ID No. 14). was amplified from pMK-RQ_S-2019-nCoV and inserted into pFlap by restriction/ligation between BamHI and XhoI sites, between the native human ieCMV promoter and a mutated Woodchuck Posttranscriptional Regulatory Element (WPRE) sequence. The atg starting codon of WPRE was mutated (mWPRE) to avoid transcription of the downstream truncated “X” protein of Woodchuck Hepatitis Virus for safety concerns (
[0294] Mice
[0295] Transgenic mice were generated as disclosed in detail in Example 2.
[0296] Humoral and T-Cell Immunity, Inflammation
[0297] As recently detailed elsewhere (Ku et al., 2021), T-splenocyte responses were quantitated by IFN-g ELISPOT and anti-S IgG or IgA Abs were detected by ELISA by use of recombinant stabilized S.sub.CoV-2. NAb quantitation was performed by use of S.sub.CoV-2 pseudo-typed LV, as recently described (Anna et al., 2020; Sterlin et al., 2020). The qRT-PCR quantification of inflammatory mediators in the lungs and brain of hamsters and mice was performed in total RNA extracted by TRIzol reagent, as detailed in Example 1.
[0298] SARS-CoV-2 Inoculation
[0299] Hamsters or transgenic B6.K18-hACE2.sup.IP-THV or B6.K18-ACE2.sup.2PrImn/JAX were anesthetized by i.p. injection of mixture Ketamine and Xylazine, transferred into a biosafety cabinet 3 and inoculated i.n. with 0.3×10.sup.5 TCID.sub.50 of the BetaCoV/France/IDF0372/2020 SARS-CoV-2 clinical isolate (Lescure et al., 2020). This clinical isolate was a gift of the National Reference Centre for Respiratory Viruses hosted by Institut Pasteur (Paris, France), headed by Pr. van der Werf. The human sample from which this strain was isolated has been provided by Dr. Lescure and Pr. Yazdanpanah from the Bichat Hospital, Paris, France. The viral inoculum was contained in 20 μl for mice and in 50 μl for hamsters. Animals were housed in an isolator in BioSafety Level 3 animal facilities of Institut Pasteur. The organs recovered from the infected animals were manipulated according to the approved standard procedures of these facilities.
[0300] Determination of Viral Loads in the Organs
[0301] Organs from mice or hamsters were removed aseptically and immediately frozen at −80° C. RNA from circulating SARS-CoV-2 was prepared from lungs as recently described (Ku et al). Briefly, lung homogenates were prepared by thawing and homogenizing of the organs using lysing matrix M (MP Biomedical) in 500 μl of ice-cold PBS in an MP Biomedical Fastprep 24 Tissue Homogenizer. RNA was extracted from the supernatants of lung homogenates centrifuged during 10 min at 2000 g. Alternatively, total RNA was prepared from lungs or other organs by addition of lysing matrix D (MP Biomedical) containing 1 mL of TRIzol reagent and homogenization at 30 s at 6.0 m/s twice using MP Biomedical Fastprep 24 Tissue Homogenizer. Total RNA was extracted using TRIzol reagent (ThermoFisher). SARS-CoV-2 E gene (Corman et al., 2020) or E sub-genomic mRNA (sgmRNA) (Wolfel et al., 2020), was quantitated following reverse transcription and real-time quantitative TaqMan® PCR, using SuperScript™ Ill Platinum One-Step qRT-PCR System (Invitrogen) and specific primers and probe (Eurofins) (Table 4). The standard curve of EsgmRNA assay was performed using in vitro transcribed RNA derived from PCR fragment of “T7 SARS-CoV-2 E-sgmRNA”. The in vitro transcribed RNA was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega) and purified by phenol/chloroform extraction and two successive precipitations with isopropanol and ethanol. Concentration of RNA was determined by optical density measurement, diluted to 10.sup.9 genome equivalents/μL in RNAse-free water containing 100 μg/mL tRNA carrier, and stored at −80° C. Serial dilutions of this in vitro transcribed RNA were prepared in RNAse-free water containing 10 μg/ml tRNA carrier to build a standard curve for each assay. PCR conditions were: (i) reverse transcription at 55° C. for 10 min, (ii) enzyme inactivation at 95° C. for 3 min, and (iii) 45 cycles of denaturation/amplification at 95° C. for 15 s, 58° C. for 30 s. PCR products were analyzed on an ABI 7500 Fast real-time PCR system (Applied Biosystems).
TABLE-US-00007 TABLE 4 Sequences of primers used to quantitate SARS-COV-2 loads by qRT- PCR Primer/Probe SEQ ID No. DNA Sequence ″E-Sarbeco″ 5′-ACAGGTACGTTAATAGTTAATAGCGT-3′ Fw ID No. 91 ″E-Sarbeco″ 5′-ATATTGCAGCAGTACGCACACA-3′ Rv ID No. 92 ″E-Sarbeco″ 5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ-1-3′ ID No. 93 ″E-sgmRNA″ Fw 5′-CGATCTCTTGTAGATCTGTTCTC-3′ ID No. 94
[0302] Cytometric Analysis of Immune Lung and Brain Cells
[0303] Isolation and staining of lung innate immune cells were largely detailed in Example 1. Cervical lymph nodes, olfactory bulb and brain from each group of mice were pooled and treated with 400 U/ml type IV collagenase and DNase I (Roche) for a 30-minute incubation at 37° C. Cervical lymph nodes and olfactory bulbs were then homogenized with glass homogenizer while brains were homogenized by use of GentleMacs (Miltenyi Biotech). Cell suspensions were then filtered through 100 μm-pore filters, washed and centrifuged at 1200 rpm during 8 minutes. Cell suspensions from brain were enriched in immune cells on Percoll gradient after 25 min centrifugation at 1360 g at RT. The recovered cells from lungs were stained as recently described elsewhere (Ku et al., 2021). The recovered cells from brain were stained by appropriate mAb mixture as follows. (i) To detect innate immune cells: Near IR Live/Dead (Invitrogen), FcγII/III receptor blocking anti-CD16/CD32 (BD Biosciences), BV605-anti-CD45 (BD Biosciences), PE-anti-CD11b (eBioscience), PE-Cy7-antiCD11c (eBioscience), (ii) to detect NK, neutrophils, Ly-6C.sup.+/− monocytes and macrophages: Near IR DL (Invitrogen), FcγII/III receptor blocking anti-CD16/CD32 (BD Biosciences), BV605-anti-CD45 (BD Biosciences), PE-anti-CD11b (eBioscience), LPE-Cy7-antiCD11c (eBioscience), APC-anti-Ly6G (Miltenyi), BV711-anti-Siglec-F (BD), AF700-anti-NKp46 (BD Biosciences), FITC-anti-Ly6C (Abcam) (iii) To detect adaptive immune cells: Near IR Live/Dead (Invitrogen), FcγII/III receptor blocking anti-CD16/CD32 (BD Biosciences), APC-anti-CD45 (BD), PerCP-Cy5.5-anti-CD3 (eBioscience), FITC-anti-CD4 (BD Pharmingen), BV711-anti-CD8 (BD Horizon), BV605-anti-CD69 (Biolegend), PE-anti-CCR7 (eBioscience) and VioBlue-Anti-B220 (Miltenyi).Cells were incubated with appropriate mixtures for 25 minutes at 4° C., washed in PBS containing 3% FCS and fixed with Paraformaldehyde 4% by an overnight incubation at 4° C. Samples were acquired in an Attune NxT cytometer (Invitrogen) and data analyzed by FlowJo software (Treestar, OR, USA).
[0304] Results
[0305] New hACE2 Transgenic Mice with Substantial Brain Permissibility to SARS-CoV-2 replication
[0306] B6.K18-hACE2.sup.IP-THV mice were generated as disclosed in Example 2. The permissibility of these mice to SARS-CoV-2 replication was evaluated and it was determined that large permissibility to SARS-CoV-2 replication at both lung and CNS, marked brain inflammation and rapid lethal disease are major distinctive features of this new B6.K18-hACE2.sup.IP-THV transgenic model.
[0307] Full Protection of Lungs and Brain in LV::S.sub.ΔF2P-Immunized B6.K18-hACE2.sup.IP-THV Mice
[0308] We then evaluated the vaccine efficacy of LV::S.sub.ΔF2P in B6.K18-hACE2.sup.IP-THV mice. Individuals (n=6/group) where primed i.m. with 1×10.sup.7 TU/mouse of LV::S.sub.ΔF2P or an empty LV (sham) at wk 0 and then boosted i.n. at wk 3 with the same dose of the same vectors (
[0309] At 3 dpi, cytometric investigation of the lung innate immune cell subsets (
[0310] Therefore, an i.m.-i.n. prime-boost with NILV::S.sub.ΔF2P prevents SARS-CoV-2 replication in both lung and CNS anatomical areas and inhibits virus-mediated lung pathology and neuro-inflammation.
[0311] Requirement of i.n. Boost for Full Protection of Brain in B6.K18-hACE2.sup.IP-THV Mice
[0312] To go further in characterization of the protective properties of LV, in the following experiments in B6.K18-hACE2.sup.IP-THV mice, similar to the hamster model, we used the non-integrative version of LV. The observed protection of brain against SARS-CoV-2 may reflect the benefits of i.n. route of LV administration against this respiratory and neurotropic virus. To address this hypothesis, B6.K18-hACE2.sup.IP-THV mice were vaccinated with NILV::S.sub.ΔF2P: (i) i.m. wk 0 and i.n. wk5, as a positive control, (ii) i.n. wk 0, or (iii) i.m. wk 5. Sham-vaccinated controls received i.n. an empty NILV at wks 0 and 5 (
[0313] As analyzed by cytometry, composition of innate and adaptive immune cells in the cervical lymph nodes were unchanged in NILV::S.sub.ΔF2P i.m.-i.n. protected group, sham i.m.-i.n. unprotected group and untreated controls (data not shown). Notably, we detected increased proportion of CD8.sup.+ T cells in the olfactory bulb of NILV::S.sub.ΔF2P i.m.-i.n. protected group compared to unprotected group (
[0314] Collectively, our data generated in the highly stringent B6.K18-hACE2.sup.IP-THV mouse model support the advantage of NILV::S.sub.ΔF2P i.n. boost in the immune protection of CNS from SARS-CoV-2 replication and the resulting infiltration and neuro-inflammation. The local induction and/or activation of mucosal immune response in nasal cavity and olfactory bulbs, i.e. the entry point for the virus, is a performant strategy.
[0315] Discussion
[0316] LV-based platform emerges as a powerful vaccination approach against COVID-19, notably when used in systemic prime followed by mucosal i.n. boost, able to induce sterilizing immunity against lung SARS-CoV-2 infection in preclinical animal models. We first demonstrate that a single i.n. administration of an LV encoding the S.sub.ΔF2P prefusion form of S.sub.CoV-2 confers, as efficiently as an i.m.-i.n. prime-boost regimen, full protection of respiratory tracts in the highly susceptible hamster model, as evaluated by virological, immunological and histopathological parameters. The hamster ACE2 ortholog interacts efficaciously with S.sub.CoV-2, which readily allows host cell invasion by SARS-CoV-2 and its high replication rate. With rapid weight loss and development of severe lung pathology subsequent to SARS-CoV-2 inoculation, this species provides a sensitive model to evaluate the efficacy of drug or vaccine candidates, for instance compared to Rhesus macaques which develop only a mild COVID-19 pathology (Munoz-Fontela et al., 2020; Sia et al., 2020). The fact that a single i.n. LV administration, either seven or two weeks before SARS-CoV-2 challenge, elicits sterilizing protection in this susceptible model is valuable in setting the upcoming clinical trials with this LV-based vaccine and could provide remarkable socio-economic advantages for mass vaccination.
[0317] To further investigate the efficacy of our vaccine candidates, we generated a new transgenic mouse model, by use of an LV-based transgenesis approach (Nakagawa and Hoogenraad, 2011). The ILV used in this strategy encodes for hACE2 controlled by cytokeratin K18 promoter, i.e., the same promoter as previously used by Perlman's team to generate B6.K18-ACE2.sup.2PrImn/JAX mice (McCray et al., 2007), with a few adaptations to the lentiviral FLAP transfer plasmid. However, the new B6.K18-hACE2.sup.IP-THV mice have certain distinctive features, as they express much higher levels of hACE2 mRNA in the brain and display markedly increased brain permissibility to SARS-CoV-2 replication, in parallel with a substantial brain inflammation and development of a lethal disease in <4 days post infection. These distinct characteristics can result from differential hACE2 expression profile due to: (i) alternative insertion sites of ILV into the chromosome compared to naked DNA, and/or (ii) different effect of the Woodchuck Posttranscriptional Regulatory Element (WPRE) versus the alfalfa virus translational enhancer (McCray et al., 2007), in B6.K18-hACE2.sup.IP-THV and B6.K18-ACE2.sup.2PrImn/JAX animals, respectively. Other reported hACE2 humanized mice express the transgene under: (i) murine ACE2 promoter, without reported hACE2 mRNA expression in the brain (Yang et al., 2007), (ii) “hepatocyte nuclear factor-3/forkhead homologue 4” (HFH4) promoter, i.e., “HFH4-hACE2” C3B6 mice, in which lung is the principal site of infection and pathology (Jiang et al., 2020; Menachery et al., 2016), and (iii) “CAG” mixed promoter, i.e. “AC70” C3H×C57BL/6 mice, in which hACE2 mRNA is expressed in various organs including lungs and brain (Tseng et al., 2007). Comparison of AC70 and B6.K18-hACE2.sup.IP-THV mice may be informative to assess similarities and distinctions of these two models. However, here we report much higher brain permissibility of B6.K18-hACE2.sup.IP-THV mice to SARS-CoV-2 replication, compared to B6.K18-ACE2.sup.2PrImn/JAX mice. The B6.K18-hACE2.sup.IP-THV murine model not only has broad applications in COVID-19 vaccine studies, but also provides a unique rodent model for exploration of COVID-19-derived neuropathology. Based on the substantial permissibility of the brain to SARS-CoV-2 replication and development of a lethal disease by these transgenic mice, this pre-clinical model can be considered as more stringent than the golden hamster model.
[0318] In this study, the use of the highly stringent B6.K18-hACE2.sup.IP-THV mice demonstrated the importance of i.n. booster immunization for the induction of sterilizing protection of CNS by the LV-based vaccine candidate developed against SARS-CoV-2. Olfactory bulb may control viral CNS infection through the action of local innate and adaptive immunity (Durrant et al., 2016), and we observed increased frequencies of CD8.sup.+ T cells at this anatomically strategic area in i.m.-i.n. vaccinated and protected mice. Substantial reduction in the inflammation mediators was also demonstrated in the brain of these vaccinated and protected mice, together with decrease in the neutrophils and inflammatory monocytes in the olfactory bulbs and brain, respectively.
[0319] The source of neurological manifestations associated with COVID-19 in patients with comorbid conditions can be: (i) direct impact of SARS-CoV-2 on CNS, (ii) infection of brain vascular endothelium and, (iii) uncontrolled anti-viral immune reaction inside CNS. ACE2 is expressed in human neurons, astrocytes and oligodendrocytes, located in middle temporal gyrus and posterior cingulate cortex, which may explain the brain permissibility to SARS-CoV-2 in patients (Song et al., 2020; Hu et al., 2020). Viruses can invade the brain through neural dissemination or hematogenous route (Bohmwald et al., 2018; Desforges et al., 2019, 2014). The olfactory system establishes a direct connection to the CNS via frontal cortex (Mori et al., 2005). Neural transmission of viruses to the CNS can occur as a result of direct neuron invasion through axonal transport in the olfactory mucosa. Subsequent to intraneuronal replication, the virus spreads to synapses and disseminate to anatomical CNS zones receiving olfactory tract projections (Koyuncu et al., 2013; Zubair et al., 2020; Berth, 2009; Koyuncu et al., 2013; Roman et al., 2020). However, the detection of viral RNA in CNS regions without connection with olfactory mucosa suggests existence of another viral entry into the CNS, including migration of SARS-CoV-2-infected immune cells crossing the hemato-encephalic barrier or direct viral entry pathway via CNS vascular endothelium (Meinhardt et al., 2020). Although at steady state, viruses cannot penetrate to the brain through an intact blood-brain barrier (Berth, 2009), inflammation mediators which are massively produced during cytokine/chemokine storm, notably TNF-α and CCL2, can disrupt the integrity of blood-brain barrier or increase its permeability, allowing paracellular blood-to-brain transport of the virus or virus-infected leukocytes {Aghagoli, 2020 #77; Hu, 2011 #15}. Regardless of the mechanism of the SARS-CoV-2 entry to the brain, we provide evidence of the full protection of the CNS against SARS-CoV-2 by i.n. booster immunization with NILV::S.sub.ΔF2P.
[0320] We reported results in Example 1 demonstrating the strong prophylactic capacity of LV::S.sub.FL at inducing sterilizing protection in the lungs against SARS-CoV-2 infection. In the present study, moving toward clinical assay, we used LV encoding stabilized prefusion S.sub.ΔF2P forms of S.sub.CoV-2 as an additional form of the S protein exhibiting vaccinal interest. This choice was based on data indicating that stabilization of viral envelop glycoproteins at their prefusion forms improve the yield of their production as recombinant proteins in industrial manufacturing of subunit vaccines, and the efficacy of nucleic acid-based vaccines by raising availability of the antigen under its optimal immunogenic shape (Hsieh et al., 2020). The prefusion stabilization approach has been so far applied to S protein of several coronaviruses, including HKU1-CoV, SARS-CoV, and MERS-CoV. Stabilized S.sub.MERS-CoV has been shown to elicit much higher NAb responses and protection in pre-clinical animal models (Hsieh et al., 2020).
[0321] The sterilizing protection of the lungs conferred by a single i.n. administration and the full protection of CNS conferred by i.n. boost is an asset of primary importance. The non-cytopathic and non-inflammatory LV encoding either full length, or stabilized forms of S.sub.CoV-2, from either ancestral or emerging variants of SARS-CoV-2 provides a promising COVID-19 vaccine candidate of second generation. Protection of the brain, so far not directly addressed by other vaccine strategies, has to be taken into account, considering the multiple and sometimes severe neuropathological manifestations associated with COVID-19.
Example 4: Complete Cross-Protection Induced by NILV::S.SUB.CoV-2 .Wuhan Against the Genetically Distant P.1 (so Called Manaus, Brazil or γ) Variant
[0322] A critical issue regarding the COVID-19 vaccines currently in use is the protective potency against emerging variants. To assess this question with the NILV::S.sub.CoV-2 Wuhan vaccine candidate, B6.K18-hACE2.sup.IP-THV transgenic mice were primed i.m. (wk0) and boosted i.n. (wk5) with NILV::S.sub.CoV-2 or sham (
[0323] This drastically reduced protective B-cell response despite the remarkable protection, raised the possibility of T-cell involvement in this NILV::S.sub.CoV-2 Wuhan-mediated full protection. To evaluate this possibility, we vaccinated following the same protocol (
[0324] This is consistent with: (i) strong CD8.sup.+ T-cell responses induced by NILV::S.sub.CoV-2 Wuhan at the systemic level (
[0325] Remarkably, all murine and human CD8.sup.+ T-cell epitopes identified on S.sub.CoV-2 Wuhan sequence are preserved in the mutated S.sub.CoV-2 Manaus P.1 (Table 5). These observations indicate the strong potential of NILV at inducing full protection of lungs and brain against ancestral and emerging SARS-CoV-2 variants by eliciting marked B and T cell-responses. In contrast to the B-cell epitopes which are targets of NAbs (Hoffmann et al., 2021), the so far identified T-cell epitopes have not been impacted by mutations accumulated in the S.sub.CoV-2 of the emerging variants.
TABLE-US-00008 TABLE 5 S.sub.CoV-2-derived murine and human T-cell epitopes SEQ a.a substitution/ Murine Sequence aa ID NO: deletion H-2D.sup.b LDSKVGGNYNYLYRL 18 H-2D.sup.b NKCVNFNFNGLTGTG 16 H-2D.sup.b VRDPQTLEILDITPC 17 H-2D.sup.b CASYQTQTNSPRRAR 19 P .fwdarw. Hin B1.1.7 H-2D.sup.b VQIDRLITGRLQSLQ 20 Identified Human (Immundex data base) observation A*0101 LTDEMIAQY 121 A*0201 FLHVTYVPA 122 A*0201 KIYSKHTPI 123 A*0201 KLPDDFTGCV 124 A*0201 LLFNKVTLA 125 A*0201 RLDKVEAEV 126 A*0201 RLITGRLQSL 127 A*0201 RLQSLQTYV 128 A*0201 TLDSKTQSL 129 A*0201 VLNDILSRL 130 S .fwdarw. A in B1.1.7 A*0201 YLQPRTFLL 131 A*0201 RLNEVAKNL 132 A*0201 VVFLHVTYV 133 A*0201 NLNESLIDL 134 A*0201 FIAGLIAIV 135 A*0301 KCYGVSPTK 136 A*0301 GVYFASTEK 137 A*1101 RLFRKSNLK 138 A*1101 GTHWFVTQR 139 A*1101 GVYFASTEK 137 A*2402 KWPWYIWLGF 140 A*2402 QYIKWPWYI 141 A*2402 NYNYLYRLF 142 A*2402 RFDNPVLPF 143 D .fwdarw. A in B1.351 B*0702 SPRRARSVA 144 P .fwdarw. H in B1.1.7 B*0702 APHGVVFL 145 B*3501 QPTESIVRF 146 B*3501 LPFNDGVYF 147 B*3501 IPFAMQMAY 148 B*4403 YEQYIKWPW 149 DR ITRFQTLLALHRSYL 150 LAL deletion in B1.351 DR FNGLTVLPPLLTDEM 151 DRB1*0101 QLIRAAEIRASANLAATK 152 A .fwdarw. I in P.1 DRB1*0401 DRB1*0701 DRB1*1501
Example 5: Identification of Spike from SARS-CoV-2 B1.351 (so Called South African or β) Variant as the Most Suitable Antigen for a Broad Protection LV Vaccine
[0326] As demonstrated in Example 4, we showed that NI LV::S.sub.CoV-2 Wuhan largely protects the strongly susceptible B6. K18-hACE2.sup.IP-THV transgenic mice against both the ancestral Wuhan and the most genetically distant Manaus P.1 SARS-CoV-2 variants. For the establishment of a therapeutic, to further improve the antigen, the use of the most suitable Spike variant, which can best consider the dynamics of the virus propagation of the known variants was considered.
[0327] To identify the most cross-protective Spike variant, we primed and boosted C57BL/6 mice with LV encoding each Spike of interest (
[0329] (ii) sera from mice immunized with LV::S.sub.CoV-2 P.1 neutralized at high EC50 pseudo-viruses harboring S.sub.CoV-2 P.1 and LV::S.sub.CoV-2 B1.351, but poorly pseudo-viruses harboring S.sub.CoV-2 Wuhan and LV::S.sub.CoV-2 B1.1.7.
[0330] (iii) sera from mice immunized with LV::S.sub.CoV-2 B1.351 not only neutralized at high EC50 pseudo-viruses carrying S.sub.CoV-2 P.1 and LV::S.sub.CoV-2 B1.351 but also pseudo-viruses harboring S.sub.CoV-2 Wuhan and LV::S.sub.CoV-2 B1.1.7.
[0331] These results designate the Spike sequence from the B1.351 (South African or β) variant as the most cross-reactive immunogen in terms of neutralizing antibodies.
[0332] Furthermore, we showed that in the context of LV, Spike stabilization by K.sup.986P-V.sup.987P substitutions (2P) considerably improves the (cross) neutralizing antibody activity (
[0333] Therefore, our future lead antigen candidate is the full-length Spike from the B1.351 (South African or β) variant with 2P.
REFERENCES CITED FOR EXAMPLE 1
[0334] Amanat, F., and F. Krammer. 2020. SARS-CoV-2 Vaccines: Status Report. Immunity 52:583-589. [0335] Beignon, A. S., K. Mollier, C. Liard, F. Coutant, S. Munier, J. Riviere, P. Souque, and P. Charneau. 2009. Lentiviral vector-based prime/boost vaccination against AIDS: pilot study shows protection against Simian immunodeficiency virus SIVmac251 challenge in macaques. J Virol 83:10963-10974. [0336] Belouzard, S., V. C. Chu, and G. R. Whittaker. 2009. Activation of the SARS coronavirus spike protein via sequential proteolytic cleavage at two distinct sites. Proc Natl Acad Sci USA 106:5871-5876. [0337] Bourgine, M., S. Crabe, Y. Lobaina, G. Guillen, J. C. Aguilar, and M. L. Michel. 2018. Nasal route favors the induction of CD4(+) T cell responses in the liver of HBV-carrier mice immunized with a recombinant hepatitis B surface- and core-based therapeutic vaccine. Antiviral Res 153:23-32. [0338] Bulla, V., D. R. Negri, P. Leone, M. Borghi, R. Bona, Z. Michelini, D. Compagnoni, C. Sgadari, B. Ensoli, and A. Cara. 2006. Evaluation of a self-inactivating lentiviral vector expressing simian immunodeficiency virus gag for induction of specific immune responses in vitro and in vivo. Viral Immunol 19:690-701. [0339] Chandrashekar, A., J. Liu, A. J. Martinot, K. McMahan, N. B. Mercado, L. Peter, L. H. Tostanoski, J. Yu, Z. Maliga, M. Nekorchuk, K. Busman-Sahay, M. Terry, L. M. Wrijil, S. Ducat, D. R. Martinez, C. Atyeo, S. Fischinger, J. S. Burke, M. D. Slein, L. Pessaint, A. Van Ry, J. Greenhouse, T. Taylor, K. Blade, A. Cook, B. Finneyfrock, R. Brown, E. Teow, J. Velasco, R. Zahn, F. Wegmann, P. Abbink, E. A. Bondzie, G. Dagotto, M. S. Gebre, X. He, C. Jacob-Dolan, N. Kordana, Z. Li, M. A. Lifton, S. H. Mahrokhian, L. F. Maxfield, R. Nityanandam, J. P. Nkolola, A. G. Schmidt, A. D. Miller, R. S. Baric, G. Alter, P. K. Sorger, J. D. Estes, H. Andersen, M. G. Lewis, and D. H. Barouch. 2020. SARS-CoV-2 infection protects against rechallenge in rhesus macaques. Science, May 2020:eabc4776. doi: 10.1126/science.abc4776. Online ahead of print. PMID: 32434946. [0340] Corman, V., T. Bleicker, S. Brünink, and C. Drosten. 2020. Diagnostic detection of 2019-nCoV by real-time RT-PCR. https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf [0341] Cousin, C., M. Oberkampf, T. Felix, P. Rosenbaum, R. Weil, S. Fabrega, V. Morante, D. Negri, A. Cara, G. Dadaglio, and C. Leclerc. 2019. Persistence of Integrase-Deficient Lentiviral Vectors Correlates with the Induction of STING-Independent CD8(+) T Cell Responses. Cell Rep 26:1242-1257 e1247. [0342] Coutant, F., R. Y. Sanchez David, T. Felix, A. Boulay, L. Caleechurn, P. Souque, C. Thouvenot, C. Bourgouin, A. S. Beignon, and P. Charneau. 2012. A nonintegrative lentiviral vector-based vaccine provides long-term sterile protection against malaria. PLoS One 7:e48644. [0343] Coutard, B., C. Valle, X. de Lamballerie, B. Canard, N. G. Seidah, and E. Decroly. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176:104742. [0344] Di Nunzio, F., T. Felix, N. J. Arhel, S. Nisole, P. Charneau, and A. S. Beignon. 2012. HIV-derived vectors for therapy and vaccination against HIV. Vaccine 30:2499-2509. [0345] Esslinger, C., P. Romero, and H. R. MacDonald. 2002. Efficient transduction of dendritic cells and induction of a T-cell response by third-generation lentivectors. Hum Gene Ther 13:1091-1100. [0346] Gallinaro, A., M. Borghi, R. Bona, F. Grasso, L. Calzoletti, L. Palladino, S. Cecchetti, M. F. Vescio, D. Macchia, V. Morante, A. Canitano, N. Temperton, M. R. Castrucci, M. Salvatore, Z. Michelini, A. Cara, and D. Negri. 2018. Integrase Defective Lentiviral Vector as a Vaccine Platform for Delivering Influenza Antigens. Front Immunol 9:171. [0347] Gao, Q., L. Bao, H. Mao, L. Wang, K. Xu, M. Yang, Y. Li, L. Zhu, N. Wang, Z. Lv, H. Gao, X. Ge, B. Kan, Y. Hu, J. Liu, F. Cai, D. Jiang, Y. Yin, C. Qin, J. Li, X. Gong, X. Lou, W. Shi, D. Wu, H. Zhang, L. Zhu, W. Deng, Y. Li, J. Lu, C. Li, X. Wang, W. Yin, Y. Zhang, and C. Qin. 2020. Rapid development of an inactivated vaccine candidate for SARS-CoV-2. Science 2020 Jul. 3; 369(6499):77-81. doi: 10.1126/science.abc1932. Epub 2020 May 6.PMID: 32376603. [0348] Guo, Y. R., Q. D. Cao, Z. S. Hong, Y. Y. Tan, S. D. Chen, H. J. Jin, K. S. Tan, D. Y. Wang, and Y. Yan. 2020. The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak—an update on the status. Mil Med Res 7:11. [0349] He, Y., J. Zhang, Z. Mi, P. Robbins, and L. D. Falo, Jr. 2005. Immunization with lentiviral vector-transduced dendritic cells induces strong and long-lasting T cell responses and therapeutic immunity. J Immunol 174:3808-3817. [0350] Hu, B., A. Tai, and P. Wang. 2011. Immunization delivered by lentiviral vectors for cancer and infectious diseases. Immunol Rev 239:45-61. [0351] Iglesias, M. C., M. P. Frenkiel, K. Mollier, P. Souque, P. Despres, and P. Charneau. 2006. A single immunization with a minute dose of a lentiviral vector-based vaccine is highly effective at eliciting protective humoral immunity against West Nile virus. J Gene Med 8:265-274. [0352] Ku, M. W., F. Anna, F. Souque, S. Petres, M. Prot, E. Simon-Loriere, P. Charneau, and M. Bourgine. 2020. A Single Dose of NILV-Based Vaccine Provides Rapid and Durable Protection against Zika Virus. Mol Ther 2020 May 20; 51525-0016(20)30250-1. doi: 10.1016/j.ymthe.2020.05.016. [0353] Ku, M. W., P. Authié, P. Souque, M. Bourgine, M. Romano, P. Charneau, and L. Majlessi. Submitted. High-Quality Memory T Cells by Programmed Antigen Expression in Dendritic Cells Induced by Lentiviral Vector. (In revision) [0354] Lai, A. L., J. K. Millet, S. Daniel, J. H. Freed, and G. R. Whittaker. 2017. The SARS-CoV Fusion Peptide Forms an Extended Bipartite Fusion Platform that Perturbs Membrane Order in a Calcium-Dependent Manner. J Mol Biol 429:3875-3892. [0355] Lorin, V., and H. Mouquet. 2015. Efficient generation of human IgA monoclonal antibodies. J Immunol Methods 422:102-110. [0356] Qiu, H., S. Sun, H. Xiao, J. Feng, Y. Guo, W. Tai, Y. Wang, L. Du, G. Zhao, and Y. Zhou. 2016. Single-dose treatment with a humanized neutralizing antibody affords full protection of a human transgenic mouse model from lethal Middle East respiratory syndrome (MERS)-coronavirus infection. Antiviral Res 132:141-148. [0357] Rosenberg, S. A., Y. Zhai, J. C. Yang, D. J. Schwartzentruber, P. Hwu, F. M. Marincola, S. L. Topalian, N. P. Restifo, C. A. Seipp, J. H. Einhorn, B. Roberts, and D. E. White. 1998. Immunizing patients with metastatic melanoma using recombinant adenoviruses encoding MART-1 or gp100 melanoma antigens. J Natl Cancer Inst 90:1894-1900. [0358] Schirmbeck, R., J. Reimann, S. Kochanek, and F. Kreppel. 2008. The immunogenicity of adenovirus vectors limits the multispecificity of CD8 T-cell responses to vector-encoded transgenic antigens. Mol Ther 16:1609-1616. [0359] Sia, S. F., L. M. Yan, A. W. H. Chin, K. Fung, K. T. Choy, A. Y. L. Wong, P. Kaewpreedee, R. Perera, L. L. M. Poon, J. M. Nicholls, M. Peiris, and H. L. Yen. 2020. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 2020 May 14. doi: 10.1038/s41586-020-2342-5. Online ahead of print.PMID: 32408338. [0360] Sterlin, D., A. Mathian, M. Miyara, A. Mohr, F. Anna, L. Claër, P. Quentric, J. Fadlallah, P. Ghillani, C. Gunn, R. Hockett, S. Mudumba, A. Guihot, C. Luyt, J. Mayaux, A. Beurton, S. Fourati, J. Lacorte, H. Yssel, C. Parizot, K. Dorgham, P. Charneau, Z. Amoura, and G. Gorochov. IgA dominates the early neutralizing antibody response to SARS-CoV-2. (in preparation). [0361] Vabret, N., G. J. Britton, C. Gruber, S. Hegde, J. Kim, M. Kuksin, R. Levantovsky, L. Malle, A. Moreira, M. D. Park, L. Pia, E. Risson, M. Saffern, B. Salome, M. Esai Selvan, M. P. Spindler, J. Tan, V. van der Heide, J. K. Gregory, K. Alexandropoulos, N. Bhardwaj, B. D. Brown, B. Greenbaum, Z. H. Gumus, D. Homann, A. Horowitz, A. O. Kamphorst, M. A. Curotto de Lafaille, S. Mehandru, M. Merad, R. M. Samstein, and P. Sinai Immunology Review. 2020. Immunology of COVID-19: Current State of the Science. Immunity 52:910-941. [0362] Walls A. C., Y. J. Park, M. A. Tortorici, A. Wall, A. T. McGuire, and D. Veesler. 2020. Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell 181:281-292 e286. [0363] Wan, Y., J. Shang, S. Sun, W. Tai, J. Chen, Q. Geng, L. He, Y. Chen, J. Wu, Z. Shi, Y. Zhou, L. Du, and F. Li. 2020. Molecular Mechanism for Antibody-Dependent Enhancement of Coronavirus Entry. J Virol 94: [0364] Wang, Q., Y. Qiu, J. Y. Li, Z. J. Zhou, C. H. Liao, and X. Y. Ge. 2020. A Unique Protease Cleavage Site Predicted in the Spike Protein of the Novel Pneumonia Coronavirus (2019-nCoV) Potentially Related to Viral Transmissibility. Virol Sin 2020 June; 35(3):337-339. doi: 10.1007/s12250-020-00212-7. Epub 2020 Mar. 20. [0365] Yu, J., L. H. Tostanoski, L. Peter, N. B. Mercado, K. McMahan, S. H. Mahrokhian, J. P. Nkolola, J. Liu, Z. Li, A. Chandrashekar, D. R. Martinez, C. Loos, C. Atyeo, S. Fischinger, J. S. Burke, M. D. Slein, Y. Chen, A. Zuiani, N. L. FJ, M. Travers, S. Habibi, L. Pessaint, A. Van Ry, K. Blade, R. Brown, A. Cook, B. Finneyfrock, A. Dodson, E. Teow, J. Velasco, R. Zahn, F. Wegmann, E. A. Bondzie, G. Dagotto, M. S. Gebre, X. He, C. Jacob-Dolan, M. Kirilova, N. Kordana, Z. Lin, L. F. Maxfield, F. Nampanya, R. Nityanandam, J. D. Ventura, H. Wan, Y. Cai, B. Chen, A. G. Schmidt, D. R. Wesemann, R. S. Baric, G. Alter, H. Andersen, M. G. Lewis, and D. H. Barouch. 2020. DNA vaccine protection against SARS-CoV-2 in rhesus macaques. Science 2020 May 20; eabc6284. doi: 10.1126/science.abc6284. PMID: 32434945. [0366] Zennou, V., C. Petit, D. Guetard, U. Nerhbass, L. Montagnier, and P. Charneau. 2000. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101:173-185. [0367] Zhao, J., K. Li, C. Wohlford-Lenane, S. S. Agnihothram, C. Fett, J. Zhao, M. J. Gale, Jr., R. S. Baric, L. Enjuanes, T. Gallagher, P. B. McCray, Jr., and S. Perlman. 2014. Rapid generation of a mouse model for Middle East respiratory syndrome. Proc Natl Acad Sci USA 111:4970-4975. [0368] Zhu, F. C., Y. H. Li, X. H. Guan, L. H. Hou, W. J. Wang, J. X. Li, S. P. Wu, B. S. Wang, Z. Wang, L. Wang, S. Y. Jia, H. D. Jiang, L. Wang, T. Jiang, Y. Hu, J. B. Gou, S. B. Xu, J. J. Xu, X. W. Wang, W. Wang, and W. Chen. 2020. Safety, tolerability, and immunogenicity of a recombinant adenovirus type-5 vectored COVID-19 vaccine: a dose-escalation, open-label, non-randomised, first-in-human trial. Lancet. 2020 Jun. 13; 395(10240):1845-1854. doi: 10.1016/S0140-6736(20)31208-3. Epub 2020 May 22. P.
REFERENCES CITED FOR EXAMPLES 2 AND 3
[0369] Aghagoli, G., Gallo Marin, B., Katchur, N. J., Chaves-Sell, F., Asaad, W. F., and Murphy, S. A. (2020). Neurological Involvement in COVID-19 and Potential Mechanisms: A Review. Neurocrit Care. [0370] Bergmann, C. C., T. E. Lane, and S. A. Stohlman. 2006. Coronavirus infection of the central nervous system: host-virus stand-off. Nat Rev Microbiol 4:121-132. [0371] Anna, F., Goyard, S., Lalanne, A. I., Nevo, F., Gransagne, M., Souque, P., Louis, D., Gillon, V., Turbiez, I., Bidard, F. C., et al. (2020). High seroprevalence but short-lived immune response to SARS-CoV-2 infection in Paris. Eur J Immunol. [0372] Bos, R., Rutten, L., van der Lubbe, J. E. M., Bakkers, M. J. G., Hardenberg, G., Wegmann, F., Zuijdgeest, D., de Wilde, A. H., Koornneef, A., Verwilligen, A., et al. (2020). Ad26 vector-based COVID-19 vaccine encoding a prefusion-stabilized SARS-CoV-2 Spike immunogen induces potent humoral and cellular immune responses. NPJ Vaccines 5, 91 [0373] Bourgonje, A. R., Abdulle, A. E., Timens, W., Hillebrands, J. L., Navis, G. J., Gordijn, S. J., Bolling, M. C., Dijkstra, G., Voors, A. A., Osterhaus, A. D., et al. (2020). Angiotensin-converting enzyme 2 (ACE2), SARS-CoV-2 and the pathophysiology of coronavirus disease 2019 (COVID-19). J Pathol 251, 228-248. [0374] Chandrashekar, A., Liu, J., Martinot, A. J., McMahan, K., Mercado, N. B., Peter, L., Tostanoski, L. H., Yu, J., Maliga, Z., Nekorchuk, M., et al. (2020). SARS-CoV-2 infection protects against rechallenge in rhesus macaques. Science May 2020:eabc4776 doi: 101126/scienceabc4776 PMID: 32434946. [0375] Chen, R., Wang, K., Yu, J., Howard, D., French, L., Chen, Z., Wen, C., and Xu, Z. (2020). The spatial and cell-type distribution of SARS-CoV-2 receptor ACE2 in human and mouse brain. BioRxiv. [0376] Chow, Y. H., O'Brodovich, H., Plumb, J., Wen, Y., Sohn, K. J., Lu, Z., Zhang, F., Lukacs, G. L., Tanswell, A. K., Hui, C. C., et al. (1997). Development of an epithelium-specific expression cassette with human DNA regulatory elements for transgene expression in lung airways. Proc Natl Acad Sci USA 94, 14695-14700. [0377] Corman, V., Bleicker, T., Brünink, S., and Drosten, C. (2020). Diagnostic detection of 2019-nCoV by real-time RT-PCR. https://wwwwhoint/docs/default-sou rce/coronavi ruse/protocol-v2-1pdf. [0378] Cupovic, J., Onder, L., Gil-Cruz, C., Weiler, E., Caviezel-Firner, S., Perez-Shibayama, C., Rulicke, T., Bechmann, I., and Ludewig, B. (2016). Central Nervous System Stromal Cells Control Local CD8(+) T Cell Responses during Virus-Induced Neuroinflammation. Immunity 44, 622-633. [0379] Desforges, M., Le Coupanec, A., Stodola, J. K., Meessen-Pinard, M., and Talbot, P. J. (2014). Human coronaviruses: viral and cellular factors involved in neuroinvasiveness and neuropathogenesis. Virus Res 194, 145-158. [0380] Di Nunzio, F., Felix, T., Arhel, N. J., Nisole, S., Charneau, P., and Beignon, A. S. (2012). HIV-derived vectors for therapy and vaccination against HIV. Vaccine 30, 2499-2509. [0381] Dogan, R. I., Getoor, L., Wilbur, W. J., and Mount, S. M. (2007). Features generated for computational splice-site prediction correspond to functional elements. BMC Bioinformatics 8, 410. [0382] Firat H. et al. The Journal of Gene Medicine 2002; 4: 38-45 [0383] Fotuhi, M., Mian, A., Meysami, S., and Raji, C. A. (2020). Neurobiology of COVID-19. J Alzheimers Dis 76, 3-19. [0384] Glass, W. G., Subbarao, K., Murphy, B., and Murphy, P. M. (2004). Mechanisms of host defense following severe acute respiratory syndrome-coronavirus (SARS-CoV) pulmonary infection of mice. J Immunol 173, 4030-4039. [0385] Guo, Y. R., Cao, Q. D., Hong, Z. S., Tan, Y. Y., Chen, S. D., Jin, H. J., Tan, K. S., Wang, D. Y., and Yan, Y. (2020). The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak—an update on the status. Mil Med Res 7, 11 [0386] Hsieh, C. L., Goldsmith, J. A., Schaub, J. M., DiVenere, A. M., Kuo, H. C., Javanmardi, K., Le, K. C., Wrapp, D., Lee, A. G., Liu, Y., et al. (2020). Structure-based design of prefusion-stabilized SARS-CoV-2 spikes. Science 369, 1501-1505. [0387] Hu, B., Tai, A., and Wang, P. (2011). Immunization delivered by lentiviral vectors for cancer and infectious diseases. Immunol Rev 239, 45-61. [0388] Hu, J., Jolkkonen, J., and Zhao, C. (2020). Neurotropism of SARS-CoV-2 and its neuropathological alterations: Similarities with other coronaviruses. Neurosci Biobehav Rev 119, 184-193. [0389] Hoffmann, M., H. Kleine-Weber, S. Schroeder, N. Kruger, T. Herrler, S. Erichsen, T. S. Schiergens, G. Herrler, N. H. Wu, A. Nitsche, M. A. Muller, C. Drosten, and S. Pohlmann. 2020. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 181:271-280 e278 [0390] Jiang, R. D., Liu, M. Q., Chen, Y., Shan, C., Zhou, Y. W., Shen, X. R., Li, Q., Zhang, L., Zhu, Y., Si, H. R., et al. (2020). Pathogenesis of SARS-CoV-2 in Transgenic Mice Expressing Human Angiotensin-Converting Enzyme 2. Cell 182, 50-58 e58. [0391] Koehler, D. R., Chow, Y. H., Plumb, J., Wen, Y., Rafii, B., Belcastro, R., Haardt, M., Lukacs, G. L., Post, M., Tanswell, A. K., et al. (2000). A human epithelium-specific vector optimized in rat pneumocytes for lung gene therapy. Pediatr Res 48, 184-190. [0392] Ku, M. W., Anna, F., Souque, F., Petres, S., Prot, M., Simon-Loriere, E., Charneau, P., and Bourgine, M. (2020). A Single Dose of NILV-Based Vaccine Provides Rapid and Durable Protection against Zika Virus. Mol Ther 2020 May 20; 51525-0016(20)30250-1 doi: 101016/jymthe202005016. [0393] Ku, M. W., Bourgine, M., Authié, P., Lopez, J., Nemirov, N., Moncoq, F., Noirat, A., Vesin, B., Nevo, F., Blanc, C., et al. (2021). Intranasal Vaccination with a Lentiviral Vector Protects against SARS-CoV-2 in Preclinical Animal Models [0394] Cell Host and Microbe in press. PMID: 33357418 [0395] Lescure, F. X., Bouadma, L., Nguyen, D., Parisey, M., Wicky, P. H., Behillil, S., Gaymard, A., Bouscambert-Duchamp, M., Donati, F., Le Hingrat, Q., et al. (2020). Clinical and virological data of the first cases of COVID-19 in Europe: a case series. Lancet Infect Dis 20, 697-706. [0396] Li, K., Wohlford-Lenane, C., Perlman, S., Zhao, J., Jewell, A. K., Reznikov, L. R., Gibson-Corley, K. N., Meyerholz, D. K., and McCray, P. B., Jr. (2016). Middle East Respiratory Syndrome Coronavirus Causes Multiple Organ Damage and Lethal Disease in Mice Transgenic for Human Dipeptidyl Peptidase 4. J Infect Dis 213, 712-722. [0397] Liu, J., Li, S., Liu, J., Liang, B., Wang, X., Wang, H., Li, W., Tong, Q., Yi, J., Zhao, L., et al. (2020). Longitudinal characteristics of lymphocyte responses and cytokine profiles in the peripheral blood of SARS-CoV-2 infected patients. EBioMedicine 55, 102763. [0398] Lopez, J., Anna, F., Authié, P., Pawlik, A., Ku, M. W., Blanc, C., Souque, P., Moncoq, F., Noirat, A., Sougakoff, W., et al. (in preparation). An Optimized Poly-antigenic Lentiviral Vector Induces Protective CD4+ T-Cell Immunity and Predicts a Booster Vaccine against Mycobacterium tuberculosis. [0399] Mao, L., Jin, H., Wang, M., Hu, Y., Chen, S., He, Q., Chang, J., Hong, C., Zhou, Y., Wang, D., et al. (2020). Neurologic Manifestations of Hospitalized Patients With Coronavirus Disease 2019 in Wuhan, China. JAMA Neurol 77, 683-690. [0400] McCallum, M., Walls, A. C., Bowen, J. E., Corti, D., and Veesler, D. (2020). Structure-guided covalent stabilization of coronavirus spike glycoprotein trimers in the closed conformation. Nat Struct Mol Biol 27, 942-949. [0401] McCray, P. B., Jr., Pewe, L., Wohlford-Lenane, C., Hickey, M., Manzel, L., Shi, L., Netland, J., Jia, H. P., Halabi, C., Sigmund, C. D., et al. (2007). Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. J Virol 81, 813-821. [0402] Meinhardt, J., Radke, J., Dittmayer, C., Franz, J., Thomas, C., Mothes, R., Laue, M., Schneider, J., Brunink, S., Greuel, S., et al. (2020). Olfactory transmucosal SARS-CoV-2 invasion as a port of central nervous system entry in individuals with COVID-19. Nat Neurosci. [0403] Menachery, V. D., Yount, B. L., Jr., Sims, A. C., Debbink, K., Agnihothram, S. S., Gralinski, L. E., Graham, R. L., Scobey, T., Plante, J. A., Royal, S. R., et al. (2016). SARS-like WIV1-CoV poised for human emergence. Proc Natl Acad Sci USA 113, 3048-3053. [0404] Munoz-Fontela, C., Dowling, W. E., Funnell, S. G. P., Gsell, P. S., Riveros-Balta, A. X., Albrecht, R. A., Andersen, H., Baric, R. S., Carroll, M. W., Cavaleri, M., et al. (2020). Animal models for COVID-19. Nature 586, 509-515. [0405] Nakagawa, T., and Hoogenraad, C. C. (2011). Lentiviral transgenesis. Methods Mol Biol 693, 117-142. [0406] Netland, J., Meyerholz, D. K., Moore, S., Cassell, M., and Perlman, S. (2008). Severe acute respiratory syndrome coronavirus infection causes neuronal death in the absence of encephalitis in mice transgenic for human ACE2. J Virol 82, 7264-7275. [0407] Park, F. 2007. Lentiviral vectors: are they the future of animal transgenesis? Physiol Genomics 31:159-173 [0408] L. S., Salsano, E., and Grimaldi, M. (2020). Magnetic Resonance Imaging Alteration of the Brain in a Patient With Coronavirus Disease 2019 (COVID-19) and Anosmia. JAMA Neurol 77, 1028-1029. [0409] Roman, G. C., Spencer, P. S., Reis, J., Buguet, A., Faris, M. E. A., Katrak, S. M., Lainez, M., Medina, M. T., Meshram, C., Mizusawa, H., et al. (2020). The neurology of COVID-19 revisited: A proposal from the Environmental Neurology Specialty Group of the World Federation of Neurology to implement international neurological registries. J Neurol Sci 414, 116884. [0410] Rosenberg, S. A., Zhai, Y., Yang, J. C., Schwartzentruber, D. J., Hwu, P., Marincola, F. M., Topalian, S. L., Restifo, N. P., Seipp, C. A., Einhorn, J. H., et al. (1998). Immunizing patients with metastatic melanoma using recombinant adenoviruses encoding MART-1 or gp100 melanoma antigens. J Natl Cancer Inst 90, 1894-1900. [0411] Sayes, F., C. Blanc, L. S. Ates, N. Deboosere, M. Orgeur, F. Le Chevalier, M. I. Groschel, W. Frigui, O. R. Song, R. Lo-Man, F. Brossier, W. Sougakoff, D. Bottai, P. Brodin, P. Charneau, R. Brosch, and L. Majlessi. 2018. Multiplexed Quantitation of Intraphagocyte Mycobacterium tuberculosis Secreted Protein Effectors. Cell Rep 23:1072-1084 [0412] Schirmbeck, R., Reimann, J., Kochanek, S., and Kreppel, F. (2008). The immunogenicity of adenovirus vectors limits the multispecificity of CD8 T-cell responses to vector-encoded transgenic antigens. Mol Ther 16, 1609-1616. [0413] Sia, S. F., Yan, L. M., Chin, A. W. H., Fung, K., Choy, K. T., Wong, A. Y. L., Kaewpreedee, P., Perera, R., Poon, L. L. M., Nicholls, J. M., et al. (2020). Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 2020 May 14 doi: 101038/s41586-020-2342-5 Online ahead of printPMID: 32408338. [0414] Song, E., Zhang, C., lsraelow, B., Lu-Culligan, A., Prado, A. V., Skriabine, S., Lu, P., Weizman, O. E., Liu, F., Dai, Y., et al. (2020). Neuroinvasion of SARS-CoV-2 in human and mouse brain. bioRxiv. [0415] Sterlin, D., Mathian, A., Miyara, M., Mohr, A., Anna, F., Claer, L., Quentric, P., Fadlallah, J., Devilliers, H., Ghillani, P., et al. (2020). IgA dominates the early neutralizing antibody response to SARS-CoV-2. Sci Transl Med. [0416] Sternberg, A., and Naujokat, C. (2020). Structural features of coronavirus SARS-CoV-2 spike protein: Targets for vaccination. Life Sci 257, 118056. [0417] Tostanoski, L. H., Wegmann, F., Martinot, A. J., Loos, C., McMahan, K., Mercado, N. B., Yu, J., Chan, C. N., Bondoc, S., Starke, C. E., et al. (2020). Ad26 vaccine protects against SARS-CoV-2 severe clinical disease in hamsters. Nat Med 26, 1694-1700. [0418] Tseng, C. T., Huang, C., Newman, P., Wang, N., Narayanan, K., Watts, D. M., Makino, S., Packard, M. M., Zaki, S. R., Chan, T. S., et al. (2007). Severe acute respiratory syndrome coronavirus infection of mice transgenic for the human Angiotensin-converting enzyme 2 virus receptor. J Virol 81, 1162-1173. VandenDriessche T. et al. Blood, 1 Aug. 2002—vol. 100, no 3, p. 813-822 [0419] von Weyhern, C. H., Kaufmann, I., Neff, F., and Kremer, M. (2020). Early evidence of pronounced brain involvement in fatal COVID-19 outcomes. Lancet 395, e109. [0420] Walls A. C., Park, Y. J., Tortorici, M. A., Wall, A., McGuire, A. T., and Veesler, D. (2020). Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell 181, 281-292 e286. [0421] Whittaker, A., Anson, M., and Harky, A. (2020). Neurological Manifestations of COVID-19: A systematic review and current update. Acta Neurol Scand 142, 14-22. [0422] Wolfel, R., Corman, V. M., Guggemos, W., Seilmaier, M., Zange, S., Muller, M. A., Niemeyer, D., Jones, T. C., Vollmar, P., Rothe, C., et al. (2020). Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469. [0423] Xu, J., and Lazartigues, E. (2020). Expression of ACE2 in Human Neurons Supports the Neuro-Invasive Potential of COVID-19 Virus. Cell Mol Neurobiol. [0424] Yang, X. H., Deng, W., Tong, Z., Liu, Y. X., Zhang, L. F., Zhu, H., Gao, H., Huang, L., Liu, Y. L., Ma, C. M., et al. (2007). Mice transgenic for human angiotensin-converting enzyme 2 provide a model for SARS coronavirus infection. Comp Med 57, 450-459. [0425] Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P. (2000). HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101, 173-185.
REFERENCES CITED FOR EXAMPLES 4 AND 5
[0426] MBuss, L. F., Prete, C. A., Jr., Abrahim, C. M. M., Mendrone, A., Jr., Salomon, T., de Almeida-Neto, C., Franca, R. F. O., Belotti, M. C., Carvalho, M., Costa, A. G., et al. (2021). Three-quarters attack rate of SARS-CoV-2 in the Brazilian Amazon during a largely unmitigated epidemic. Science 371, 288-292. [0427] Hoffmann, M., Arora, P., Gross, R., Seidel, A., Hornich, B. F., Hahn, A. S., Kruger, N., Graichen, L., Hofmann-Winkler, H., Kempf, A., et al. (2021). SARS-CoV-2 variants B.1.351 and P.1 escape from neutralizing antibodies. Cell. [0428] Kitamura, D., Roes, J., Kuhn, R., and Rajewsky, K. (1991). A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature 350, 423-426. [0429] Ku, M. W., Bourgine, M., Authie, P., Lopez, J., Nemirov, K., Moncoq, F., Noirat, A., Vesin, B., Nevo, F., Blanc, C., et al. (2021). Intranasal vaccination with a lentiviral vector protects against SARS-CoV-2 in preclinical animal models. Cell Host Microbe 29, 236-249 e236.