MODIFIED KISSPEPTIN RECEPTOR AGONISTS FOR FATTY LIVER DISEASE
20230256051 · 2023-08-17
Inventors
- M. Moshmi BHATTACHARYA BABWAH (New Brunswick, NJ, US)
- Andy VIDESH BABWAH (New Brunswick, NJ, US)
- Sally RADOVICK (New Brunswick, NJ, US)
- Fredric E. WONDISFORD (New Brunswick, NJ, US)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61P5/50
HUMAN NECESSITIES
International classification
A61K45/06
HUMAN NECESSITIES
Abstract
This invention involves repurposing the use of TAK-448 in NAFLD or NASH. In this study, a diet-induced mouse model of NAFLD was used to demonstrate that a hepatic knock-out of Kiss1r promotes steatosis. Moreover, infusion of the KP analog (TAK-488) in obese, wild-type diabetic mice protects against disease progression. Thus, the present invention provides a therapy for metabolic disorders such as NAFLD and NASH through the administration of TAK-488, a long-lasting synthetic analog of kisspeptin-10, a naturally occurring peptide found in the blood.
Claims
1. A method of reducing fat in the liver of a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound selected from TAK-448 and any salt thereof; a conservative variant of TAK-448 and any salt thereof; kisspeptin-10 and any salt thereof; and a conservative variant of kisspeptin-10 and any salt thereof.
2. The method of claim 1, wherein the subject suffers from a fatty liver.
3. The method of claim 2, wherein the subject suffers from a condition selected from alcoholism, hepatitis, non-alcoholic fatty liver disease (NALFD), or non-alcoholic steatohepatitis (NASH).
4. The method of claim 1, wherein the subject suffers from non-alcoholic fatty liver disease (NALFD) or non-alcoholic steatohepatitis (NASH).
5. The method of claim 1, further comprising administering a therapeutic amount of a second compound selected from AKR-001, aramchol, ASC40, AZD7687, BIO89-100, BMS-986036, canagliflozin, cenicriviroc, cilofexor, dapagliflozin, EDP-305, elafibranor, emricasan, EYP001a, fenofibrate, firsocostat, GR-MD-02, IONIS-DGAT2.sub.Rx, ipragliflozin, licogliflozin, luseogliflozin, LY3202328, MET409, metformin, MGL-3196, MK-4074, MSDC-0602K, MT-3995, NGM282, nidufexor, PF-05221304, PF-06835919, PF-06865571, PF-06882961, PX-102, PXL770, PXS-5153A, selonsertib, simtuzumab, TERN-101, TERN-201, troifexor, vitamin D, vitamin E, and VK2809.
6. The method of claim 1 wherein the administration is subcutaneous, intravenous, or oral.
Description
BRIEF SUMMARY OF THE DRAWINGS
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION
1. Definitions
[0036] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although various methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. However, the skilled artisan understands that the methods and materials used and described are examples and may not be the only ones suitable for use in the invention. Moreover, as measurements are subject to inherent variability, any temperature, weight, volume, time interval, pH, salinity, molarity or molality, range, concentration and any other measurements, quantities or numerical expressions given herein are intended to be approximate and not exact or critical figures unless expressly stated to the contrary.
[0037] The term “about,” as used herein, means plus or minus 20 percent of the recited value, so that, for example, “about 0.125” means 0.125 ±0.025, and “about 1.0” means 1.0 ±0.2.
[0038] The term “TAK-448” as used herein, refers to a stable analog of the fully active 10-amino acid C terminus of kisspeptin-54 (kisspeptin-10); these are peptide products of kispeptin-145, encoded by the KISSI gene. Kisspeptin-54 was formerly known as metastin and is a ligand for the G-protein coupled kisspeptinel receptor (KISS1R), previously known as GPR54.
[0039] The term “treat,” and its cognates such as “treatment,” as used herein, refers to obtaining a desired pharmacologic and/or physiologic effect. Thus, “treatment” includes (a) preventing the condition or disease or symptom thereof from occurring in a subject which may be predisposed to the condition or disease but has not yet been diagnosed as having it; (b) inhibiting the condition or disease or symptom thereof, such as, arresting its development; and (c) relieving, alleviating or ameliorating the condition or disease or symptom thereof, such as, for example, causing regression or partial regression of the condition or disease or symptom thereof.
[0040] The term “prevent,” and its cognates such as “prevention,” as used herein, refers to reducing the likelihood of occurrence of a disease or condition, reducing the severity of a disease or condition, and partially or totally stopping the disease or condition in a subject.
[0041] The term “subject,” as used herein, refers to a mammal, preferably a human patient, including human children patients.
[0042] The term “in need thereof,” as used herein, refers to a subject suffering from or suspected of suffering from non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis.
[0043] The term “therapeutically effective amount,” as used herein, refers to an amount, dosage, or dosage regimen that produces a therapeutic effect, preferably a desired pharmacologic and/or physiologic result.
[0044] The term “administer,” and its cognates, such as “administration,” refers to contact of a compound with a subject according to methods and routes known in the art of pharmaceutical science.
[0045] The term “fatty liver” refers to the condition where the liver of a subject contains 5% or more fat. Conditions falling within the category of “fatty liver” include, but are not limited to, fatty liver disease, hepatitis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, alcoholic steatohepatitis, liver fibrosis, cirrhosis of the liver, jaundice and liver cancer, or any condition where the liver contains 5% or more fat.
[0046] The term “NAFLD/NASH,” as used herein, refers to non-alcoholic fatty liver disease and/or non-alcoholic steatohepatitis. NAFLD encompasses a spectrum of pathological conditions, including steatosis (fatty liver), nonalcoholic steatohepatitis (NASH), fibrosis and cirrhosis (excessive scarring of liver).
[0047] The term “conservative variant” with respect to a natural or synthetic peptide or peptide analog, refers to a sequence that is about 90% or more identical to the peptide, for example with one amino acid substituted, added, or deleted in the sequence. This term also includes chemical variants of the peptide, such as a chemical modification of the amino acid side chains, including addition of a methyl, ethyl, halo, tri-fluoro, hydroxyl, carboxylate, amino, methylamino, and the like to the structure of the compound.
2. Overview
[0048] The present invention will provide a therapy for metabolic disorders such as NAFLD and NASH through the administration of TAK-488, a long-lasting synthetic analog of kisspeptin-10, a naturally occurring peptide found in the blood. Kisspeptin signals via the kisspeptin receptor (KISS1R), a G protein-coupled receptor and both kisspeptin and KISS1R are expressed by the liver. Kisspeptin-54 peptide has been administered to healthy men which has been shown to enhance insulin secretion, without altering food intake or appetite.
3. Embodiments of the Invention
[0049] This report provides the first evidence of a novel function of KISS 1R as a key regulator of hepatic lipogenesis. Although KISS1R is expressed in the liver, its biological function in the liver remained unknown. The goal of the present study was to determine the role of KISS 1R in the development and progression of fatty liver, such as NAFLD, and to provide compositions and methods for use in prevention and treatment of NAFLD/NASH and other conditions involving accumulation of fat in the liver. Using a hepatic Kiss1r knockout (LKO), we found that hepatic Kiss1r deficiency exacerbated hepatic steatosis, inflammation and fibrosis in a mouse model of NAFLD. HFD LKO mice showed aggravated metabolic parameters such as increased body weight, elevated levels of liver TGs, elevated fasting glucose and insulin resistance and an increase in inflammatory and fibrosis markers.
[0050] These phenotypes suggest that hepatic KISS ⅟KISS 1R ablation plays a crucial role in negatively regulating the development of the NAFLD phenotype and related metabolic deterioration. Thus, to test the hypothesis that hepatic KISS 1R plays a protective role in NAFLD, insulin resistant wild-type mice were treated with TAK-448, a protease-resistant KP analog with potent agonist activity comparable to KP10. TAK administration to humans and animals suppresses the neuroendocrine-reproductive axis. We found that in insulin-resistant wild-type mice, TAK treatment suppressed lipid accumulation in livers, reduced serum TGs, cholesterol and FFAs and lowered adipose mass. Additionally, TAK treatment prevented a gain in body weight without changing food intake and improved glucose tolerance and insulin sensitivity. Importantly, TAK administration resulted in a reduction in inflammatory and fibrosis markers. Collectively, these findings demonstrate a critical role of KISS 1R in the development of steatosis and NASH.
[0051] We also delineated the cellular pathways by which KISS1R regulates lipogenesis (see
[0052] AMPK activation has been shown to attenuate TG synthesis, resulting in an antisteatotic effect by two possible mechanisms. First, AMPK activation inhibits Liver X receptor α (LXRα) activity in the liver; LXRα is a lipid sensor that promotes fatty acid synthesis and leads to hypertriglyceridemia. Second, AMPK activation inhibits PPARy transcription. The mechanism by which KP activates AMPK is currently not known. Activation of AMPK requires phosphorylation of threonine 172 (T172) via increases in the AMP:ATP ratio and elevation of intracellular Ca2+(38). Several reports suggest that activation of Ca2+/calmodulin-dependent protein kinase β (CaMKKβ) plays a physiological role in activating AMPK in mammalian cells. Since KISS1R activation increases intracellular Ca2+(41), it is likely that KISS1R activates AMPK via the CaMKKβ pathway.
[0053] PPARy expression is low in healthy livers but rises significantly in NAFLD and contributes to the development of hepatic steatosis by regulating de novo lipid metabolism. Furthermore, PPARy plays a major role in directly upregulating genes/pathways involved in TG synthesis such as Gykl, the key enzyme in fatty acid esterification, Cd36, the fat importer, and Mogatl, which esterifies monoacylglycerol to form diacylglycerol (DAG), the precursor of TG. Suppression of PPARy-dependent MOGAT1 expression inhibits hepatic steatosis, whereas CD36-dependent FFA uptake and MOGAT mediated fatty acid esterification promote steatosis. PPARy and MOGAT overexpression has also been observed in humans with NAFLD. The finding that TAK inhibited the expression of PPARy, CD36, and MOGAT1 has significant clinically implications, given the established link between DAG negatively regulating hepatic insulin sensitivity. In conclusion, our study suggests that the hepatic KP/KISS 1R signaling system inhibits hepatic de novo lipogenesis in hepatocytes via a mechanism involving AMPK-PPARy signaling, further suggesting that activation of KISS 1R signaling is a promising therapeutic target for the treatment of NAFLD.
[0054] Specifically, the pre-clinical studies described here use an established mouse model of NAFLD in which male mice are fed a Western high fat diet (HFD, 60% kcal fat), compared to a regular diet (RD, 4% kcal fat). Using this model, we found that the sub-cutaneous administration of the kisspeptin analog (TAK-448) protected against the development of NAFLD compared to mice treated with Vehicle (PBS) control (see
[0055] In addition, in mice fed HFD bearing a deletion of liver KisslR (LKO), a greater increase in body weight (
[0056] Kisspeptin also has actions on the brain, regulating the central reproductive system. Chronic administration of kisspeptin results in suppression of sex steroid hormone synthesis. This is mimicked by the long-acting TAK-448 which has been used in men with prostate cancer (two Phase 1 clinical trials) to lower testosterone levels. Additionally, TAK-448 under a different name (MVT-602) is being tested by MYOVANT to treat infertility in women and is currently in Phase 1 and Phase 2 clinical trials.
[0057] TAK-448 is an oligopeptide analog of the fully active 10-amino acid C terminus of kisspeptin-54 (kisspeptin-10). It has a half-life of 4 hours in the blood, in contrast to kisspeptins which are rapidly degraded within minutes. TAK-448 is a potent Kisspeptin 1 receptor (KISS1R, or GPR54) agonist. KISS 1R is a G protein-coupled receptor that binds kisspeptins. Kisspeptin is encoded by the metastasis suppressor gene KISS 1, which is expressed in a variety of endocrine and gonadal tissues. Kisspeptin and KISS 1R play key roles in mammalian reproduction due to their involvement in the onset of puberty and control of the hypothalamic-pituitary-gonadal axis. It has been used in trials studying the treatment of prostate cancer, low testosterone, prostatic neoplasms, and hypogonadotropic hypogonadism. The structure of TAK-448 is:
##STR00001##
[0058] See Table 1, below, for sequences of interest.
TABLE-US-00001 Peptide Sequences Name Sequence SEQ ID NO Mouse Kisspeptin-52 Ser-Ser-Pro-Cys-Pro-Pro-Val-Glu-Gly-Pro-Ala-Gly-Arg-Gln-Arg-Pro-Leu-Cys-Ala-Ser-Arg-Ser-Arg-Leu-Ile-Pro-Ala-Pro-Arg-Gly-Ala-Val-Leu-Val-Gln-Arg-Glu-Lys-Asp-Leu-Ser-Thr-Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Tyr-NH.sub.2 1 Human Kisspeptin-54 Gly-Thr-Ser-Leu-Ser-Pro-Pro-Pro-Glu-Ser-Ser-Gly-Ser-Arg-Gln-Gln-Pro-Gly-Leu-Ser-Ala-Pro-His-Ser-Arg-Gln-Ile-Pro-Ala-Pro-Gln-Gly-Ala-Val-Leu-Val-Gln-Arg-Glu-Lys-Asp-Leu-Pro-Asn-Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Phe-NH.sub.2 2 Human Kisspeptin-10 Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Phe-NH2 3 TAK-448 Ac-D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Leu-Arg(Me)-Trp-NH.sub.2 4
[0059] Subjects that can be treated according to embodiments of the invention include any mammal, including laboratory animals, companion animals, farm animals, zoo animals, and the like, including humans. Preferred subjects are humans and rodents. A suitable subject for the invention preferably is a human that is suspected of having, has been diagnosed as having, or is at risk of developing a disease that can be ameliorated, treated or prevented by administration of TAK-448, including any disease or condition involving fatty liver or accumulation of fat in the liver.
[0060] TAK-448 can be administered to prevent, delay, slow, reverse, or halt disease progression in any disease or condition involving accumulation of fat in the liver or fatty liver. Such conditions include, but are not limited to, (1) NAFLD, (2) NASH, (3) fatty liver disease, (4) hepatitis, (5) liver fibrosis, (6) cirrhosis of the liver, (7) jaundice, (8) liver cancer, or (9) any condition where the liver of a subject contains 5% or more fat.
[0061] The term “NAFLD/NASH,” as used herein, refers to non-alcoholic fatty liver disease and/or non-alcoholic steatohepatitis. NAFLD encompasses a spectrum of pathological conditions, including steatosis (fatty liver), nonalcoholic steatohepatitis (NASH), fibrosis and cirrhosis (excessive scarring of liver).
[0062] The compounds contemplated for use in the invention described herein include, but are not limited to, TAK-448 or any conservative variant thereof, and kisspeptin-10 or any conservative variant thereof. A conservative variant is a peptide of about 90% or more identity of sequence, or a chemically modified peptide as described above. For example, a conservative variant of kisspeptin-10 includes deletions, substitutions, and additions of kisspeptin-10, as well as chemical variants, such as, for example, those exemplified in Tables 2 through Table 6, below. A conservative variant of TAK-448 includes deletions, substitutions, and additions, of TAK-448, as well as chemical variants, such as, for example, those exemplified in Table 2 through Table 6, below.
TABLE-US-00002 Exemplary Compound Variants Compound Sequence/Structure SEQ ID NO Kisspeptin-10 Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Phe-NH2 5 Kisspeptin-10 Variant Trp-Asn-Trp-Asn-Ser-Phe-Ser-Leu-Arg-Phe-NH2 6 Kisspeptin-10 Variant Tyr-Asn-Trp-Arg-Ser-Phe-Gly-Leu-Arg-Phe-NH2 7 Kisspeptin-10 Variant Tyr-Asn-Trp-Asn-Ser-Phe-Leu-Arg-Phe-NH2 8 Kisspeptin-10 Variant Tyr-Asn-D-Trp-Asn-Ser-Phe-Gly-Leu-Arg (Me)-Phe-NH2 9 Kisspeptin-10 Variant Ac-Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Phe-NH2 10 TAK-448 Ac-D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Leu-Arg(Me)-Trp-NH.sub.2 11 TAK-448 Variant D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Leu-Arg(Me)-Trp-NH.sub.2 12 TAK-448 Variant Ac-D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Leu-Arg-Trp-NH.sub.2 13 TAK-448 Variant Ac-D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Ala-Arg(Me)-Trp-NH.sub.2 14 TAK-448 Variant Ac-D-Tyr-D-Trp-Asn-Ser-Phe-azaGly-Leu-Arg(Me)-Trp-CH.sub.3-NH.sub.2 15 TAK-448 Variant Ac-D-Tyr-D-Trp-Asn-Thr-Phe-Gly-Leu-Arg(Me)-Trp-NH.sub.2 16 TAK-448 Variant Ac-D-Tyr-D-Trp-Asn-Thr-Phe-azaGly-Arg(Me)-Trp-NH.sub.2 17
TABLE-US-00003 Sequences and Binding Affinities of Kisspeptin-10 Analogs Peptide Name Sequence IC50****, nM SEQ ID NO Kisspeptin-10 YNWNSFGLRF-NH2 1.0+/- 0.3 18 ANA1* ANWNSFGLRF-NH2 23.2 +/-14.3 19 ANA2* YAWNSFGLRF-NH2 145.1 +/- 138.0 20 ANA3* YNANSFGLRF-NH2 2.7 +/- 0.7 21 ANA4* YNWASFGLRF-NH2 43.5 +/- 15.5 22 ANA5* YNWNAFGLRF-NH2 0.8 +/- 0.4 23 ANA6* YNWNSAGLRF-NH2 109.5 +/- 89.8 24 ANA7* YNWNSFALRF-NH2 4.6 +/- 1.5 25 ANA8* YNWNSFGARF-NH2 77.4 +/- 10.0 26 ANA9* YNWNSFGLAF-NH2 42.3 +/- 6.7 27 ANA10* YNWNSFGLRA-NH2 --- 28 ANA11* FNWNSFGLRF-NH2 3.5 +/- 2.1 29 ANA12* YDWNSFGLRF-NH2 29.1 +/- 13.5 30 ANA13* YNWDSFGLRF-NH2 140.2 +/- 60.6 31 ANA14* YNWNTFGLRF-NH2 2.3 +/- 1.6 32 ANA15* YNWNSYGLRF-NH2 87.5 +/- 30.7 33 ANA 16* YNWNSFGIRF-NH2 39.9 +/- 8.1 34 ANA17* YNWNSFGLKF-NH2 9.8 +/- 2.6 35 ANA18* YNWNSFGLRH-NH2 378.4 +/- 266.0 36 ANA19* [dY]NWNSFGLRF-NH2 3.6 +/- 0.3 37 ANA20* YNWNS [dF]GLRF-NH2 252.9 +/- 144.0 38 ANA21* YNWNSFGLR[dF]-NH2 447.2 +/- 173.0 39 TAK-683 Ac-dYdWNTFazaGLR(Me)W-NH.sub.2 --- 40 Compound 2** Ac-YNWNSFGLRY-NH.sub.2 --- 41 Compound 3** Ac-YK(Palm-y-D)WGΨ[Tz]LRY-NH.sub.2 --- 42 Compound 4** Ac-YNK(Palm-γ-D)NSFGT[Tz]LRY-NH.sub.2 --- 43 Compound 5** Palm-γ-DYNWNSFG′P[Tz]LRY-NH.sub.2 --- 44 Compound 6** Palm-γ-DYNWNSFGT[Tz]LR[Me]Y-NH.sub.2 --- 45 Compound 7** Ac-YNWNSFGT[Tz]LR[Me]Y-NH.sub.2 --- 46 *Information from Curtis et al., 2009; **Information from Decourt et al., 2016; ****IC.sub.50 (means +/- SE; n = 3-5) against [125I]KP-54 binding to KISS1R in CHO-KISS1R membrane preparations. Each receptor binding assay was carried out in triplicate.
##STR00002##
##STR00003##
##STR00004##
##STR00005##
TABLE-US-00004 Kisspeptin Analogs, Nishizawa et al Structures, biological activities, and HPLC retention times of Kp analogs** R-AA.sup.45-AA.sup.46-AA.sup.47-AA.sup.48-AA.sup.49-Phe-AA.sup.51-Leu-AA.sup.53-AA.sup.59-NH.sub.2 Compound R AA.sup.45 AA.sup.46 AA.sup.47 AA.sup.48 AA.sup.40 AA.sup.51 AA.sup.53 AA.sup.54 Agonist activity EC.sub.50 (nM) RP-HPLC .;< (min) metastin(45-54) 1 2 3 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 H H H Ac 3-(indol-3-yl)propionyl 3-phenylpropionyl 3-(4-pyridylipropionyl 3-(indol-3-yl)propionyl 3-(indol-3-yl)propionyl H Ac n-hexonoyl benzoyl benzyl 3-(indol-3-yl)propionyl benzoyl 2-pyridylcarbonyl 3-pyridylcarbonyl 4-pyridylcarbonyl 3-furanylcarbonyl 2-pyrolylcarbonyl 4-imidazolylcarbonyl phenylacetyl cyclohexanoyl propionyl isobutyryl cyclopropylcarbonyl Tyr Asn o-Tyr o-Tyr Trp o-Pya(4) Trp Trp Trp Asn Asn Asn Asn Asn Asn Asn Asn Ser Ser Ser Ser Ser Ser Ser Ser Ser Gly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly azaGly Arg Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Arg(Me) Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Phe Trp Trp Trp Trp Trp Trp Trp Trp Trp Trp Trp Trp 0.087 0.27 (0.074-0.99) 0.057 (0.018-0.17) 7.7 (2.2-28) 2.1 (0.96-4.6) 0.13 (0.020-0.86) 0.17 (0.067-0.44) 1.5 (0.48-4.8) 8.2 (3.4-20) 0.62 (0.16-2.3) 130 (93-170) 0.33 (0.19-0.57) 1.4 (0.44-4.3) 0.60 (0.28-1.2) 0.89 (0.23-3.4) 0.022 (0.0072-0.066) 0.024 (0.0073-0.079) 0.037 (0.0099-0.14) 0.16 (0.037-0.67) 0.068 (0.023-0.20) 0.11 (0.021-0.58) 0.23 (0.18-0.31) 0.24 (0.062-0.90) 0.27 (0.048-1.5) 0.12 (0.017-0.82) 0.13 (0.038-0.49) 0.058 (0.013-0.26) 0.028 (0.0081-0.096) 5.54 5.03 5.76 5.95 5.90 4.51 6.17 6.58 4.29 5.02 6.66 6.21 5.20 6.67 6.29 6.02 4.69 4.48 5.88 5.91 4.47 6.49 6.70 5.52 5.88 5.70 .sup.a EC.sub.50 values [nM (95% confidence interval)] of [Ca.sup.2+] increasing activities of all peptide analogs were evaluated in CHO cells expressing human KISSIR. .sup.b Retention times (t.sub.ret) of peptide analogs were measured via RP-HPLC Elution conditions linear density gradient on Merck Chromolith* Performance RP-18e (4.6 % 100 mm), with eluents A/B = 95/5-35/65 (10 min), using 0.1% TFA in water as eluent A and 0.1% TFA-containing acetonitrile as eluent B) flow rate: 3.0 mL/min.
[0063] acceptable hydrate, solvate, acid or salt, and can be amorphous or in any crystalline form, or as an oil or wax. Any pharmaceutically acceptable salt can be used, as may be convenient. Generally, these salts are derived from pharmaceutically and biologically acceptable inorganic or organic acids and bases or metals. Examples of such salts include, but are not limited to: acetate, adipate, alginate, ammonium, aspartate, benzoate, benzenesulfonate (besylate), bicarbonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, carbonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, magnesium, maleate, malonate, methanesulfonate (mesylate), 2-naphthalenesulfonate, nicotinate, nitrate, oxalate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, potassium, propionate, salicylate, sodium, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate (tosylate) and undecanoate salts.
[0064] The compounds also include any or all stereochemical forms of the therapeutic agents (i.e., the R and/or S configurations for each asymmetric center). Therefore, single enantiomers, racemic mixtures, and diastereomers of the therapeutic agents are within the scope of the invention. Also within the scope of the invention are steric isomers and positional isomers of the therapeutic agents. The therapeutic agents of some embodiments are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, therapeutic agents in which one or more atom is replaced by, for example, deuterium, tritium, .sup.13C, .sup.14C (or any isotopic labels as commonly used in the art such as phosphorus, calcium, iodine, chlorine, bromine, or any other convenient element for isotopic labeling) are within the scope of this invention.
[0065] Compounds such as TAK-448, and the other compounds according to embodiments of the invention, can be administered to the subject by any suitable route or method as known in the art. Suitable routes of admiration include, but are not limited to, oral administration, intravenous, intraarterial, intrathecal, intraperitoneal, intradermal, subcutaneous, intramuscular or intraperitoneal injections, rectal or vaginal administration by way of suppositories or enema, transmucosal, transdermal, buccal, nasal, inhalation, sublingual, topical, or local administration directly into or onto a target tissue, or administration by any route or method that delivers a therapeutically effective amount of the drug or composition to the cells or tissue to which it is targeted. When administration is oral, the dosage form preferable is a delayed release or other formulation that allows the compound to be absorbed prior to degradation of a peptide or peptide analog compound. Preferably, the methods of embodiments of this invention involve administration subcutaneously or intravenously. The administration can be given by transfusion or infusion, and can be administered by an implant, an implanted pump, or an external pump, or any device known in the art.
[0066] In preferred method embodiments, the compounds described herein are formulated and are administered as a pharmaceutical composition that includes a pharmaceutically acceptable carrier and one or more pharmaceutical agent, including one or more of the inventive compounds described herein, and including one or more of the inventive compounds described herein optionally with an additional agent, such as a fatty liver reducing drug of the same or another class, for a combination therapy.
[0067] Exemplary compounds for use in a combination treatment, simultaneously or sequentially with the compounds of this invention, such as TAK-488, include but are not limited to an ACC inhibitor, AMPK, AKR-001, aramchol, ASC40, AZD7687, BI-1467335, BIO89-100, BMS-986036, canagliflozin, cenicriviroc, cilofexor, dapagliflozin, DGATEDP-305, elafibranor, elobixibat, empagliflozin, emricasan, exenatide, EYP001a, FALCON1 (PEG-FGF21, an FASN inhibitor, fenofibrate, firsocostat, an FXR agonist, GR-MD-02, IONIS-DGAT2.sub.Rx, ipragliflozin, licogliflozin, liraglutide, luseogliflozin, LY3202328, MET409, MGL-3196, MK-4074, MSDC-0602K, MT-3995, NGM282, nidufexor, OAT-1251, obeticholic acid, OCA, OWL833, PF-05221304, PF-06835919, PF-06865571, PF-06882961, pioglitazone, PX-102, PXL770, PXS-5153A, seladelpar, selonsertib, semaglutide, simtuzumab, TERN-101, TERN-201, troifexor, TTP273, vitamin D, vitamin E, VK2809, and volixibat. In addition, treatment by administration with the compounds TAK-488, kisspeptin, and their variants, can be accompanied by a first line treatment including diet and exercise changes and weight loss.
[0068] A pharmaceutically acceptable carrier refers to any convenient compound or group of compounds that is not toxic and that does not destroy or significantly diminish the pharmacological activity of the therapeutic agent with which it is formulated. Such pharmaceutically acceptable carriers or vehicles encompass any of the standard pharmaceutically accepted solid, liquid, or gaseous carriers known in the art, such as those discussed in the art. A suitable carrier depends on the route of administration contemplated for the pharmaceutical composition.
[0069] A non-inclusive list of carriers and vehicles contemplated for use with the invention follows: fillers, diluents, adjuvants, pH adjusters, buffers, preservatives, binders and disintegrants, solvents, lipids, liposomes, emulsions, suspensions, and containers (e.g., ampoules, bottles, pre-filled syringes, and the like).
[0070] Liquid carriers can be in the form of a solution, suspension, emulsion, oil, gel, and the like, and include, for example aqueous solution (e.g., saline solutions, phosphate-buffered saline solutions, Ringer’s, and the like), oil-in-water or water-in-oil emulsions, liposomes, and the like. Gaseous carriers can include, for example air, oxygen, fluorocarbons, dispersing agents, and the like. Solid carriers can include, for example, starch (e.g., corn starch, potato starch, rice starch, and the like), cellulose (e.g., microcrystalline cellulose, and the like), sugars (e.g., lactose, sucrose, glucose, and the like), clays, minerals (e.g., talc, and the like), gums, flavorings, preservatives, colorings, taste-masking agents, sweeteners, lipids, oils, solvents, saline solutions, emulsifiers, suspending agents, wetting agents, dispersants, binders, lubricants (e.g., magnesium stearate and the like), salts, pH modifiers (e.g., acids or bases), buffers, and the like.
[0071] Pharmaceutical compositions suitable for injection comprise sterile aqueous solutions (where water soluble) or dispersions, suspensions or emulsions, and sterile powders or granules for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers comprise physiological saline, bacteriostatic water, Cremophor EL™ (BASF™, Parsippany, N.J.) or (e.g., phosphate) buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the selected particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some cases, isotonic agents are included in the composition, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride. Prolonged absorption of an injectable composition can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
[0072] Extended and sustained release compositions also are contemplated for use with and in the inventive embodiments. Thus, suitable carriers can include any of the known ingredients to achieve a delayed release, extended release or sustained release of the active components.
[0073] Routes of administration are determined by the person of skill according to convenience, the health and condition of the subject to be treated, and the location and stage of the condition to be treated. Therefore, the forms which the pharmaceutical composition can take will include, but are not limited to: tablets, capsules, caplets, lozenges, dragees, pills, granules, oral solutions, powders for dilution, powders for inhalation, vapors, gases, sterile solutions or other liquids for injection or infusion, transdermal patches, buccal patches, inserts and implants, rectal suppositories, vaginal suppositories, creams, lotions, oils, ointments, topical coverings (e.g., wound coverings and bandages), suspensions, emulsions, lipid vesicles, and the like.
[0074] Treatment regimens include a single administration or a course of administrations lasting two or more days, including a week, two weeks, several weeks, a month, two months, several months, a year, or more, including administration for the remainder of the subject’s life. The regimen can include multiple doses per day, one dose per day or per week, for example, or a long infusion administration lasting for an hour, multiple hours, a full day, or longer.
[0075] Suitable dosages can be determined by the treating physician depending on the patient, the condition to be treated, and the severity of the condition to be treated. Such dosages can include any amount, dosage, or dosage regimen that produces a desired result. Dosage amounts per administration include any amount determined by the practitioner, and will depend on the size of the subject to be treated, the state of the health of the subject, the route of administration, the condition to be treated or prevented, and the like.
[0076] In general, it is contemplated that for the majority of subjects, a dose in the range of about 0.01 nmol per hour to about 10 nmol per hour is suitable, preferably about 0.1 nmol per hour to about 5 nmol per hour, are useful, given over a course of about 1 hour to about 72 hours, or about 24 hours to about 48 hours, or over a period of days, weeks, or longer. This dose can be administered weekly, daily, or multiple times per day, or as a continuous infusion, transdermal formulation, or depot formulation.
[0077] In addition, a single injected dose of about 0.01 mg, about 0.02 mg, about 0.025 mg, about 0.05 mg, about 0.1 mg, about 0.2 mg, about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, or more can be administered. Alternatively, a single injected dose of about 0.002 .Math.mol/kg, about 0.004 .Math.mol/kg, about 0.008 .Math.mol/kg, about 0.01 .Math.mol/kg, about 0.025 .Math.mol/kg, about 0.5 .Math.mol/kg, about 0.75 .Math.mol/kg, about 1 .Math.mol/kg, about 2 .Math.mol/kg, about 5 .Math.mol/kg, about 8 .Math.mol/kg, about 10 .Math.mol/kg, or more can be administered.
4. Summary of Results
[0078] Hepatic Kiss1R knock-out mice fed with HFD (Western high fat diet, 60% kcal fat) have a greater increase in body weight, liver steatosis and liver triglycerides when compared to littermate controls on HFD, despite no change in food intake. This implicates the pathologic role of kisspeptin/Kiss1R pathway in the pathogenesis of NAFLD and other fatty liver conditions.
[0079] Hepatic Kiss1R knock-out mice were also glucose intolerant and insulin resistant, compared to controls (all on HFD). The livers from hepatic KISS 1R knock-out mice livers displayed a significant increase in biochemical markers for NASH/fibrosis (e.g. TGFβ, collagen), and proinflammatory cytokines (Interleukins (IL)-1α, Mip2, IP10), compared to controls (all on HFD).
[0080] Subcutaneous administration of TAK-448 protected HFD-fed mice against the development of NAFLD compared to mice treated with Vehicle (PBS) control.
[0081] TAK-448 administered for one month to HFD-fed mice prevented the accumulation of liver triglycerides and the rise in free fatty acids and glycerol (triglyceride building blocks) in the blood. These changes occurred without a change in food intake, compared to vehicle-treated controls on HFD who developed NAFLD.
[0082] TAK-448 treatment also protected against peripheral fat accumulation and insulin resistance.
5. Examples
[0083] This invention is not limited to the particular processes, compositions, or methodologies described, as these may vary. The terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein, are incorporated by reference in their entirety; nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
Example 1: Methods and Materials
A. Animals.
[0084] Animal studies were approved according to guidelines established by the Institutional Animal Care and Use Committee at Rutgers University. Kiss1rAlb-Cre knockout mice were generated by crossing a male Alb-Cre+/- to a female Kiss1rrf/fl. Alb-Cre mice were purchased from Jackson Laboratories™. The Kiss1rrf/fl mouse was generated according to know methods. The F1 generation was Kiss1rfl/+, AlbCre+/- or Kiss1rfl/+, AlbCre-/-. The Kiss1rfl/+, AlbCre+/- was back-crossed to the Kiss1rfl/fl to generate Kiss1rfl/fl, AlbCre+/- (liver knockout: LKO) and Kiss1rfl/fl (littermate controls). Mice were housed in a pathogen-free barrier facility maintained on a 12-hour light/dark cycle.
[0085] Four-week-old male LKO and control mice were fed a high fat diet (HFD: 60% kcal fat, 0.2796% cholesterol, 20% calories from carbohydrate (Research Diets™ catalog #D12492, New Brunswick, NJ) or regular control chow diet (RD). Mice were group-housed and provided food and water ad libitum. Five months after commencing the designated diet, a glucose tolerance test was performed, followed by insulin tolerance test a week later. Total body weights were measured weekly for 24 weeks after commencing the designated diet and then animals were euthanized.
B. Administration of KP-Analog TAK-488.
[0086] C57BL6/J male mice (4 weeks of age) were maintained on a HFD or RD for 6 weeks and then fasting blood glucose was measured. An Azlet™ mini-osmotic pump model 2004 containing TAK-448 (0.3 nmol/hour) or PBS (vehicle controls) were inserted subcutaneously into the flanks of mice, according to known methods. Animals were treated for 4 weeks unless otherwise indicated and maintained on RD or HFD (total of 10 weeks).
C. Metabolic Tests.
[0087] Blood glucose measurements were obtained via a small nick in the lateral tail vein using a glucometer (Bayer Contour™). For glucose tolerance tests, mice were fasted for 12 hours and then injected intraperitoneally with D-glucose (1 g/kg). For the insulin tolerance tests, mice were fasted for 6 hours and then injected intraperitoneally with insulin (0.5 U/kg; Novo Nordisk™).
D. Metabolic Cage Assessments.
[0088] Mice where individually housed in an 8-chamber Clinical Laboratory Animal Monitoring System (CLAMS) with controlled light and feeding. Carbon dioxide output, oxygen update, respiratory exchange ratio (RER), ambulatory movement, and feeding were measured over a 4-day period.
E. Insulin, Glycerol, Triglycerides, ALT, FFA, and Cholesterol Measurements.
[0089] Serum insulin levels were measured using the Ultra-Sensitive Mouse Insulin ELISA Kit (Crystal Chem™). Serum glycerol levels were measured using the Glycerol Assay Kit (Sigma™). Liver triglycerides were measured using the triglyceride quantification kit (MBL™ international Catalog # JM-K622-500). Free fatty acids were measured using the Free Fatty Acid Quantification Kit (Sigma™, MAK044-1KT). ALT levels were measured using Liquid ALT (SGPT) Reagent set according to the manufacturer’s instructions; cholesterol levels were measured using the Cholesterol set according to the manufacturer’s instructions.
F. Immunoblot Assays.
[0090] Immunoblot assays were conducted according to known methods. Mouse liver tissue or primary hepatocytes were homogenized in RIPA lysis buffer containing protease inhibitors and centrifuged at 4° C.; the protein expression in lysates was analyzed by Western blot analysis. Protein was separated using SDS-PAGE and probed using the following antibodies: Abcam™ (rabbit anti-KISS1R 1:1000; rabbit anti-MOGAT1 1:1000), Cell Signaling Technology™ (rabbit anti-pAMPK, rabbit anti-AMPK, rabbit anti-pACC, rabbit anti-FASN, rabbit anti-PPAR-y, rabbit anti-CD36, and rabbit anti-GYK all 1:1000), Proteintech™ (rabbit anti-KISS1 1:750). Mouse anti-β actin (1:5000, Thermo Fisher Scientific™) or anti-vinculin (1:1000, Bio-Rad™) were used for loading control. Protein was then incubated for 1 hour in horseradish peroxidase (HRP)-conjugated rabbit (1:2500, Cell Signaling Technology™) or mouse (1:2500, Cell Signaling Technology™) secondary antibody. Blots were imaged by chemiluminescence with ChemiDoc™ Touch imaging system (Bio-Rad™), SuperSignal and West Dura Extended Duration Substrate (Thermo Scientific™). Protein levels were quantified using Image Lab Software (Bio-Rad™).
G. Quantitative Real-Time PCR (qPCR).
[0091] Total RNA was extracted from cells using the Trizol method. Reverse transcription was done according to manufacturer’s instructions using iScript RT Supermix (Bio-Rad™). Gene expression was determined using SYBR green real-time qPCR (RT-qPCR) as described previously using primers shown in Table 7, below. The following primers were purchased from BioRad™ (validated PCRPrime™ primers): Srebpl, Aqp3, Aqp9, Gpat2, Agpat2, Dgat1, Dgat2, Mogat1, Slc2a2, Dgkg, Dgkh, Lgpat1, Sod1, Sod2, Gss, Ucp2, and Gpam. Il-13 was purchased from Qiagen™ (QT00099554). Primers for Srebf1, Aqp3, Aqp9, Gpat2, Agpat2, Dgat1, Dgat2, Mogat1, Slc2a2, Lgpat1, Sod1, Sod2, Gss, Ucp2, and Gpam are pre-made and were purchased from BioRad™.
TABLE-US-00005 Primer Sequences Name Sequence Forward/ Reverse SEQ ID NO Lfabp GCAGAGCCAGGAGAACTTTGAG Forward 47 Lfabp TTTGATTTTCTTCCCTTCATGCA Reverse 48 Cd36 GATGACGTGGCAAAGAACAG Forward 49 Cd36 TCCTCGGGGTCCTGAGTTAT Reverse 50 Acaca ATGGGCGGAATGGTCTCTTTC Forward 51 Acaca TGGGGACCTTGTCTTCATCAT Reverse 52 Fasn GGAGGTGGTGATAGCCGGTAT Forward 53 Fasn TGGGTAATCCATAGAGCCCAG Reverse 54 Gyk1 ATCCGCTGGCTAAGAGACAACC Forward 55 Gyk1 TGCACTGGGCTCCCAATAAGG Reverse 56 G6pc AAAAAGCCAACGTATGGATTCCG Forward 57 G6pc CAGCAAGGTAGATCCGGGA Reverse 58 Pckl AGCATTCAACGCCAGGTTC Forward 59 Pck1 CGAGTCTGTCAGTTCAATACCAA Reverse 60 Gpd1 CCACTGTTTTGGGACTCTCT Forward 61 Gpd1 CGGGTGTGTTCTTCAAAGTC Reverse 62 Mip2 CCCAGACAGAAGTCATAGCCAC Forward 63 Mip2 GCCTTGCCTTTGTTCAGTATC Reverse 64 Mcpl AATGAGTAGCAGCAGGTGAGTG Forward 65 Mcpl GAAGCCAGCTCTCTCTTCCTC Reverse 66 Il1a CGCTTGAGTCGGCAAAGAAA Forward 67 Il1a TGATACTGTCACCCGGCTCT Reverse 68 Ip10 AAGTGCTGCCGTCATTTTCT Forward 69 Ip10 GTGGCAATGATCTCAACACG Reverse 70 Tgfb TGACGTCACTGGAGTTGTACGG Forward 71 Tgfb GGTTCATGTCATGGATGGTGC Reverse 72 Kiss1r CTGCCACAGACGTCACTTTC Forward 73 Kiss1r ACATACCAGCGGTCCACACT Reverse 74 Kiss1 AGCTGCTGCTTCTCCTCTGT Forward 75 Kiss1 GCATACCGCGATTCCTTTT Reverse 76 Ppary CGACATGAGTTCCTTTATGATGGG Forward 77 Ppary TGTGATCTCTTGCACGGCTT Reverse 78 Colla2 GCAGGGTTCCAACGATGTTG Forward 79 Colla2 GCAGCCATCGACTAGGACAGA Reverse 80 Timpl CCTTGCAAACTGGAGAGTGACA Forward 81 Timpl AGGCAAAGTGATCGCTCTGGT Reverse 82 Il1b CAACCAACAAGTGATATTCTCCATG Forward 83 Il1b GATCCACACTCTCCAGCTGCA Reverse 84 Sma ACTGGGACGACATGGAAAAG Forward 85 Sma GTTCAGTGGTGCCTCTGTCA Reverse 86 Rpl13a GCTGCTCTCAAGGTTGTTCG Forward 87 Rpl13a CCTTTTCCTTCCGTTTCTCC Reverse 88
H. Histological Analysis.
[0092] Liver tissue was immediately fixed in 10% neutral formalin after mice were euthanized. Tissue was processed for histology by the Research Pathology Services at Rutgers University. Livers were sectioned into 5 .Math.m thick sections and stained with hematoxylin and eosin. Sections were examined by light microscopy for histopathological changes.
I. Metabolomic Analysis by Liquid Chromatography-Mass Spectrometry (LC-MS).
[0093] Metabolomics analysis of serum and liver by LC-MS was conducted according to known methods. LC-MS analysis of cell metabolites was conducted on Q Exactive Plus Hybrid Quadrupole Orbitrap mass spectrometer (Thermo Fisher Scientific™) and with hydrophilic interaction chromatography. Data was obtained using the MAVEN software with each labeled isotope (mass accuracy window: 5 ppm). Labeled isotope natural abundance and impurity were corrected using the AccuCor package coded in R.
J. Mouse Primary Hepatocyte Studies
[0094] Primary hepatocytes from mice were isolated according to known methods. Mice (wild-type, C57BL6) or LKO and littermate controls were anesthetized using a ketamine/xylazine mixture (Henry Schein™). The liver was cannulated via the hepatic portal vein and first perfused with 37° C. Kreb’s Ringer solution containing EGTA for 10 minutes. After the first wash, a second Kreb’s Ringer solution containing CaCl2 and LIBERASE (Roche™) was used until the liver was thoroughly perfused. Hepatocytes were filtered through a gauze mesh and resuspended in William’s Media E (Sigma™) with 10 % FBS (Sigma™), 200 nM dexamethasone (Sigma™), 5 mM pen/strep (Fisher™), 2 mM L-glutamine (Fisher™). Cells were plated at a density of 3 × 10.sup.5 on 6-well collagen-coated plates (Sigma™). Hepatocytes were left to recover overnight and then were serum starved for 3 hours prior to experiments. For free fatty acid (FFA) loading, 150 .Math.M oleic and 150 .Math.M palmitic acid was conjugated with 2% BSA (0.3 mM). Cells were loaded with FFA post isolation and left to recover overnight prior to serum starvation, and then treated with KP-10 or TAK.
K. Statistical Analysis.
[0095] Statistical significance between two groups was determined by unpaired two-tailed Student’s t test. For comparison among multiple groups, one-way analysis of variance followed by Dunnett’s multiple comparisons test was used. P value <0.05 is considered to be statistically significant. Graphs were generated with GraphPad™ Prism version 8.3.1 (San Diego, CA). Example 2: Initial Studies; Kisspeptin analog (TAK-448) administration protects against NAFLD and insulin resistance in a mouse model of NAFLD.
[0096] C57BL/6J mice fed high fat diet (HFD) or control regular diet (RD) for 12 weeks (4-5/group). TAK-448 (TAK) or Vehicle (Veh i.e., PBS controls) were administered for 4 weeks using an ALZET mini-osmotic pump implanted subcutaneously. See
Example 3: Initial Studies; Hepatic Knock-Out (KO) of Kiss1r Promotes Weight Gain, Hepatic Steatosis and Lipid Accumulation in a Mouse Model of NAFLD
[0097] Hepatic Kiss1r KO (LKO) were generated by crossing a Kiss1r fl/fl mouse to Alb-Cre mouse (Jackson Labs™). Littermate controls (Kiss1rfl/fl) and Kiss1r KO mice (3 weeks old, 10/group) were fed regular diet (RD) or HFD diet for 24 weeks. LKO mice had significant increase in body weight (
Example 4: Hepatic Kiss1R Knockouts Exhibit Increased Hepatic Steatosis in a Diet-Induced Mouse Model of NAFLD
A. Hepatic KISS1R Deficiency Aggravates Hepatosteatosis in Obese, Insulin Resistant Mice
[0098] To test whether or not hepatic KISS 1/KISS 1R is involved in the pathogenesis of NAFLD, hepatic Kiss1/Kiss1r expression was measured in a diet-induced mouse model of NAFLD. After 4-week old wild-type C57BL/6 mice were fed a high fat diet (HFD) for 8 weeks, Kiss1and Kiss1r mRNA levels were significantly increased in the livers. See
[0099] Next, to investigate a role for KISS 1R in regulating hepatic lipid metabolism, a liver-specific knockout of Kiss1r (LKO) was generated. Analysis of the LKO mice showed that Kiss1r expression, but not Kiss1, was significantly reduced. See
[0100] Interestingly, LKO mice exhibited lower heat expenditure compared to controls (
[0101] LKO mice also exhibited a decrease in muscle mass (
B. Hepatic KISS1R Deficiency Upregulates Genes Regulating Lipogenesis and Free Fatty Acid (FFA) Uptake
[0102] To elucidate the mechanism underlying hepatic lipid accumulation in LKO mice, the levels of hepatic regulators of fatty acid uptake (the fatty acid translocase, cluster of differentiation (Cd36), liver fatty acid-binding protein, (Lƒabp1)), and lipogenesis (peroxisome proliferator-activated receptor γ (PPARy, encoded by Pparg), sterol regulatory element binding protein-1 (SREBP1, encoded by Srebƒ1) and its downstream target fatty acid synthase (FAS, encoded by Fasn)) were measured. Under HFD conditions, there was a significant upregulation of all genes (
[0103]
[0104] Additionally, LKO livers exhibited suppressed phosphorylation of AMPK (
Example 5: Hepatic Kiss1R Knockouts Exhibit Increased Expression of Genes Regulating Triglyceride Synthesis and Enhanced Liver Lipids Levels
[0105] Triglyceride (TG) synthesis requires glycerol 3-phosphate (G3P), which can be formed by two methods: (a) the glycerol kinase (GYK)-dependent phosphorylation of glycerol and (b) by the glycerol 3-phosphate dehydrogenase (GPD1)-dependent reduction of dihydroxyacetone phosphate. See
[0106] Glycerol enters the liver primarily via aquaglyceroporins (AQP) such as AQP3 and AQP9 (see
[0107] In order to uncover metabolic differences contributing to the distinct phenotypes observed in LKO mice under HFD conditions, a global, untargeted metabolomic analysis of LKO and control livers was conducted. This revealed that various lipids including TGs, DAG, and phosphatidylcholine were significantly upregulated in HFD LKO livers (
[0108] Since the data revealed that the loss of hepatic KISS 1R resulted in an increase in lipid accumulation in hepatocytes under HFD, possibly via an upregulation of PPARy and its downstream gene targets, we asked whether this also occurred in livers of LKO mice maintained on RD. Interestingly, LKO mice maintained on RD did not develop steatosis or accumulate TGs. However, Pparg was significantly upregulated with no significant changes in Mogat1, Cd36, or Srebƒ1 (see
Example 6: Hepatic Kiss1r KO Mice Are Glucose Intolerant and Insulin Resistant
[0109] Since insulin resistance plays an important role in the pathogenesis of NAFLD, metabolic tests were performed to examine the effect of loss of hepatic KISS1R on blood glucose levels. Results showed that compared to HFD controls, HFD LKO mice had significantly higher fasting glucose levels, indicative of elevated gluconeogenesis (
[0110] Additionally, there was increased expression of key hepatic genes regulating gluconeogenesis, such as G6pc (which converts glucose-6-phosphate to glucose at the terminal step in gluconeogenesis), Pck1 (which converts oxaloacetate to phosphoenolpyruvate), and hepatic glucose transporter GLUT2 encoded by Slc2a2 in the LKO HFD livers (
[0111] NAFLD can progress to NASH, a state associated with increased inflammation, fibrosis and oxidative stress in the liver. We observed that in LKO mice, after 24 weeks of HFD, there was an upregulation of various markers for inflammation associated with NAFLD such as cytokines macrophage inflammatory protein 2 (Mip2), interleukin 1 isoforms, IL1α and ILβ (encoded by Il1a and Il1b) and chemokines interferon gamma-induced protein 10 (Ip10) and monocyte chemoattractant protein (Mcp1), although the latter was not statistically significant. See
[0112] LKO mice also exhibited an increase in genes involved in NASH, that are upregulated in early stage of fibrosis. These included collagen (Col1a2) and transforming growth factor β (Tgƒb1). An increase in smooth muscle actin (Acta2) and tissue inhibitor of metalloproteinase 1 (Timp1) was also observed but this did not reach significance (see
Example 7: Kisspeptin-Analog, TAK-488, Treatment Protects Against Glucose Intolerance and Insulin Resistance in a Mouse Model of NAFLD
[0113] Based on the data obtained, we next determined the effect of enhanced KISS 1R signaling on the development of NAFLD. Wild-type C57BL6J mice (4 weeks of age) were placed on either RD or HFD for 6 weeks. Mice on HFD gained weight (
Example 8: Kisspeptin-Analog (TAK-488) Treatment Lowers Liver Steatosis, Circulating Free Fatty Acids and White Adipose Tissue Mass in a Mouse Model of NAFLD
[0114] In addition to its striking effects on body weights and glucose homeostasis, TAK treatment also protected against the development of steatosis in the HFD mice resulting in a significant decrease in liver and serum TGs (see
[0115] Mechanistically, TAK treatment under HFD conditions significantly reduced the hepatic expression of key regulators of TG synthesis such as PPARy, CD36 and MOGAT1 (
Example 9: Kisspeptin Inhibits De Novo Lipogenic Gene Expression and Stimulates AMPK to Inhibit Triglyceride Formation in Isolated Mouse Hepatocytes
[0116] Since our data revealed that KISS 1R signaling inhibits steatosis in vivo, a direct effect of KP on hepatic lipogenesis was examined using primary mouse hepatocytes cultured in the presence or absence of a mixture of FFAs (150 .Math.M palmitate and 150 .Math.M oleate conjugated to bovine serum albumin (BSA) carrier. KP (100 nM) or TAK (3 nM) treatment of FFA loaded hepatocytes isolated from wild-type animals substantially decreased TG accumulation (
[0117] Phosphorylation of ACC reduces its activity, thereby inhibiting de novo lipogenesis (see
REFERENCES
[0118] All references listed below and throughout the specification are hereby incorporated by reference in their entirety.
[0119] 1. U.S. Pat. No. 7,625,869 to Takeda. [0120] 2. Dudek et al., Frontiers Endocrinol., 9(145):1-8, 2018. [0121] 3. Wang et al., Frontiers Physiol., 9(209): 1-13, 2018. [0122] 4. Song et al., Cell Metab., 19(4):667-681, 2014. [0123] 5. Tolson et al, J. Clin. Invest., 124(7):3075-3079, 2014. [0124] 6. Wolfe and Hussain, Frontiers Endocrinol. (Lausanne), 9(184), 2018. [0125] 7. International Application No. PCT/JP2007/071169. [0126] 8. Machado Cortez-Pinto, World J. Gastroenterol. 20(36):12956-12980, 2014. [0127] 9. Younossi et al., Hepatol., 64(1):73-84, 2016. [0128] 10. Younossi et al., Hepatol. 64(5):1577-1586, 2016. [0129] 11. Diehl and Day, N. Engl. J. Med., 377(21):2063-2072, 2017. [0130] 12. Wong et al., Gastroenterol., 148(3):547-555, 2015. [0131] 13. Bhattacharya and Babwah, Endocrinol., 156(4):1218-1227. 2015. [0132] 14. Seminara et al., N. Engl. J. Med., 349(17):1614-1627, 2003. [0133] 15. Shoji et al., Peptides, 31(10):1920-1925, 2010. [0134] 16. Foretz et al., Int. J. Mol. Sci., 19(9), 2018. [0135] 17. Browning and Horton, J. Clin. Invest., 114(2):147-152, 2004. [0136] 18. Jelen et al., J. Biol. Chem., 286(52):44319-44325, 2011. [0137] 19. Rodriguez et al., Cell Cycle., 10(10):1548-1556, 2011. [0138] 20. Puri et al., Hepatol., 46(4):1081-1090, 2007. [0139] 21. Zhang et al., Cell. Mol. Gastroenterol. Hepatol., 7(4):763-781, 2019. [0140] 22. Abdelmalek, Nat. Rev. Gastroenterol. Hepato., 13(12):685-686, 2016. [0141] 23. Diehl and Day, N. Engl. J. Med., 377(21):2063-2072, 2017. [0142] 24. Ng et al., Lancet, 384(9945):766-781, 2014. [0143] 25. Izzi-Engbeaya et al., Diabetes Obes. Metab., 20(12):2800-2810, 2018. [0144] 26. MacLean et al., J. Clin. Endocrinol. Metab. 99(8):E1445-E1453, 2014. [0145] 27. Asami et al., J. Med. Chem., 56(21):8298-8307, 2013. [0146] 28. Paradies et al., Antioxid. Redox. Signal. 20(12):1925-1953, 2014. [0147] 29. Paradies et al., World J. Gastroenterol., 20(39):14205-14218, 2014. [0148] 30. Petrosillo et al., Biochim. Biophys. Acta, 1767(10):1260-1267, 2007. [0149] 31. Tarantino et al., J. Clin. Med., 9(1), 2019. [0150] 32. Friedman et al., Nat. Med., 24(7):908-922, 2018. [0151] 33. Chang et al., Sci. Rep., 5:10096, 2015. [0152] 34. Haukeland et al., J. Hepatol., 44(6):1167-1174, 2006. [0153] 35. Mirea et al., Trends Mol. Med., 24(5):458-471, 2018. [0154] 36. Syn et al., Clin. Liver Dis., 13(4):565-580, 2009. [0155] 37. Rakhshandehroo et al., PPAR Res. 2010;2010. [0156] 38. Thompson et al., Am. J. Physiol. Endocrinol. Metab., 291(5):E1074-1082, 2006. [0157] 39. Calder et al., Endocrinol., 155(8):3065-3078, 2014. [0158] 40. Sozio et al., Am. J. Physiol. Gastrointest. Liver Physiol., 301(4):G739-G747, 2011. [0159] 41. Li et al., Cell. Metab., 13(4):376-388, 2011. [0160] 42. Nagarajan et al., Am. J. Physiol. Endocrinol. Metab., 316(4):E578-E589, 2019. [0161] 43. Munday et al., Eur. J. Biochem., 175(2):331-338, 1998. [0162] 44. Millar and Babwah, Neuroendocrinol., 101(3):193-210, 2015. [0163] 45. Lambert et al., Gastroenterol., 146(3):726-735, 2014. [0164] 46. Hwahng et al., Hepatol., 49(6):1913-1925, 2019. [0165] 47. Smith et al., Am. J. Physiol. Endocrinol. Metab., 311(4):E730-E740, 2016. [0166] 48. Green et al., Cell Signal., 23(12):2005-2012, 2011. [0167] 49. Willows et al., Biochem. J., 474(17):3059-3073, 2017. [0168] 50. Kirby et al., Pharmacol. Rev., 62(4):565-578, 2010. [0169] 51. Bedoucha et al., J. Hepatol., 35(1):17-23, 2001. [0170] 52. Memon et al., Endocrinol., 141(11):4021-4031, 2000. [0171] 53. Li et al., Proc. Natl. Acad. Sci. U.S.A., 111(36):13163-13168, 2014. [0172] 54. Mazzucotelli et al., Diabetes, 56(10):2467-2475, 2007. [0173] 55. Lasar et al., Cell. Rep., 22(3):760-773, 2018. [0174] 56. Guan et al., Genes Dev., 19(4):453-461, 2005. [0175] 57. Tontonoz et al., Cell, 93(2):241-252, 1998. [0176] 58. Lee et al., Proc. Natl. Acad. Sci. U.S.A., 109(34):13656-13661, 2012. [0177] 59. Yu et al., Sci. Rep., 6:29352, 2016. [0178] 60. Wolf Greenstein et al., J. Endocrinol., 232(1):107-121, 2017. [0179] 61. Hall et al., J. Lipid Res., 53(5):990-999, 2012. [0180] 62. Yu et al., Biochem. Biophys. Res. Commun., 460(3):715-720, 2015. [0181] 63. Savage et al., Physiol. Rev., 87(2):507-520, 2007. [0182] 64. Novaira et al., Mol. Endocrinol., 28(2):225-238, 2014. [0183] 65. Zajac et al., PLoS One, 6(6):e21599, 2011. [0184] 66. Cvetkovic et al., Endocrinol., 154(6):1999-2014, 2013. [0185] 67. Dragan et al., Cell Death Dis., 11(2):106, 2020. [0186] 68. Blake et al., Sci. Rep., 7:46525, 2017. [0187] 69. Kalemba et al., J. Biol. Chem., 294(48):18017-18028, 2019. [0188] 70. Curtis et al., Am. J. Physiol. Endocrinol. Metab. 298:E296-E303, 2009. [0189] 71. Nishizawa et al., Bioorg. Med. Chem. Lett. 29(4):654-658, 2019. [0190] 72. Decourt et al., Scientific Rep. 6:26908, 2016