Methods for controlling root parasitic weeds: inhibitors of seed germination in Striga
11324216 · 2022-05-10
Assignee
Inventors
Cpc classification
A01G7/06
HUMAN NECESSITIES
A01N31/08
HUMAN NECESSITIES
A01N37/38
HUMAN NECESSITIES
C07C49/255
CHEMISTRY; METALLURGY
C07C59/68
CHEMISTRY; METALLURGY
International classification
A01N37/38
HUMAN NECESSITIES
A01G7/06
HUMAN NECESSITIES
C07C59/68
CHEMISTRY; METALLURGY
C07C49/255
CHEMISTRY; METALLURGY
A01N35/02
HUMAN NECESSITIES
Abstract
Herbicides, systems, and methods for inhibiting germination of a root parasitic plant are provided. In particular, the herbicide includes an active compound represented by Formula I. In this regard, the active compound is selected to bind to an active site of strigolactone receptors in seeds of the root parasitic plant.
Claims
1. A method for inhibiting germination of root parasitic plants, the method comprising applying an effective amount of a composition of to a planting area comprising a host plant before seed germination of the root parasitic plants, wherein the composition comprises an active compound represented by Formula I: ##STR00020## wherein R.sub.1 is selected from the group consisting of: ##STR00021## a carboxyl group, and an acyl group, wherein when R.sub.1 is the carboxyl group or the acyl group, R.sub.1 includes a straight chain C.sub.1-C.sub.n alkyl group between O and the carboxyl group or the acyl group; R.sub.2 is a straight chain or branched C.sub.6-C.sub.10 alkyl group; and n is from 1 to 40, wherein the active compound binds to an active site of at least one strigolactone receptor in seeds of the root parasitic plant and the active compound is effective in inhibiting germination of the seeds without affecting germination of the host plant and wherein the root parasitic plants comprise at least one Orobanchaceae species or at least one Striga, species, or combinations thereof.
2. The method of claim 1, wherein applying the composition to the planting area comprising a host plant before seed germination of the root parasitic plant comprises applying the composition to the planting area during planting season.
3. The method of claim 1, wherein the active compound comprises at least one of ##STR00022## or any combination thereof.
4. The method claim 1, wherein the root parasitic plants comprise at least one Striga, species, selected from the group consisting of Striga asiatica, Striga aspera, Striga forbesii, Striga hermonthica, Striga gesnerioides, and combinations thereof.
5. The method of claim 1, wherein the host plant is a monocotyledonous crop, a dicotyledonous crop, or any combination thereof.
6. The method of claim 1, wherein the active compound is a Striga-specific herbicide.
7. The method of claim 1, wherein the active compound is, a Striga-specific agonist.
8. The method of claim 1, wherein the at least one strigolactone receptor comprises an ShHTL7 receptor, and wherein the active compound is selected to bind to an active site of the ShHTL7 receptor in seeds of the root parasitic plant.
9. The method of claim 5, wherein the host plant is selected from the group consisting of sorghum, maize, millet, rice, cowpea, tomato, tobacco, carrot, clover, cucumber, sunflower, and combinations thereof.
10. The method of claim 6, wherein the composition selectively inhibits Striga seed germination.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
(1) Having thus described the invention in general terms, reference will now be made to the accompanying drawings, which are not necessarily drawn to scale, and wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION
(13) The invention now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, this inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout. As used in the specification, and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.
(14) Plants in the Striga genus are root parasitic plants that infest, for example, cereals, threating food security worldwide, and particularly in Sub-Saharan Africa, the Middle East, India, and Europe. For germination, Striga seeds require host-released strigolactones (“SLs”) that are perceived by HYPOSENSITIVE to LIGHT (“ShHTL”) receptors. Efficacious control of Striga would need specific herbicides, such as SL antagonists that block ShHTLs but not the homologous host plant receptor DWARF14 (“D14”).
(15)
(16)
(17) Canonical SLs include a tricyclic lactone (ABC-ring) moiety that is connected via an enol ether bridge to a further lactone (D-ring). Based on the stereochemistry of the B/C junction, they are divided into the orobanchol and strigol-like family. In addition, there are non-canonical SLs, such as carlactone-like SLs, that vary in the moiety corresponding to the ABC-ring, i.e. non-canonical SLs lack one of the A, B, or C rings but have the enol ether D-ring moiety. Modifications of the ABC ring in canonical SLs and the presence of different structures that replace the ABC-ring in non-canonical SLs give rise to the diversity of natural SLs, some of which are illustrated in
(18) Apart from their role in inducing seeds germination of root parasitic weeds, SLs are plant hormones that shape the architecture of plants in accordance with the availability of minerals, such as phosphate. In addition, SLs are involved in the response of plants to abiotic stress. SLs are perceived by α/β hydrolase (D14 in rice) that hydrolyze these compounds leading to a covalent binding of the D-ring with the receptor. This process is accompanied by conformational changes and leads to the proteasome-mediated degradation of target proteins such as D53 in rice, which is supposed to inhibit the expression of SLs' inducible genes. The receptor itself is also subjected to degradation. In Arabidopsis, this process is mediated by the F-box protein More axillary growth 2 (MAX2; D3 in rice), a component of a Skp1-Cullin-F-box (SCF) E3 ubiquitin ligase complex that catalyzes the polyubiquitination of specific protein substrates, which are then degraded by the 26S proteasome. D14 acts as both a SL receptor and enzyme. The enzymatic activity is mediated by a conserved Ser-His-Asp catalytic triad that is needed for SL hydrolysis and also for the signaling function. Binding of the SL analog GR24 leads to thermal destabilization of the receptor, which requires the presence of the catalytic triad. The crystal structure of the Arabidopsis perception complex shows that the D14 protein forms an intermediate structure in which the D-ring—released due to the hydrolysis of SLs—is covalently bound to the His residue of the catalytic triad. This modification leads to a closed-state conformation with a small binding pocket.
(19) The protein KARRIKIN-INSENSITIVE2 (KAI2)/HYPOSENSITIVE to LIGHT (HTL)/D14-like is a close homolog to D14. However, KAI2 and D14 have different ligand specificity, as shown in
(20) The root parasitic weed Striga hermonthica, for example, has 12 SLs receptor candidates (named ShHTL1 to ShHTL11 and ShD14) with homology to AtD14 and AtKAI2. Functional tests of their activity revealed that ShHTL2 to 11 can hydrolyze the synthetic SLs GR24 and Yushimolactone Green (YLG), a fluorogenic agonist for D14. Functional complementation of the Arabidopsis kai2 mutant shows that ShHTL7 is a functional SL receptor that induces germination in Arabidopsis. Moreover, testing of different SLs in transformed Arabidopsis plants shows that ShHTL7 is 100 times more sensitive than the other ten SL receptors.
(21) Through applied effort, ingenuity, and innovation, the inventors have identified a family of active compounds that potently inhibit Striga seed germination without affecting the host plant. High-resolution X-ray structures reveal that these active compounds plug the deep catalytic pocket of, for example, ShHTL7, the most sensitive ShHTL. Structural and functional analyses explain the specificity of these active compounds. In this regard, the inventors have identified a way for combating Striga by blocking seed germination without harming the host plant.
(22) I. Herbicide for Inhibiting Germination of a Root Parasitic Plant
(23) In accordance with certain embodiments of the invention, an herbicide for inhibiting germination of a root parasitic plant is provided. In one embodiment, the herbicide comprises a carrier and a p-disubstituted phenyl ether having a straight chain or branched C.sub.6-C.sub.10 alkyl group, and a polyethylene oxide chain, carboxyl group, or acyl group attached to the ether. In certain embodiments, the herbicide includes a carrier and an active compound represented by Formula I:
(24) ##STR00007##
In Formula I, R.sub.1 is selected from the group consisting of a carboxyl group, an acyl group, and
(25) ##STR00008##
In some exemplary embodiments in which R.sub.1 is a carboxyl group or an acyl group, for example, R.sub.1 may further include a carbon chain between the ether O and the carboxyl group or the acyl group. For instance, in certain embodiments, the carbon chain may comprise a C.sub.1 to C.sub.n alkyl group. In further embodiments, R.sub.2 is a straight chain or branched C.sub.6-C.sub.10 alkyl group. In some embodiments, for example, R.sub.2 may be a tert-octyl group. In other embodiments, for instance, R.sub.2 may be a branched nonyl group (C.sub.9H.sub.19) as shown below:
(26) ##STR00009##
According to certain embodiments, for example, n is from 1 to 40. In other embodiments, for instance, n is from 5 to 20. In further embodiments, for example, n is from 8 to 16. In this regard, the active compound is selected to bind to an active site of at least one strigolactone receptor (e.g., ShHTL receptors) in seeds of the root parasitic plant.
(27) According to certain embodiments, the active compound may comprise (but is not limited to) at least one or any combination of:
(28) ##STR00010##
These compounds are nonionic surfactants having a hydrophilic polyethylene oxide chain and an aromatic hydrocarbon lipophilic or hydrophobic group. These compounds bind to ShHTL (e.g., ShHTL7) receptors by positioning the hydrophobic moiety entirely inside the active site pocket of the receptor. Such binding results from strong, covalent interactions including, but not limited to, hydrophobic interactions, hydrogen bonds, van der Waals forces, and the like.
(29) According to certain embodiments, for example, the herbicide may comprise the active compound and a carrier. In some embodiments, for instance, the herbicide may comprise the active compound at a concentration of about 1 to about 100 μM. In certain embodiments, the carrier may comprise an aqueous solution. In other embodiments, for instance, the carrier may be formulated with emulsifiers. In further embodiments, for example, the carrier may comprise nanoparticles. For example, the carrier may comprise at least one of water, liquid fertilizer (e.g., liquid urea-ammonium nitrate fertilizer (UAN)), petroleum, plant oils, dry fertilizer, clay, lime, vermiculite, ground corn cob, attapulgite (i.e. palygorskite), kaolinite, bentonite, starch polymers, and/or the like as understood by one of ordinary skill in the art.
(30) According to certain embodiments, the herbicide may be produced in any suitable formulation as understood by one of ordinary skill in the art (e.g., powder, spray, coating, etc.). For example, the herbicide may comprise at least one of an emulsifiable concentrate, and emulsifiable gel, a wettable powder, a soluble liquid, a soluble powder, a dry flowable, a flowable, a suspension concentrate, an aqueous suspension, a microencapsulated suspension, a capsule suspension, granules, pellets, and/or the like as understood by one of ordinary skill in the art. In some embodiments, the active compound and the carrier may be similarly formed so as to be suitable for the desired formulation of the herbicide as understood by one of ordinary skill in the art.
(31) According to certain embodiments, for example, the root parasitic plant may comprise at least one species from the family Orobanchaceae. In this regard, the root parasitic plant may be from one of any of the following genera: Aeginetia, Agalinis gerardia, Alectra, Asepalum Aureolaria, Bartsia, Bellardia, Boschniakia, Brandisia, Buchnera, Bungea, Buttonia, Castilleja, Centranthera, Christisonia, Cistance, Clevelandia, Conopholis, Cordylanthus, Cycnium, Cymbaria, Dasistoma, Epifagus, Escobedia, Eremitilla, Esterhazya, Euphrasia, Gerardina, Ghikaea, Gleadovia, Graderia, Harveya, Hedvergia, Hyobanche, Lamourouxia, Lathraea, Leptorhabdos, Leucosalpa, Lindenbergia, Macranthera, Magdalenaea, Mannagettaea, Melampyrum, Melasma, Micrargeria, Micrargeriella, Monochasma, Nesogenes, nothobarsia, Nothochilus, Odontites, Omphalotrix, Ophiocephalus, Orobanche, Orthocarpus, Parastriga, Parentucellia, Pedicularis, Petitmenginia, Phacellanthus, Phelypaea, Phtheirospermum, Physocalyx, Platypholis, Pseudobartsia, Pseudomelasma, Pseudosopubia, Pseudostriga, Pterygiella, Radamaea, Rehmannia, Rhamphicarpa, Rhaphispermum, Rhinanthus, Rhynchocorys, Schwalbea, Seymeria, Sieversandreas, Silviella, Siphonostegia, Sopubia, Spirostegia, Striga, Tetraspidium, Thunbergianthus, Tienmuia, Tozzia, Triaenophora, Triphysaria, Vellosiella, Xizangia, and Xylocalyx.
(32) In particular, in some embodiments, for instance, the root parasitic plant may comprise at least one Striga species. In this regard, the root parasitic plant may comprise, for example, one of the following species: Striga asiatica, Striga gesnerioides, Striga hermonthica, Striga aequinoctialis, Striga angolensis, Striga angustifolia, Striga aspera, Strica bilabiata, Striga brachylcalyx, Striga chrysantha, Striga dalzielii, Striga elegans, Striga forbesii, Striga gastonii, Striga gracillima, Striga hallaei, Striga hirsute, Striga indica, Striga junodii, Striga klingii, Striga latericea, Striga lepidagathidis, Striga lutea (a synonym for Striga asiatica), Striga macrantha, Striga passargei, Striga pinnatifida, Striga primuloides, Striga pubiflora, and Striga yemenica. In particular, in certain embodiments, for instance, the root parasitic plant may comprise at least one of Striga asiatica, Striga aspera, Striga forbesii, Striga hermonthica, Striga gesnerioides, or any combination thereof.
(33) In this regard, according to certain embodiments, for example, the herbicide may selectively inhibit Striga seed germination. In further embodiments, for instance, the herbicide may comprise a Striga-specific agonist.
(34) II. System for Inhibiting Germination of a Root Parasitic Plant
(35) In another aspect, systems for inhibiting germination of a root parasitic plant are provided. The system includes the herbicide described in detail above and a host plant. In this regard, the active compound of the herbicide may be selected to bind to an active site of at least one strigolactone receptor (e.g., ShHTL receptors) in seeds of the root parasitic plant without affecting germination of the host plant.
(36) In some embodiments, for example, the host plant may comprise at least one of a monocotyledonous crop, a dicotyledonous crop, or any combination thereof. Monocotyledonous crops may be any monocotyledonous plant harvested as a food source including, but not limited to, a cereal, sugarcane, etc. A cereal, for example, may be any grass cultivated for the edible components of its grain, which includes the endosperm, germ, and bran. Examples of cereals may include, but are not limited to, rice, wheat (e.g., einkorn, durum, kamut, etc.), millet, maize, sorghum, barley, rye, spelt, oats, triticale, fonio, teff, wild rice, and/or the like. Dicotyledonous crops may be any dicotyledonous plant harvested as a food source. Examples of dicotyledonous crops may include, but are not limited to, legumes, broccoli, cauliflower, turnips, cabbage, carrots, celery, parsley, rosemary, sage, thyme, apples, peaches, pears, plums, potatoes, tomatoes, peppers, tobacco, cucumber, sunflowers, and/or the like. Examples of legumes may include, but are not limited to, alfalfa, clover, peas, beans (e.g., kidney bean, lima bean, mung bean, broad bean, etc.), cowpeas (i.e. black-eyed peas), chickpeas, lentils, lupin beans, mesquite, carob, soybeans, peanuts, tamarind, and/or the like.
(37) III. Method for Inhibiting Germination of a Root Parasitic Plant
(38) In yet another aspect, methods for inhibiting germination of a root parasitic plant are provided. The method includes applying the herbicide described in detail above to a planting area for a host plant before seed germination of the root parasitic plant. In some embodiments, for example, the herbicide may be applied to the planting area for the host plant during planting season of the host plant. In other embodiments, for instance, the herbicide may be applied to the planting area of the host plant before planting season. In either scenario, the herbicide may be applied to the planting area such that the host plant will be able to grow, but the seeds of the root parasitic plant will not germinate.
EXAMPLES
(39) The following examples are provided for illustrating one or more embodiments of the present invention and should not be construed as limiting the invention.
(40) Testing Methods and Materials
(41) Protein Cloning, Expression, and Purification
(42) cDNA fragments, encoding the S. hermonthica ShHTL7 or the mutated version S95C (in which the serine in the active triad was changed to cysteine) flanked with BamHI and XhoI restriction sites, were cloned into the pGEX-6P1 (GE Healthcare) expression vector that enables the expression of GST fusion protein, using the corresponding restriction sites, as shown in Table 1 below. The plasmid obtained was then transformed into BL21 (DE3) E. coli cells. Cells were grown in LB medium at 37° C., and protein expression was induced at OD 0.6 at λ=600 nm by adding 150 μM isopropyl β-D-1-thiogalactopyranoside (IPTG). After induction, cultures were grown at 16° C. overnight under shaking. Cultures were then harvested, and pellets corresponding to 1 liter culture were re-suspended in 25 ml lysis buffer (50 mM Tris-HCl [pH 8.0], 200 mM NaCl, 3 mM DTT, 0.5% Triton X-100 or 0.5% Tween 20), followed by sonification. After centrifugation at 30,000 g for 30 min, supernatant was isolated, and the protein was purified using Glutathione Sepharose 4B resins (GE Healthcare). The GST tag was then removed by overnight incubation with Prescission Protease (GE healthcare) at 4° C. Proteins were further purified on a HiLoad16/60 Superdex 200 prep-grade gel filtration column (GE Healthcare) in a buffer containing 10 mM HEPES (pH 7.5), 50 mM KCl, 3 mM DTT. The purified protein was concentrated to 10 mg/ml and stored at −80° C.
(43) TABLE-US-00001 TABLE 1 Primers sequences used for protein cloning Primer name Sequence (5′-3′) Restriction site ShHTL7-F CGggatccATGAGCTCAATTGGATTAGCCC BamHI ShHTL7-F CCGctcgagTCAGTGATCCGTGATGTCCTG XhoI AtD14-F CGgaattcATGAGTCAACACAACATCTTAGAA EcoRI G AtD14-R ACGCgtcgacTCACCGAGGAAGAGCTCG SalI OsD14-F CGggatccATGCTGCGATCGACGCATCC BamHI OsD14-R CCGctcgagTTAGTACCGGGCGAGAGCGC XhoI ShHTL7-S95C-F CGggatccATGAGCTCAATTGGATTAGCCC BamHI ShHTL7-S95C-R CCGctcgagTCAGTGATCCGTGATGTCCTG XhoI ShHTL7-L143Y-F GAGCAGAAGGTGATGGATGAGACGTACAG GTCCTTGGACGAGAAC ShHTL7-L143Y-R GTTCTCGTCCAAGGACCTGTACGTCTCATC CATCACCTTCTGCTC
(44) Crystallization and Structure Determination
(45) For crystallization, the hanging drop vapor diffusion method was used. Initial plate crystals were obtained by equilibrating 1.0 μl of protein (15 mg/ml) mixed with 1.0 μl of reservoir solution (0.2 M Magnesium Chloride, 0.1 M Tris-HCl pH 8.5 and 30% PEG 4000). The produced crystals were crushed and used as microseeds to obtain diffraction quality crystals under the same crystallization conditions. For ShHTL7 with Triton X-100, diffraction-quality crystals were obtained by equilibrating 1.0 μl of protein (10 mg/ml) mixed with 1.0 μl of reservoir solution (1 M Lithium Sulfate, 0.1 M HEPES pH 7.5). All crystals grew in 1-3 days at 23° C. For data collection, 25% glycerol was added to the well solution as a cryo-protectant and the crystals were flash-cooled in liquid nitrogen. Data were collected at 100K, at the beamline Proxima 1, SOLEIL Synchrotron (France), using a Pilatus 6M detector and processed with XDS. The structure was determined by molecular replacement using MoRDa with using the ShHTL5 structure as a search model. The structures were manually inspected and rebuilt using Coot and refined using Phenix (Table X-ray Statistics).
(46) Yoshimulactone Green (YLG) Hydrolysis Analysis
(47) For measuring the hydrolysis of YLG in vitro, 10 μg of purified ShHTL7, AtD14 and OsD14 in a reaction buffer (1×PBS) containing 0.1% dimethyl sulfoxide (DMSO) in a total volume of 100 μL in 96-well black plate (Greiner) were used. To measure the fluorescent intensity, SpectraMax i3 (Molecular Devices) with an excitation wavelength of 480 nm and a detection wavelength of 520 nm were used. Purified proteins were mixed with Triton X-100, using serial dilutions with concentrations ranging from 5 μM to 4.87 nM. Proteins were pre-incubated with Tritone X-100 for 30 min, followed by incubation with 1 μM YLG (Tokyo Chemical Industry Co. Ltd., product number E1238) for 60 min. Fluorescence values measured in the void control were subtracted from those obtained in the presence of protein. Curves and IC.sub.50 values were plotted using Graph pad (PRISM 6) four-parameter logistic curve.
(48) Triton X-100 Fluorescence
(49) Purified proteins (at concentrations of 1 nm to 5 μM) were incubated with 1.54 μM of Triton X-100 for 2 h. Since Triton X-100 has an excitation and emission wavelength of 275 nm and 302 nm, fluorescence was measured at the corresponding wavelengths using SpectraMax i3 (Molecular Devices). The fluorescence exhibited by Triton X-100 alone was subtracted from the fluorescence in the presence of protein. Data were normalized to the background fluorescence from the protein and values obtained in absence of proteins were subtracted, to determine changes in Triton X-100 fluorescence intensity. K.sub.d values were determined by plotting changes in Triton X-100 fluorescence intensity against the concentration of the protein, using the single binding site model implemented in Graph pad (PRISM 6).
(50) Differential Static Light Scattering (DSLS)
(51) The specific aggregation temperature, T.sub.agg, was determined using DSLS on the Stargazer system (Harbinger Biotechnology and Engineering Corporation, Markham, Canada). For this purpose, purified protein (1 mg/mL) was overlaid with mineral oil in a clear bottom 384-well black plate (Corning), and temperature was increased from 20 to 95° C. with a ratio of 1° C./min. A CCD camera was used to detect light scattering every 0.5° C. in the presence or absence of varying concentrations of Triton X-100, unraveling X-100 concentration-dependent changes in aggregation temperature (ShHTL7 ΔT.sub.agg). Data were normalized, and ΔT.sub.agg was plotted against the Triton X-100 concentration. Resulting data were plotted to determine the change in T.sub.agg of ShHTL7 upon binding to Triton X-100 using Graph pad (PRISM 6).
(52) Striga hermonthica Germination Assay
(53) Striga hermonthica germination bioassays were carried out using Striga seeds collected from a Sorghum bicolor field in Sudan. About 50-100 dry Striga washed and sterilized seeds were distributed on a 9-mm diameter glass fiber filter paper discs (Sartorius, Goettingen Germany). Discs were then placed in 9-cm diameter petri-dishes (12 discs per petri-dish) on filter paper (Whatman, Maidstone, UK) moistened with 3 mL sterilized water. The petri-dishes were sealed with parafilm, wrapped with aluminum foil and incubated in growth chambers at 30° C. for 10 days for preconditioning. On the 11.sup.th day, discs were air dried in laminar flow cabinet and transferred to 9-cm petri-dishes (four discs in each plate), which contained 9-mm diameter glass fiber filter paper rings, moistened with 900 μL sterile MilliQ water. The pre-conditioned Striga seeds were treated with Triton X-100 at concentrations of 15.4 μM (0.001%) and 1.54 μM (0.0001%) along with GR24 at 1 nM, 0.5 nM, 0.25 nM and 0.125 nM respectively. Triton X-100/GR24 mixtures were applied (50 μl per disc) in four replicates. Corresponding volumes of GR24 and sterile MilliQ water were included as positive and negative control, respectively. The petri-dishes were sealed with parafilm, enfolded with aluminum foil and incubated for 48 h at 30° C. The germinated (seeds with radicle emerging through the seed coat) and non-germinated Striga seeds were recorded under a binocular and germination percentage was calculated.
(54) Rice Seed Germination Assay and Seedling Growth
(55) The rice seeds cv. Nipponbare were surface-sterilized using 50 ml (2.5%) sodium hypochlorite with 0.4% of Tween-20 for 15 min. After six subsequent washing steps with sterilized water, the rice seeds were kept in water at 30° C. for overnight imbibition. About 2 ml of dilutions of Triton X-100 at 15.4 μM, 1.54 μM in sterile MilliQ water (control) was added in 24-well plates with six replications. One sterilized rice seed was put in each well and allowed to germinate for 48 h at 30° C. The germinated (radicle emergence) and non-germinated seeds were recorded and germination percentage was calculated. Then same seeds were allowed to grow under light in growth cabinet for another one week. The length of one week old seedlings was measured with a roller and averaged.
Example 1
(56) X-ray crystallography was used to obtain high-resolution (1.2 to 1.7 Å) diffraction patterns of wild-type and active site mutant (S95C) ShHTL7 proteins, summarized by the data shown in Table 2 below. The phase problem was solved using molecular replacement methods. The 2FoFc electron density showed a small molecule compound bound in the ShHTL7 active site. Owing to the high-resolution of the data, this bound molecule could clearly be identified as Triton X-100 (hereafter referred to as Triton, unless stated otherwise), as illustrated in
(57) TABLE-US-00002 TABLE 2 X-Ray Statistics Crystal ShHTL7_WT_Apo ShHTL7_WT_Triton ShHTL7_S95C_Triton Resolution range Å 45.28-1.7 (1.761-1.7) 40.09-1.2 (1.243-1.2) 19.45-1.423 (1.474- 1.423) Space group I 2 2 2 P 65 P 65 Cell Dimensions 73.98 84.04 90.55 92.59 92.59 80.26 92.57 92.57 80.19 a, b, c, Å No. of Unique 31351 (3061) 121689 (12066) 72852 (7139) reflections measured Redundancy 9.8 (7.9) 9.9 (9.6) 14.4 (13.8) Completeness (%) 99.80 (98.61) 99.98 (99.95) 99.72 (97.66) Mean I/σ (I) 12.05 (1.04) 24.56 (1.87) 30.40 (4.52) R-merge 0.1034 (1.482) 0.04276 (1.069) 0.05644 (0.76) R-pim 0.03445 (0.5538) 0.0142 (0.3641) 0.01533 (0.2128) CC1/2 0.998 (0.449) 1 (0.721) 1 (0.886) Refinement Resolution range Å 45.28-1.7 (1.761-1.7) 40.09-1.2 (1.243-1.2) 19.45-1.423 (1.474- 1.423) Reflections used in 31351 (3060) 121689 (12061) 72852 (7138) refinement Reflections used for R- 1571 (156) 6083 (603) 3642 (356) free R-work 0.2082 0.1236 0.1007 R-free 0.2360 0.1374 0.1201 No. of atoms in Protein 2087 2270 2232 No. of atoms in ligands 8 41 47 No. of atoms in solvent 178 325 301
(58) Although Triton bound to the active site pocket, its binding site is different from that of SLs. The polyethylene oxide moiety is more than 8 Å away from the catalytic serine S95, and hence fails to reach the active site. Consequently, Triton physically blocks the active site entrance without being in contact with the catalytic residues, as shown in
Example 2
(59) Triton bound ShHTL7 specifically with high potency in vitro. Triton remained associated with ShHTL7 despite washes, dialyses and size exclusion columns with buffers without Triton, and despite extensive exposure to high concentrations of the synthetic SL GR24. Therefore, the association of Triton with ShHTL7 was expected to be very strong. A high affinity between Triton and ShHTL7 was apparent in assays where ShHTL7 was pre-incubated with Triton for 2 h or more, akin to the time of Triton treatment during cell lysis, as shown in
(60) These experiments suggested that Triton can inhibit SL binding and hydrolysis by blocking the active site access. In agreement, pre-incubation with Triton blocked Yoshimulactone green (YLG) hydrolysis by ShHTL7 with an IC.sub.50 of 0.47±0.11 μM, as shown in
Example 3
(61) Germination bioassays were used to assess the potency of Triton in plants. Striga hermonthica seeds were prepared as discussed previously herein. Triton also revealed to be a potent germination inhibitor in vivo, with both 1.54 μM and 15.4 μM Triton X-100 significantly inhibiting GR24-induced S. hermonthica germination, as shown in
Example 4
(62) SLs exert various important functions in plants. To be useful as an inhibitor of Striga, it has to be assured that Triton does not compete with SLs or bind to the corresponding receptor in non-parasitic plants. Triton fluorescence assays were used to assess binding of Triton in vitro to the ShHTL orthologue D14 from A. thaliana (AtD14) and rice (OsD14). No change in Triton fluorescence was observed for AtD14 and OsD14 concentrations up to 10 μM, excluding strong direct association between Triton and AtD14 or OsD14, as shown in
Example 5
(63) To determine why Triton does not inhibit AtD14 and OsD14 catalyzed hydrolysis of YLG, the structure of ShHTL7 was compared with the elucidated structures of AtD14, OsD14 and ShHTL5, as shown in
Example 6
(64) Triton X-114 (with 7-8 polyethylene repeats, compared to 9-10 in Triton X-100) and 2-[4-(2,4,4-trimethylpentan-2-yl)phenoxy]acetic acid that carries a phenoxy acid group instead of the polyethylene repeats were tested to determine whether they also inhibited the ShHTL7 catalyzed hydrolysis of YLG. Though with a higher IC.sub.50 than Triton X-100, as shown in Table 3 below, both compounds showed a clear inhibitory effect on the ShHTL7 activity. The activity of other Tritons—with 1, 2, 5 or 40 polyethylene repeats—was significantly weaker. These results identified the head moiety (polyethylene repeats) as a significant modulator of binding strength, suggesting that careful rational choice of functional groups in this position can provide derivatives with increased affinity over Triton X-100, which can be used as Striga germination inhibitor. The high-resolution structure of Triton-bound ShHTL7 also suggests that derivatives with modified tail groups (hydrophobic moiety) may exploit the gap between Triton and the active site and occupy a larger space in the active pocket.
(65) TABLE-US-00003 TABLE 3 IC50 Values of triton X-100 like compounds No. of ethylene oxide Groups Compound IC50 (μM) 40 Triton X-405 11.52 ± 2.8 9-10 Triton X-100 0.47 ± 0.11 7-8 Triton X-110 2.15 ± 0.5 2 4-ter-octylphenol diethoxylate 7.5 ± 2.1 1 4-ter-octylphenol Monoethoxylate 9.2 ± 3.2 None (Phenoxy 2-[4-(2,4,4-trimethylpentan-2- 1.5 ± 0.41 acetic acid) yl)phenoxy]acetic acid
(66) In this regard, Triton X-100 is a highly potent and selective inhibitor of seed germination in Striga. By binding to the active site of ShHTL7, Triton X-100 inhibits S. hermonthica germination up to 90%. Importantly, S. hermonthica germination is inhibited substantially by Triton concentrations that are five orders of magnitude lower than concentrations that affect rice growth. The results showed that inhibition of ShHTL7 is sufficient for suppression of GR24-induced germination, despite GR24 binding to other ShHTL family members. This effect is expected to be preserved and even strengthened in natural soil where SL concentrations are substantially lower than 1 μM. ShHTL7 is by far the most responsive HTL family member for relevant natural SLs, strongly suggesting a broad inhibitory effect of Triton in a natural setting. Triton has several advantages compared to current synthetic SL mimics, including affordable synthesis and extremely high specificity. Structural analyses allow rationalization of this specificity as being promoted by particular ShHTL7 features such as its unique capacity for helix a4 opening and its uniquely large binding pocket.
Non-Limiting Exemplary Embodiments
(67) Having described various aspects and embodiments of the invention herein, further specific embodiments of the invention include those set forth in the following paragraphs.
(68) Certain embodiments provide herbicides, systems, and methods for inhibiting germination of a root parasitic plant. In one aspect, an herbicide for inhibiting germination of a root parasitic plant is provided. The herbicide may include an active compound represented by Formula I:
(69) ##STR00011##
such that R.sub.1 is selected from the group consisting of:
(70) ##STR00012##
a carboxyl group, and an acyl group, wherein when R.sub.1 is the carboxyl group or the acyl group, R.sub.1 optionally includes a straight chain C.sub.1-C.sub.n alkyl group between O and the carboxyl group or the acyl group; R.sub.2 is a straight chain or branched C.sub.6-C.sub.10 alkyl group; and n is from 1 to 40. The active compound may be selected to bind to an active site of at least one strigolactone receptor in seeds of the root parasitic plant. According to certain embodiments, for example, the active compound may comprise at least one of:
(71) ##STR00013##
or any combination thereof. In some embodiments, for example, the herbicide may further comprise a carrier.
(72) In accordance with certain embodiments, for instance, the root parasitic plant may comprise at least one Orobanchaceae species. In some embodiments, for example, the root parasitic plant may comprise at least one Striga species. In further embodiments, for instance, the root parasitic plant may comprise at least one of Striga asiatica, Striga aspera, Striga forbesii, Striga hermonthica, Striga gesnerioides, or any combination thereof.
(73) In accordance with certain embodiments, for example, the herbicide may selectively inhibit Striga seed germination. In some embodiments, for instance, the herbicide may comprise a Striga-specific agonist. In further embodiments, for example, the at least one strigolactone receptor may comprise an ShHTL7 receptor. In such embodiments, for instance, the active compound may be selected to bind to an active site of the ShHTL7 receptor in seeds of the root parasitic plant.
(74) In another aspect, a system for inhibiting germination of a root parasitic plant is provided. The system may include an herbicide and a host plant. The herbicide may include an active compound represented by Formula I:
(75) ##STR00014##
(76) ##STR00015##
(77) such that R.sub.1 is selected from the group consisting of: a carboxyl group, and an acyl group, wherein when R.sub.1 is the carboxyl group or the acyl group, R.sub.1 optionally includes a straight chain C.sub.1-C.sub.n alkyl group between O and the carboxyl group or the acyl group; R.sub.2 is a straight chain or branched C.sub.6-C.sub.10 alkyl group; and n is from 1 to 40. The active compound of the herbicide may be selected to bind to an active site of at least one strigolactone receptor in seeds of the root parasitic plant without affecting germination of the host plant. According to certain embodiments, for example, the active compound may comprise at least one of:
(78) ##STR00016##
or any combination thereof. In some embodiments, for example, the herbicide may further comprise a carrier.
(79) In accordance with certain embodiments, for instance, the root parasitic plant may comprise at least one Orobanchaceae species. In some embodiments, for example, the root parasitic plant may comprise at least one Striga species. In further embodiments, for instance, the root parasitic plant may comprise at least one of Striga asiatica, Striga aspera, Striga forbesii, Striga hermonthica, Striga gesnerioides, or any combination thereof.
(80) In accordance with certain embodiments, for example, the herbicide may selectively inhibit Striga seed germination. In some embodiments, for instance, the herbicide may comprise a Striga-specific agonist. In further embodiments, for example, the at least one strigolactone receptor may comprise an ShHTL7 receptor. In such embodiments, for instance, the active compound may be selected to bind to an active site of the ShHTL7 receptor in seeds of the root parasitic plant.
(81) In accordance with certain embodiments, for example, the host plant may comprise at least one of a monocotyledonous crop, a dicotyledonous crop, or any combination thereof. In some embodiments, for instance, the host plant may comprise at least one of sorghum, maize, millet, rice, cowpea, tomato, tobacco, carrot, clover, cucumber, sunflower, or any combination thereof.
(82) In yet another aspect, a method for inhibiting germination of a root parasitic plant is provided. The method may include applying an herbicide to a planting area for a host plant before seed germination of the root parasitic plant. The herbicide may include an active compound represented by Formula I:
(83) ##STR00017##
such that R.sub.1 is selected from the group consisting of:
(84) ##STR00018##
a carboxyl group, and an acyl group, wherein when R.sub.1 is the carboxyl group or the acyl group, R.sub.1 optionally includes a straight chain C.sub.1-C.sub.n alkyl group between O and the carboxyl group or the acyl group; R.sub.2 is a straight chain or branched C.sub.6-C.sub.10 alkyl group; and n is from 1 to 40. The active compound of the herbicide may be selected to bind to an active site of at least one strigolactone receptor in seeds of the root parasitic plant without affecting germination of the host plant. According to certain embodiments, for example, the active compound may comprise at least one of:
(85) ##STR00019##
or any combination thereof. In some embodiments, for example, the herbicide may further comprise a carrier.
(86) In accordance with certain embodiments, for instance, the root parasitic plant may comprise at least one Orobanchaceae species. In some embodiments, for example, the root parasitic plant may comprise at least one Striga species. In further embodiments, for instance, the root parasitic plant may comprise at least one of Striga asiatica, Striga aspera, Striga forbesii, Striga hermonthica, Striga gesnerioides, or any combination thereof.
(87) In accordance with certain embodiments, for example, the herbicide may selectively inhibit Striga seed germination. In some embodiments, for instance, the herbicide may comprise a Striga-specific agonist. In further embodiments, for example, the at least one strigolactone receptor may comprise an ShHTL7 receptor. In such embodiments, for instance, the active compound may be selected to bind to an active site of the ShHTL7 receptor in seeds of the root parasitic plant.
(88) In accordance with certain embodiments, for example, the host plant may comprise at least one of a monocotyledonous crop, a dicotyledonous crop, or any combination thereof. In some embodiments, for instance, the host plant may comprise at least one of sorghum, maize, millet, rice, cowpea, tomato, tobacco, carrot, clover, cucumber, sunflower, or any combination thereof.
(89) Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which the inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.