INORGANIC POROUS SUBSTRATE, INORGANIC POROUS SUPPORT, AND NUCLEIC ACID PRODUCTION METHOD

Abstract

An inorganic porous substrate having a silyl group represented by (i) and (ii) and having characteristics (iii) to (v), an inorganic porous support derived from the inorganic porous substrate, and a nucleic acid production method using the inorganic porous support: (i) a silyl group (A): a silyl group represented by the formula (i-1); (ii) a silyl group (B): at least one silyl group selected from the group consisting of silyl groups represented by (ii-1), (ii-2), and (ii-3); (iii) a particle diameter of 1 μm or more; (iv) a pore diameter of 20 nm or more; and (v) a cumulative pore volume in a pore diameter range of 40 nm to 1000 nm of more than 0.32 mL/g and 4 mL/g or less.

##STR00001##

Claims

1. An inorganic porous substrate that comprises a silyl group represented by the following (I) and (ii) and has the following characteristics (iii) to (v): (i) a silyl group (A): a silyl group represented by the following formula (i-1), (ii) a silyl group (B): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (ii-1), (ii-2), and (ii-3), (iii) a particle diameter of 1 m or more, (iv) a pore diameter of 20 nm or more, and (v) a cumulative pore volume in a pore diameter range of 40 nm to 1000 nm of more than 0.32 mL/g and 4 mL/g or less:
[Chemical Formula 1]
(X1)(Y1).sub.a(Z1).sub.bSi-A1-NH-B1  (i-1) [in the formula (i-1), X1 represents a bond with the inorganic porous substrate, Y1 each independently represents any one selected from the group consisting of a bond with the inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms, Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms, a represents an integer represented by 2-b, b represents an integer of 0 to 2, A1 represents an organic group having 1 to 20 carbon atoms, and B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms], ##STR00069## [in the formula (ii-1), (ii-2), or (ii-3), P1 represents a bond with the inorganic porous substrate, Q1 and R1 each independently represents any one selected from the group consisting of the bond with the inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms, J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms, K1 each independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms, M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms].

2. The inorganic porous substrate according to claim 1, wherein the inorganic porous substrate has a pore diameter of 40 nm or more and 500 nm or less.

3. The inorganic porous substrate according to claim 1, wherein the inorganic porous substrate has a specific surface area of 0.1 m.sup.2/g or more and 200 m.sup.2/g or less.

4. The inorganic porous substrate according to claim 1, comprising silica, silica gel, zeolite, or glass.

5. The inorganic porous substrate according to claim 1, wherein an amount of an active NH group represented by the following formula (NH-1) satisfies the following mathematical formula (NH #1):
[Chemical Formula 5]
Si-A1-NH-B1  (NH-1) [in the formula (NH-1), A1 represents an organic group having 1 to 20 carbon atoms, B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, and an NH group satisfying the requirement of the above structure is an active NH group],
[Math. 1]
0.05≤I1/S1≤6.0  (NH #1) I1: active NH group amount (mol/g) in inorganic porous substrate, and S1: specific surface area (m.sup.2/g) of inorganic porous substrate obtained by nitrogen adsorption/desorption isotherm measurement.

6. The inorganic porous substrate according to claim 1, comprising a silyl group represented by the formula (ii-3) as the silyl group (B).

7. The inorganic porous substrate according to claim 1, wherein the silyl group represented by the formula (ii-3) is a silyl group represented by the following formula (ii-3-1): ##STR00070## [in the formula (ii-3-1), P1 represents the bond with the inorganic porous substrate, K2 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms, M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms].

8. The inorganic porous substrate according to claim 1, wherein A1 in the formula (i-1) is an alkylene group having 1 to 20 carbon atoms which may optionally contain any one or more of an imino group, an oxy group, and a thio group.

9. The inorganic porous substrate according to claim 1, wherein the silyl group (A) is represented by the following formula (i-1-1):
[Chemical Formula 7]
(X1)(Z1).sub.2Si-A2-NH-B2  (i-1-1) [in the formula (i-1-1), X1 represents the bond with the inorganic porous substrate, Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms, A2 represents an alkylene group having 1 to 15 carbon atoms which may optionally contain any one or more of an imino group, an oxy group, and a thio group, and B2 represents any one selected from the group consisting of a hydrogen atom and an alkyl group having 1 to 2 carbon atoms.

10. An inorganic porous support that comprises silyl groups of the following (vi) and (vii) and has the following characteristic (viii): (vi) a silyl group (C): a silyl group represented by the following formula (vi-1), (vii) a silyl group (D): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (vii-1), (vii-2), and (vii-3), and (viii) a pore diameter of 20 nm or more: ##STR00071## [in the formula (vi-1), X01 represents a bond with the inorganic porous support, Y01 each independently represents any one selected from the group consisting of the bond with the inorganic porous support, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms, Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms, a represents an integer represented by 2-b, b represents an integer of 0 to 2, A01 represents an organic group having 1 to 20 carbon atoms, B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, and C1 represents a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected], ##STR00072## [in the formula (vii-1), (vii-2), or (vii-3), P01 represents the bond with the inorganic porous support, Q01 and R01 each independently represents any one selected from the group consisting of the bond with the inorganic porous support, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms, J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms, K1 each independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms, M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms].

11. The inorganic porous support according to claim 10, wherein the inorganic porous support has a pore diameter of 40 nm or more and 500 nm or less.

12. The inorganic porous support according to claim 10, wherein the inorganic porous support has a cumulative pore volume in a pore diameter range of 40 nm to 1000 nm of more than 0.32 mL/g and 4 mL/g or less.

13. The inorganic porous support according to claim 10, wherein the inorganic porous support has a specific surface area of 0.1 m.sup.2/g or more and 200 m.sup.2/g or less.

14. The inorganic porous support according to claim 10, wherein the inorganic porous body is composed of silica, silica gel, zeolite, or glass.

15. The inorganic porous support according to claim 10, wherein an amount of a group containing a nucleoside or a nucleotide structure in which a reactive group is protected or deprotected satisfies the following mathematical formula (Nu #1):
[Math. 2]
0.05≤I01/S01≤3.0  (Nu #1) I01: a group (μmol/g) having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected in the inorganic porous support, and S01: a specific surface area (m.sup.2/g) of the inorganic porous support obtained by nitrogen adsorption/desorption isotherm measurement.

16. The inorganic porous support according to claim 10, wherein C1 in the general formula (vi-1) contains a succinyl linker.

17. The inorganic porous support according to claim 10, comprising a silyl group represented by the formula (vii-3) as a silyl group (D).

18. The inorganic porous support according to claim 10, wherein the silyl group represented by the formula (vii-3) is a silyl group represented by the following formula (vii-3-1): ##STR00073## [in the formula (ii-3-1), P01 represents the bond with the inorganic porous support, K2 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms, M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms].

19. The inorganic porous support according to claim 10, wherein A01 in the formula (vi-1) is an alkylene group having 1 to 20 carbon atoms which may optionally contain any one or more of an acylimino group, an oxy group, and a thio group.

20. The inorganic porous support according to claim 10, wherein the silyl group (C) is represented by the following formula (vi-1-1): ##STR00074## [in the formula (vi-1-1), X01 represents the bond with the inorganic porous support, Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms, A02 represents an alkylene group having 1 to 15 carbon atoms which may optionally contain any one or more of an acylimino group, an oxy group, and a thio group, B2 represents any one selected from the group consisting of a hydrogen atom and an alkyl group having 1 to 2 carbon atoms, and C2 represents a group including a succinyl linker and having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected].

21. A nucleic acid production method using an inorganic porous support in which C1 in the formula (vi-1) has a group having nucleoside or nucleotide structure in which the hydroxyl group as a reactive group is protected, the nucleic acid production method comprising: a step (A) of deprotecting a protecting group of the hydroxyl group at the 5′-position of the nucleoside; a step (B) of producing a phosphite by subjecting the hydroxyl group at the 5′-position of the nucleoside produced in the step (A) to a condensation reaction with an amidite compound having a second nucleoside base; a step (C) of oxidizing the phosphite produced in the step (B) to produce a nucleotide; and a step (D) of deprotecting the protecting group of the hydroxyl group at the 5′-position of the nucleotide produced in the step (C).

22. The nucleic acid production method according to claim 21, further comprising: a step (B′) of further subjecting a product produced in the step (D) to a condensation reaction with an amidite compound having a nucleoside base to be introduced next to produce a phosphite; a step (C′) of oxidizing the phosphite produced in the step (B′) to produce an oligonucleotide; and a step (D′) of deprotecting the protecting group for the hydroxyl group at the 5′-position of a terminal of an oligonucleotide chain produced in the step (C′).

23. The nucleic acid production method according to claim 22, comprising a step (E) of further repeating a series of steps including the step (B′), the step (C′), and the step (D′) m times (m represents an integer of 1 or more) to react m amidite compounds, and then cutting out an elongated nucleic acid.

24. (canceled)

Description

EXAMPLES

[0325] Hereinafter, the present invention is described in more detail with reference to Examples; however, the present invention should not be limited to these examples.

[0326] Hereinafter, representative reaction schemes relating to the production of the inorganic porous support of the present invention will be described; however, the production method of the present invention is not limited thereto.

##STR00048##

Production of Inorganic Molded Body

Production Example 1

[0327] A zeolite molded body (1) was obtained in the same manner as in Example 1 described in JP 5875843 B2. The zeolite molded body (1) was sieved with a sieve having an opening of 38 μm to remove a particulate component. The sieved product (50 g) was placed in an autoclave, a 1.6 mol/L aqueous potassium hydroxide solution (500 g) was added thereto, and after the mixture was stirred at about 20° C. for 5 hours, a solid was separated by filtration. Thereafter, water washing was repeated three times with water (500 g). Next, washing was performed three times with a 20 wt ammonium chloride aqueous solution (500 g), and then water washing was further repeated three times with water (500 g). Finally, drying was performed to obtain an inorganic molded body SP (1).

Production of Inorganic Porous Substrate

Production Example 2

[0328] 3-Aminopropyldiisopropylethoxysilane (87 mg) and toluene (12.43 g) were mixed in a glass vial to prepare a 3-aminopropyldiisopropylethoxysilane/toluene solution. The inorganic molded body SP (1) (7.13 g) was placed in a round-bottom flask, toluene (61 g) was added thereto, and then the prepared 3-aminopropyldiisopropylethoxysilane/toluene solution (3.11 g) was added thereto under stirring at room temperature. The round-bottom flask was heated in an oil bath and refluxed for 11.5 hours. Thereafter, the mixture was once cooled to room temperature, left to stand for 10 hours, and then refluxed for another 5 hours. The reaction mixture was filtered, and the solid content was washed with toluene and then dried under reduced pressure to obtain an inorganic porous substrate precursor 1.

Example 1

[0329] The inorganic porous substrate precursor 1 (0.40 g) was placed in a round-bottom flask, and toluene (61 g) was added thereto. A mixture of N,N-diisopropylethylamine (210 mg) and toluene (4.0 g) was further added under stirring at room temperature, then a mixture of tributylchlorosilane (379 mg) and toluene (4.0 g) was added, and the flask was heated in an oil bath and refluxed for 5 hours. Thereafter, the reaction solution was filtered, and the solid content was washed with a 5 vol % N,N-diisopropylethylamine/ethanol solution (13 mL), and then washed with tetrahydrofuran (14 mL). The washed product was dried under reduced pressure to obtain an inorganic porous substrate 1.

Example 2

[0330] An inorganic porous substrate 2 was obtained by performing synthesis in the same manner as in Example 1 except that chloro (hexyl) dimethylsilane (287 mg) was used in place of tributylchlorosilane (379 mg) used in Example 1.

Example 3

[0331] An inorganic porous substrate 3 was obtained by performing synthesis in the same manner as in Example 1 except that benzylchlorodimethylsilane (293 mg) was used in place of tributylchlorosilane (379 mg) used in Example 1.

Example 4

[0332] An inorganic porous substrate 4 was obtained by performing synthesis in the same manner as in Example 1 except that (3-cyanopropyl) dimethylchlorosilane (261 mg) was used in place of tributylchlorosilane (379 mg) used in Example 1.

Example 5

[0333] An inorganic porous substrate 5 was obtained by performing synthesis in the same manner as in Example 1 except that 2-acetoxyethyldimethylchlorosilane (290 mg) was used in place of tributylchlorosilane (379 mg) used in Example 1.

Reference Example 1

[0334] The inorganic porous substrate precursor 1 (0.40 g) was placed in a round-bottom flask, and toluene (61 g) was added thereto. A mixture of hexamethyldisilazane (262 mg) and toluene (4.0 g) was added thereto under stirring at room temperature, and the flask was heated in an oil bath and refluxed for 5 hours. Thereafter, the reaction solution was filtered, and the solid content was washed with a 5 vol, N,N-diisopropylethylamine/ethanol solution (13 mL), and then washed with tetrahydrofuran (14 mL). The washed product was dried under reduced pressure to obtain an inorganic porous substrate 6.

Reference Example 2

[0335] An inorganic porous substrate 7 was obtained by performing synthesis in the same manner as in Reference Example 1 except that trimethoxy (methyl) silane (52 mg) was used in place of hexamethyldisilazane (262 mg) used in Reference Example 1.

Reference Example 3

[0336] An inorganic porous substrate 8 was obtained by performing synthesis in the same manner as in Reference Example 1 except that triethoxyphenylsilane (57 mg) was used in place of hexamethyldisilazane (262 mg) used in Reference Example 1.

Reference Example 4

[0337] An inorganic porous substrate 9 was obtained by performing synthesis in the same manner as in Reference Example 1 except that 2-(4-pyridylethyl) triethoxysilane (61 mg) was used in place of hexamethyldisilazane (262 mg) used in Reference Example 1.

Production of Inorganic Porous Support

Example 6

[0338] In a glass vial, U-succinate (5′-O-dimethoxytrityl-2′-O-tert-butyldimethylsilyl-3′-O-succinyluridine) (311.3 mg), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxid hexafluorophosphate (HBTU) (155.2 mg), N,N-diisopropylethylamine (90.1 μL), and acetonitrile (25 mL) were mixed. The prepared mixed solution (3.08 mL) and the inorganic porous substrate 1 (300 mg) were added to a test tube. The mixture was left to stand at 25° C. for 18 hours and then filtered, and a solid component was washed with acetonitrile (10 mL). A tetrahydrofuran solution of acetic anhydride and 2,6-lutidine (acetic anhydride/2,6-lutidine/tetrahydrofuran, volume ratio: 1/1/8) (1 mL) and a tetrahydrofuran solution of 1-methylimidazole (1-methylimidazole/tetrahydrofuran, volume ratio: 16/84) (1 mL) were added to the solid content after washing. The mixture was left to stand for 1 minute and then filtered, and the solid content was washed with acetonitrile (10 mL). The solid content after washing was vacuum-dried to obtain an inorganic porous support 1 supporting a group having a nucleoside structure.

##STR00049##

U-Succinate

Example 7

[0339] A reaction was performed according to Example 6 using the inorganic porous substrate 2 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 2.

Example 8

[0340] A reaction was performed according to Example 6 using the inorganic porous substrate 3 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 3.

Example 9

[0341] A reaction was performed according to Example 6 using the inorganic porous substrate 4 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 4.

Example 10

[0342] A reaction was performed according to Example 6 using the inorganic porous substrate 5 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 5.

Comparative Example 1

[0343] A reaction was performed according to Example 6 using the inorganic porous substrate precursor 1 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 6. The data of Comparative Example 1 is data in the case of no cap.

Reference Example 5

[0344] A reaction was performed according to Example 6 using the inorganic porous substrate 6 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 7.

Reference Example 6

[0345] A reaction was performed according to Example 6 using the inorganic porous substrate 7 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 8.

Reference Example 7

[0346] A reaction was performed according to Example 6 using the inorganic porous substrate 8 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 9.

Reference Example 8

[0347] A reaction was performed according to Example 6 using the inorganic porous substrate 9 instead of the inorganic porous substrate 1 to obtain an inorganic porous support 10.

[0348] For the obtained series of inorganic molded bodies, inorganic porous substrate precursors, inorganic porous substrates, and inorganic porous supports, the pore diameter by a mercury intrusion method, the particle diameter by scanning electron microscope measurement, the cumulative pore volume in the pore diameter range of 40 nm to 1000 nm, the specific surface area by a nitrogen adsorption method, the active NH group loading, the silyl group (B) loading, and the nucleoside loading were each measured using the above-described methods. The results are shown in Table 2 described later.

<Solid-Phase Synthesis of Oligonucleic Acid>

[0349] The oligonucleotide consisting of the following sequence (A) was synthesized from the 3′ side to the 5′ side according to the phosphoramidite method by using a nucleic acid synthesizer (trade name: NTS M-4-MX-E, produced by Nihon Techno Service Co., Ltd.) (see the reaction route (condensation reaction, oxidation, and deprotection)). For such solid-phase synthesis, the inorganic porous support produced above was used.

[0350] As the amidite monomer, the adenosine EMM amidite (described in Example 4 of US 2012/035246 A1), the cytidine EMM amidite (described in Example 3 of the same US patent literature), the guanosine EMM amidite (described in Example 5 of the same US patent literature), and the uridine EMM amidite (described in Example 2 of the same US patent literature) as shown below were used.

TABLE-US-00001 Sequence (A): (SEQ ID NO: 1) 5′-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUU-3′

##STR00050## ##STR00051##

[0351] In the solid-phase synthesis, a high-purity trichloroacetic acid toluene solution was used as a deblocking solution, 5-benzylmercapto-1H-tetrazole was used as a condensing agent, an iodine solution was used as an oxidizing agent, and a phenoxyacetic acid solution and a 1-methyl imidazole solution were used as a capping solution.

[0352] The inorganic porous support after the completion of synthesis was placed in a glass vial with a lid, and a solution of 281 aqueous ammonia and EtOH at a ratio of 1:1 to 2:1 was added thereto. Thereafter, the mixture was left to stand at 40° C. for 4 hours. The solution after the reaction was filtered and washed with water and EtOH. The resulting solution was dried to obtain a crude oligonucleotide having a protected group, and then the crude oligonucleotide was deprotected by the treatment with tetra-n-butyl ammonium fluoride (TBAF) in the presence of nitromethane to obtain a crude product.

[Measurement of Purity of Oligonucleic Acid]

[0353] The solution prepared using the obtained crude oligonucleotide was separated into components by high performance liquid chromatography HPLC (wavelength: 260 nm, column DNAPac (trademark) PA100 4×250 mm), and a peak width at 10% of a height of an LC peak vertex of a main product in the obtained chromatogram was determined as “10% width”.

[0354] In order to verify the effect by each inorganic porous support, a value obtained by dividing the value of “10% width” in each inorganic porous support by the value of “10% width” in the inorganic porous support 6 (Comparative Example 2) having no silyl group (B) was defined as “relative 10; width” and calculated. Here, when the purity is high, the “relative 10% width” is a small value, and when the purity is low, the “relative 10% width” is a large value.

Example 11

[0355] Using the inorganic porous support 1, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Example 12

[0356] Using the inorganic porous support 2, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Example 13

[0357] Using the inorganic porous support 3, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Example 14

[0358] Using the inorganic porous support 4, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Example 15

[0359] Using the inorganic porous support 5, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Comparative Example 2

[0360] Using the inorganic porous support 6, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A). The data of Comparative Example 2 is data in the case of no cap.

Reference Example 9

[0361] Using the inorganic porous support 7, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Reference Example 10

[0362] Using the inorganic porous support 8, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

Reference Example 11

[0363] Using the inorganic porous support 9, solid-phase synthesis of the oligonucleic was performed according to the above method for the sequence (A).

Reference Example 12

[0364] Using the inorganic porous support 10, solid-phase synthesis of the oligonucleic acid was performed according to the above method for the sequence (A).

[0365] The results of the solid-phase synthesis of the oligonucleic acids of a series of the sequences (A) are shown in Table 1.

TABLE-US-00002 TABLE 1 Cumulative pore volume Active Inorganic in pore NH group Nucleoside material diameter loading in loading in of range of Specific inorganic Silyl inorganic Oligo- Inorganic inorganic Inorganic Pore Particle 40 nm to surface porous group (B) porous nucleic Relative porous porous porous diameter diameter 1000 nm area substrate loading support acid strand 10% substrate substrate support (nm) (μm) (mL/g) (m2/g) Silyl group (A) (μmol/m2) Silyl group (B) (μmol/m2) (μmol/m2) length width Example 11 Inorganic porous substrate 1 Zeolite Inorganic porous support 1 109 48.9 0.88 24.7 [00052] 0.67 *—Si(C.sub.4H.sub.9).sub.3 0.92 0.40 100 mer (RNA) 0.73 Example 12 Inorganic porous substrate 2 Zeolite Inorganic porous support 2 109 48.9 0.88 24.7 [00053] 0.67 [00054] 1.95 0.41 100 mer (RNA) 0.77 Example 13 Inorganic porous substrate 3 Zeolite Inorganic porous support 3 109 48.9 0.88 24.7 [00055] 0.67 [00056] 1.40 0.43 1.00 mer (RNA) 0.59 Example 14 Inorganic porous substrate 4 Zeolite Inorganic porous support 4 109 48.9 0.89 24.7 [00057] 0.67 [00058] 2.64 0.43 100 mer (RNA) 0.78 Example 15 Inorganic porous substrate 5 Zeolite Inorganic porous support 5 109 48.9 0.88 24.7 [00059] 0.67 [00060] 2.62 0.41 100 mer (RNA) 0.81 Comparative Example 2 (Inorganic porous substrate precursor 1) Zeolite Inorganic porous support 6 109 48.9 0.88 24.7 [00061] 0.67 — — 0.46 100 mer (RNA) 1.00 Reference Example 9 Inorganic porous substrate 6 Zeolite Inorganic porous support 7 109 48.9 0.88 24.7 [00062] 0.67 *—Si(CH.sub.3).sub.3 2.71 0.45 100 mer (RNA) 1.29 Reference Example 10 Inorganic porous substrate 7 Zeolite Inorganic porous support 8 109 48.9 0.88 24.7 [00063] 0.67 [00064] 0,21 0.38 100 mer (RNA) 1.44 Reference Example 11 Inorganic porous substrate 8 Zeolite Inorganic porous support 9 109 48.9 0.88 24.7 [00065] 0.67 [00066] 0.04 0.38 100 mer (RNA) 0.97 Reference Example 12 Inorganic porous substrate 9 Zeolite Inorganic support 10 109 48.9 0.88 24.7 [00067] 0.67 [00068] 0.37 0.39 100 mer (RNA) 1.00

[0366] [In Table 1, * represents a bond with the inorganic porous substrate, a bond with the inorganic porous support, or a bond with the inorganic porous substrate precursor.]

[0367] In the solid-phase synthesis result of the oligonucleic acid of the sequence (A), the inorganic porous support used in Examples 11 to 15 showed a lower relative 10% width as compared with the inorganic porous support used in Comparative Example 2 and Reference Examples 9 to 12, and it was found that the obtained oligonucleic acid had a higher purity.

INDUSTRIAL APPLICABILITY

[0368] According to the present invention, there are provided the inorganic porous support, the inorganic porous substrate as the raw material of the inorganic porous support, and the oligonucleic acid production method, which can improve the purity of the oligonucleic acid in production of the oligonucleic acid. The oligonucleic acid obtained by the present invention is useful as a raw material for pharmaceuticals and the like.

SEQUENCE LISTING FREE TEXT

[0369] SEQ ID NO: 1 in the Sequence Listing represents the base sequence of an oligonucleotide produced according to the production method of the present invention.