T CELL ANTIGEN RECEPTOR, MULTIMERIC COMPLEX THEREOF AND PREPARATION METHOD AND USE THEREOF

Abstract

A T cell antigen receptor, an immune cell for expressing the T cell antigen receptor (TCR) and a preparation method and use thereof. The TCR disclosed in the present invention can be specifically activated by virus antigen peptide presenting cells, so that the release level of extracellular cytokines IFNγ and IL2 and the release amount of lactate dehydrogenase are improved, and target cells are significantly killed.

Claims

1-48. (canceled)

49. A T cell antigen receptor, wherein the T cell antigen receptor specifically binding to CMV pp65, wherein the T cell antigen receptor comprises CDR1α-CDR3α of an α chain and/or CDR1β-CDR3β of a β chain, wherein the CDR1α has an amino acid sequence comprising any one of SEQ ID NOs: 4-7 or having at least 80% homology to any one of SEQ ID NOs: 4-7, the CDR2α has an amino acid sequence comprising any one of SEQ ID NOs: 8-11 or having at least 80% homology to any one of SEQ ID NOs: 8-11, the CDR3α has an amino acid sequence comprising any one of SEQ ID NOs: 12-17 or having at least 80% homology to any one of SEQ ID NOs: 12-17, the CDR1β has an amino acid sequence comprising any one of SEQ ID NOs: 18-22 or having at least 80% homology to any one of SEQ ID NOs: 18-22, and the CDR2β has an amino acid sequence comprising any one of SEQ ID NOs: 23-27 or having at least 80% homology to any one of SEQ ID NOs: 23-27, and the CDR3β has an amino acid sequence comprising any one of SEQ ID NOs: 28-33 or having at least 80% homology to any one of SEQ ID NOs: 28-33.

50. The T cell antigen receptor according to claim 49, wherein the CMV pp65 has a binding epitope comprising any one of or a combination of two or three of SEQ ID NOs: 1-3.

51. The T cell antigen receptor according to claim 49, wherein the CDR1α-CDR3α and the CDR1β-CDR3β comprise any one of the following groups: TABLE-US-00010 Binding TCR epitope CDR1α CDR2α CDR3α CDR1β CDR2β CDR3β C22 SEQ ID SSNFYA MTLNGDE ARNTGNQFY MNHEY SVGAGI ASSFATGVGSYGYT NO: 1 (SEQ ID (SEQ ID NO: (SEQ ID NO: 12) (SEQ ID (SEQ ID (SEQ ID NO: 28) NO: 4) 8) NO: 18) NO: 23) C27 SEQ ID SSNFYA MTLNGDE ASGTYKYT MNHEY SVGAGI ASRPLGVGETQY NO: 2 (SEQ ID (SEQ ID NO: (SEQ ID NO: 13) (SEQ ID (SEQ ID (SEQ ID NO: 29) NO: 4) 8) NO: 18) NO: 23) C29 SEQ ID NSAFQY TYSSGN ATFLIGNQFY SGHDY ENNNVP ASSESLPYEQY NO: 1 (SEQ ID (SEQ ID NO: (SEQ ID NO: 14) (SEQ ID (SEQ ID (SEQ ID NO: 30) NO: 5) 9 NO: 19) NO: 24) C30 SEQ ID SSNFYA MTLNGDE ARYGNKLV SGHVS PONEAQ ASSFYTGQETQY NO: 2 (SEQ ID (SEQ ID NO: (SEQ ID NO: 15) (SEQ ID (SEQ ID (SEQ ID NO: 31) NO: 4) 8) NO: 20) NO: 25) C44 SEQ ID TSESDYY QEAYKQQN AYRAFYTGANSKLT SGHDT YYEEEE ASSFFRGEGNQPQH NO: 3 (SEQ ID (SEQ ID NO: (SEQ ID NO: 16) (SEQ ID (SEQ ID (SEQ ID NO: 32) NO: 6) 10) NO: 21) NO: 26) C45 SEQ ID NSMFDY ISSIKDK AASAWNTGNQFY SGHRS YFSETQ ASSLAGYKQETQY NO: 3 (SEQ ID (SEQ ID NO: (SEQ ID NO: 17) (SEQ ID (SEQ ID (SEQ ID NO: 33) NO: 7) 11) NO: 22) NO: 27)

52. The T cell antigen receptor according to claim 49, wherein the β chain has an amino acid sequence comprising any one of SEQ ID NOs: 247-252 or having at least 80% homology to any one of SEQ ID NOs: 247-252.

53. The T cell antigen receptor according to claim 49, wherein the α chain has an amino acid sequence comprising any one of SEQ ID NOs: 253-258 or having at least 80% homology to any one of SEQ ID NOs: 253-258.

54. The T cell antigen receptor according to claim 49, wherein amino acids of the α chain and the β chain are linked directly or indirectly.

55. The T cell antigen receptor according to claim 49, wherein the T cell antigen receptor has an amino acid sequence comprising any one of SEQ ID NOs: 36, 38, 40, 42, 44 or 46 or having at least 80% homology to any one of SEQ ID NOs: 36, 38, 40, 42, 44 or 46.

56. A nucleic acid encoding the T cell antigen receptor according to claim 49.

57. The nucleic acid according to claim 56, wherein the nucleic acid has a sequence comprising any one of SEQ ID NOs: 37, 39, 41, 43, 45 or 47 or having at least 80% homology to any one of SEQ ID NOs: 37, 39, 41, 43, 45 or 47.

58. An immune cell, wherein the immune cell expresses the T cell antigen receptor according to claim 49.

59. The immune cell according to claim 58, wherein the immune cell is selected from a T cell and a stem cell.

60. The immune cell according to claim 58, wherein the immune cell is isolated from a T cell derived from a subject.

61. A method for preparing an immune cell, wherein the method comprises transfecting an immune cell with a nucleic acid sequence encoding the T cell antigen receptor according to claim 49 for expression.

62. The method according to claim 61, further comprising a step of knocking out an endogenous TCR of the cell.

63. A method for preparing a recombinant T cell, comprising the following steps: 1) obtaining the nucleic acid according to claim 56 from a positive T cell clone; 2) separating, culturing a primary T cell; and 3) delivering the nucleic acid obtained in the step 1) to the primary T cell in the step 2) to obtain a recombinant T cell expressing the T cell antigen receptor according to claim 1.

64. A multimeric complex, comprising the T cell antigen receptor according to claim 49.

65. The multimeric complex according to claim 64, further comprising a monomer, a biotin molecule, and a streptavidin or avidin molecule, wherein the monomer comprises an α-chain extracellular domain of an MHC molecule, a β 2m chain and an antigen peptide, and the monomer is conjugated to the biotin molecule binding to the streptavidin or avidin molecule.

66. A method for treating and/or preventing a CMV-related disease, which comprises administering to an individual an effective amount of the T cell antigen receptor according to claim 49.

67. A method for treating and/or preventing a CMV-related disease, which comprises administering to an individual an effective amount of the immune cell according to claim 58.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0145] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0146] FIG. 1: the SDS PAGE detection result of the antigen peptide-MHC monomer, wherein M is a protein Madker, and the strips 1 and 2 are monomers;

[0147] FIG. 2: the detection result of the tetramer fishing for specific T cells, wherein the first row is comparison results of the self-developed A0201-NLV tetramer and the commercialized tetramer fishing for specific T cells, and the second row is comparison results of the self-developed A2402-QYD tetramer and the commercialized tetramer fishing for specific T cells;

[0148] FIG. 3: the detection of the positive rate of C44 TCR-T cells by the A1101-ATV tetramer;

[0149] FIG. 4: a schematic diagram of the linking of TCR β and α chains in a pHAGE vector, wherein the linking is performed by the following order a promoter, the β chain, furin-p2A, the α chain, IRES and RFP sequences:

[0150] FIG. 5: the expression of the membrane surface as assayed by flow cytometry, wherein FIG. 5A shows the expression of the membrane surface of HLA-A*A0201 NLVPMVATV specific TCRs (C2, C22, C29), FIG. 5B shows the expression of the membrane surface of HLA-A*A2402 QYDPVAALF specific TCRs (C27, C30), and FIG. 5C shows the expression of the membrane surface of HLA-A*A1101 ATVQGQNLK specific TCRs (C44, C45), in which BV421 is one of fluoresceins, and BV stands for Brilliant Violet:

[0151] FIG. 6: the affinity of TCRs for binding to the CMV pp65 tetramer probe as assayed by flow cytometry, wherein FIG. 6A shows the detection result of the affinity of HLA-A*A0201 NLVPMVATV specific TCRs (C2, C22, C29) for binding to the CMV pp65 tetramer probe, FIG. 6B shows the detection result of the affinity of HLA-A*A2402 QYDPVAALF specific TCRs (C27. C30) for binding to the CMV pp65 tetramer probe, and FIG. 6C shows the detection result of the affinity of HLA-A*A1101 ATVQGQNLK specific TCRs (C44, C45) for binding to the CMV pp65 tetramer probe;

[0152] FIG. 7: the detection results of the release levels of C2-TCR T. C22-TCR T. C29-TCR T cytokines IL2 (FIG. 7B), TNFα (FIG. 7C) and IFNγ (FIG. 7D) and the luciferase level of target cells (FIG. 7A), wherein C2, C22 and C29 are TCRs prepared in Example 2, NE represents a blank control group, NT represents a T cell-only group, Raji is Raji cells untransfected with pp65, and IG4 represents a specific TCR against NY-ESO-1;

[0153] FIG. 8: the detection results of the release levels of C27-TCR T, C30-TCR T cytokines IL2 (FIG. 8B), TNFα (FIG. 8C) and IFNγ (FIG. 8D) and the luciferase level of target cells (FIG. 8A), wherein C27 and C30 are TCRs prepared in Example 2, NE represents a blank control group, NT represents a T cell-only group, Raji is Raji cells untransfected with pp65, and 1G4 represents a specific TCR against NY-ESO-1;

[0154] FIG. 9: the detection results of the release levels of C44-TCR T, C45-TCR T cytokines IFNγ (FIG. 9B) and the luciferase level of target cells (FIG. 9A), wherein C44 and C45 are TCRs prepared in Example 2, NE represents a blank control group. NT represents a T cell-only group. Raji is Raji cells untransfected with pp65, and 1G4 represents a specific TCR against NY-ESO-1;

[0155] FIG. 10: evaluation of the inhibition of C22-TCR on tumor growth in mice in a lymphoma animal model;

[0156] FIG. 11: statistics for the survival rates of mice in a lymphoma animal model, a T cell-free injection group (PBS), a control T-cell injection group (NC), and a CMV TCR-T injection group (C22-TCR):

[0157] FIG. 12: statistics for the weight of mice in the lymphoma animal model, the T cell-free injection group (PBS), the control T-cell injection group (NC), and the CMV TCR-T injection group (C22-TCR):

[0158] FIG. 13: statistics for TCR T cell-specific proliferation of mice in the lymphoma animal model, the T cell-free injection group (PBS), the control T-cell injection group (NC), and the CMV TCR-T injection group (C22-TCR), which show that the results of the PBS group and the NC group are both 0, and 6 broken lines of FIG. 13 are statistics for TCR T cell-specific proliferation of six different mice in the C22-TCR group:

[0159] FIG. 14: evaluation of the inhibition of C27-TCR on tumor growth in mice in a lymphoma animal model:

[0160] FIG. 15: statistics for the tumor growth of mice in a lymphoma animal model, a T cell-free injection group (PBS), a control T-cell injection group (NC), and a CMV TCR-T injection group (C27-TCR);

[0161] FIG. 16: statistics for TCR T cell-specific proliferation of mice in the lymphoma animal model, the T cell-free injection group (PBS), the control T-cell injection group (NC), and the CMV TCR-T injection group (C27-TCR);

[0162] FIG. 17: evaluation of the inhibition of C45-TCR on tumor growth in mice in a lymphoma animal model:

[0163] FIG. 18: statistics for the tumor growth of mice in a lymphoma animal model, a T cell-free injection group (PBS), a control T-cell injection group (NC), and a CMV TCR-T injection group (C45-TCR); and

[0164] FIG. 19: statistics for TCR T cell-specific proliferation of mice in the lymphoma animal model, the T cell-free injection group (PBS), the control T-cell injection group (NC), and the CMV TCR-T injection group (C45-TCR).

DETAILED DESCRIPTION

[0165] Technical solutions in the embodiments of the present invention will be described clearly and completely below with reference to the drawings. It is apparent that the described embodiments are only a part of the embodiments of the present invention, but not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work shall fall within the protection scope of the present invention.

Example 1: Construction of and Effect Assay on CMV Antigen Epitope Tetramers

I. Construction of CMV Antigen Epitope Tetramers

[0166] 1) An α chain and a β2m chain (with the amino acid sequence set forth in SEQ ID NO: 54, and the nucleotide sequence set forth in SEQ ID NO: 55) of HLA-A*0201 (with the amino acid sequence set forth in SEQ ID NO: 48, and the nucleotide sequence set forth in SEQ ID NO: 49). HLA-A*2402 (with the amino acid sequence set forth in SEQ ID NO: 50, and the nucleotide sequence set forth in SEQ ID NO: 51) and HLA-A*1101 (with the amino acid sequence set forth in SEQ ID NO: 52, and the nucleotide sequence set forth in SEQ ID NO: 53) with optimized expression sequences were provided. The structure of the α chain was as follows: the extracellular domain sequence of the α chain of the corresponding HLA type was connected with an Avi-tag sequence, with a BamHI enzyme cutting site as a spacer to provide a biotinylation site. The β2m chain was depleted of the signal peptide sequence, with two amino acids (M and A) added before a mature peptide sequence. The expression vector was PET28a+, and the expression strain was transetta or BL21. IPTG was at a concentration of 0.5 mM, and the expression was induced for 4 h. The protein inclusion bodies of the α chain and β2m chain were extracted.
2) Selection of CMV antigen epitopes (antigen peptides): HLA-A*0201 type corresponds to an antigen epitope NLVPMVATV (SEQ ID NO: 1). HLA-A*2402 type corresponds to an antigen epitope QYDPVAALF (SEQ ID NO: 2), and HLA-A*1101 type corresponds to an antigen epitope ATVQGQNLK (SEQ ID NO: 3).
3) Folding and purification of pMHC I monomer: the antigen peptides in the step 2), and the corresponding β2m chain renaturation proteins and the α chain proteins in the step 1) were added into a reduction system in order according to the molar ratio of 40:2:1, and the folding reaction was performed for 72 h. The resulting products were purified on a Superdex75 10/300GL column. The purified products were collected, biotinylated using an avidity kit, and purified again to obtain biotinylated monomers, which were determined for the purity by gel electrophoresis.
4) The biotinylated monomers in the step 3) were subjected to a binding reaction with APC-labeled streptavidin to obtain corresponding tetramers, which were named as A0201-NLVPMVATV-tetramer (A0201-NLV tetramer for short). A2402-QYDPVAALF-tetramer (A2402-QYD tetramer for short) and A1101-ATVQGQNLK-tetramer (A1101-ATV tetramer for short).

II. Assay on the Effect of CMV Antigen Epitope Tetramers

[0167] 1. Human peripheral blood mononuclear cells (PBMCs) were isolated or TCR-T cells were prepared, and a cell suspension was prepared at a cell density of 1×10.sup.6 cells/mL.
2. The cells were centrifuged at 3000 rpm for 5 min. The supernatant was removed and resuspended in 50 μL of PBS containing 1% serum.
3. 2 μL of tetramer was added, and the mixture was incubated at room temperature for 30 min.
4. 2 μL of CD8 antibody was added, and the mixture was incubated on ice for 20 min.
5. 1 mL of PBS was added, and the mixture was centrifuged at 3000 rpm for 5 min.
6. The supernatant was removed, 1 mL of PBS was added, and the mixture was centrifuged at 3000 rpm for 5 min.
7. The supernatant was removed, the cells were resuspended in 500 μL of 4% paraformaldehyde, and the cell suspension was filtered through a filter membrane.
8. Positive cells were detected by a flow cytometer.

III. Experimental Results

[0168] The SDS PAGE detection results of the monomers are shown in FIG. 1. As shown in FIG. 1, after refolding and HPLC purification, for the resulting monomers, the proteins with sizes corresponding to those of the heavy chain (the α-chain extracellular domain connected with the Avi-tag sequence at the C-terminus) and the light chain (the β2m chain depleted of the signal peptide region), respectively, and having higher purity are clearly showed.

[0169] The constructed tetramers were separately co-incubated with corresponding HLA type PBMC cells to fish for specific T cells. As shown in FIG. 2, the self-developed tetramer has a significant advantage over the commercial tetramer (from MBL) in fishing for specific T cells. Specifically, the self-developed A0201-NLV tetramer sorted specific T cells twice as many as the commercial tetramer (MBL, TS-0010-2C). In addition, the sorting efficiency of different batches was similar, thereby showing extremely high sorting efficiency and stability. The A0201-NLV tetramer was used to fish for C22 TCR and C29 TCR. The commercial A2402-QYD (MBL, TS-0020-2C) tetramer did not detect corresponding specific T cells, while the self-developed tetramer detected 0.02%-0.05% of the positive cell population, which indicated that the self-developed tetramer was highly sensitive in sorting specific T cells and the data from different batches showed high stability. The A2402-QYD tetramer was used to fish for C27 TCR and C30 TCR.

[0170] Meanwhile, the TCR corresponding to A1101 type (C44 TCR) could be simultaneously recognized by the self-developed tetramer and the commercialized tetramer on the same epitope (MBL, TS-M012-1) (see FIG. 3), and the positive cell population in the commercial tetramer accounted for 90.5% of the infected cells, and that of the self-developed tetramer accounted for 91% of the infected cells. The results for C45 TCR are shown in FIG. 5.

Example 2: Construction of pHAGE-TCR-RFP Vector

I. Acquisition of 0 and a Gene Fragments of CMV Pp65 Epitope-Specific TCRs

[0171] 1) The HLA-A*0201-NLVPMVATV-tetramer, HLA-A*2402-QYDPVAALF-tetramer and HLA-A*1101-ATVQGQNLK-tetramer which were purchased from MBL or self-prepared were stained with peripheral blood according to the product instructions. T cells positive for tetramer staining were sorted by flow cytometry and subjected to reverse transcription to obtain cDNA (SuperScript® IV Reverse Transcriptase. Invitrogen). The variable region fragments of the TCRβ gene were obtained by amplification by two rounds of PCR (KOD-Plus-Neo, TOYOBO) based on the principle of multiplex PCR.

TABLE-US-00005 Reverse transcription primer: (SEQ ID NO: 136) TRBC1-TCAGGCAGTATCTGGAGTCATTG PCR amplification primers: Upstream primer 1: (see SEQ ID NOs: 56-95) T cell receptor β variable region-TRBV_F1 Upstream primer 2: (see SEQ ID NOs: 96-135) T cell receptor β variable region-TRBV_F2 Downstream primer 1: (SEQ ID NO: 137) T cell receptor β constant region-TRBC2-GCACCTCCTTCCCATTCACC Downstream primer 2: (SEQ ID NO: 138) T cell receptor β constant region-TRBC3-GCTTCTGATGGCTCAAACACAG 

[0172] Specifically, according to the product instructions of the PCR polymerase KOD-Plus-Neo, the PCR system of the first round was at 20 μL, the annealing temperature was 60° C. and the reaction was performed for 30 cycles, 1 μL of the product from the first round of PCR reaction was taken as a template of the second round of PCR, wherein the PCR system of the second round was at 30 μL, the annealing temperature was 60° C., and the reaction was performed for 30 cycles. The product from the second round of PCR was subjected to agarose gel electrophoresis, and the band with the corresponding size was extracted from gel (TIANGEN Gel Extraction Kit) and sent for sequencing, wherein the sequencing primer was the downstream primer 2. The TCRβ gene sequences were obtained. The β-chain nucleotide sequences of C2, C22, C27, C29. C30. C44 and C45 are set forth in SEQ ID NOs: 277, 260-265.

2) As above, reverse transcription was performed on T cells positive for tetramer staining to obtain cDNA (SuperScript® IV Reverse Transcriptase, Invitrogen). The TCRα gene fragments were obtained by amplification by two rounds of PCR (KOD-Plus-Neo. TOYOBO) according to the product instructions.

TABLE-US-00006 Reverse transcription primer: (SEQ ID NO: 139) T cell receptor α constant region-TRAC1-CGACCAGCTTGACATCACAG PCR amplification primers: Upstream primer 3: (see SEQ ID NOs: 142-186) T cell receptor α variable region-TRAV_F1 Upstream primer 4: (see SEQ ID NOs: 187-228) T cell receptor α variable region-TRAV_F2 Downstream primer 3: (SEQ ID NO: 140) T cell receptor α constant region-TRAC2-GTTGCTCTTGAAGTCCATAGACCTC Downstream primer 4: (SEQ ID NO: 141) T cell receptor α constant region-TRAC3-CAGGGTCAGGGTTCTGGATA

[0173] Specifically, according to the product instructions of the PCR polymerase KOD-Plus-Neo, the PCR system of the first round was at 20 μL, the annealing temperature was 60° C., and the reaction was performed for 30 cycles, 1 μL of the product from the first round of PCR reaction was taken as a template of the second round of PCR, wherein the PCR system of the second round was at 30 μL, the annealing temperature was 60° C., and the reaction was performed for 30 cycles. The product from the second round of PCR was subjected to agarose gel electrophoresis, and the band with the corresponding size was extracted from gel (TIANGEN Gel Extraction Kit) and sent for sequencing, wherein the sequencing primer was the downstream primer 4. The TCRα gene sequences were obtained. Specifically, the α-chain nucleotide sequences of C2, C22, C27, C29, C30, C44 and C45 are set forth in SEQ ID NOs: 278, 266-271.

II. Construction of pHAGE-TCR Vector

[0174] TCRβ, fp2A and TCRα were amplified by overlap-PCR (KOD-Plus-Neo, TOYOBO) with long primer (containing fp2A sequence) to obtain TCRβ-fp2A-TCRα fragments, which were named as C22, C27, C29, C30, C44 or C45, respectively.

[0175] The primers for amplification included an upstream primer 5 (Table 1), a downstream primer 5, an upstream primer 6 (Table 2), and a downstream primer 6.

TABLE-US-00007 TABLE 1 TCR Upstream primer 5 C2 atttcaggtgtcgtgaagcggccgcgccaccATGGGCCCCCAGCTCCT (SEQ ID NO: 279) C22 atttcaggtgtcgtgaagcggccgcgccaccATGAGCATCGGCCTCCT (SEQ ID NO: 229) C27 atttcaggtgtcgtgaagcggccgcgccaccATGAGCATCGGCCTCCT (SEQ ID NO: 230) C29 atttcaggtgtcgtgaagcggccgcgccaccATGGACTCCTGGACCTT (SEQ ID NO: 231) C30 atttcaggtgtcgtgaagcggccgcgccaccATGGGCACCAGGCTCCT (SEQ ID NO: 232) C44 atttcaggtgtcgtgaagcggccgcgccaccATGGGCCCCGGGCTCCT (SEQ ID NO: 233) C45 atttcaggtgtcgtgaagcggccgcgccaccATGGGCTCCAGGCTGCT (SEQ ID NO: 234) Downstream primer 5: TCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCGCTccgtttccgccgGAAATCCTTTCTCTTGACCATG (SEQ ID NO: 235)

TABLE-US-00008 TABLE 2 TCR Upstream primer 6 C2 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGATGGAGAAGAATCCTTTGGCA (SEQ ID NO: 280) C22 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGAGAAGAATCCTTTGGC AGCC (SEQ ID NO: 236) C27 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGAGAAGAATCCTTTGGC AGCC (SEQ ID NO: 237) C29 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGATGAAATCCTTGAGAGTT TTA (SEQ ID NO: 238) C30 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGAGAAGAATCCTTTGGC AGCC (SEQ ID NO: 239) C44 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGCATGCCCTGGCTTCCTG TGG (SEQ ID NO: 240) C45 TCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGCCATGCTCCTGGGGGC ATCA (SEQ ID NO: 241) Downstream primer 6: agggatcctctagactcgagctagcTCAGCTGGACCACAGCCGCA (SEQ ID NO: 242).

[0176] Specifically, the TCRβ and the TCRα were firstly obtained by amplification by using a primer 5 and a primer 6, respectively, wherein the PCR system was at 50 μL, the annealing temperature was 60° C. and the reaction was performed for 30 cycles. The PCR products were subjected to gel electrophoresis and extracted (TIANGEN Gel Extraction Kit), and the extracted products were taken as templates, each at 1 μL, and subjected to overlap PCR by using an upstream primer 5 and a downstream primer 6, respectively, wherein the PCR system was at 50 μL, the annealing temperature was 60° C. and the reaction was performed for 30 cycles. The product was subjected to agarose gel electrophoresis to obtain a band of about 1800 bp, which was then extracted from gel.

[0177] The lentiviral vector pHAGE-IRES-RFP was double digested with NotI and NheI, wherein the enzyme digestion system was at 40 μL, wherein the NotI and NheI were each at 1.5 μL, the plasmid was at 2-3 μg, and the enzyme digestion was performed at 37° C. for 6 h. Then 1 μL of alkaline phosphatase (NEB) was added into the system and treated for 1 h to reduce the self-ligation of the plasmid, and the plasmid after the enzyme digestion was subjected to gel electrophoresis and extracted, determined for the concentration using nanodrop, and used as a backbone for constructing the plasmid.

[0178] According to the product instructions of Clone Express II One Step Cloning kit, the TCR was connected with a linearized pHAGE-IRES-RFP vector after enzyme digestion through overlap (see FIG. 4), and transformed into Stb13 strain, which was then cultured in an ampicillin-containing LB plate for 12-16 h. The monoclonal strain was picked for sequencing, wherein the sequencing primers selected were primers seq-pHAGE-F and seq-pHAGE-R on the pHAGE vector and a downstream primer 4. Corresponding TCRs were obtained, abbreviated as C22 (with the nucleotide sequence set forth in SEQ ID NO: 37, and the amino acid sequence set forth in SEQ ID NO: 36), C27 (with the nucleotide sequence set forth in SEQ ID NO: 39, and the amino acid sequence set forth in SEQ ID NO: 38), C29 (with the nucleotide sequence set forth in SEQ ID NO: 41, and the amino acid sequence set forth in SEQ ID NO: 40), C30 (with the nucleotide sequence set forth in SEQ ID NO: 43, and the amino acid sequence set forth in SEQ ID NO: 42). C44 (with the nucleotide sequence set forth in SEQ ID NO: 45, and the amino acid sequence set forth in SEQ ID NO: 44), C45 (with the nucleotide sequence set forth in SEQ ID NO: 47, and the amino acid sequence set forth in SEQ ID NO: 46) and C2 (with the nucleotide sequence set forth in SEQ ID NO: 274, the amino acid sequence set forth in SEQ ID NO: 273, the amino acid sequence of the β chain set forth in SEQ ID NO: 275, and the amino acid sequence of the α chain set forth in SEQ ID NO: 276).

[0179] Wherein. C2 was prepared as a control, which differed from the CDR regions of C22 by only a few amino acids, and the details are shown in Table 3.

TABLE-US-00009 TABLE 3 NO. CDR1α CDR2α CDR3α CDR1β CDR2β CDR3β C2 SSNFYA MTLNGDE ASPYFNKFY MNHEY SMNVEV ASSPTLGTGAETQY (SEQ ID (SEQ ID NO: (SEQ ID NO: 281) (SEQ ID (SEQ ID (SEQ ID NO: 283) NO: 4) 8) NO: 18) NO: 282) C22 SSNFYA MTLNGDE ARNTGNQFY MNHEY SVGAGI ASSFATGVGSYGYT (SEQ ID (SEQ ID NO: (SEQ ID NO: 12) (SEQ ID (SEQ ID (SEQ ID NO: 28) NO: 4) 8) NO: 18) NO: 23)

Example 3: Assay on Membrane Expression and Affinity of TCRs by a pMHC Tetramer Staining Method

1. Construction of Endogenous TCR Knockout Jurkat T Cell Lines

[0180] Based on the sequence characteristics of the Jurkat cell TCR, guide sequences (TRA_oligo1-CACCGTCICTCAGCTGGTACACGGC (SEQ ID NO: 243). TRA_oligo2-AAACGCCGTGTACCAGCTGAGAGAC (SEQ ID NO: 244), TRB_oligo1-CACCGGGCCCAAACACACCGACCTC (SEQ ID NO: 245), TRB_oligo2-AAACGAGGTCGCTGTGTTTGAGCCC (SEQ ID NO: 246)) were designed in the constant regions of the α chain and the β chain.

[0181] The synthesized guide sequences of the α chain and the β chain were constructed into sgRNA-LentiCRISPR-puro and sgRNA-LentiCRISPR-BSD lentiviral vectors, respectively, and the vectors were co-transfected with packaging plasmids psPAX2 and pMD2.G and a PEI transfection reagent into 293T cells according to a certain ratio. The cell culture supernatants were harvested at 48 h and 72 h and concentrated, and the two viruses after concentration were simultaneously used to infect a human Jurkat T cell line, 48 h after the infection, killing was performed using puromycin and blasticidin at appropriate concentrations until all cells in the control group for each of the two drugs were dead. Surviving cells were sorted by flow cytometry to obtain single cells, which were added into a 96-well plate for culturing. For the obtained monoclonal cell line, its expression was separately identified using antibodies of the TCRα chain and the TCRβ chain, and the cell strain defective in both chains was the obtained endogenous TCR knockout Jurkat T cell, which was named as JC5.

2. Construction of JC5 Cell Line Stably Integrating CMV TCR

[0182] The pHAGE-TCR plasmids such as C22, C27, C29, C30, C44 or C45 constructed in Example 2 were separately mixed with packaging plasmids psPAX2 and pMD2.G and a PEI transfection reagent according to a certain ratio, and transfected into 293T cells. The cell culture supernatants were harvested at 48 h and 72 h and concentrated to infect JC5 cells in the logarithmic growth phase (MOI=0.3), 3 days after infection, cells were stained with anti-human CD3 and anti-human TCRαβ flow cytometry antibodies, and the cells with the same TCR expression level were sorted and cultured to obtain the JC5-TCR cell line.

3. Assay on Expression-On-Membrane and Affinity of TCRs

[0183] 1×10.sup.6 JC5-TCR cells were taken, stained with Brilliant Violet 421™ anti-human TCRαβ (Biolegend) and the corresponding CMV pp65pMHC tetramer-APC (tetramer-APC) and then analyzed by flow cytometry.

[0184] As can be seen from FIGS. 5 and 6, the prepared specific C22-TCR and C29-TCR against CMV pp65 HLA-A*A0201 NLVPMVATV were both able to be correctly expressed and displayed on the outer side of the cell membrane, and had certain affinity for the corresponding tetramer probe. The C2-TCR was compared to the C22-TCR in that the CDR regions differed by only a few amino acids, and the differences in the effect of the expression-on-membrane (FIG. 5A) and the affinity for the corresponding tetramer probe (FIG. 6A) were significant. The specific C27-TCR and C30-TCR against CMV pp65 HLA-A*A2402 QYDPVAALF and the specific C44-TCR and C45-TCR against CMV pp65 HLA-A*A1101 ATVQGQNLK were all correctly expressed and displayed on the outer side of the cell membrane and had a certain affinity for the corresponding tetramer probe. In summary, the results show that the TCR prepared in the example of the present application has good affinity.

Example 4: Construction of and In Vitro Functional Assay on Human Primary TCR T Cells

1. Isolation, Culture and Lentivirus Infection of Human Primary T Cells

[0185] To further verify the recognition and killing function of the selected TCRs for the CMV pp65 antigens, mononuclear cells (PBMCs) were isolated from peripheral blood of volunteers using the lymphocyte isolation solution Ficoll, then T cells were obtained from PBMCs by negative selection according to the product instructions of EasySep Human T cell isolation kit (stem cell technologies), resuspended to 1×10.sup.6 cells/mL in a 1640 complete medium containing 100 U/mL IL2, and cultured in an anti-CD3/CD28 antibody-coated culture dish for activation. After 48 h of activation, the T cells were infected with the TCR-loaded viral particles (prepared in Example 3) using a lentivirus system by centrifuging at 1500 rpm for 2 h at 32° C., culturing in a 37° C. cell incubator for 10 h and terminating the infection by media exchange, and then cultured in a 37° C. cell incubator. Three days after infection, TCR positive cells were sorted by flow cytometry to obtain TCRT cells (including C2, C22, C27, C29, C30, C44 and C45 as described above).

2. Construction of Target Cells

[0186] Virus particles separately loaded with pp65-PURO, HLA-A*0201-BSD, HLA-A*2402-BSD, HLA-A*1101-BSD and luciferase-GFP were used to infect into Raji cells in the logarithmic growth phase using a lentivirus system. Raji cells simultaneously stably expressing pp65. HLA-A*0201/2402/1101 molecules and luciferase-GFP were obtained by drug screening and flow cytometry sorting, and named as Raji-A0201-pp65-luciferase. Raji-A2402-pp65-luciferase and Raji-A1101-pp65-luciferase, respectively.

3. In Vitro Functional Verification of TCRs in Human Primary T Cells

[0187] Raji/HLA-A0201/pp65 and Raji cells untransfected with pp65 (named as Raji) were each separately co-incubated with 1G4-TCRT cells, TCR-C2T cells. TCR-C22T cells and TCR-C29T cells according to a quantity ratio of 1:1. After 24 h of co-incubation, the cells and supernatant were separately collected, and the activation of TCR-C22T cells and TCR-C29T cells and the death of target cells were preliminarily determined. In terms of the release levels of the extracellular cytokines TNFα. IL2 and IFNγ (see FIG. 7), TCR-C22T and TCR-C29T, when co-incubated with target cells, were able to significantly cause the activation of T cells as compared to the control groups 1G4-TCRT and TCR-C2T. The amount of luciferase released from the target cells after lysis may reflect the death of the target cells (see FIG. 7), and TCR-C22T and TCR-C29T prepared in the example of the present application have a significant killing effect on target cells compared to TCR-C2T with similar CDR structure. Experimental results show that the TCR-C22T cells and TCR-C29T cells constructed in the example of the present invention can be specifically activated by CMV pp65 antigen peptide presenting cells, and can significantly kill target cells.

[0188] Meanwhile, the hypervariable region of CDR3 of the α chain and the β chain of the TCRs has the greatest effect on TCR function. The experiment has proved that the hypervariable region of CDR3, even if highly similar with only one amino acid difference, was functionally far apart. For example, the amino acids after the first position of CDR3 regions of the α chain and the β chain of TCR E141 were mutated into alanine in sequence and constructed onto a lentiviral vector to prepare corresponding TCR-T cells. The TCR-T cells were co-cultured with target cells at a ratio of 1:1, and the amount of luciferase and the secreted amount of cytokines TNFα, IL2 and IFNγ were determined. The results show that the unmutated E141, when exposed to HLA matched-Raji, can effectively clear target cells and specifically produce a large amount of cytokine IL2. In addition, mutations of a single amino acid at the sites a3, a5, a6 and b6, b7, b8 are sufficient to completely inactivate TCR T cells (see Patent CN202010373100.4 for details). Accordingly, the mutated TCR, although differing by only one amino acid, is sufficient to completely inactivate the TCR-T cells. Therefore, although the target is the same, only one amino acid difference may produce a completely different technical effect for two nearly identical TCRs, let alone for multiple amino acids.

[0189] Raji/HLA2402/pp65 and Raji cells untransfected with pp65 (named as Raji) were each separately co-incubated with 1G4-TCRT cells. TCR-C27T cells and TCR-C30T cells according to a quantity ratio of 1:1. After 24 h of co-incubation, the cells and supernatant were separately collected, and the activation of TCR-C27T cells and TCR-C30T cells and the death of target cells were preliminarily determined. In terms of the release levels of the extracellular cytokines TNFα, IL2 and IFNγ (see FIG. 8), TCR-C27T cells and TCR-C30 cells, when co-incubated with target cells, were able to significantly cause the activation of T cells as compared to the control group 1G4-TCRT. Moreover, the amount of luciferase released from the target cells after lysis may reflect that TCR-C27T and TCR-C30T can significantly kill target cells (see FIG. 8). Experimental results show that the TCR-C27T cells and TCR-C30T cells constructed in the example of the present invention can be specifically activated by CMV pp65 antigen peptide presenting cells, and can significantly kill target cells.

[0190] Raji/HLA1101/pp65 and Raji cells untransfected with pp65 (named as Raji) were each separately co-incubated with 1G4-TCRT cells, TCR-C44T cells and TCR-C45T cells according to a quantity ratio of 1:1. After 24 h of co-incubation, the cells and supernatant were separately collected, and the activation of TCR-C44T cells and TCR-C45T cells and the death of target cells were preliminarily determined. In terms of the release levels of the extracellular cytokine IFNγ (see FIG. 9), TCR-C44T cells and TCR-C45T cells, when co-incubated with target cells, were able to significantly cause the activation of T cells as compared to the control group IG4-TCRT. Moreover, the amount of luciferase released from the target cells after lysis may reflect that TCR-C44T and TCR-C45T can significantly kill target cells (see FIG. 9). Experimental results show that the TCR-C44T cells and TCR-C45T cells constructed in the example of the present invention can be specifically activated by CMV pp65 antigen peptide presenting cells, and can significantly kill target cells.

Example 5: Animal Model Construction and In Vivo Functional Assay on CMV TCR-T

[0191] NOD/Scid IL-2Rγ null (NCG) female mice aged 5-6 weeks were inoculated with 3×10.sup.5 Raji-HLA-A*1101/0201/2402-pp65-luciferase tumor cells via tail veins to construct a lymphoma model (see FIGS. 10, 14 and 17), which was recorded as day 1. On day 6, the mice were divided into 3 groups, i.e., A: a PBS injection group (with equal volume of PBS injected); B: a control NC cell injection group (NC T cells); and C: a CMV TCR T injection group (C22/C27/C45-TCR T cells), wherein the mice in group B were injected with 1×10.sup.7 NC T cells via tail veins, the mice in group C were injected with 1×10.sup.7 TCR T cells via tail veins, and the mice in group A were injected with equal volume (200 μL) of PBS. Specific reinfusion volume and reinfusion time points for other TCR T cells are shown in FIGS. 14 and 17. The mice were monitored for tumor cell growth, T cell proliferation and mouse survival over the next few weeks. As shown in FIGS. 10-13, compared with the control group, the CMV-specific C22-TCR T cells constructed in the example of the present invention were able to significantly kill tumor cells in mice (FIG. 10) and increase the survival rate of mice (FIG. 11, FIG. 12), and the returned TCR T cells proliferated specifically in vivo (FIG. 13). In addition, as shown in FIGS. 14-19, compared with the control group, the CMV-specific C27-TCR T. C45-TCR T cells constructed in the example of the present invention were also able to significantly kill tumor cells in mice.

[0192] The preferred embodiments of the present invention are described in derail above, which, however, are not intended to limit the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, all of which will fall within the protection scope of the present invention.

[0193] In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, such combinations will not be illustrated separately.