Use of insecticidal protein
20230257766 · 2023-08-17
Inventors
- Tengyu CHANG (Beijing, CN)
- Qinyang WANG (Beijing, CN)
- Aihong ZHANG (Beijing, CN)
- Qing TAO (Beijing, CN)
Cpc classification
International classification
Abstract
Related is a use of an insecticidal protein. The insecticidal protein may be used to control a thrip pest. A method for controlling the a thrip pest includes: allowing the a thrip pest to be at least in contact with an ACh1 protein. In the present application, the a thrip pest is controlled through producing the ACh1 protein that can kill the a thrip pest in bacteria and/or a plant in vivo.
Claims
1. A method for controlling a thrip pest, comprising allowing the a thrip pest to be at least in contact with an ACh1 protein; preferably, the ACh1 protein is present in a host cell that produces at least the ACh1 protein, and the a thrip pest is in contact with at least the ACh1 protein by ingesting the host cell; and more preferably, the ACh1 protein is present in at least a bacterium or a transgenic plant that generates the ACh1 protein, the a thrip pest is in contact with at least the ACh1 protein by ingesting the bacterium or a tissue of the transgenic plant, and after contacting, the growth of the a thrip pest is inhibited and/or death is caused, so as to achieve the control of the damage of the a thrip pest to plants.
2. The method for controlling a thrip pest according to claim 1, wherein the transgenic plant is corn, soybean, cotton or rape.
3. The method for controlling a thrip pest according to claim 1, wherein the tissue of the transgenic plant is a leaf, a stem, a fruit, a male ear, a female ear, an anther, or a filament.
4. The method for controlling a thrip pest according to claim 1, wherein the ACh1 protein is an ACh1_1 protein or an ACh1_4 protein.
5. The method for controlling a thrip pest according to claim 4, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.
6. The method for controlling a thrip pest according to claim 4, wherein a nucleotide sequence of the ACh1 protein is shown in SEQ ID NO:3 or SEQ ID NO:4.
7. The method for controlling a thrip pest according to claim 1, wherein the transgenic plant further comprises at least a second nucleotide different from the nucleotide encoding the ACh1 protein.
8. The method for controlling a thrip pest according to claim 7, wherein the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, lectin, α-amylase, or a peroxidase.
9. The method for controlling a thrip pest according to claim 7, wherein the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.
10. The method for controlling a thrip pest according to claim 1, wherein the thrip pest is selected from the group consisting of Anaphothrips obscurus, Frankliniella tenuicornis (Uzel), Stenchaetothrips biformis (Bagnall) and frankliniella occidentalis (Pergande).
11. A method of producing a plant for controlling a thrip pest, comprising introducing a polynucleotide sequence encoding an ACh1 protein into a genome of the plant.
12. The method of producing a plant for controlling a thrip pest according to claim 11, wherein the polynucleotide sequence of the ACh1 protein is shown in SEQ ID NO:3 or SEQ ID NO:4.
13. The method of producing a plant for controlling a thrip pest according to claim 11, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.
14. A method of producing a plant seed for controlling a thrip pest, comprising hybridizing a plant obtained by the method according to claim 11 with a second plant, so as to produce a seed containing a polynucleotide sequence encoding an ACh1 protein.
15. A method of cultivating a plant for controlling a thrip pest, comprising planting at least one plant seed, wherein the genome of the plant seed comprises a polynucleotide sequence encoding an ACh1 protein; growing the plant seed into a plant; and growing the plant under conditions that the a thrip pest is artificially inoculated and/or the hazard of the a thrip pest naturally occurs, and harvesting a plant that has an attenuated plant damage and/or has an increased plant yield compared with other plants that do not have the polynucleotide sequences encoding the ACh1 protein.
16. The method of cultivating a plant for controlling a thrip pest according to claim 15, wherein the polynucleotide sequence of the ACh1 protein is shown in SEQ ID NO:3 or SEQ ID NO:4.
17. The method of cultivating a plant for controlling a thrip pest according to claim 15, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0081]
[0082]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0083] The technical schemes of the use of the insecticidal protein of the present disclosure are further described below by specific embodiments.
First Embodiment: Acquisition and Synthesis of Gene
1. Acquisition of the Nucleotide Sequence
[0084] An amino acid sequence of an ACh1_1 insecticidal protein (309 amino acids) is shown in SEQ ID NO:1 in a sequence listing. An ACh1_1 nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_1 insecticidal protein is shown in SEQ ID NO: 3 in the sequence listing.
[0085] An amino acid sequence of an ACh1_4 insecticidal protein (309 amino acids) is shown in SEQ ID NO:2 in the sequence listing. An ACh1_4 nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_4 insecticidal protein in bacteria is shown in SEQ ID NO: 4 in the sequence listing.
2. Synthesis of Above Nucleotide Sequence
[0086] The nucleotide sequences (as shown in SEQ ID NO:3 or SEQ ID NO:4 in the sequence listing) of ACh1_1 and ACh1_4 are synthesized by Nanjing GenScript Biotech Corp.
Second Embodiment: Construction Of Recombinant Expression Vector And Transformation Of Recombinant Expression Vector Into Agrobacterium Tumefaciens To Obtain Ach1 Protein
1. Construction of Recombinant Cloning Vector Containing ACh1 Gene
[0087] The synthesized ACh1_1 nucleotide sequence is linked to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and an operation step is performed according to instructions of a pGEM-T vector product of Promega Company, to obtain a recombinant cloning vector DBN01-T, and its construction process is shown in
[0088] Then, the recombinant cloning vector DBN01-T is transformed into Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method, and a white bacterial colony is picked, and placed in a Luria-Bertani (LB) liquid medium (10 g/L of a tryptone, 5 g/L of a yeast extract, 10 g/L of NaCl, 100 mg/L of an ampicillin, and pH is adjusted to 7.5 with NaOH) and cultured overnight at 37° C. Plasmids thereof are extracted by an alkaline method and stored at -20° C. for future use.
[0089] After the extracted plasmid is identified by enzyme digestion, the positive colonies are sequenced and verified, and results show that the ACh1_1 nucleotide sequence inserted in the recombinant cloning vector DBN01-T is the nucleotide sequence shown in the sequence listing (SEQ ID NO:3). That is to say, the ACh1_1 nucleotide sequence is correctly inserted.
[0090] According to the aforementioned method of constructing the recombinant cloning vector DBN01-T, the synthesized ACh1_4 nucleotide sequence was ligated into a cloning vector pGEM-T to obtain a recombinant cloning vector DBN02-T, wherein ACh1_4 represented the ACh1_4 nucleotide sequence (SEQ ID NO: 4). The correct insertion of the ACh1_4 nucleotide sequence in the recombinant cloning vector DBN02-T was verified through enzyme digestion and verification by sequencing.
2. Construction of the Recombinant Expression Vector Containing the ACh1 Gene
[0091] The recombinant cloning vector DBN01-T and the expression vector DBNBC-01 (vector framework: pCAMBIA2301 (provided by the CAMBIA institution)) are digested with restriction endonucleases, and an excised ACh1_1 nucleotide sequence fragment is inserted between the restriction endonuclease sites of the expression vector DBNBC-01. It is well-known to those skilled in the art to construct a vector with a conventional enzyme digestion method, the recombinant expression vector DBN01-B is constructed, and the construction flow is shown in
[0092] The recombinant expression vector DBN01-B is transformed into the Escherichia coli T1 competent cells with the heat shock method; the white colony is picked and placed in the LB liquid medium (10 g/L of the tryptone, 5 g/L of the yeast extract, 10 g/L of NaCl, 50 mg/L of the kanamycin, and pH is adjusted to 7.5 with NaOH); and culture is performed overnight at 37° C., and plasmids thereof are extracted by an alkaline method. The extracted plasmid is identified by the restriction endonuclease digestion, and the positive colonies are sequenced and identified. The results show that the nucleotide sequence in the recombinant expression vector DBN01-B is the nucleotide sequence shown in SEQ ID NO:3 in the sequence listing, that is, the ACh1_1 nucleotide sequence.
[0093] According to the aforementioned method of constructing the recombinant expression vector DBN01-B, the ACh1_4 nucleotide sequence cleaved from the recombinant cloning vector DBN02-T by enzymatic cleaving was inserted into the expression vector DBNBC-01 to obtain a recombinant expression vector DBN02-B. After enzymatic cleaving and as verified by sequencing, it is found that the nucleotide sequence in the recombinant expression vector DBN02-B contained the nucleotide sequence as shown in SEQ ID NO: 4 of the sequence listing, namely the ACh1_4 nucleotide sequence. The ACh1_4 nucleotide sequence could be connected to the Ubi promoter and the Nos terminator.
3. Transformation of the Recombinant Expression Vector Into an Agrobacterium
[0094] The correctly constructed recombinant expression vectors DBN01-B and DBN02-B are transformed into agrobacterium LBA4404 (lnvitrgen, Chicago, USA, CAT: 18313-015) through a liquid nitrogen method, and the transformation conditions are as follows: 100 .Math.l of the agrobacterium LBA4404, and 3 .Math.l of a plasmid DNA (the recombinant expression vector); it is placed in liquid nitrogen for 10 minutes, and a warm water bath is performed at 37° C. for 10 minutes; the transformed agrobacterium LBA4404 is inoculated in an LB tube, cultured for 2 hours under conditions of a temperature of 28° C. and a rotation speed of 200 rpm, and spread on an LB plate containing 50 mg/L of rifampicin and 100 mg/L of kanamycin until positive monoclones grow, the monoclones are picked for culture and plasmids thereof are extracted, the restriction endonuclease is used to verify the recombinant expression vectors DBN01-B and DBN02-B after being enzyme-digested, and results show that the structure of the recombinant expression vectors DBN01-B and DBN02-B is completely correct.
Example 3. Obtaining of Transgenic Corn Plant
[0095] According to the conventional agrobacterium infection method, the immature embryos of the aseptically cultured maize variety Zong 31 (Z31) are co-cultured with the agrobacterium transformed with the recombinant expression vector described in step 3 in the second embodiment, to transfer the T-DNA (including the promoter sequence of maize ubiquitin gene, the ACh1_1 nucleotide sequence, the ACh1_4 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vectors DBN01-B and DBN02-B constructed in step 2 in the second embodiment into a maize genome, so as to obtain a corn plant transformed with the ACh1_1 nucleotide sequence and a corn plant transformed with the ACh1_4 nucleotide sequence. In addition, a wild corn plant is used as a control.
[0096] For agrobacterium-mediated transformation of corns, briefly, immature embryos are isolated from the corns and are in contact with agrobacterium suspension. The agrobacterium can deliver the ACh1_1 nucleotide sequence and/or the ACh1_4 nucleotide sequence to at least one cell (step 1: infection step) of one of the embryos. In this step, the embryos are preferably immersed in the agrobacterium suspension (OD.sub.660=0.4-0.6, an infection medium (4.3 g/L of MS salt, MS vitamins, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of Acetosyringone (AS), and 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) to initiate inoculation. The embryos are co-cultured with the agrobacterium for a period of time (3 days) (Step 2: co-culture step). Preferably, the embryos are cultured in a solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of AS, 1 mg/L of 2,4-D, and 8 gIL of agar, pH5.8) after the infection step. After this co-culture phase, there may be an optional “recovery” step. In the “recovery” step, in a recovery culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8), there is at least one antibiotic (cephalosporin) known to inhibit the growth of the agrobacterium, and a selective agent for a plant transformant (Step 3: recovery step) is not added. Preferably, the embryos are cultured on a solid medium with the antibiotic without the selective agent, as to eliminate the agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos are grown on a culture medium containing the selective agent (hygromycin) and a grown transformed callus is selected (Step 4: selection step). Preferably, the embryos are cultured in the solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 5 g/L of sucrose, 50 mg/L of hygromycin, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8) containing the selective agent, so as to cause the transformed cells to selectively grow. The callus are then regenerated into plants (Step 5: regeneration step), preferably, the callus grown on the medium containing the selective agent is cultured on the solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.
[0097] The screened resistant callus are transferred to the MS differentiation medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 50 mg/L of hygromycin, and 8 g/L of agar, pH5.8), and culture differentiation is performed at 25° C. The differentiated seedling is transferred to the MS rooting medium (2.15 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 8 g/L of agar, pH5.8); and the seedling is cultured to a height of about 10 cm at 25° C., and then moved to a greenhouse to grow until fruiting. In the greenhouse, culture is performed for 16h at 28° C. every day, and then culture is performed for 8h at 20° C.
Example 4. Verification of Transgenic Corn Plants With TaqMan
[0098] About 100 mg of leaves of the corn plant transformed with the ACh1_1 nucleotide sequence or the ACh1_4 nucleotide sequence is taken as a sample, respectively, and the genome DNA is extracted with DNeasy Plant Maxi Kit of Qiagen, and the copy number of the Hpt gene is detected by a Taqman probe fluorescence quantitative PCR method to determine the copy number of the ACh1_1 gene or the ACh1_4 gene. At the same time, the wild corn plant is used as a control, and the detection and analysis are performed according to the above method. The experiment is repeated for 3 times, and the average value is taken.
[0099] A specific method to detect the copy number of the Hpt gene is as follows.
[0100] Step 11, 100 mg of the leaves of the corn plant transformed with the ACh1_1 nucleotide sequence, the ACh1_4 nucleotide sequence and the wild corn plant are taken respectively, and ground into uniform slurry with liquid nitrogen in a mortar, and 3 replicates for each sample are taken.
[0101] Step 12, Qiagen’s DNeasy Plant Mini Kit is used to extract the genome DNA of the above samples, and a specific method refers to its product specification.
[0102] Step 13, NanoDrop 2000 (Thermo Scientific) is used to measure the genome DNA concentration of the above samples.
[0103] Step 14, the genome DNA concentration of the above samples is adjusted to the same concentration value, and the range of the concentration value is 80-100 ng/.Math.l.
[0104] Step 15, the Taqman probe fluorescence quantitative PCR method is used to identify the copy number of the sample, the sample with the known copy number after the identification is used as a standard substance, and the sample of the wild corn plant is used as a control, 3 replicates for each sample are taken, and its average value is taken; and fluorescence quantitative PCR primer and probe sequences are as follows.
[0105] The following primers and probes are used to detect the Hpt nucleotide sequence.
[0106] Primer 1: cagggtgtcacgttgcaaga is as shown in SEQ ID NO:8 in the sequence listing.
[0107] Primer 2: ccgctcgtctggctaagatc is as shown in SEQ ID NO:9 in the sequence listing.
[0108] Probe 1: tgcctgaaaccgaactgcccgctg is as shown in SEQ ID NO: 10 in the sequence listing.
[0109] A PCR reaction system is as follows.
TABLE-US-00001 JumpStart™ Taq ReadyMix™ (Sigma) 10 .Math.l 50× primer/probe mixture 1 .Math.l Genomic DNA 3 .Math.l Water (ddH.sub.2O) 6 .Math.l
[0110] The 50× primer/probe mixture contains 45 .Math.l of each primer at a concentration of 1 mM, 50 .Math.l of the probe at a concentration of 100 .Math.M and 860 .Math.l of 1×TE buffer, and is stored in a centrifuge tube at 4° C.
[0111] PCR reaction conditions are as follows.
TABLE-US-00002 Step Temperature Time 21 95° C. 5 min 22 95° C. 30 s 23 60° C. 1 min 24 Returning to Step 22, and repeating for 40 times Data is analyzed with SDS 2.3 software (Applied Biosystems).
[0112] The experimental results by analyzing the copy number of the Hpt genes show that, the ACh1_1 nucleotide sequence and the ACh1_4 nucleotide sequence have been integrated into the genome of the tested corn plants, and the corn plants transformed with the ACh1_1 nucleotide sequence and the corn plants transformed with the ACh1_4 nucleotide sequence are all obtained with single-copy.
Example 5. Detection of Insect Resistance of Transgenic Corn Plants
[0113] The corn plant transformed with the ACh1_1 nucleotide sequence, the corn plant transformed with the ACh1_1 nucleotide sequence, the corresponding wild-type corn plant, and the non-transgenic corn plant identified by Taqman are detected for insect-resistant effects against the Frankliniella occidentalis (Pergande).
[0114] Fresh leaves (heart leaves) of the corn plant transformed with the ACh1_1 nucleotide sequence, of the corn plant transformed with the ACh1_4 nucleotide sequence, of the wild corn plant, and of the corn plant (Stage V3-V4) identified as non-transgenic by Taqman are taken respectively, washed with sterile water and dried with gauze; then, the veins are removed from the corn leaves, the leaves are cut into strips of about 1 cm × 4 cm, and 1 piece of the cut strip-like leaf is taken and put the leaf on a moisturizing filter paper at the bottom of a circular plastic petri dish; 10 Frankliniella occidentalis (Pergande) (larvae) are put in each petri dish; after the insect-testing petri dish is covered, the petri dish is put for 1 day under the conditions of a temperature of 26±1° C., a relative humidity of 70%-80%, and a photoperiod (light/dark) of 16:8 for 5 days. Then the mortality rate of the larvae of frankliniella occidentalis (Pergande) and leaf damage are counted. The mortality rate = the number of dead insects/total number of infected insects × 100%. A total of 3 lines (S1, S2 and S3) are transformed into ACh1_1 nucleotide sequence, 3 lines (S4, S5 and S6) are transformed into ACh1_4 nucleotide sequence, 1 line is identified as non-transgenic (NGM) by Taqman, and 1 line is identified as wild (CK). 5 plants are selected from each line for test, and each plant is tested repeatedly for 3 times. Results are shown in Table 1.
TABLE-US-00003 Insect resistance experimental results of transgenic corn plants inoculated with Frankliniella occidentalis (Pergande) Serial number of proteins Test insect Frankliniella occidentalis (Pergande) ACh1_1 + ACh1_4 + NGM - CK - “+” means that there is an inhibitory activity against pest; and “-” means that there is no inhibitory activity against pest
[0115] The results of Table 1 show that the corn plants transformed with the ACh1_1 nucleotide sequence, the corn plants transformed with the ACh1_4 nucleotide sequence both have had a good insecticidal effect against the Frankliniella occidentalis (Pergande), while the WT corn plants and the non-transgenic plants identified by Taqman are basically not lethal to larvae of Frankliniella occidentalis (Pergande).
[0116] The detection results also show that the corn plants transformed with the ACh1_1 nucleotide sequence and the corn plants transformed with the ACh1_4 nucleotide sequence are only slightly damaged.
[0117] Therefore, it indicates that the ACh1_1 protein and the ACh1_4 protein show resistance activity against the a thrip pest, and this activity is sufficient to have adverse effects on the growth of the a thrip pest, so that the a thrip pest can be controlled in the fields. In addition, it is also possible to reduce the occurrence of diseases on corns by controlling the damage of the a thrip pest, thereby greatly improving the yield and quality of the transgenic ACh1 plants.
[0118] In conclusion, through the use of the insecticidal protein of the present disclosure, ACh1 protein that can kill the a thrip pest is produced in a plant in vivo to control the a thrip pest. Compared with an agricultural control method, a chemical control method, a physical control method and a biological control method used in the prior art, the present disclosure achieves the protection of whole growth period and whole plant on the plants so as to control the infestation of the a thrip pest, and is pollution-free, residue-free, stable in effect, thorough, simple, convenient and economical.
[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical schemes of the present disclosure and not to limit them. Although the present disclosure is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical schemes of the present disclosure may be modified or equivalently replaced without departing from the spirit and scope of the technical schemes of the present disclosure.